WO2001047999A1 - Nouveau polypeptide, gonadoliberine humaine 11, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, gonadoliberine humaine 11, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001047999A1 WO2001047999A1 PCT/CN2000/000684 CN0000684W WO0147999A1 WO 2001047999 A1 WO2001047999 A1 WO 2001047999A1 CN 0000684 W CN0000684 W CN 0000684W WO 0147999 A1 WO0147999 A1 WO 0147999A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- sequence
- gonadotropin
- human gonadotropin
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human gonadotropin 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
- Gonadotropin-releasing hormones constitute an independent protein family whose members play a key role in the growth and reproduction of organisms. Gonadotropin-releasing hormone stimulates the synthesis and secretion of gonadotropins such as the corpus luteum and follicle-stimulating hormone in the body by acting on the pituitary gland. Gonadotropin-releasing hormone also plays a regulatory role in some special tissues such as the brain, retina, sympathetic nervous system, gonads, and placenta. There are at least three different forms of gonadotropins in living organisms. The second form of gonadotropin-releasing hormone is widely expressed in midbrain tissue, while the third form of gonadotropin-releasing hormone is only found in fish. .
- Gonadotropin-releasing hormone is a decapeptide hormone, a polypeptide formed by amidation of the c-terminus of a large protein precursor. Four of its ten amino acid residues are highly conserved, and all gonadotropin-releasing hormones of different origins consist of conserved consensus sequence fragments as shown below:
- G is an amidation site.
- the amidation of this amino acid residue is a key step for the organism to form a mature gonadotropin-releasing hormone.
- the highly conserved four amino acid residues of the ten amino acid residues composed of the hormone protein play an important role in the biological function of the hormone.
- gonadotropin-releasing hormone receptor on the membrane of the pituitary gonadotropin cells. After the gonadotropin-releasing hormone binds to its receptor, it can exert its role in increasing the intracellular calcium ion concentration through the phosphatidylinositol information transmission system The role in the body. Only when the concentration ratio of luteinizing hormone and follicular estrogen in the blood is normal in the body can the body's development and growth be stimulated normally. The secretion balance among various hormones in the organism is mainly regulated by gonadotropin-releasing hormone. The direct effect of gonadotropin-releasing hormone on the gonads is inhibitory.
- the gonadotropin-releasing mound regulates the normal development and growth of the organism by regulating the secretion of estrogen and androgen in the organism. Over-expression and under-expression of this protein will cause abnormal secretion of related hormones in the body, which will cause various related endocrine and metabolic disorders such as adolescent development disorders, male and female infertility, and reproductive organs Developmental abnormalities and tumors and cancers of some related tissues.
- polypeptide of the present invention is deduced to be identified as human gonadotropin 11.
- the human gonadotropin 11 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human gonadotropin 11 involved in these processes. Protein, especially the amino acid sequence of this protein. Isolation of the new human gonadotropin-releasing hormone 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- An object of the present invention is to provide an isolated novel polypeptide, human gonadotropin 11 and fragments, analogs and derivatives thereof.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human gonadotropin 11.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human gonadotropin 11.
- Another object of the present invention is to provide a method for producing human gonadotropin 11.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human gonadotropin-releasing hormone 11.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention, human gonadotropin-releasing hormone 11.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormal human gonadotropin releasing hormone. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1886 to 21 in SEQ ID NO: 1; and (b) a sequence having 1-1 in SEQ ID NO: 1 51 09-bit sequence.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human gonadotropin 11 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human gonadotropin 11 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human gonadotropin-releasing hormone II.
- Fig. 1 is a comparison diagram of the amino acid sequence homology of the gonadotropin-releasing hormone 11 of the present invention at 50 amino acids and domains of 9-58.
- the upper sequence is human gonadotropin 11 and the lower sequence is the gonadotropin domain.
- ⁇ "and”: “and”. “Indicate that the probability of the same amino acid decreasing between the two sequences decreases in order.
- FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of isolated human gonadotropin-releasing hormone 11.
- FIG. l lkDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human gonadotropin 11, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human gonadotropin 11.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human gonadotropin 11 when combined with human gonadotropin 11.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human gonadotropin-releasing hormone 11.
- Regular refers to a change in the function of human gonadotropin 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune changes in human gonadotropin 11.
- substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Matter. Those skilled in the art can purify human gonadotropin 11 using standard protein purification techniques. Essentially pure human gonadotropin 11 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human gonadotropin 11 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cl uster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences is calculated by the following formula: The number of matching residues between the sequence and sequence S x 100 The number of residues in the sequence-the number of interval residues in the sequence ⁇ -sequence The number of intermediate residues X can also be determined by Clus ter method or using methods known in the art, such as Jotun He in (%). (He in J., (1990) Methods in enzymo l ogy 183: 625 -645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense chain means “have "Sense strand” is a complementary nucleic acid strand.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human gonadotropin 11.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human gonadotropin ⁇ means that human gonadotropin 11 is substantially free of other proteins, lipids, sugars or other substances that are naturally associated with it.
- Those skilled in the art can purify human gonadotropin II using standard protein purification techniques.
- Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
- the purity of human gonadotropin 11 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human gonadotropin-releasing hormone 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human gonadotropin 11.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human gonadotropin 11 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may Is: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon Or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (in) such a type in which the mature polypeptide and another compound ( For example, a compound that prolongs the half-life of a polypeptide, such as polyethylene glycol, is fused; or (IV) is a polypeptide sequence (such as a leader sequence or a secretion sequence or a polypeptide used to purify the polypeptide in which an additional amino acid sequence is fused into a mature polypeptide) Sequence or protease sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains 5109 bases of polynucleotide sequence and its open reading frame 1886-2179 encodes 97 amino acids. This peptide has the characteristic sequence of gonadotropin, and it can be deduced that the human gonadotropin 11 has the structure and function represented by gonadotropin.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between 50%, preferably 70% identity).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human gonadotropin 11.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human gonadotropin ⁇ of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of human gonadotropin 11 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, preferably at least 100 nucleotides.
- probes are typically 2000 nucleotides in length Within 1,000 nucleotides is preferred.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human gonadotropin 11 gene.
- a method for amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-cDM terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human gonadotropin 11 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding human gonadotropin 11 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human gonadotropin 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide iiiRM synthesis. Representative examples of these promoters are: the l ac or t r p promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human gonadotropin 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human gonadotropin 11 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
- Gonadotropin-releasing hormone stimulates the synthesis and secretion of gonadotropins such as luteinizing hormone and follicle stimulating hormone by acting on the pituitary gland in the body.
- Gonadotropin-releasing hormone also plays a regulatory role in some special tissues such as the brain, retina, sympathetic nervous system, gonads, and placenta.
- the secretion balance between various hormones in the organism is mainly regulated by gonadotropin-releasing hormones.
- gonadotropin-releasing hormones The direct effect of gonadotropin-releasing hormone on the gonads is inhibitory. It can inhibit follicular development and ovulation on the ovary, and it can reduce the production of estrogen and progesterone. On the testes, it can inhibit sperm production and reduce testosterone secretion.
- Gonadotropin-releasing hormone regulates the normal development and growth of the organism by regulating the secretion of estrogen and androgen in the organism.
- Gonadotropin-specific conserved sequences are required to form its active mot if. It can be seen that the abnormal expression of the specific gonadotropin-releasing hormone mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormal levels of gonadotropin secretion and release, and triggering sex hormones and related substances in the body. Abnormal secretion of hormones, resulting in endocrine and metabolic disorders, sexual development disorders, male and female infertility, reproductive organ dysplasia and growth disorders, tumors of some related tissues.
- human gonadotropin 11 in the present invention will produce endocrine and metabolic disorders.
- Disorders, sexual development disorders, male and female infertility, genital abnormalities and growth disorders, tumors of some related tissues, these diseases include but are not limited to:
- prolactin hyperemia galacic-amenorrhea syndrome
- pituitary syndrome adult hypophyseal hypoglycemia (Simmonds-Sheehan syndrome)
- pituitary dwarfism Disease pituitary tumor (prolactinoma)
- hyperthyroidism hypothyroidism
- hyperparathyroidism hypoparathyroidism
- hypoparathyroidism cortisol (Cushing)
- Primary hyperaldosteronism Adrenal insufficiency
- Testicular and epididymal inflammation Testicular and epididymal inflammation, Fallopian tube inflammation, Fallopian tube pregnancy, Endometrial hyperplasia, Endometriosis, Cervicitis, Endometritis, Malformation of the breast
- Testicular tumors such as seminoma, embryos sexual cancer, teratoma, choriocarcinoma, yolk sac tumor, testicular stromal cell tumor, epididymal tumors such as adenoma-like tumors, papillary cystadenomas, epididymal tumors, uterine tumors such as cervical cancer, endometrial cancer, Endometrial stromal tumors, mixed mesoderm tumors, leiomyomas and leiomyosarcoma, hydatidiform mole, chorionic carcinoma, fallopian tube cancer, ovarian tumors, breast tumors such as adenofibroma, lobular cystosarcoma, breast cancer
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially secretory and metabolic disorders, sexual development disorders, male and female infertility, and reproductive organs. Dysplasia and growth disorders, tumors of some related tissues, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human gonadotropin-releasing hormone 1 1.
- Agonists enhance human gonadotropin-releasing hormone 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human gonadotropin 1 1 can be cultured with the labeled human gonadotropin 1 1 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human gonadotropin-releasing hormone 1 1 include antibodies, compounds, receptor deletions, and the like that have been screened.
- Antagonist of human gonadotropin 11 1 can bind to human gonadotropin 1 1 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human gonadotropin 11 When screening compounds as antagonists, human gonadotropin 11 can be added to the bioanalytical assay to determine whether the compound is antagonistic by measuring the effect of the compound on the interaction between human gonadotropin 11 and its receptor. Agent. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide capable of binding to human gonadotropin releasing hormone 1 1 Molecules can be obtained by screening random peptide libraries composed of various possible combinations of amino acids bound to a solid phase. When screening, human gonadotropin 11 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human gonadotropin 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human gonadotropin 11 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human gonadotropin-releasing hormone 11 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single-chain antibodies against human gonadotropin 11.
- Anti-human gonadotropin 11 antibodies can be used in immunohistochemical techniques to detect human gonadotropin 11 in biopsy specimens.
- Monoclonal antibodies that bind to human gonadotropin 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human gonadotropin-releasing hormone 11 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human gonadotropin 11-positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human gonadotropin 11.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human gonadotropin 11.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human gonadotropin 11 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human gonadotropin 11 detected in the test can be used to explain the importance of human gonadotropin 11 in various diseases and to diagnose diseases in which human gonadotropin 11 plays a role.
- polypeptides of the present invention can also be used for peptide mapping, for example, the polypeptides can be physically, chemically or enzymatically Specific cleavage and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry.
- Polynucleotides encoding human gonadotropin hormone 1 1 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human gonadotropin 11.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human gonadotropin 11 to inhibit endogenous human gonadotropin 11 activity.
- a variant human gonadotropin 11 may be a shortened human gonadotropin 11 lacking a signaling functional domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human gonadotropin 11.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the human gonadotropin-releasing hormone ⁇ into a cell.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human gonadotropin 11 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human gonadotropin 11 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human gonadotropin-releasing hormone 1 1 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human gonadotropin 1 1 can be used for the diagnosis of diseases related to human gonadotropin 1 1.
- the polynucleotide encoding human gonadotropin 1 1 can be used to detect the expression of human gonadotropin 1 1 or the abnormal expression of human gonadotropin 1 1 in a disease state.
- a DNA sequence encoding human gonadotropin 1 1 can be used to hybridize biopsy specimens to determine the expression of human gonadotropin 1 1.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, in situ hybridization, and the like. These technical methods are all mature technologies that are publicly available, and the relevant kits are commercially available. Get.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human gonadotropin 11 transcripts can also be detected by in vitro amplification of RNA-polymerase chain reaction (RT-PCR) using primers specific for gonadotropin 11.
- Human gonadotropin 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human gonadotropin 11 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human gonadotropin-releasing hormone 11 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human gonadotropin-releasing hormone 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from CI on tech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
- Dye terminate cyc le react ion sequenc ing kit (Perkin-Elmer) and ABI 377
- An automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0246a02 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the sequence of the human gonadotropin 11 and its encoded protein sequence of the present invention were profiled using the GCG profile scan program (Basic local alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in a database such as prosit.
- the human gonadotropin 11 of the present invention is homologous with the domain gonadotropin at 9-58, and the homology result is shown in FIG. 1.
- the homology rate is 37%, and the score is 18.53; the threshold value is 18.12.
- Example 3 Cloning of a gene encoding human gonadotropin 11 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- AACCTGAATATTTTATCATGAAAT -3 '(SEQ ID NO: 3)
- Primer2 5'- CCCCCCTAAGCTTCGTCTTCTCGC -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-HC1, pH 8.5, 1.5 mraol / L MgCl 2 , 200 ⁇ 1 / 1 dNTP, lOpmol primer, 1U Taq DNA polymerase in a 50 ⁇ 1 reaction volume (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72. C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-5109bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of human gonadotropin 11 gene expression
- the method includes acid sulfur Guanidinium cyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (p! 0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ) And centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
- Primer3 5'- CATGCTAGCATGACCAGGAATAGTGAAGATGAA -3 '(Seq ID No: 5)
- Primer4 5'- CCCGAATTCCTATAATAGACTCCACACAAAATA -3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Nhel and EcoRI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Nhel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the PCR reaction was performed using pBS-0246a02 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0246a02 plasmid was contained in a total volume of 50 ⁇ 1, and primers Primer-3 and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into the coliform bacteria DH5cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were selected by colony PCR method and sequenced. The correct positive clone (PET-0246a02) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following human gonadotropin 11-specific peptides: NH2-Met-Thr-Arg-Asn-Ser-Glu-Asp-Glu-I le-Leu-Asn-Phe- Gln-Glu-Trp- C00H (SEQ ID NO: 7).
- the polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Imraunochemi s try, 1969; 6:43.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: The first type of probe Are oligonucleotide fragments that are completely identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are oligonucleotides that are partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention Acid fragments.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
- Gene chip or gene micro matrix (DNA Mi croarray) is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific methods and steps have been reported in the literature for various references.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotting instrument (purchased by Cartesian, USA). The distance from the point is 280 ⁇ m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer by one-step method, and mRM was purified with Oligotex mRNAMidi Kit (purchased from QiaGen).
- the fluorescent reagent Cy 3dUTP (5- Amino- propargyl-S'-deoxyuridine 5 ' -tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Pharaacia Biotech) niRNA labeled with normal liver tissue
- Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye, purchased)
- Hepatocellular carcinoma mRM was labeled from Amersham Phamacia Biotech, and probes were prepared after purification. For specific steps and methods, see
- the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
- Scanner purchased from General Scanning Company, USA
- the scanned image was processed by Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point. The point where the ratio is less than 0.5 and greater than 2 is considered Genes with differential expression.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Toxicology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU21446/01A AU2144601A (en) | 1999-12-27 | 2000-12-25 | A new polypeptide-human gonadoliberin 11 and the polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN99125356.6 | 1999-12-27 | ||
CN99125356A CN1301771A (zh) | 1999-12-27 | 1999-12-27 | 一种新的多肽——人促性腺释放激素11和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001047999A1 true WO2001047999A1 (fr) | 2001-07-05 |
Family
ID=5283883
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000684 WO2001047999A1 (fr) | 1999-12-27 | 2000-12-25 | Nouveau polypeptide, gonadoliberine humaine 11, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1301771A (zh) |
AU (1) | AU2144601A (zh) |
WO (1) | WO2001047999A1 (zh) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1983004250A1 (en) * | 1982-05-25 | 1983-12-08 | Richter Gedeon Vegyészeti Gyár R.T. | Gonadoliberin derivatives, process for the preparation and pharmaceutical and veterinary compositions thereof |
EP0263521A2 (de) * | 1986-10-09 | 1988-04-13 | Hoechst Aktiengesellschaft | Analoga von Gonadoliberin mit verbesserter Löslichkeit, Verfahren zu deren Herstellung, diese enthaltende Mittel und und ihre Verwendung |
EP0477499A1 (de) * | 1990-08-04 | 1992-04-01 | Hoechst Aktiengesellschaft | Gonadoliberin-Antagonisten |
-
1999
- 1999-12-27 CN CN99125356A patent/CN1301771A/zh active Pending
-
2000
- 2000-12-25 AU AU21446/01A patent/AU2144601A/en not_active Abandoned
- 2000-12-25 WO PCT/CN2000/000684 patent/WO2001047999A1/zh active Application Filing
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1983004250A1 (en) * | 1982-05-25 | 1983-12-08 | Richter Gedeon Vegyészeti Gyár R.T. | Gonadoliberin derivatives, process for the preparation and pharmaceutical and veterinary compositions thereof |
EP0263521A2 (de) * | 1986-10-09 | 1988-04-13 | Hoechst Aktiengesellschaft | Analoga von Gonadoliberin mit verbesserter Löslichkeit, Verfahren zu deren Herstellung, diese enthaltende Mittel und und ihre Verwendung |
EP0477499A1 (de) * | 1990-08-04 | 1992-04-01 | Hoechst Aktiengesellschaft | Gonadoliberin-Antagonisten |
Non-Patent Citations (2)
Title |
---|
LOFTUS B.J. ET AL.: "Genome duplications and other features in 12 Mb of DNA sequence from human chromosome 16p and 16q", GENOMICS, vol. 60, no. 3, 1999, pages 295 - 308 * |
SULSTON J.E. AND WATERSTON R.: "Toward a complete human genome sequence", GENOME RES., vol. 8, no. 11, 1998, pages 1097 - 1108 * |
Also Published As
Publication number | Publication date |
---|---|
AU2144601A (en) | 2001-07-09 |
CN1301771A (zh) | 2001-07-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001090176A1 (fr) | Nouveau polypeptide, keratine humaine 45.87, et polynucleotide codant ce polypeptide | |
WO2001047999A1 (fr) | Nouveau polypeptide, gonadoliberine humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001048221A1 (fr) | Nouveau polypeptide, colipase 12, et polynucleotide codant pour ce polypeptide | |
WO2001075031A2 (en) | Novel polypeptide - a human gonadotropin-releasing hormone 12 andpolynucleotide encoding it | |
WO2001055380A1 (fr) | Nouveau polypeptide, 3-beta-hydroxysteroide deshydrogenase/5-ene-4-ene isomerase 57, et polynucleotide codant pour ce polypeptide | |
WO2001066587A1 (fr) | Nouveau polypeptide, sous-unite c humaine de la pompe a proton vacuolaire atpase, et polynucleotide codant pour ce polypeptide | |
WO2001081394A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison d'un facteur de croissance d'un echantillon d'insuline, et polynucleotide codant pour ce polypeptide | |
WO2001055381A1 (fr) | Nouveau polypeptide, facteur regulateur 80 de la transcription humaine, et polynucleotide codant pour ce polypeptide | |
WO2001096387A1 (fr) | Nouveau polypeptide, proteine 9.13 associee au recepteur oestrogene, et polynucleotide codant ce polypeptide | |
WO2001072799A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide | |
WO2001055399A1 (fr) | Nouveau polypeptide, dipeptide aminopeptidase humaine 28, et polynucleotide codant pour ce polypeptide | |
WO2002006470A1 (fr) | Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide | |
WO2001085752A1 (fr) | Polynucleotide codant un peptide de myosine | |
WO2001098337A1 (fr) | Nouveau polypeptide, globuline humaine de l'uterus 9, et polynucleotide codant ce polypeptide | |
WO2001090348A1 (fr) | Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide | |
WO2001047969A1 (fr) | Nouveau polypeptide, proteine de translocation nucleaire i10, et polynucleotide codant pour ce polypeptide | |
WO2001068692A1 (fr) | Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide | |
WO2001094531A2 (fr) | A novel polypeptide, globuline humaine 12 de l'uterus, et polynucleotide codant ce polypeptide | |
WO2001046247A1 (fr) | Nouveau polypeptide, subtilisine 9, et polynucleotide codant pour ce polypeptide | |
WO2002006473A1 (fr) | Nouveau polypeptide, proteine humaine 10.01 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide | |
WO2001094397A1 (fr) | Nouveau polypeptide, proteine a doigt de zinc 79.46, et polynucleotide codant ce polypeptide | |
WO2001090132A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant ce polypeptide | |
WO2001075043A2 (fr) | Nouveau polypeptide, proteine kinase humaine 9 adn-dependante, et polynucleotide codant pour ce polypeptide | |
WO2001077287A2 (fr) | Nouveau polypeptide, globine humaine de l'uterus 11, et polynucleotide codant pour ce polypeptide | |
WO2001077286A2 (fr) | Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |