WO2001046239A1 - A novel polypeptide - human serine/threonine protein kinase 52 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of human serine/threonine protein kinase 52 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as cancer, hemopathy, HIV infection, immune diseases and inflammations. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said human serine/threonine protein kinase 52.

Description

 A new polypeptide-human silk / threonine protein kinase 52 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human silk / threonine protein kinase 52, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique

 The evolution of multicellular organisms depends on the communication between cells. Because of the delicate division of labor between cells, some cell populations depend on other cell populations and require other cell populations to respond. This sophisticated intercellular communication network can control cell growth, division, death, and differentiation to form tissues And various life processes.

 Cells communicate in three ways: (1) cells communicate with each other by secreting chemical signals; (2) cells are in direct contact with each other through signal molecules bound to the plasma membrane; (3) gaps are formed between cells to make the cytoplasm Communicate with each other to regulate metabolic responses by exchanging small molecules.

 Signaling is the process of converting extracellular signals into intracellular messengers. Hydrophilic signal molecules include neurotransmitters, growth factors, cytokines, local chemical transmitters, and most hormones. They cannot pass through the plasma membrane and can only bind to receptors on the cell surface to form ligand-receptor complexes for signaling. divert. According to the mechanism of signal transduction and the types of receptor proteins, cell surface receptors can be divided into three types: (1) ion channel-coupled receptors; (2) ligase surface receptors; (3) with G proteins Coupling receptor.

 Protein phosphorylation is a basic regulatory mechanism in the regulation of eukaryotic cells, and it is also the most common way of protein modification. For example, cell phosphorylation occurs during cell division, cell metabolism, cell adhesion and cell migration, cell-to-cell communication, and signaling. To accomplish these functions, 2% to 4% of the human coding genes encode about 2,000 different kinases. (Hunter, 1996)

 Serine / threonine protein kinases are a class of protein kinases that can phosphorylate serine / threonine residues on substrates that are involved in the process of transmitting signals downstream of serine / threonine protein kinase activation. Many serine / threonine residues phosphorylate the cascade, thereby regulating the expression of many genes.

There are many types of serine / threonine protein kinases. According to existing research, they are structurally similar. Similarly, both can activate MAP kinase kinase (MAMK), and serine / threonine protein kinases have been shown to interact with MAPKK, and the binding domain of MAPKK has been demonstrated to exist on filokine / threonine protein kinases. Please refer to the related literature for the specific structure of the amino acid protein kinase.

 Serine / threonine protein kinase activates MAPKK by phosphorylating the serine / threonine residues of the MAP kinase kinase (MAPKK). MAPKK phosphorylates the activation of threonine and tyrosine residues of MAPK. This bispecific phosphorylation ensures that MAPK is not phosphorylated by other protein kinases, and remains inactive until MAPKK is activated before MAPK can be activated, so the only substrate of MAPKK is MAPK. Activated MAPK enters the nucleus, activates them by phosphorylating the silk / threonine residues of other kinases or gene regulatory proteins (transcription factors), transmits signals downstream, and regulates the transcriptional expression of some genes, such as jun and Elk -1 or some protein kinases and other proteins.

 Although the specific research on the structure and function of the serine / threonine protein kinase has yet to be completed, we can be sure that as a serine / threonine protein kinase, activated serine / threonine in Ras and PKC, etc. Phosphorylation has an important role in the cascade reaction. Indirectly, serine / threonine protein kinases have a non-negligible effect on the signaling process. It can regulate cell growth, division, death, differentiation and formation of tissues and various Life process.

 According to the results of amino acid homology comparison, the polypeptide of the present invention was inferred and identified as a new human silk / threonine protein kinase 52 (HPK52), and its homologous protein was the silk / threonine protein kinase 51PK of Mus musculus. The protein number is AF080252.

 As mentioned above, the human silk / threonine protein kinase 52 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art The human serine / threonine protein kinase 52 protein involved in these processes, especially the amino acid sequence of this protein is identified. Isolation of the novel human silk / threonine protein kinase 52 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

It is an object of the present invention to provide isolated novel polypeptides-human silk / threonine protein kinase 52 and fragments, analogs and derivatives thereof. Another object of the invention is to elevate a polynucleotide encoding the polypeptide.

 It is another object of the present invention to provide a recombinant vector containing a polynucleotide encoding human silk / threonine protein kinase 52.

 Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding human silk / threonine protein kinase 52.

 Another object of the present invention is to provide a method for producing human silk / threonine protein kinase 52.

 Another object of the present invention is to provide an antibody against the polypeptide-human silk / threonine protein kinase 52 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-human silk / threonine protein kinase 52 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human silk / threonine protein kinase 52.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2 or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 179 to 1603 in SEQ ID NO: 1; and (b) a sequence having 1-1965 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human silk / threonine protein kinase 52 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to 组合。 The compound.

 The invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human silk / threonine protein kinase 52 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.

 The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptides and / or polynucleotides of the present invention in the manufacture of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human silk / threonine protein kinase 52.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

 "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to natural, recombinant or synthetic proteins and fragments thereof in a suitable animal or cell Ability to induce specific immune responses as well as binding to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human silk / threonine protein kinase 52, causes the protein to change, thereby regulating the activity of the protein. Agonists may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human silk / threonine protein kinase 52.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human silk / threonine protein kinase 52 when combined with human silk / threonine protein kinase 52. . Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human silk / threonine protein kinase 52.

 "Regulation" refers to changes in the function of human silk / threonine protein kinase 52, including the increase or decrease in protein activity, changes in binding characteristics, and any other biological properties and functions of human silk / threonine protein kinase 52 Or changes in immune properties.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human silk / threonine protein kinase 52 using standard protein purification techniques. Substantially pure human silk / threonine protein kinase 52 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human silk / threonine protein kinase 52 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percentage identity can be determined electronically, such as through the MEGALIGN program (Lasergene s of tware package, DNASTAR, Inc., Madi son Wi s.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cl us ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks the distance between all pairs by Each group of sequences is arranged into clusters. Then the clusters are allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The residues of the match between sequence A and sequence B Base number

X 100 The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B. The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in. (Hein J., (1990) Methods in emzumology 183: 625-645) ₀

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^) ₂ and? ^ It can specifically bind to the epitope of human silk / threonine protein kinase 52.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still Away.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated human silk / threonine protein kinase 52" means that human silk / threonine protein kinase 52 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human silk / threonine protein kinase 52 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human silk / threonine protein kinase 52 peptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human silk / threonine protein kinase 52, which basically consists of the amino acid sequence shown in SEQ II) NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human silk / threonine protein kinase 52. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human silk / threonine protein kinase 52 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which is basically composed of a gene having the amino acid sequence of SEQ ID NO: 2 List of polypeptides consisting of polynucleotides. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1965 bases in length and its open reading frame (1790-1603) encodes 474 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 40% homology with the silk / threonine protein kinase 51PK in Mus musculus, and it can be inferred that the human silk / threonine protein kinase 52 has silk in Mus musculus / Threonine protein kinase 51PK has a similar structure and function.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 xSSC, 0.1% SDS, 60 ° C; or (2 ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only in two Sequences do not hybridize until the identity between the sequences is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2. The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human silk / threonine protein kinase 52.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.

 The specific polynucleotide sequence encoding human silk / threonine protein kinase 52 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Q i agene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Moleculiar Cloning, A Labora tory Manual, Cold Spring Harbor Labora tory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (D DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human silk / threonine protein kinase 52 transcripts; (4) Detecting protein products of gene expression through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probe The label can be radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).

 In the method (4), immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human silk / threonine protein kinase 52 gene.

 A method for amplifying DNA / RM using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE- rapid amplification of cDNA ends) can be preferably used. The primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence. The present invention also relates to a vector comprising the polynucleotide of the present invention, and using the vector of the present invention or directly using human silk / threonine protein kinase 52. A host cell with a coding sequence produced by genetic engineering, and a method for producing a polypeptide of the present invention by recombinant technology.

 In the present invention, a polynucleotide sequence encoding human silk / threonine protein kinase 52 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human silk / threonine protein kinase 52 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a

Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). Said The DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human silk / threonine protein kinase 52 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector. cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the ( ₁₂ method, the steps used are well known in the art. Alternatively, MgC ₁₂ If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.

Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human silk / threonine protein kinase 52 (Scence, 1984; 224: 1431). Generally there are the following steps Step:

 (1) using the polynucleotide (or variant) encoding human human silk / threonine protein kinase 52 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ionization Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of amino acid sequence homology of human silk / threonine protein kinase 52 and mouse silk / threonine protein kinase 51PK of the present invention. The upper sequence is human silk / threonine protein kinase 52, and the lower sequence is mouse silk / threonine protein kinase 51PK. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human silk / threonine protein kinase 52. 52kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention. It is not intended to limit the scope of the invention. In the following examples, the experimental methods without specific conditions are usually performed according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1. Cloning of human silk / threonine protein kinase 52

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total MA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA was formed into cDNA by reverse transcription. A Smart cDNA cloning kit (purchased from Clontech) was used to orient the cDNA fragment into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5cx. The bacteria formed a cDNA library. The Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. Comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank), it was found that the cDNA sequence of one of the clones, 1238g04, was new DNA. The cloned insert cDNA fragment was bidirectionally determined by synthesizing a series of primers. The results showed that the 1238g04 clone contained a full-length cDNA of 1965 bp (as shown in Seq ID NO: 1), and a 1425 bp open reading frame (0RF) from 179 bp to 1603 bp, encoding a new protein (such as Seq ID N0 : 2)). We named this clone pBS-1238g04 and encoded the protein named human silk / threonine protein kinase 52.

 Example 2: Homologous search of cDNA clones

 The sequence of the human silk / threonine protein kinase 52 of the present invention and the protein sequence encoded by the same were applied using the Blast program (Basic local Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], perform homology search in databases such as Genbank and Swissport. The gene with the highest homology to the human silk / threonine protein kinase 52 of the present invention is a known silk / threonine protein kinase 51PK of Mus musculus, and its encoded protein has accession number AF080252 in Genbank. . The protein homology results are shown in Figure 1. The two are highly homologous, with 40% identity; 56% similarity.

 Example 3: Cloning of a gene encoding human silk / threonine protein kinase 52 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5, — GGCCCAGCGGAAGTTTTCGCTGGG —3, (SEQ ID NO: 3)

Priraei-2: 5,-CATAGGCCGAGGCGGCCGACATGT -3, (SEQ ID NO: 4) Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 μl of KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mraol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol in a reaction volume of 50 μ 1 Primer, 1U of Taq DM polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min. in-? At the time of € !, set-& 01 ^ 1 as a positive control and template blank as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1965bp sequence shown in SEQ ID NO: 1.

 Example 4: Northern blot analysis of human silk / threonine protein kinase 52 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR amplified human silk / threonine protein kinase 52 coding region sequence (179b _P to 1603bp.) Shown in FIG. 1. The 32P- labeled probe (approximately 2 X 10 ⁶ cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 C in a hybridization solution, the solution comprising 50% formamide - 25mM KH ₂ P0 ₄ ( pH7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were placed at 1 x SSC-0.1 ° /. 55 in SDS. C Wash for 30min. Then, Phosphor Imager was used for analysis and quantification.

 Example 5: In vitro expression, isolation and purification of recombinant human silk / threonine protein kinase 52

 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers was designed. The sequences are as follows:

Primer 3: 5'- CATGCTAGCATGATCTCCTTCTGTCCAGACTGTG -3, (Seq ID No: 5) Primer4: 5'- CCCGAATTCCTAGGGCACCATCGGGAGGCCAATG -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively , Followed by the 5 'end and 3 ¹ of the target gene, respectively The coding sequence at the end, Ndel and EcoRI ^ cut sites correspond to alternative endonuclease sites on the expression vector plasmid pET-28b (+) (product of Novagen, Cat. No. 69865.3). The PCR reaction was performed using the pBS-1238g04 plasmid containing the full-length target gene as a template. The PCR reaction conditions are as follows: a total volume of 50 μ1 contains 10 pg of pBS-1238g04 plasmid, primers? 1 ^ 1116]: -3 and? 1: 11116]: -4 points and another!] Is 1 (^ 11101, Advantage polymerase Mix (Clontech)) 1μ 1. Cycle parameters: 94.C 20s, 60.C 30s, 68 ° C 2 min, a total of 25 The digestion product and plasmid PET-28 (+) were double-digested with Ndel and EcoRI, respectively, and the large fragments were recovered and ligated with T4 ligase. The ligation products were transformed by the calcium chloride method of coliform bacteria DH5CC. After kanamycin (final concentration 30 g / ml) was cultured on LB plates overnight, colony PCR method was used to screen positive clones and sequenced. Pick positive clones with the correct sequence ( _P ET-1238g04). Recombine by calcium chloride method The plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen). In a LB liquid medium containing kanamycin (final concentration 30 μ _§ / πι1), the host strain BL21 (pET-1238g04) was cultured at 37 ° C. to In the logarithmic growth phase, IPTG was added to a final concentration of 1 mmol / L, and the culture was continued for 5 hours. The cells were collected by centrifugation, sonicated, and the supernatant was collected by centrifugation. The affinity was 6-His-tag) Column His. Bind Quick Cartridge (Novagen) for chromatography The purified target protein human silk / threonine protein kinase 52 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 52 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.

 Example 6 Production of anti-human silk / threonine protein kinase 52 antibodies

A peptide synthesizer (product of PE company) was used to synthesize the following human silk / threonine protein kinase 52-specific peptides: NH ₂ -Met-Ile-Ser-Phe-Cys-Pro-Asp-Cys-Gly-Lys-Ser -Ile-Gln-Ala-Ala-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex with complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human silk / threonine protein kinase 52.

 Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe

The selection of suitable oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes is versatile For example, if the probe can be used to hybridize to a genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used; 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5 '-GCGGAGCCGAGTGACCACCTCACTTGAAGCTTTGCCCACAG-3' (SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5 '-GCGATCGCGAGTGACCAATCGACTTGAAGCTTATCGCACAG-3' (SEQ ID NO: 9)

 Please refer to the literature for other commonly listed reagents and their preparation methods related to the following specific experimental procedures: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning experiment manual books such as "Molecular Guide to Cloning Experiments, Second Edition, U998) [US] Sambrook, et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenization buffer (0.25mol / L sucrose; 25 mol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25mmol / L MgCl ₂ ) to suspend the precipitate (about 10ml / g) „4) in 4 ° C homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5ml per 0.1 g of the original tissue sample), Centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Procedure: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lx 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) wait Volume phenol: chloroform: isoamyl alcohol (25: 24: 1) was extracted and centrifuged in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Add 1800 volumes of 2mol / L sodium acetate and 1 volume of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5 X 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 _μg / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentration is 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well--20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A _{26 (1} and A _2S . To detect the purity and yield of DNA. 15) Store at -20 ° (:) after dispensing.

Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe in order to follow the experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours. Labeling of probes

1) 3 μ IProbe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ U

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) The combined solution after the first peak was collected as ³² P-Probe (second peak to prepare the desired free γ- ³² Ρ- dATP). Pre-hybridization

 Put the sample membrane in a plastic bag, add 3-10 mg of pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray autoradiography:

-70 ° C, X-ray autoradiography (compression time depends on the radioactivity of the hybrid spot). Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Industrial applicability

 The polypeptide of the present invention (human silk / threonine protein kinase 52) plays an important role in the cascade of activated silk / threonine phosphorylation such as Ras and PKC, so it plays a role in cell signaling It plays an important role in controlling cell growth, division, death, differentiation to form tissues, and various life processes, and can be further used to diagnose and treat various related diseases, such as: various malignant tumors and cancers, various Developmental disorders, various immune system diseases, etc.

 For the human serine / threonine protein kinase 52 of the present invention, the expression of the protein is related to the occurrence of various malignant tumors and cancers; therefore, the polypeptide of the present invention can be used for the diagnosis and treatment of many diseases, such as Related malignancies and cancers, these diseases include, but are not limited to, gastric cancer, liver cancer, colorectal cancer, breast cancer, lung cancer, prostate cancer, cervical cancer, pancreatic cancer, esophageal cancer, pituitary adenoma, benign thyroid tumor, Thyroid cancer, parathyroid adenoma, parathyroid cancer, adrenal myeloma, pheochromocytoma, islet cell tumor, multiple endocrine gland tumor, thymic tumor, etc.

 The human silk / threonine protein kinase 52 of the present invention can also be used to diagnose and treat various developmental disorders related thereto, including but not limited to the following, spina bifida, craniocerebral fissure, anencephaly, brain Swelling, foramen deformity, Down syndrome, congenital hydrocephalus, aqueduct deformity, cartilage hypoplasia, dwarfism, spinal epiphyseal dysplasia, pseudochondral dysplasia, Langer-G iedion syndrome, funnel chest, Gonad hypoplasia, congenital adrenal hyperplasia, upper urethra, cryptorchidism, short stature syndrome such as Conradi syndrome and Danbol t-Closs syndrome, congenital glaucoma or cataract, congenital lens position abnormality, congenital Small eyelid fissure, retinal dysplasia, congenital optic nerve atrophy, congenital sensorineural hearing loss, cleft foot and hand crack, teratosis, Williams syndrome, Alagilie syndrome, Bayer syndrome, etc.

The human silk / threonine protein kinase 52 of the present invention can also be used for the diagnosis and treatment of various immune system diseases related to its abnormal expression, including but not limited to the following, rheumatoid arthritis, chronic active liver Inflammation, primary Sjogren's syndrome, acute pre- uveitis, arthritis after gonococcal infection, ankylosing spondylitis, hemochromatosis, immune complex glomerulonephritis, myocarditis after gonococcal infection, systemic lupus erythematosus , Rheumatoid arthritis, scleroderma, polymyositis, xerostomia, nodular polyarteritis, Wegener's granulomatosis, myasthenia gravis, Guillain-Barre syndrome, autoimmune hemolytic Anemia, immune thrombocytopenic purpura, autoimmune interstitial nephritis, autoimmune gastritis, insulin autoimmune syndrome, autoimmune thyroid disease, autoimmune heart disease, etc.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human silk / threonine protein kinase 52. Agonists enhance human silk / threonine protein kinase 52 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human silk / threonine protein kinase 52 can be cultured with labeled human silk / threonine protein kinase 52 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human silk / threonine protein kinase 52 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of human silk / threonine protein kinase 52 can bind to human silk / threonine protein kinase 52 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.

 When screening compounds as antagonists, human silk / threonine protein kinase 52 can be added to a bioanalytical assay by measuring the effect of the compound on the interaction between human silk / threonine protein kinase 52 and its receptor Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. The peptide molecules capable of binding to human silk / threonine protein kinase 52 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human silk / threonine protein kinase 52 molecules should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against human silk / threonine protein kinase 52 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

Polyclonal antibodies can be produced by directly injecting human silk / threonine protein kinase 52 into immunized animals (such as rabbits, Mice, rats, etc.), a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies to human silk / threonine protein kinase 52 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human Beta-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human silk / threonine protein kinase 52.

 Antibodies against human silk / threonine protein kinase 52 can be used in immunohistochemical techniques to detect human silk / threonine protein kinase 52 in biopsy specimens.

 Monoclonal antibodies that bind to human silk / threonine protein kinase 52 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human silk / threonine protein kinase 52 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human silk / threonine protein domains 52 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human silk / threonine protein kinase 52. The administration of an appropriate dose of antibodies can stimulate or block the production or activity of human silk / threonine protein kinase 52.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human silk / threonine protein kinase 52 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human silk / threonine protein kinase 52 detected in the test can be used to explain the importance of human silk / threonine protein kinase 52 in various diseases and to diagnose human silk / threonine protein kinase 52. A working disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

The polynucleotide encoding human silk / threonine protein kinase 52 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human silk / threonine protein kinase 52. Recombinant gene therapy vectors (such as viral vectors) can be designed for expression Mutated human silk / threonine protein kinase 52 to inhibit endogenous human silk / threonine protein kinase 52 activity. For example, a mutated human silk / threonine protein kinase 52 may be a shortened human silk / threonine protein kinase 52 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signal transduction. active. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human silk / threonine protein kinase 52. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human silk / threonine protein kinase 52 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human silk / threonine protein kinase 52 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human silk / threonine protein kinase 52 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DM) and ribozymes that inhibit human silk / threonine protein kinase 52 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidation synthesis of oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.

The polynucleotide encoding human silk / threonine protein kinase 52 can be used for the diagnosis of diseases related to human silk / threonine protein kinase 52. The polynucleotide encoding human silk / threonine protein kinase 52 can be used to detect the expression of human silk / threonine protein kinase 52 or the abnormal expression of human silk / threonine protein kinase 52 in a disease state. For example, the DNA sequence encoding human silk / threonine protein kinase 52 can be used to hybridize biopsy specimens to determine the expression status of human silk / threonine protein kinase 52. Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing the difference of genes in tissues. Expression analysis and genetic diagnosis. Human silk / threonine protein kinase 52-specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human silk / threonine protein kinase 52 transcription products.

 Detection of mutations in the human silk / threonine protein kinase 52 gene can also be used to diagnose human silk / threonine protein kinase 52-related diseases. Human silk / threonine protein kinase 52 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human silk / threonine protein kinase 52 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position of a human chromosome and can hybridize with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeat polymorphisms) are available for labeling chromosomal positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendeian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If in some Or if a mutation is observed in all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase Figure resolution and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human silk / threonine protein kinase 52 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human silk / threonine protein kinase 52 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Request for Profit

 1. An isolated polypeptide-human silk / threonine protein kinase 52, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog or derivative of a polypeptide thereof .

 2. The polypeptide according to claim 1, wherein the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 179 to 1603 in SEQ ID NO: 1 or the sequence of positions 1-1965 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human silk / threonine protein kinase 52 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human silk / threonine protein kinase 52;

 (b) Isolating a polypeptide having human silk / threonine protein kinase 52 activity from the culture.

10.An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to human silk / threonine protein kinase 52 Specific binding antibody.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human silk / threonine protein kinase 52.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human silk / threonine protein kinase 52 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human silk / threonine protein kinase 52; or For identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip. Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human silk / threonine protein kinase 52 abnormality.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Diseases, HIV infection and immune diseases and drugs of various inflammations.