WO2001045729A1 - Nouveau polypeptide, phosphoproteine ribosomale humaine 16, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, phosphoproteine ribosomale humaine 16, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001045729A1
WO2001045729A1 PCT/CN2000/000603 CN0000603W WO0145729A1 WO 2001045729 A1 WO2001045729 A1 WO 2001045729A1 CN 0000603 W CN0000603 W CN 0000603W WO 0145729 A1 WO0145729 A1 WO 0145729A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
ribosomal phosphoprotein
sequence
acidic ribosomal
Prior art date
Application number
PCT/CN2000/000603
Other languages
English (en)
Chinese (zh)
Other versions
WO2001045729A8 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU19869/01A priority Critical patent/AU1986901A/en
Publication of WO2001045729A1 publication Critical patent/WO2001045729A1/fr
Publication of WO2001045729A8 publication Critical patent/WO2001045729A8/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human acid ribosomal phosphoprotein 16, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • the correct translation of proteins is very important for all bacteria and higher organisms.
  • the research on the regulation mechanism of protein translation is obtained from E. coli.
  • the protein translation process is mainly completed by various aminoacyl-tRNA synthetases, various tRNAs and ribosomes.
  • the ribosome and other cofactors together provide the full enzymatic activity of the translation process. These enzyme activities are only in the ribose Only when the overall structure of the body is complete. Therefore, the ribosome and its constituent subunits work synergistically in the body and play an important physiological function.
  • Ribosomes are organelles that synthesize proteins. Their only function is to synthesize polypeptide chains from amino acids in accordance with the instructions of mRNA. It is called ribosome, and is simply called ribosome or ribosome. Ribosomes are found in almost all cells, whether in prokaryotic or eukaryotic cells, there are a large number of ribosomes. The ribosome is a granular structure without a membrane. Its diameter is 25 nm. The main components are protein and RNA. Ribosomal RNA is called rRNA. The protein content is about 40 ° / »and RNA is about 60%.
  • Protein molecules are mainly distributed on the surface of the ribosome, while rRNA is located inside, and the two are bound together by non-covalent bonds.
  • Cell Biology Zhai Zhonghe Higher Education Press ppl 22-129 The functional research of ribosomes has focused on ribosomal RNA. There are many rRNA functional domains that determine different functions of ribosomes. (Annu Rev B ochem 1991; 60 191-227)
  • ribosomes there are two basic types of ribosomes in biological organism cells: one is 70S (S is Sverdberg sedimentation coefficient unit) ribosome, all prokaryotic ribosomes are 70S eukaryotic cells, mitochondria and ribosomes in chloroplasts are also Approximately 70S. The other is 80S ribosomes, the ribosomes of eukaryotic cells (except for mitochondria and chloroplast ribose) are 80S. Ribosomes, whether 70S or 80S, are composed of two subunits of different sizes.
  • Ribosome size subunits are often free in the cytoplasmic matrix within the cell. After the mRNA is bound, the large subunits bind to the small subunits to form a complete ribosome. After the peptide synthesis is terminated, the large and small subunits dissociate and then exist freely in the cytoplasmic matrix.
  • 60SrRNA is the RNA component of the large subunit of the 80S ribosomes of eukaryotes.
  • Acidic ribosomal phosphoprotein PO (acid ribosomal phosphoprotein PO) is one of the subunits of the eukaryotic 60S ribosome, and it can form a complex pentamer with dimeric ribosomal proteins P1 and P2. (Plant Physiol. 1994 Jun; 105 (2): 753-4)
  • PI (P2) and PO are homologous to the ribosomal proteins L7 / L12 and L10 of E. coli, respectively. Therefore, their combined protein is considered to have the following functions: Binding to 28SrRM; Interaction with certain translation factors; Binding of aminoacyl tRNA; related to GTP binding activity. (Plant Physiol. 1994 Jun; 105 (2): 753-4)
  • the PO gene has been cloned in many organisms, including humans, yeasts, mice, nematodes, and so on.
  • the P0 protein contains some conserved amino acid sequences.
  • One of the hydrophilic fragments is deduced to be the binding site of 28SrRNA. This fragment contains 45-67 amino acid residues of the mouse P0 protein. This region is rich in Lysine and arginine, the basic amino acids are also highly conserved.
  • the mouse P0 protein also has a phosphorylation site for tyrosine protein kinase, that is, the serine residue (Ser) at position 309 in (XEXXSX), which may have important significance for the regulation of the function of the P0 protein.
  • Acidic ribosomes Phosphoprotein P0 has an important role in the translation process of proteins. If it is deleted or chemically modified, or the gene encoding it is mutated, it will affect the function of ribosomes and reduce the activity of peptide synthesis.
  • the function of acidic ribosome phosphoprotein P0 includes: Binding with 28SrRNA: Interaction with certain translation factors; Improved with ammonia Acyl tRNA binding; related to GTP binding activity and so on.
  • the polypeptide of the present invention was inferred and identified as human acid ribosomal phosphoprotein 16 (HARP16), and its homologous protein was human 60S acid ribosomal phosphoprotein P0.
  • the protein number is
  • the human acidic ribosomal phosphoprotein 16 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participants These processes are the human acidic ribosomal phosphoprotein 16 protein, and in particular the amino acid sequence of this protein is identified. Isolation of the new acidic ribosomal phosphoprotein 16 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human acidic ribosomal phosphoprotein 16.
  • Another object of the present invention is to provide a method for producing human acidic ribosomal phosphoprotein 16.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human acidic ribosomal phosphoprotein 16.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the human acidic ribosomal phosphoprotein 16 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human acidic ribosomal phosphoprotein 16.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide complementary to polynucleotide (a);
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 118-552 in SEQ ID NO: 1; and (b) a sequence having 1-1167 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human acidic ribosomal phosphoprotein 16 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of human acidic ribosomal phosphoprotein 16 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human acidic ribosomal phosphoprotein 16.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide is one that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human acidic ribosomal phosphoprotein 16, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human acidic ribosomal phosphoprotein 16.
  • Antagonist refers to a molecule that, when combined with human acidic ribosomal phosphoprotein 16, can block or regulate the biological or immunological activity of human acidic ribosome phosphoprotein 16.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human acidic ribosomal phosphoprotein 16.
  • Regular refers to a change in the function of human acidic ribosome phosphoprotein 16, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human acidic ribosome phosphoprotein 16 change.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human acidic ribosomal phosphoprotein 16 using standard protein purification techniques. Essentially pure human acidic ribosomal phosphoprotein 16 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human acidic ribosomal phosphoprotein 16 peptide can be analyzed by amino acid sequence.
  • Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands The efficiency and strength of inter-strand hybridization have a significant effect.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences be combined with each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The C Luster method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645),
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine: asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode major biological features that retain natural molecules Sexual peptide.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human acidic ribosomal phosphoprotein 16.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human acidic ribosomal phosphoprotein 16 means that human acidic ribosomal phosphoprotein 16 is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated with it. Those skilled in the art can purify human acidic ribosomal phosphoprotein 16 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human acidic ribosomal phosphoprotein 16 peptides can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human acidic ribosomal phosphoprotein 16, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated-or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human acidic ribosomal phosphoprotein 16.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human acidic ribosomal phosphoprotein 16 of the present invention.
  • Fragments and derivatives of polypeptides of the invention or analogues may be: U) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be inherited Codon-encoded; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or ( ⁇ ⁇ ) such a type in which the mature polypeptide and another A compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence (such as a leader sequence or a secretory sequence or a polypeptide sequence formed by fusing an additional amino acid sequence into a mature polypeptide) To purify the sequence of the polypeptide or protease sequence) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1 167 bases, and its open reading frame (118-552) encodes 144 amino acids.
  • this polypeptide is similar to human 60S acidic ribosome Phosphoprotein P0 has 99% homology. It can be deduced that the human acidic ribosomal phosphoprotein 16 has similar structure and function to human 60S acidic ribosomal phosphoprotein P0.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cI) NA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, Mutants and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50 ° / »(v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) only the identity between the two sequences is at least Crosses occur at 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least SO-SO nucleotides, most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human acidic ribosomal phosphoprotein 16.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human acidic ribosomal phosphoprotein 16 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) screening of antibodies expressing cultures to detect polynuclear clones with common structural characteristics Nucleotide fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • C Commercially available cDNA libraries can also be obtained, such as different cDNA libraries from Clontech. . when When combined with polymerase reaction technology, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3.) determining the level of transcripts of human acidic ribosomal phosphoprotein 16; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the gene itself or the fragment of the present invention can of course be used as a probe.
  • the DNA probe can be labeled with a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human acidic ribosomal phosphoprotein 16 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DM / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • the polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such multicore Nucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human acidic ribosomal phosphoprotein 16 coding sequence, and a recombinant technology for producing the polypeptide of the present invention method.
  • a polynucleotide sequence encoding human acidic ribosomal phosphoprotein 16 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, reverse transcription, as is well known in the art. Virus or other vector.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human acidic ribosomal phosphoprotein 16 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 27 ⁇ base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human acidic ribosomal phosphoprotein 16 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S 2 or Sf 9
  • animal cells such as CH0, COS, or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after exponential growth and used.
  • the (12 ) method is used, and the steps used are well known in the art.
  • MgC l 2 can be used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following can be used DM transfection method: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human acidic ribosomal phosphoprotein 16 (Scence, 1 984; 224: 1 431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Figure 1 is the amino group of human acidic ribosomal phosphoprotein 16 and human 60S acidic ribosomal phosphoprotein P 0 of the present invention Comparison of acid sequence homology.
  • the upper sequence is human acidic ribosomal phosphoprotein 16, and the lower sequence is human 60S acidic ribosomal phosphoprotein P0.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human acidic ribosomal phosphoprotein 16 isolated.
  • 16kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0184f 12 was new DNA.
  • the cloned insert cDNA fragment was bidirectionally determined by synthesizing a series of primers. The results show that the full-length cDNA contained in the 0184 ⁇ 2 clone is 1167bp (as shown in Seq ID NO: 1), and there is a 561bp open reading frame (ORF) from 118bp to 552bp, which encodes a new protein (such as Seq ID N0 : Shown in 2).
  • ORF open reading frame
  • the sequence of the human acidic ribosomal phosphoprotein 16 of the present invention and the protein sequence encoded by the same were performed using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et a 1. J. Mol. Biol. 1990; 215: 403- 10], homology search in databases such as Genbank and Swissport. versus
  • the gene with the highest homology of the human acidic ribosomal phosphoprotein 16 of the present invention is a known human 60S acidic ribosomal phosphoprotein P0, whose accession number encoded by Genbank is AF173378.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 99% identity; 99% similarity.
  • Example 3 Cloning of a gene encoding human acidic ribosomal phosphoprotein 16 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primer 1 5'- GACCACAGCCCTCTCTGTCCTCTC -3 '(SEQ ID NO: 3)
  • Primer2 5'- CACGACTAATTTTTTTTTATTTTTTTT -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer 2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ramol / L KC1, 10 crypto ol / L Tris'-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontecli).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen product).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1167bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human acidic ribosomal phosphoprotein 16 gene expression:
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR amplified human acid ribosomal phosphoprotein 16 coding region sequence (118bp to 552bp) shown in FIG.
  • the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA.
  • the filter was placed in 1 x SSC-0.1% SDS at 55 "C. Wash for 30min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human acidic ribosomal phosphoprotein 16
  • Primer 3 5'- CCCCATATGATGGGCTGGTGGCGTGGCCAGGAGC -3, (Seq ID No: 5)
  • Primer 4 5,-CCCGAGCTCTCAGTCATCATCTTCTGAGTCTGAC -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and Sacl restriction sites, respectively , followeded by the coding sequences of the 5 'end and 3' end of the gene of interest, respectively, and the Nde I and Sac I restriction sites correspond to the expression vector plasmid pET-28 b (+) (Novagen product, Cat. No. 69865.3 Selective endonuclease sites on).
  • PCR was performed using the pBS-0184 ⁇ 2 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of P BS-0184 ⁇ 2 plasmid, primers Primer-3 and Primer-4, and 1 J was lOpmoi, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Ndel and Sacl were used to double-digest the amplified product and plasmid pET-28, respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5C by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0184 ⁇ 2) with a correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novageii) by the calcium chloride method.
  • the following peptides specific to human acidic ribosomal phosphoprotein 16 were synthesized using a peptide synthesizer (product of PE): NH 2 -Met-Gly-Trp-Trp-Arg-Gly-Gln-Glu-His-Leu-Leu-Leu -Pro-Leu-Leu-COOH (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then use the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides; Wo 01/45729
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • Sample preparation Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl 2 ). 4) at 4. C Homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken.
  • PBS phosphate buffered saline
  • DNA phenol extraction method Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (1 X 10 8 cells / ml) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 7 cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight.
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for later experiments. High-strength conditions and Strength conditions wash the film.
  • Low-intensity washing film 1) Take out the hybridized sample membrane.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi s i, J. L., Lyer, V. & Brown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR (as described in Example 3), and the amplified product was purified to a concentration of about 500 ng / ul, and a Cartes i an 7500 spotter (purchased from Cartes, USA) was used. i an company) point on the glass medium, and the distance between the points is 280 ⁇ . The spotted slides are hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides are fixed to fix the DNA on the glass slides. Into a chip. The specific method steps have been variously reported in the literature. The post-sampling processing steps of this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer tissues by a single method, and the mRNA was purified by Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino- propargy 1-2 ⁇ - deoxyur i dine 5'- triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label mRNA of normal liver tissue
  • Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label abnormal liver tissue RNA], and probes were prepared after purification.
  • probes were prepared after purification.
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • the scanned image was processed by Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point. The points with the ratio less than 0.5 and greater than 2 were considered. Genes with differential expression.
  • the polypeptide of the present invention (human acidic ribosomal phosphoprotein 16) is one of the human 60S ribosomal subunits, and plays an important role in the translation process of the protein. If it is deleted or chemically modified, or the gene encoding it occurs Mutations will affect the function of the ribosome and reduce the activity of peptide synthesis. Although the functional studies of human acidic ribosomal phosphoprotein 16 are not thorough enough, according to various research results, it can be proved that the functions of human acidic ribosomal phosphoprotein 16 include: binding to 28 SrRNA; interaction with certain translation factors ; Improve binding to aminoacyl tRNA; Related to GTP binding activity and so on.
  • the human acidic ribosomal phosphoprotein 16 of the present invention can be used for the diagnosis and treatment of many diseases, such as malignant tumors, immune diseases, endocrine system diseases, nervous system diseases and various inflammations.
  • the polypeptide of the present invention can be used for treating human malignant tumors, including but not limited to gastric cancer, liver cancer, colorectal cancer, breast cancer, lung cancer, prostate cancer, cervical cancer, pancreatic cancer, and esophageal cancer.
  • the polypeptide of the present invention is also an immunomodulator, and has an immune promoting or immunosuppressing effect.
  • the polypeptide of the present invention can be used for the treatment of some diseases, including non-response of the immune response, or abnormal immune response, or ineffective host defense. Examples are as follows:
  • Autoimmune diseases systemic lupus erythematosus, rheumatoid arthritis, scleroderma, polymyositis, xerostomia, nodular polyarteritis, autoimmune gastritis, insulin autoimmune syndrome.
  • Autoimmune Immune thyroid disease autoimmune heart disease;
  • Primary immunodeficiency disease (1) Primary specific immunodeficiency disease such as antibody-based primary specific immunodeficiency disease, combined immunodeficiency disease, primary specific immunodeficiency disease with other characteristics; (2) primary non-specific immunodeficiency diseases such as phagocytic deficiency immunodeficiency diseases and complement system defects; (3) primary immunodeficiency diseases accompanied by other diseases such as Down syndrome, short-limb dwarfism, Hereditary transcobalamin I] deficiency with hypogammaglobulinemia, biotin-dependent carboxylase deficiency, Dun Can syndrome, thymoma, chronic disease skin mucosal candidiasis, aplastic anemia, Di George syndrome Disease, Wis co t t A l dr i ch syndrome, immunodeficiency disease with ataxia capillary dilatation; Secondary immunodeficiency diseases such as acquired immunodeficiency syndrome;
  • Allergic diseases bronchial asthma, aspirin asthma;
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human acidic ribosomal phosphoprotein 16.
  • Agonists enhance human acidic ribosomal phosphoprotein 16 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human acidic ribosomal phosphoprotein 16 can be cultured with labeled human acidic ribosomal phosphoprotein 16 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human acidic ribosomal phosphoprotein 16 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human acidic ribosome phosphoprotein 16 can bind to human acidic ribosome phosphoprotein 16 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human acidic ribosomal phosphoprotein 16 can be added to the bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human acidic ribosomal phosphoprotein 16 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • the peptide molecules capable of binding to human acidic ribosomal phosphoprotein 16 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human acidic ribosomal phosphoprotein 16 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human acidic ribosomal phosphoprotein 16 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human acidic ribosomal phosphoprotein 16 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human acidic ribosomal phosphoprotein 16 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morris on etal, PNAS, 1 985, 81: 685 1). And existing production Single chain antibody technology (US Pat No. 4946778) can also be used to produce single chain antibodies against human acidic ribosomal phosphoprotein 16.
  • Antibodies against human acidic ribosome phosphoprotein 16 can be used in immunohistochemical techniques to detect human acidic ribosome phosphoprotein 16 in biopsy specimens.
  • Monoclonal antibodies that bind to human acidic ribosomal phosphoprotein 16 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human acidic ribosomal phosphoprotein 16 can be covalently bound to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human acidic ribosomal phosphoprotein 16 positive Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human acidic ribosomal phosphoprotein 16. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human acidic ribosomal phosphoprotein 16.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human acidic ribosomal phosphoprotein 16 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays. The level of human acidic ribosomal phosphoprotein 16 detected in the test can be used to explain the importance of human acidic ribosomal phosphoprotein 16 in various diseases and to diagnose diseases in which human acidic ribosomal phosphoprotein 16 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • Polynucleotides encoding human acidic ribosomal phosphoprotein 16 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human acidic ribosomal phosphoprotein 16.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human acidic ribosome phosphoprotein 16 to inhibit endogenous human acidic ribosome phosphoprotein 16 activity.
  • a mutated human acidic ribosome Phosphoprotein 16 can be a shortened human acidic ribosomal phosphoprotein 16 which lacks the signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human acidic ribosomal phosphoprotein 16.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human acidic ribosomal phosphoprotein 16 to in the cell.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human acidic ribosomal phosphoprotein 16 can be found in existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding human acidic ribosomal phosphoprotein 16 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human acidic ribosomal phosphoprotein 16 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained using any existing RM or DM synthesis techniques, such as solid-phase phosphoramidation synthesis of oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human acidic ribosomal phosphoprotein 16 can be used for the diagnosis of diseases related to human acidic ribosomal phosphoprotein 16.
  • Polynucleotides encoding human acidic ribosomal phosphoprotein 16 can be used to detect the expression of human acidic ribosomal phosphoprotein 16 or abnormal expression of human acidic ribosomal phosphoprotein 16 under disease conditions such as encoding human acidic ribosomal phosphoprotein 16
  • the DNA sequence of protein 16 can be used to hybridize biopsy specimens to determine the expression of human acidic ribosomal phosphoprotein 16. Hybridization techniques include Southern blotting, No r thern imprinting, and in situ hybridization.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues. diagnosis.
  • Human acid ribosomal phosphoprotein 16 specific primers can also be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human acid ribosomal phosphoprotein 16 transcripts.
  • Human acid ribosomal phosphoprotein 16 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human acid ribosomal phosphoprotein 16 DNA sequence.
  • Existing techniques such as Sout hern blotting, DNA sequence analysis, PCR and in situ hybridization can be used to detect mutations.
  • mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used. Indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers are then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • the somatic hybrid cell PCR mapping method is a fast method for locating DNA to a specific chromosome.
  • oligonucleotide primers of the present invention by a similar method, a group of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sub- Positioning.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins Univer s Wetch Medica 1 Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Ability and every 2 Okb correspond to one gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human acidic ribosomal phosphoprotein 16 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human acidic ribosomal phosphoprotein 16 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une phosphoprotéine ribosomale humaine (16), et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la phosphoprotéine ribosomale humaine(16).
PCT/CN2000/000603 1999-12-22 2000-12-18 Nouveau polypeptide, phosphoproteine ribosomale humaine 16, et polynucleotide codant pour ce polypeptide WO2001045729A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19869/01A AU1986901A (en) 1999-12-22 2000-12-18 A novel polypeptide-human ribosomal phosphoprotein 16 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99125676.X 1999-12-22
CN 99125676 CN1300772A (zh) 1999-12-22 1999-12-22 一种新的多肽－人酸性核糖体磷蛋白16和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001045729A1 true WO2001045729A1 (fr) 2001-06-28
WO2001045729A8 WO2001045729A8 (fr) 2001-07-26

Family

ID=5284089

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000603 WO2001045729A1 (fr) 1999-12-22 2000-12-18 Nouveau polypeptide, phosphoproteine ribosomale humaine 16, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1300772A (fr)
AU (1) AU1986901A (fr)
WO (1) WO2001045729A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996033414A2 (fr) * 1995-04-21 1996-10-24 Corixa Corporation Composes et procedes pour diagnostiquer la leishmaniose

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996033414A2 (fr) * 1995-04-21 1996-10-24 Corixa Corporation Composes et procedes pour diagnostiquer la leishmaniose

Also Published As

Publication number Publication date
WO2001045729A8 (fr) 2001-07-26
AU1986901A (en) 2001-07-03
CN1300772A (zh) 2001-06-27

Similar Documents

Publication Publication Date Title
WO2001064892A1 (fr) Nouveau polypeptide, threonyl-arnt synthetase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001045729A1 (fr) Nouveau polypeptide, phosphoproteine ribosomale humaine 16, et polynucleotide codant pour ce polypeptide
WO2001048221A1 (fr) Nouveau polypeptide, colipase 12, et polynucleotide codant pour ce polypeptide
WO2001066575A1 (fr) Nouveau polypeptide, actine 49, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001053499A1 (fr) Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide
WO2001055417A1 (fr) Nouveau polypeptide, proteine a f-box 65, et polynucleotide codant pour ce polypeptide
WO2001055374A1 (fr) Nouveau polypeptide, sequence 71 de multirepetition de la leucine, et polynucleotide codant pour ce polypeptide
WO2001066724A1 (fr) Nouveau polypeptide, actine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001040487A1 (fr) NOUVEAU POLYPEPTIDE, SYNTHASE HUMAINE 9 DE TYPE II A BASE AMINEE D'ARNt, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001055402A1 (fr) Nouveau polypeptide, succinyl-coa synthetase 51 atp specifique, et polynucleotide codant pour ce polypeptide
WO2001075036A2 (fr) Nouveau polypeptide, immunophiline humaine 14, et polynucleotide codant pour ce polypeptide
WO2001066701A1 (fr) Nouveau polypeptide, nadh-deshydrogenase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075057A2 (fr) Nouveau polypeptide, proteine ribosomale s4 humaine 12, et polynucleotide codant pour ce polypeptide
WO2001066581A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-19, et polynucleotide codant pour ce polypeptide
WO2001070779A1 (fr) Nouveau polypeptide, proteine humaine 12 de type cdc4, et polynucleotide codant pour ce polypeptide
WO2001073065A1 (fr) Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 12, et polynucleotide codant pour ce polypeptide
WO2001083728A1 (fr) Nouveau polypeptide, proteine humaine de transport d'acides amines excitateurs 9, et polynucleotide codant pour ce polypeptide
WO2001098336A1 (fr) Nouveau polypeptide, proteine ribosomale s4 humaine 10, et polynucleotide codant ce polypeptide
WO2001066576A1 (fr) Nouveau polypeptide, glycoproteine amyloidogenique humaine 11, et polynucleotide codant pour ce polypeptide
WO2001070795A1 (fr) Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001074128A2 (fr) Nouveau polypeptide, microtubuline 11, et polynucléotide codant pour ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2001074871A1 (fr) Nouveau polypeptide, camp-phosphodiesterase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001040287A1 (fr) Nouveau polypeptide, sous-unite beta 10 de la pompe a sodium, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: C1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: PAT. BUL. 26/2001 UNDER (51) REPLACE THE EXISTING SYMBOL BY "C07K 14/435, A61K 38/17"

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP