WO2001040287A1 - A novel polypeptide-beta subunit 10 of sodium pump and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of polypeptide-beta subunit 10 of sodium pump and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as cancer, hemopathy, HIV infection, immune diseases and inflammation. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said beta subunit 10 of sodium pump.

Description

 A new polypeptide-beta subunit 10 of a sodium pump and a polynucleotide encoding the polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, the P subunit 10 of a sodium pump, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique

 Sodium pump (Na +, K + ATPase) exists in the plasma membrane of all animal cells. The sodium pump adjusts the ion concentration on both sides of the plasma membrane (sodium ion is transferred out, potassium ion is transferred and accompanied by the hydrolysis of ATP), and then the ion gradient, osmotic balance and membrane potential of the cell are controlled. The sodium pump is composed of two subunits: an alpha subunit (which has a catalytic function) composed of a heterotrimer and a beta subunit composed of a heterodimer.

 The beta subunits of sodium pumps vary between species and tissues and contain 302-304 amino acids. The beta subunit crosses the cell membrane once, and its 35 amino-terminal residues are located in the cytoplasm. Due to the similarity of the primary structure, the same secondary structure of the β subunit is determined. From the amino terminus to the first glycoprotein binding site, it appears as an α-helix; the carboxy-terminated peptide is mainly a β-sheet and two short helices; the transmembrane part contains three highly hydrophilic helixes.

 The β subunit has three isomers as far as known, βΐ and β3 have three glycosylation sites and β2 has seven glycosylation sites; all β isomers have six conserved Cys residues The three disulfide bonds formed by these Cys can maintain the stability of the tertiary structure of the polypeptide.

Such two identical residue sequences were found in all β subunits. The first one is in the intracellular domain, and its order is: (Phe, Tyr, Trp) -X (2) 一 (Phe, Tyr, Trp) -X- (Phe, Tyr, Trp)-(Asp, Asn)- X (6)-(Leu, I le, Va l, Met) -Gly-Arg-Thr-X (3) -Trp _{0 The} second one is in the extracellular domain and contains a disulfide bond consisting of two Cys, The sequence is: (Arg, Lys) -X (2)-Cys- (Arg, Lys, Gin, TRp, I le) -X (5) -Leu-X (2) -Cys- (Ser, Ala)- Gly ₀ (where X represents any amino acid residue, a brine shr imp, the sodium pump β subunit does not contain a second sequence.) During the synthesis and transport of sodium pump to the plasma membrane surface β The subunit plays an important regulatory role. The proton pump of the stomach (κ +, Η + ATPase) also contains two subunits, and its beta subunit is very similar to the beta subunit of the sodium pump. As the β-subunit 10 protein of the sodium pump plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more P-subunits of sodium pumps involved in these processes. 10 protein, especially the amino acid sequence of this protein is identified. Isolation of the beta subunit 10 protein encoding gene of the new sodium pump also provides the basis for research to determine the role of this protein in health and disease states Foundation. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Disclosure of invention

 It is an object of the present invention to provide an isolated novel polypeptide, the P subunit 10 of a sodium pump, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a P subunit 10 of a sodium pump. Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding the P subunit 10 of a sodium pump.

 Another object of the present invention is to provide a method for producing the β subunit 10 of a sodium pump.

 Another object of the present invention is to provide antibodies against the P subunit 10 of the polypeptide-sodium pump of the present invention. Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the P subunit 10 of the one-nano pump of the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of the sodium subunit P subunit 10.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 145-417 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 070-bit sequence.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the P subunit 10 protein of the sodium pump, which comprises utilizing the polypeptide of the invention. The invention also relates to a compound obtained by the method Thing.

 The present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a β-subunit 10 protein of a sodium pump, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of the β subunit 10 of the sodium pump.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

"Agonist" refers to a protein that, when combined with the beta subunit 10 of the sodium pump, Molecules that are active in this protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the beta subunit 10 of a sodium pump.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with the beta subunit 10 of a sodium pump, can block or regulate the biological or immunological activity of the sodium subunit's P subunit 10. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the beta subunit 10 of the sodium pump.

 "Regulation" refers to a change in the function of the e-subunit 10 of the sodium pump, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of the P-subunit 10 of the sodium pump change.

 "Substantially pure '" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify the P subunit 10 of the sodium pump using standard protein purification techniques. Basic The pure sodium pump β-subunit 10 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the nano-pump β-subunit 10 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" may be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence A and sequence B

 X 100

 Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B

 The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo logy 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (& 13 ') ₂ and? ^ It can specifically bind to the epitope of beta subunit 10 of the sodium pump.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

As used herein, "the P subunit 10 of an isolated sodium pump" means that the beta subunit 10 of a sodium pump is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can use the standard The quasi protein purification technique purifies the beta subunit 10 of the sodium pump. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the sodium pump P subunit 10 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide P-subunit 10 of a sodium pump, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of the P subunit 10 of the sodium pump. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the beta subunit 10 of the sodium pump of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1070 bases, and its open reading frame (145-417) encodes 90 amino acids. This peptide has the characteristic sequence of the beta subunit of the proton pump of the stomach, and it can be deduced that the beta subunit of the sodium pump 10 has the structure and function represented by the beta subunit of the stomach proton pump.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or it may be a degenerate variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between

50%, preferably 70% identity). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% ", bovine serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding the beta subunit 10 of the sodium pump.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the β-subunit 10 of the sodium pump of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available. Way to get (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of the transcript of the beta subunit 10 of the sodium pump; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the method (4), the protein product expressed by the beta subunit 10 gene of the sodium pump can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method using PCR to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. Especially when it is difficult to obtain full-length cDNA from the library, the RACE method (RACE-c DNA terminal rapid amplification method) can be preferably used. The primers used for PCR can be based on the polynucleotide sequence information of the present invention disclosed herein. It is appropriately selected and synthesized by a conventional method. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or the β subunit 10 coding sequence of a sodium pump directly, and the recombinant technology to produce the polypeptide of the present invention. Methods.

In the present invention, the polynucleotide sequence encoding the sodium pump (3 subunit 10) may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to a bacterial plasmid, Phage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus Or other carriers. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Na thans, JBio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding the beta subunit 10 of the sodium pump and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Mo l ecu l ar C l oni ng, a Labora tory Manua l, co ld Spr ing Harbor Laborat ory. New York, 1989 ). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, HSV thymidine kinase promoter, and early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding the β-subunit 10 of a sodium pump or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transforming a host cell with the DNA sequence of the present invention or a recombinant vector containing the DNA sequence may This is done using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCI using procedures well known in the art. Alternatively, M _g Cl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce the β subunit of recombinant sodium pump 10 (Sc ience, 1984; 224: 1431). Generally there are the following steps:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding the P subunit 10 of a human sodium pump of the present invention, or with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of amino acid sequence homology of a total of 56 amino acids in the beta subunit 10 of the sodium pump 10-29 of the present invention and the beta subunit domain of the proton pump of the stomach. The upper sequence is the P subunit 10 of the sodium pump, and the lower sequence is the beta subunit domain of the proton pump of the stomach. Ί "and": "and" · "indicate that the probability of different amino acids in the same position between two sequences decreasing in sequence.

FIG. 2 is a polyacrylamide gel electrophoresis chart (SDS-PAGE) of β subunit 10 of the separated sodium pump. OkDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions such as Sambrook et al., Molecular cloning: the conditions described in the laboratory manual (New York: Cold Harbor Harbor Laboratory Press, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer.

Example 1: Cloning of beta subunit 10 of a sodium pump

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Quik mRNA I solat ion Kit (product of Qiegene) was used to isolate poly (A) mRNA from total RM. 2ug poly (A) mRNA was reverse transcribed to form CDM. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5α. The bacteria formed a CDM library. The sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le react ion sequencing kit (Perk in-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer). The determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0349C07 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 0349C07 clone was 2381 bp (as shown in Seq ID NO: 1), and there was a 561b _P open reading frame (0RF) from 32 bp to 592 bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0349C07 and the encoded protein was named the beta subunit 10 of the sodium pump. Example 2: Domain analysis of cDNA clones

 The sequence of the β-subunit 10 of the sodium pump of the present invention and the protein sequence encoded by the sodium pump of the present invention were profiled by the prog i le scan program (Basicloca l Al ignment search tool) in GCG [Altschul, SF et a l. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed on databases such as Prote. The beta subunit 10 of the sodium pump of the present invention is homologous with the beta subunit of the proton pump of the domain stomach at 29-85, and the homology result is shown in FIG. 1 with a homology rate of 24% and a score of 13.40; The threshold is 12.78. Example 3: Cloning of the gene encoding the β-subunit 10 of the sodium pump by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Pr imer 1: 5'- AGGGTTTTCAACTATTGTTCATTAG -3 '(SEQ ID NO: 3)

Pr imer2: 5'- GTTCCCCATATTAGTTGAAATGAG —3, (SEQ ID NO: 4) Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Conditions for the amplification reaction: 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mraol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a 50 μ 1 reaction volume, 1U of Taq DNA polymerase (product of Ciontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QUGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen product). The DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as the 1-1070bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of sodium pump 10 subunit 10 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidinium isothiocyanate -25mM sodium citrate, 0.2M sodium acetate _(P H4.0) of the tissue was homogenized phenol, 1 volume and 1/5 volume of chloroform - isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a 1.2% agarose gel containing ²⁰ m 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the β-subunit 10 coding region sequence (145bp to 417bp) of the PCR-amplified sodium pump shown in FIG. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25 mM KH ₂ P0 ₄ (pH 7.4)-5 χ SSC-5 χ Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 ^X SSC_0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of β-subunit 10 of recombinant sodium pump

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer3: 5'- CCCCATATGATGTCAACATGGGGGTGGGGAAGGGT -3, (Seq ID No: 5) Primer4: 5'- CCCGAATTCCTACTTTAGGGAATAATTTATTGGCC -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. PBS- The 0349C07 plasmid was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of _P BS- 0349C07 plasmid, primer Primer-3 and Pr imer-4. J is lOpmol, Advantage polymerase Mix

(Ciontech product) 1 μ 1. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into colibacillus DH5CC by calcium chloride method.

After the LB plate (final concentration 30 g / ml) was cultured overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0349C07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (PET-0349C07) was at 37 in LB liquid medium containing kanamycin (final concentration 30 μ _§ / ιη1). C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue incubating for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation by ultrasonication. An affinity chromatography column His. Bind Quick Cartridge capable of binding to 6 histidines (6His-Tag) was used.

(Novagen) chromatography, to obtain the purified protein sodium pump β-subunit 10. After SDS-PAGE electrophoresis, a single band was obtained at 10 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the terminal were identical to the 15 amino acids at the N-terminal shown in SEQ ID NO: 2. Example 6 Production of β subunit 10 antibodies against sodium pump

 A peptide synthesizer (product of PE company) was used to synthesize the following sodium pump P-subunit 10-specific peptides:

NH ₂ -Met-Ser-Thr-Trp-G 1 y-Trp-G ly-Ar g-Va 1-Lys-Pr o-Thr-G ly-G ly-Hi s-COOH (SEQ ID NO: 7) .

The peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al. Immunochemistry, 1969; 6: 43 ₀ Immunologists with ½ g of the above hemocyanin polypeptide complex and complete Freund's adjuvant Rabbits, 15 days later, boosted with hemocyanin-polypeptide complex and incomplete Freund's adjuvant. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total _Ag G was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody could specifically bind to the beta subunit 10 of the sodium pump. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe is used to detect whether the expression of the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in cells of normal tissues or pathological tissues is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2. GC content is 30% -70%, if it exceeds, non-specific hybridization increases;

3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)

5'-GGTGGCCACCACGCACTGAGCTCTGGGCCTGAGCAGCAGTT-3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the gene fragment of SEQ ID NO: 1 or its Complementary Mutation Sequences for Complementary Fragments (41Nt):

 5 '-GGTATCGACCACGCACTGAATCGTGGGCCTATCGAGCAGTT-3' (SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used manuals of molecular cloning experiments such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Procedure: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 legs ol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) at 4. C Homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

2, phenol extraction method for DNA

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

3. Purification of DNA and ethanol precipitation

歩 猓: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to make The precipitate is completely dry, otherwise it is more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5 X 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-5. 14) Determine A _26Q and A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate WC for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPBX

 4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After the collection of the first peak is combined, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared.

Pre-hybridization Place the sample membrane in a plastic bag, add 3-10 mg of pre-hybridization solution (10xDenhardf s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C in a water bath for 2 hour.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 SDS, wash at 40 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 37. C wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (compression time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactivity of the above four probe hybrid spots; while the hybridization experiments performed under low-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than The radioactivity of the other three probe hybridization spots. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 8 DNA Microarray

Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . Its specific method Steps have been reported in the literature in various ways. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μηι. The spotted slide was hydrated, dried, and cross-linked in a purple diplomatic apparatus. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

5. 95 ^Q C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 C in the dark for future use.

 (2) Probe marking

 Total mR was extracted from normal liver and liver cancer in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5- Amino- propargyl-2'-deoxyuridine 5 '-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled liver tissue mRNA, Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5--tr iphate coupled to Cy5 fluorescent dye, (Purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see

Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dar i., Davis, RW (1995) Science. 270. (20): 467-480.

(Three) cross

The probes from the two types of tissues and the chips were respectively hybridized in a UniHyb ™ Hybridization Suiiuion (purchased from TeleCliem) hybridization solution for 16 hours. The washing solution (1 < SSC, 0.2% SDS) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are analyzed and processed with Imagene software (Biodi scovery, USA) to calculate the Cy3 of each point. / Cy5 ratio, the points whose ratio is less than 0.5 or greater than 2 are considered to be genes with differential expression.

The experimental results show that Cy3 signa l = 8904. 28 (average of four experiments), Cy5s igna l = 6518. 99 (average of four experiments), Cy3 / Cy5 = l. 36589871, the present invention There was no significant difference in the expression of polynucleotides in the above two tissues. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Sodium pumps are found in the plasma membrane of all animal cells. The sodium pump controls the ion gradient, osmotic balance, and membrane potential of the cell by adjusting the ion concentration on both sides of the plasma membrane (sodium ions are transferred out, potassium ions are transferred and accompanied by the hydrolysis of ATP). Sodium pump consists of alpha and beta subunits. The β subunit plays an important regulatory role in the process of sodium pump synthesis and transport to the plasma membrane surface.

 It can be seen that the abnormal expression of the β subunit 10 of the sodium pump of the present invention will directly lead to the abnormality of the structure and function of the sodium pump, and further cause the abnormality of the cell's ion gradient, osmotic balance, and membrane potential, thereby causing various diseases. In particular, disorders of water and electrolyte metabolism, arrhythmia caused by abnormalities of potassium ions in and out of cells, and nerve conduction disorders caused by abnormal cell membrane potentials, etc. These diseases include, but are not limited to:

 Disorders of water and electrolyte metabolism: hyperkalemia, hypokalemia, metabolic acidosis, metabolic alkalosis

 Arrhythmias: sinus tachycardia, sinus bradycardia, sinus arrest, sinus atrial block, SSS, atrial premature beat, atrial tachycardia, atrial flutter, atrial fibrillation, atrioventricular junction premature beat Atrioventricular junction escape and rhythm, Non-paroxysmal atrioventricular junction tachycardia, Paroxysmal supraventricular tachycardia, WW syndrome, Ventricular premature beat, Ventricular tachycardia, Ventricular flutter, Ventricle Tremor, atrioventricular block

Nerve conduction disorders caused by abnormal cell membrane potentials: muscular hypertrophy, Duchenne muscular dystrophy, tonic muscular dystrophy, myasthenia, bradykinesia, dystonia, ataxia capillary dilatation, Alzheimer's disease, Par Kingson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis, mental retardation. The study found that the stomach proton pump (K +, H + ATPase) also contains two subunits, and its β subunit is very similar to the β subunit of the sodium pump. It can be seen that the abnormal expression of the P subunit 10 of the sodium pump of the present invention will also cause acidic dysfunction of the proton pump of the stomach, thereby causing various gastric diseases, including but not limited to: reflux esophagitis, esophageal cancer Gastritis (acute gastritis, chronic gastritis, other special gastritis such as acute corrosive gastritis, acute purulent gastritis, giant hypertrophic gastritis), peptic ulcer, gastric cancer, intestinal tuberculosis, CROHN disease, ulcerative colitis, colorectal cancer, Gastrointestinal disorders (hysteria, psychovomiting, belching, anorexia nervosa, irritable bowel syndrome). The abnormal expression of the P subunit 10 of the sodium pump of the present invention will also produce certain hereditary, hematological and immune system diseases.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially water and electrolyte metabolism disorders, arrhythmia caused by potassium ion in and out of cells, and abnormal cell membrane potential. Nerve conduction disorders, various gastric diseases, certain hereditary, blood diseases and immune system diseases. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the P subunit 10 of the sodium pump. Agonists increase the beta subunit 10 of the sodium pump to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, a mammalian cell or a membrane preparation expressing the beta subunit 10 of a sodium pump can be cultured together with a labeled sodium pump beta subunit 10 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.

 Antagonists of the beta subunit 10 of the sodium pump include screened antibodies, compounds, receptor deletions, and the like. An antagonist of the beta subunit 10 of the sodium pump can bind to the beta subunit 10 of the sodium pump and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.

 When screening compounds as antagonists, the P subunit 10 of the sodium pump can be added to the bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between the sodium subunit 10 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to the P subunit 10 of the sodium pump can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the beta subunit 10 molecule of the sodium pump should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the P subunit 10 epitope of a sodium pump. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries Paragraph.

 Polyclonal antibodies can be produced by injecting β-subunit 10 of sodium pump directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to the beta subunit 10 of the sodium pump include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrie et al, PMS, 1985, 81: 6851). The existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against the β subunit 10 of the sodium pump.

 Antibodies to the beta subunit 10 of the sodium pump can be used in immunohistochemistry to detect beta subunit 10 of the sodium pump in biopsy specimens.

 Monoclonal antibodies that bind to the beta subunit 10 of the sodium pump can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, sodium pump β subunit 10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill the beta subunit of the sodium pump. cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to the beta subunit 10 of the sodium pump. Administration of an appropriate dose of antibody can stimulate or block the production or activity of the beta subunit 10 of the sodium pump.

 The invention also relates to a diagnostic test method for quantitatively and locally detecting the beta subunit 10 level of a sodium pump. These tests are well known in the art and include FI SH assays and radioimmunoassays. The beta subunit 10 level of the sodium pump tested in the test can be used to explain the importance of the sodium subunit 10 of the sodium pump in various diseases and to diagnose diseases in which the beta subunit 10 of the sodium pump functions.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding the beta subunit 10 of the sodium pump can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of the beta subunit 10 of the sodium pump. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated sodium pump (3 subunit 10) to inhibit the endogenous sodium pump β subunit 10 activity. For example, a mutated sodium pump The β subunit 1 0 may be a shortened P subunit 1 0 of a sodium pump lacking a signaling domain, although Can bind to downstream substrates but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of the P subunit 10 of the sodium pump. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the β-subunit 10 of the sodium pump into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a β-subunit 10 of a sodium pump can be found in existing literature (Sambrook, eta l.). In addition, a recombinant polynucleotide encoding the P subunit 10 of the sodium pump can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit the beta subunit 10 mRNA of sodium pumps are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding the beta subunit 10 of the sodium pump can be used for the diagnosis of diseases related to the beta subunit 10 of the sodium pump. Polynucleotides encoding the sodium pump (subunit 1 0) can be used to detect the expression of the β subunit 1 0 of the sodium pump or the abnormal expression of the β subunit 10 of the sodium pump in a disease state. The DNA sequence of P subunit 10 can be used to hybridize biopsy specimens to determine the expression status of sodium pump β subunit 10. Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, etc. These techniques and methods are all It is a publicly-proven technology, and related kits are available from commercial sources. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on micro arrays (Microaray) or DNA chips (also known as "gene chips"). ") For differential expression analysis and gene diagnosis of genes in tissues. The sodium pump's β subunit 10 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect sodium pump. The β subunit 1 0 is a transcription product.

Detecting mutations in the sodium pump subunit 10 gene can also be used to diagnose diseases related to the beta subunit 10 of the sodium pump. The beta subunit 1 0 mutant forms of sodium pump include the beta subunit of normal wild-type sodium pump 10 Point mutations, translocations, deletions, recombinations, and any other abnormalities compared to DNA sequences. Existing techniques such as Souter thern blotting, DNA sequence analysis, PCR, and in situ hybridization can be used to detect mutations. In addition, mutations are possible Effect protein Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition contains a safe and effective amount of the polypeptide or antagonist and does not affect Pharmaceutically effective carriers and excipients. These compositions can be used as drugs for the treatment of diseases. The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. The sodium subunit 10 of the sodium pump is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of beta subunit 10 of the sodium pump administered to the patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-sodium pump P subunit 10, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, wherein the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID N (2).

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) a polynucleotide that is at least 70% identical to) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 145-417 in SEQ ID NO: 1 or the sequence of positions 1-1070 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having β-subunit 10 activity of a sodium pump, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition that the β-subunit 10 of the sodium pump is expressed;

(b) Isolating a polypeptide having beta subunit 10 activity of a sodium pump from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to the beta subunit 10 of a sodium pump.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of the beta subunit 10 of the sodium pump.

12. The compound according to claim 11, characterized in that it is a polynucleoside represented by SEQ ID NO: 1 Antisense sequences of acid sequences or fragments thereof.

 13. An application of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of the beta subunit 10 of the sodium pump in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of beta subunit 10 of the sodium pump; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with an abnormality of the P subunit 10 of the sodium pump.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.