WO2001038526A1 - Récepteur de tnf humain - Google Patents

Récepteur de tnf humain Download PDF

Info

Publication number
WO2001038526A1
WO2001038526A1 PCT/GB2000/004438 GB0004438W WO0138526A1 WO 2001038526 A1 WO2001038526 A1 WO 2001038526A1 GB 0004438 W GB0004438 W GB 0004438W WO 0138526 A1 WO0138526 A1 WO 0138526A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
polypeptide
nfkb
disorder
activity
Prior art date
Application number
PCT/GB2000/004438
Other languages
English (en)
Inventor
Jeremy David Alistair Kitson
Original Assignee
Glaxo Group Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Glaxo Group Limited filed Critical Glaxo Group Limited
Priority to AU15319/01A priority Critical patent/AU1531901A/en
Publication of WO2001038526A1 publication Critical patent/WO2001038526A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70575—NGF/TNF-superfamily, e.g. CD70, CD95L, CD153 or CD154

Definitions

  • the present invention relates to a novel TNF receptor or a variant thereof.
  • a variant may demonstrate TNF receptor activity such as activatation of NFKB, or may inhibit TNF receptor activity.
  • the TNF receptors are a family of type 1 membrane proteins defined on the basis of homology in the extra cellular domain. This homology consists of a cysteine-rich domain (CRD). There are 2-6 copies of this motif in the different members of the TNF receptor family which have been identified. The repeats are not identical. Within each repeat, there are six cysteine residues forming three di- sulphide bonds. This gives each repeat a ladder-like structure which forms a sheath around the ligand. The ligands that have been identified are trimers. Binding of the ligand trimer causes receptor trimerisation and recruitment of intracellular signalling molecules to the receptor. The intracellular domains of the TNF receptors do not possess enzymatic activity.
  • TNF receptors namely TNF Rl, FAS, Wsl-1, Trail R1/R2 and DR6 each contain a death domain in the intracellular region.
  • the intracellular domain of each TNF receptor varies significantly in size.
  • the majority of ligands belong to the TNF ligand super family. This is a family of related type 2 transmembrane proteins with a region of homology in the extra cellular receptor binding domain.
  • TNF receptors mediate a wide range of biological activities at the cellular level including apoptosis, proliferation, differentiation, survival and activation of inflammatory response genes.
  • TNFR are involved in the development and maintenance of the immune response, development of the secondary lymphoid organs, bone remodelling, protection against infection and inflammation.
  • the TNF family receptors have been implicated in a number of diseases including rheumatoid arthritis, cancer, inflammatory bowel disease, septic shock and auto immune disorders.
  • TNF receptor is now provided which is a screening target for the identification and development of novel pharmaceutical agents which modulate the activity of the receptor and in particular modulate activation of NFKB by the receptor.
  • agents may be used in the treatment and/or prophylaxis of inflammatory diseases and in particular lung, heart, pancreas, colon, lung and lymphoid disorders including asthma, COPD, diabetes, inflammation associated with bacterial or viral infection, nephritis and heart disease and rheumatoid arthritis.
  • the present invention provides an isolated TNF-receptor polypeptide which comprises:
  • a variant has at least 80% identity to the amino acid sequence of SEQ ED NO: 2.
  • the variant is expressed in cells involved in inflammatory responses such as those associated with asthma or rheumatoid arthritis.
  • the invention also provides a polynucleotide encoding a polypeptide of the invention.
  • Such a nucleotide may be a polynucleotide which encodes a TNF receptor polypeptide which is capable of activating NFKB, which polynucleotide comprises:
  • an expression vector capable of expressing a polypeptide of the invention comprising a polynucleotide as defined above.
  • a host cell comprising an expression vector of the invention, an antibody specific for a polypeptide of the invention, a method for identification of a compound that modulates TNF receptor activity, comprising contacting a polypeptide of the invention with a test compound and monitoring NFKB mediated activity.
  • a polypeptide comprises a fragment or variant of SEQ ID No 2 which is capable of inhibiting the activity of R248, for use in the treatment of an immune or inflammatory disorder or a smooth muscle cell disorder.
  • Figure 1 is an annotated version of the sequence of R248.
  • Figure 2 is a plot of activation of NFKB by receptor R248 measured by secreted placental alkaline phosphatase (SPAP).
  • SPAP secreted placental alkaline phosphatase
  • SEQ ID No: 1 is the DNA and amino acid sequence of human protein R248 and its encoding DNA.
  • SEQ ID No: 2 is the amino acid sequence alone of R248.
  • the present invention relates to a human TNF receptor, referred to herein as R248, and variants or fragments thereof.
  • Sequence information for R248 is provided in SEQ ID NO: 1 (nucleotide and amino acid) and in SEQ ID NO: 2.
  • a polypeptide of the invention consists essentially of the amino acid sequence of SEQ ID NO: 2 or of a functional variant of that sequence.
  • the polypeptides are provided in isolated form.
  • isolated is intended to convey that the polypeptide is not in its native state, insofar as it has been purified at least to some extent or has been synthetically produced, for example by recombinant methods.
  • the polypeptide may be mixed with carriers or diluents which will not interfere with the intended purpose of the polypeptide and still be regarded as substantially isolated.
  • isolated therefore includes the possibility of the polypeptide being in combination with other biological or non- biological material, such as cells, suspensions of cells or cell fragments, proteins, peptides, expression vectors, organic or inorganic solvents, or other materials where appropriate, but excludes the situation where the polypeptide is in a state as found in nature.
  • a polypeptide of the invention may also be in a substantially purified form, in which case it will generally comprise the polypeptide in a preparation in which more than 50%, e.g. more than 80%, 90%, 95% or 99%, by weight of the polypeptide in the preparation is a polypeptide of the invention.
  • Routine methods can be employed to purify and/or synthesise the proteins according to the invention. Such methods are well understood by persons skilled in the art, and include techniques such as those disclosed in Sambrook et al, Molecular Cloning: a Laboratory Manual, 2 n Edition, CSH Laboratory Press (1989), the disclosure of which is included herein in its entirety by way of reference.
  • variants refers to polypeptides which have the same essential character or basic biological functionality as R248.
  • the essential character of R248 can be defined as that of a TNF receptor. In particular, it refers to a polypeptide which activates NFKB.
  • a variant of the polypeptide of the invention is one which exhibits binding to the same ligand as R248. Such ligand binding may be assayed using the assays described below.
  • a variant is one which does not show the same function as R248 but which may be used to inhibit this function.
  • a variant polypeptide for use in an assay or therapy is one which inhibits R248 activation of NFKB, for example by inhibiting ligand binding or receptor complex formation by R248.
  • a variant may be one which inhibits ligand binding to R248.
  • the ability to activate NFKB can be determined by monitoring the effect of a substance under test on NFKB activation mediated through binding the polypeptide.
  • This can be carried out, for example, by cotransfection of a construct expressing the polypeptide with a construct containing a reporter gene, such as secreted placental alkaline phosphatase, under the control of the NFKB promoter and monitoring for expression of the reporter gene.
  • a reporter gene such as secreted placental alkaline phosphatase
  • the functionality is as a peptide which binds a ligand of R248, inhibits NFKB activation by R248 or inhibits ligand binding to R248 and can be determined by an assay as described below.
  • a polypeptide will maintain a cysteine-rich region containing at least two cysteine rich repeats. Within each repeat there are six cysteine residues which form three di-sulphide bonds.
  • a polypeptide according to the invention does not contain a death domain.
  • polypeptides with more than about 65% identity, preferably at least 80% or at least 90% and particularly preferably at least 95%, at least 97%, or at least 99% identity, with the amino acid sequences of SEQ ID NO: 2 over a region of at least 20, preferably at least 30, at least 40, at least 60 or at least 100 contiguous amino acids or over the full length of SEQ ID NO: 2, are considered as variants of the proteins.
  • Identity is calculated using the widely used GCG (University of Wisconsin) suite of programs and preferably using the distances software (correction method).
  • Such variants may include allelic variants and the deletion, modification or addition of single amino acids or groups of amino acids within the protein sequence, as long as the peptide maintains the basic biological functionally of the TNF receptor, having a similar function to R248 or inhibits such function such as preventing ligand binding or R248 mediated activation.
  • Amino acid substitutions may be made, for example from 1, 2 or 3 to 10, 20 or 30 substitutions.
  • the modified polypeptide generally retains activity as an R248 receptor or inhibitor of R248 receptor activity.
  • Conservative substitutions may be made, for example according to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other.
  • Shorter polypeptide sequences are within the scope of the invention.
  • a peptide of at least 20 amino acids or up to 50, 60, 70, 80, 100 or 150 amino acids in length is considered to fall within the scope of the invention as long as it demonstrates the basic biological functionality of R248 or inhibits R248.
  • the peptide may also comprise an epitope of R248 for generation of antibodies.
  • this aspect of the invention encompasses the situation when the protein is a fragment of the complete protein sequence and may represent a ligand-binding region (N- terminal extracellular domain) or an effector binding region (C-terminal intracellular domain).
  • Fragments from which the C-terminus has been removed may be used as decoy receptors.
  • Other fragments such as a secreted or soluble form of the receptor or a receptor Fc fusion protein may be generated for use in the assay or in therapy in accordance with the invention.
  • the extracellular domain comprising residues 1-168 may be used or provided as an in frame fusion with the Fc receptor of IgG for use in therapy or gene therapy.
  • Such fragments can also be used to raise anti-R248 antibodies.
  • Polypeptides of the invention may be chemically modified, e.g. post- transitionally modified. For example, they may be glycosylated or comprise modified amino acid residues.
  • polypeptides may also be modified by the addition of histidine residues or for example using a HA, his 8, his 6, T7, myc or flag tag to assist their purification or detection. They may be modified by the addition of a signal sequence to promote insertion into the cell membrane. Such modified polypeptides fall within the scope of the term "polypeptide" of the invention.
  • R248 has been found to be primarily expressed in the lung, heart, lymph nodes and pancreas.
  • the receptor is found in particular in smooth muscle cell lines of lung and cardiovascular origin, synoviocyte cultures from patients with rheumatoid arthritis, and activated cells of haematopoietic lineage infiltrating the lung in a mouse asthma model.
  • the receptor is found in particular in embryonic cell lines and may therefore play a role in proliferation or differentiation in these tissues.
  • the invention also includes nucleotide sequences that encode for R248 or variants thereof as well as nucleotide sequences which are complementary thereto.
  • the nucleotide sequence may be RNA or DNA including genomic DNA, synthetic DNA or cDNA.
  • the nucleotide sequence is a DNA sequence and most preferably, a cDNA sequence.
  • Nucleotide sequence information is provided in SEQ ED NO: 1.
  • Such nucleotides can be isolated from human cells or synthesised according to methods well known in the art, as described by way of example in Sambrook et al. Such nucleotides can typically be isolated from activated cells of the immune system, heart, lung, pancreatic islet cells and lymph nodes.
  • a polynucleotide of the invention comprises a contiguous sequence of nucleotides which is capable of hybridising under selective conditions to the coding sequence or the complement of the coding sequence of SEQ ID NO: 1.
  • a polynucleotide of the invention can hydridize to the coding sequence or the complement of the coding sequence of SEQ LD NO: 1 at a level significantly above background. Background hybridisation may occur, for example, because of other cDNAs present in a cDNA library.
  • the signal level generated by the interaction between a polynucleotide of the invention and the coding sequence or complement of the coding sequence of SEQ ID NO: 1 is typically at least 10 fold, preferably at least 100 fold, as intense as interactions between other polynucleotides and the coding sequence of SEQ ID NO: 1.
  • the intensity of interaction may be measured, for example, by radio labelling the probe, e.g. with 32 P.
  • Selective hybridisation may typically be achieved using conditions of low stringency (0.03M sodium chloride and 0.03M sodium citrate at about 40°C), medium stringency (for example, 0.03M sodium chloride and 0.03M sodium citrate at about 50°C) or high stringency (for example, 0.03M sodium chloride and 0.03M sodium citrate at about 60°C).
  • the coding sequence of SEQ ID No: 1 may be modified by nucleotide substitutions, for example from 1, 2 or 3 to 10, 25, 50 or 100 substitutions.
  • the polynucleotide of SEQ ID NO: 1 may alternatively or additionally be modified by one or more insertions and/or deletions and/or by an extension at either or both ends.
  • the modified polynucleotide generally encodes a polypeptide which has TNF receptor activity or inhibits the activity of R248. Degenerate substitutions may be made and/or substitutions may be made which would result in a conservative amino acid substitution when the modified sequence is translated, for example as shown in the Table above.
  • a nucleotide sequence which is capable of selectively hybridising to the complement of the DNA coding sequence of SEQ ID NO: 1 will generally have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the coding sequence of SEQ ID NO: 1 over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, more preferably at least 100 contiguous nucleotides or most preferably over the full length of SEQ ID NO: 1.
  • Methods of measuring nucleic acid and protein homology are well known in the art. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology (Devereux et al 1984). Similarly the PILEUP and BLAST algorithms can be used to line up sequences (for example are described in Altschul 1993, and Altschul et al 1990). Many different settings are possible for such programs. In accordance with the invention, the default settings may be used.
  • polynucleotides of the invention Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define polynucleotides of the invention, with the more stringent combinations (i.e. higher sequence identity over longer lengths) being preferred.
  • a polynucleotide which has at least 90% sequence identity over 25, preferably over 30 nucleotides forms one aspect of the invention, as does a polynucleotide which has at least 95% sequence identity over 40 nucleotides.
  • the nucleotides according to the invention have utility in production of the proteins according to the invention, which may take place in vitro, in vivo or ex vivo.
  • the nucleotides may be involved in recombinant protein synthesis or indeed as therapeutic agents in their own right, utilised in gene therapy techniques.
  • Nucleotides complementary to those encoding R248, or antisense sequences may also be used in gene therapy, such as in strategies for down regulation of expression of the proteins of the invention.
  • Polynucleotides of the invention may be used as a primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors.
  • primers, probes and other fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length. Probes and fragments can be longer than 150 nucleotides in length, for example up to 200, 300, 400, 500 nucleotides in length, or even up to a few nucleotides, such as five or ten nucleotides, short of the coding sequence of SEQ ID NO: l.
  • the present invention also includes expression vectors that comprise nucleotide sequences encoding the proteins or variants thereof of the invention.
  • expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals which may be necessary, and which are positioned in the correct orientation, in order to allow for protein expression.
  • Other suitable vectors would be apparent to a person skilled in the art.
  • Polynucleotides according to the invention may also be inserted into the vectors described above in an antisense orientation in order to provide for the production of antisense RNA.
  • Antisense RNA or other antisense polynucleotides may also be produced by synthetic means. Such antisense polynucleotides may be used as test compounds in the assays of the invention or may be useful in a method of treatment of the human or animal body by therapy.
  • a polynucleotide of the invention or for use in the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector.
  • the term "operably linked” refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
  • a regulatory sequence, such as a promoter, "operably linked" to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequence.
  • the vectors may be for example, plasmid, virus or phage vectors provided with a origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter.
  • the vectors may contain one or more selectable marker genes, for example an ampicillin resistence gene in the case of a bacterial plasmid or a resistance gene for a fungal vector.
  • Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell, for example, a mammalian host cell.
  • the vectors may also be adapted to be used in vivo, for example in a method of gene therapy.
  • Promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed.
  • yeast promoters include S. cerevisiae GAL4 and ADH promoters, S. pombe nmtl and adh promoter.
  • Mammalian promoters include the metallothionein promoter which can be induced in response to heavy metals such as cadmium.
  • Viral promoters such as the SV40 large T antigen promoter or adenovirus promoters may also be used. All these promoters are readily available in the art.
  • Mammalian promoters such as ⁇ -actin promoters
  • Tissue- specific promoters in particular endothelial or neuronal cell specific promoters (for example the DDAHI and DDAHII promoters)
  • DDAHI and DDAHII promoters are especially preferred.
  • Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the SV40 promoter, the human cytomegalovirus (CMV) IE promoter, adenovirus, HSV promoters (such as the HSV IE promoters), or HPV promoters, particularly the HPV upstream regulatory region (URR).
  • MMLV LTR Moloney murine leukaemia virus long terminal repeat
  • RSV rous sarcoma virus
  • CMV human cytomegalovirus
  • HSV promoters such as the HSV IE promoters
  • the vector may further include sequences flanking the polynucleotide which comprise sequences homologous to eukaryotic genomic sequences, preferably mammalian genomic sequences, or viral genomic sequences. This will allow the introduction of the polynucleotides of the invention into the genome of eukaryotic cells or viruses by homologous recombination.
  • a plasmid vector comprising the expression cassette flanked by viral sequences can be used to prepare a viral vector suitable for delivering the polynucleotides of the invention to a mammalian cell.
  • Suitable viral vectors include herpes simplex viral vectors (for example as disclosed in WO 98/04726 and WO 98/30707) and retroviruses, including lentiviruses, adenoviruses, adeno-associated viruses and HPV viruses (such as HPV-16 or HPV-18). Gene transfer techniques using these viruses are known to those skilled in the art. Retrovirus vectors for example may be used to stably integrate the polynucleotide giving rise to the antisense RNA into the host genome. Replication-defective adenovirus vectors by contrast remain episomal and therefore allow transient expression.
  • the invention also includes cells that have been modified to express the R248 polypeptide or a variant thereof.
  • Such cells include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect cells, lower eukaryotic cells, such as yeast or prokaryotic cells such as bacterial cells.
  • Particular examples of cells which may be modified by insertion of vectors encoding for a polypeptide according to the invention include mammalian HEK293T, CHO, HeLa and COS cells.
  • the cell line selected will be one which is not only stable, but also allows for mature glycosylation and cell surface expression of a polypeptide.
  • Cells such as T-cells expressing the receptor may be used for example in screening.
  • a polypeptide of the invention may be expressed in cells of a transgenic non-human animal, preferably a mouse.
  • a transgenic non-human animal expressing a polypeptide of the invention is included within the scope of the invention.
  • proteins of the invention can be transiently expressed in a cell line or on a membrane, such as for example in a baculovirus expression system.
  • a cell line or on a membrane such as for example in a baculovirus expression system.
  • Such systems which are adapted to express the proteins according to the invention, are also included within the scope of the present invention.
  • the present invention also relates to antibodies (either polyclonal or preferably monoclonal antibodies, chimeric, single chain, Fab fragments) which have been raised by standard techniques and are specific for a polypeptide of the invention.
  • antibodies could for example, be useful in purification, isolation or screening methods involving immunoprecipitation techniques and may be used as tools to further elucidate the function of R248 or a variant thereof, or indeed as therapeutic agents in their own right.
  • Antibodies may also be raised against specific epitopes of the proteins according to the invention. Such antibodies may be used to block ligand binding to the receptor. Alternatively an antibody may be provided which acts as an agonist, to cross link receptors of the invention to mediate receptor activity.
  • An antibody, or other compounds "specifically binds" to a protein when it binds with high affinity to the protein for which it is specific but does not bind or binds with only low affinity to other proteins.
  • a variety of protocols for competitive binding or immunoradiometric assays to determine the specific binding capability of an antibody are well known in the art (see for example Maddox et al 1993). Such immunoassays typically involve the formation of complexes between the "specific protein" and its antibody and the measurement of complex formation.
  • polypeptides according to the invention in screening methods to identify compounds that may act as modulators of TNF receptor activity. Any suitable form may be used for the assay to identify a modulator of R248 activity. In general terms, such screening methods may involve contacting a polypeptide of the invention with a test compound and then measuring receptor activity.
  • Screening methods may alternatively involve contacting a polypeptide of the invention with a test compound and then monitoring for the effect on NFKB activation.
  • the binding of the substance to a polypeptide in the invention can be determined directly.
  • a radio labelled test substance can be incubated with a polypeptide of the invention and so that binding of the test substance to the polypeptide can be monitored.
  • the radio labelled test substance can be incubated with cell membranes containing the polypeptide until equilibrium is reached. The membranes can then be separated from a non-bound test substance and dissolved in scintillation fluid to allow the radioactive content to be determined by scintillation counting.
  • Non-specific binding of the test substance may also be determined by repeating the experiments in the presence of a saturating concentration of a non-radio active ligand. Preferably, a binding curve is constructed by repeating the experiment with various concentrations of the test substance.
  • Cell based assays may also be carried out, for example using a cell expressing the R248 receptor, and contacting the cell with another cell to look for ligand binding or activation of R248- mediated pathways such as NFKB activation. Additional test substance may be introduced to look for inhibitors of ligand binding or inhibitors of R248-mediated activity. Assays are preferably carried out using cells expressing R248, and incubating such cells with the R248 ligand and a test substance. Alternatively an antibody may be used to complex R248 and thus mediate R248-activity. Test substances may then be added to assess the effect on such activity.
  • a host cell expressing the receptor and containing an NFKB responsive reporter construct.
  • the host cell is treated with a substance under test for a defined time.
  • the expression of the reporter gene such as SP alkaline phosphatase or luciferase is assayed.
  • the assay enables determination of whether the addition of compounds inhibits the induction of the response in target cells.
  • Assays may also be carried out to identify modulators of receptor shedding.
  • a polypeptide of the invention can be cleaved from the cell surface. Shedding the receptor would act to down regulate receptor signalling.
  • cell based assays may be used to screen for compounds which promote or inhibit receptor-shedding.
  • Assays may also be carried out to identify substances which modify R248 receptor expression for example substances which down regulate expression. Such assays may be carried out for example by using antibodies for R248 to monitor levels of R248 expression. Additional control experiments may be carried out. Assays may also be carried out using known ligands of other TNF receptors to identify ligands which are specific for polypeptides of the invention. Preferably, the assays of the invention are carried out under conditions which would result in NFKB mediated activity in the absence of the test substance, to identify inhibitors of TNF receptor mediated activity, or agents which inhibit ligand -induced TNF receptor activity.
  • test substances which can be tested in the above assays include combinatorial libraries, defined chemical entities, peptide and peptide mimetics, oligonucleotides and natural product libraries, such as display (e.g. phage display libraries) and antibody products.
  • the test substance is a variant peptide of the invention.
  • the assay is carried out using full length R248 to identify a variant peptide which interferes with R248 mediated activity for example by inhibiting ligand binding.
  • a fusion protein may be provided such as a variant peptide coupled to an Fc receptor which affects R248 mediated activity.
  • Test substances may be used in an initial screen of, for example, 10 substances per reaction, and the substances of these batches which show inhibition or activation tested individually.
  • Test substances may be used at a concentration of from InM to lOOO ⁇ M, preferably from l ⁇ M to lOO ⁇ M, more preferably from I ⁇ M to lO ⁇ M.
  • Another aspect of the present invention is the use of polynucleotides encoding the R248 polypeptides of the invention to identify mutations in R248 genes which may be implicated in human disorders or to identify cells in which R248 is expressed. Identification of such mutations may be used to assist in diagnosis of immune system, lung, kidney, heart or other disorders or susceptibility to such disorders and in assessing the physiology of such disorders. In particular the polynucleotides of the invention may assist in diagnosis of asthma and rheumatoid arthritis. Another aspect of the present invention is the use of the compounds that have been identified by screening techniques referred to above in the treatment or prophylaxis of disorders which are responsive to regulation of R248 receptor activity.
  • variant peptides of the invention which inhibit R248 - mediated activity may be used in the treatment or prophylaxis of such disorders.
  • Antibodies which recognise R248 may similarly be used in therapy.
  • such compounds may be used in the treatment of renal, lung, heart, cardiovascular, immune system and pancreatic disorders.
  • the compound may be used to modulate inflammatory responses involving these tissues, and in particular the inflammatory responses seen in asthma and rheumatoid arthritis.
  • Conditions involving smooth muscle cell proliferation and differentiation or inflammation such as in heart disease and pancreatic islet cells leading to diabetes may be treated by agents which modulate the R248 receptor.
  • Conditions which may be treatable include asthma, rheumatoid arthritis, COPD, diabetes, inflammation associated with bacterial or viral infection, nephritis and heart disease. Additionally such compounds may be used to inhibit tumour growth or survival.
  • the compounds identified according to the screening methods outlined above may be formulated with standard pharmaceutically acceptable carriers and/or excipients as is routine in the pharmaceutical art, and as fully described in Remmington's Pharmaceutical Sciences, Mack Publishing Company, Eastern Pennsylvania 17 th Ed. 1985, the disclosure of which is included herein of its entirety by way of reference.
  • the compounds may be administered by enteral or parenteral routes such as via oral, buccal, anal, pulmonary, intravenous, intra-arterial, intramuscular, intraperitoneal, topical or other appropriate administration routes.
  • Nucleic acid encoding an inhibitor of R248 activity may be administered to the mammal.
  • Nucleic acid such as RNA or DNA, and preferably, DNA, is provided in the form of a vector, such as the polynucleotides described above, which may be expressed in the cells of the mammal.
  • Nucleic acid encoding the peptide may be administered to the animal by any available technique.
  • the nucleic acid may be introduced by injection, preferably intradermally, subcutaneously or intramuscularly.
  • the nucleic acid may be delivered directly across the skin using a nucleic acid delivery device such as particle-mediated gene delivery.
  • the nucleic acid may be administered topically to the skin, or to the mucosal surfaces for example by intranasal, oral, intravaginal, intrarectal administration. Uptake of nucleic acid constructs may be enhanced by several known transfection techniques, for example those including the use of transfection agents.
  • nucleic acid to be administered can be altered.
  • nucleic acid is administered in the range of lpg to lmg, preferably to lpg to lO ⁇ g nucleic acid for particle mediated gene delivery and lO ⁇ g to lmg for other routes.
  • lpg to lmg preferably to lpg to lO ⁇ g nucleic acid for particle mediated gene delivery and lO ⁇ g to lmg for other routes.
  • RACE PCR was performed using the Gibco BRL 5' RACE PCR system. Human Aortic smooth muscle cell total RNA was prepared using the Qiagen RNeasy kit. Reverse transcription was primed using a R248 specific primer (248RA,
  • the Incyte clone 2480076 was digested with the restriction endonucleases Hinc II and Not 1 to release a 2.4 KB fragment.
  • a fragment containing the extracellular domain of the gene was generated by Hind III/Hinc II digestion of a pCR3.1 vector containing the extracellular region. Both fragments were then ligated into the pCR3.1 vector which had been digested with Hind III (5') and Not I (3'), to generate a construct which expressed the complete open reading frame under the control of the CMV promoter.
  • the extracellular domain of receptor R248 was amplified by RT-PCR using primers 248-FCH (ATAAGCTTCACAGGTAGCTGGGAAGAACTCTC) and 248- FCX (AATCTAGACGTGTCCCGT GGGCTGGAGGCCGTGGA) and cloned into the pCR3.1 vector (Invitrogen).
  • the extracellular domain was subcloned into the pE12Fc7 vector by digestion with the restriction endonucleases Hind III and Xba I.
  • the resulting construct allows expression of residues 1-168 of receptor R248 fused in frame to the Fc region of human IgG.
  • a fragment covering residues 1-167 was amplified by PCR using the full length clone as a template and the primers 248FCH
  • telomere sequence ATAAGCTTCACAGGTAGCTGGGAAGAACTCTC
  • 248CFB TGGATCCGATCTTCACGAGGTTGACCTTG.
  • the PCR product was cloned into the pCR3.1 vector (Invitrogen) and then subcloned into the pFLAG-CMV5a vector (Sigma) by restriction enzyme digestion using Hind III and Bam HI.
  • the resulting plasmid (pFLAG-CMV5a-248) contains the extracellular domain of receptor 248 with an in frame C-terminal FLAG epitope, this protein is expressed under the control of the CMV promotor.
  • FIG. 1 shows the amino acid and nucleotide sequences of receptor R248 in SEQ ID NO: 1 and 2.
  • Figure 1 shows the predicted signal sequence in bold, residues 1-25.
  • the putative transmembrane region is underlined 169-192.
  • the positions of the cysteine rich regions (CRD) are indicated.
  • the position of the N-linked glycosylation site is marked * (residue 105).
  • the predicted ligand binding site is within residues 34-146.
  • Residues 1-168 are extracellular and residues 193-417 are intracellular.
  • Example 2 Identification of expression pattern cDNA coding for the extracellular region (amino acid residues 1-168) of human 248 was excised from pCR3.1 vector with the restriction enzymes Hind III and Xba 1. A 32 P dCTP labelled probe was generated from this cDNA fragment using the Amersham ready-prime system according to the manufacturers protocol. A 5 ⁇ l aliquot of this mixture was mixed with 5 ml of Expresshyb solution (Clontech 8015-1) and the resulting mixture was incubated with a clontech human multiple tissue northern blot (MTN 1, #7760) or clontech Human RNA master blot (#7770-1) overnight at 65°C with constant shaking.
  • the probe solution was then removed and the blot was washed three times with 2X SSC (saline sodium citrate)/ 0.05% SDS at room temperature for 20 minutes. This was followed by two 15 minute washes at 50°C with 0.1%) SSC/0.1% SDS.
  • the blot was then exposed to Kodak XAR-5 film at -70°C.
  • lxl 0 6 cells were harvested and total RNA extracted using the RNeasy kit (Qiagen) according to the manufacturer's procedures.
  • Receptor 248 was amplified using the Promega Access RT-PCR system, according to the manufacturer's protocol with the addition of an initial annealing step (70°C for 5 minutes).
  • the primers used for the RT-PCR were 248 RT1 (positive sense 5' primer
  • HEK293T cells were transfected with pE12Fc7-248 using the transfection reagent Effectene (Qiagen).
  • Culture medium containing the secreted fusion protein
  • fractions 0.5 ml were eluted with 0.1M citrate buffer (pH 2.5) and neutralised with IM Tris (pH 8). Fractions were analysed by western blot, using an antibody against the Fc portion of the fusion protein. Fractions containing 248-Fc Fusion protein with dialysed against PBS before use.
  • HEK293T cells were transfected with pFLAG-CMV5a-248 using the transfection reagent Effectene (Qiagen).
  • Culture medium containing the secreted FLAG tagged protein
  • M2 anti-FLAG agarose column Sigma
  • NFKB activation was determined by co-transfection of a construct expressing the full length receptor with a construct containing the secreted placental alkaline phosphatase SPAP under the control of the NFKB promoter into Hela or HEK293 cell lines. Culture supernatant was heated at 65°C to inactivate endogenous alkaline phosphatase. 200 ⁇ g of p-nitrophenyl phosphate (Sigma) in lOO ⁇ l of DEA buffer were added to 30 ⁇ l of sample and incubated at 37°C. Colour change was measured at 405nm after incubation periods of 1 and 2 hours. The results are shown in Figure 2. R248 induces approximately a 5 fold activation of NFKB compared to background activation (SPAP alone). Results shown from 3 assays of 2 separate transfection experiments.
  • the ability of the receptor to activate NF-kB suggests that the receptor plays either a role in inflammatory cytokine production and or the prolonged survival of activated T or B cells, thereby contributing to the chronic inflammation, and supporting a role for this receptor in chronic inflammatory diseases, such as, for example, rheumatoid arthritis and asthma.
  • Example 5 In situ Hybridisation cDNA encoding the extracellular domain of Human or Murine R248 was cloned into the pSPT18/19 vector (Roche). Digoxigenin (DIG) labelled sense and anti-sense ribo-probes were generated using the Roche DIG RNA labelling kit according to the manufacture's protocol. The human R248 ribo-probe was used for in situ hybridisation on tissue sections from the knee of a rheumatoid arthritis patient and as a control an osteoarthritis patient sample. The probe generated against the murine R248 was used for in situ hybridisation against a day 17.5 whole mouse embryo section and test and control sections from a mouse asthma model system.
  • DIG Digoxigenin
  • In situ hybridisation was performed using the following procedure: Sample was prepared by proteinase K digestion (5ng/ml) for 17 minutes at 37°C. The samples were hybridisation over night with the ribo-probe at 50° C. R248 expression was detected with anti-digoxigenin conjugated to alkaline phosphatase for 2 hours, followed by chromagen development using NBT/BCiP/iNT for 30 minutes.
  • R248 was expressed at high levels in cells in the pannus of the rheumatoid arthritis joint, these cells were predominantly lymphocytes but expression was also observed in macrophages. No expression was observed in the control oesteoarthritis section, in which there was little inflammation.
  • R248 mRNA was present in a number of different tissues in the day 17.5 mouse embryo. Expression was observed in epithelial cells in the liver, gut and in the epithelia lining of the blood vessels in the pancreas. Strong expression was seen in the chondrocytes in the vertebrae and ribs of the mouse embryo.
  • R248 was also expressed in the epithelium lining of the airways in normal lung tissue. In the samples from the asthma model R248 expression was observed in the cells which had infiltrated into the areas of inflammation. The cell types involved included lymphocytes and eosinophils.
  • R248 is expressed in activated lymphocytes but not in resting lymphocytes.
  • the expression of the receptor in chondrocytes indicates a role in bone metabolism, which is important in the bone destruction observed in rheumatoid arthritis, oesteoarthritis and steroid mediated bone erosion.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un polypeptide isolé de récepteur de TNF, qui comporte la séquence d'acides aminés SEQ ID NO: 2, une variante de celle-ci capable d'activer NFkB, ou un fragment du polypeptide ou de la variante capable d'activer NFkB. L'invention concerne également des polynucléotides codant pour ce récepteur de TNF. Un procédé d'identification d'une substance qui module l'activité du récepteur de TNF comporte les étapes consistant à mettre en contact un polypeptide de l'invention avec une substance d'essai en présence d'un rapporteur dont l'activité dépend de NFkB, et à surveiller l'activité dépendant de NFkB.
PCT/GB2000/004438 1999-11-23 2000-11-21 Récepteur de tnf humain WO2001038526A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU15319/01A AU1531901A (en) 1999-11-23 2000-11-21 Human tnf receptor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB9927681.8A GB9927681D0 (en) 1999-11-23 1999-11-23 Protein
GB9927681.8 1999-11-23

Publications (1)

Publication Number Publication Date
WO2001038526A1 true WO2001038526A1 (fr) 2001-05-31

Family

ID=10864996

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2000/004438 WO2001038526A1 (fr) 1999-11-23 2000-11-21 Récepteur de tnf humain

Country Status (3)

Country Link
AU (1) AU1531901A (fr)
GB (1) GB9927681D0 (fr)
WO (1) WO2001038526A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003013578A1 (fr) * 2001-08-07 2003-02-20 Genset S.A. Traitement des troubles metabolique au moyen d'agonistes et d'antagonistes d'omoxine
US7223852B2 (en) 1997-09-12 2007-05-29 Biogen Idec Ma Inc. Nucleic acids encoding TRAIN-R: a cysteine rich member of the TNF-receptor family
US7846438B2 (en) 2004-08-03 2010-12-07 Biogen Idec Ma Inc. Methods of promoting neurite outgrowth with soluble TAJ polypeptides
US8722615B2 (en) 2009-12-02 2014-05-13 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
US8883982B2 (en) 2011-06-08 2014-11-11 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006476A1 (fr) * 1992-09-15 1994-03-31 Immunex Corporation Procede de traitement de l'inflammation dependante du facteur necrosant des tumeurs malignes (tnf) a l'aide d'antagonistes dudit tnf
WO1999011791A2 (fr) * 1997-09-05 1999-03-11 University Of Washington Recepteurs et ligands de la famille du facteur de necrose tumorale, acides nucleiques codants et agents de liaison associes
WO1999013078A1 (fr) * 1997-09-12 1999-03-18 Biogen, Inc. Recepteurs 'train' riches en cysteine
WO2000049149A1 (fr) * 1999-02-19 2000-08-24 Toshio Kitamura Nouvelles proteines du type recepteurs des tnf

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006476A1 (fr) * 1992-09-15 1994-03-31 Immunex Corporation Procede de traitement de l'inflammation dependante du facteur necrosant des tumeurs malignes (tnf) a l'aide d'antagonistes dudit tnf
WO1999011791A2 (fr) * 1997-09-05 1999-03-11 University Of Washington Recepteurs et ligands de la famille du facteur de necrose tumorale, acides nucleiques codants et agents de liaison associes
WO1999013078A1 (fr) * 1997-09-12 1999-03-18 Biogen, Inc. Recepteurs 'train' riches en cysteine
WO2000049149A1 (fr) * 1999-02-19 2000-08-24 Toshio Kitamura Nouvelles proteines du type recepteurs des tnf

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE WPI Section Ch Week 200049, Derwent World Patents Index; Class B04, AN 2000-543756, XP002163652 *
GRUSS H-J: "Molecular, structural, and biological characteristics of the tumor necrosis factor ligand superfamily", INTERNATIONAL JOURNAL OF CLINICAL AND LABORATORY RESEARCH, vol. 26, no. 3, 1996, pages 143 - 159, XP002094504 *
KOJIMA T ET AL.: "TROY, a newly identified member of the tumor necrosis factor receptor superfamily, exhibits a homology with Edar and is expressed in embryonic skin and hair follicles.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 275, no. 27, 7 July 2000 (2000-07-07), pages 20742 - 20747, XP002163651 *
ORLINICK J R ET AL.: "TNF-related ligands and their receptors", CELLULAR SIGNALLING, vol. 10, no. 8, 1998, pages 543 - 551, XP000945103 *
SCALLON B J ET AL.: "Functional comparisons of different tumour necrosis factor receptor/IgG fusion proteins.", CYTOKINE, vol. 7, no. 8, November 1995 (1995-11-01), pages 759 - 770, XP000990674 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7223852B2 (en) 1997-09-12 2007-05-29 Biogen Idec Ma Inc. Nucleic acids encoding TRAIN-R: a cysteine rich member of the TNF-receptor family
US7838639B2 (en) 1997-09-12 2010-11-23 Biogen Idec Ma Inc. Antibodies to train R: a cysteine-rich member of the TNF-receptor family, and methods of treating tumors expressing said receptor
WO2003013578A1 (fr) * 2001-08-07 2003-02-20 Genset S.A. Traitement des troubles metabolique au moyen d'agonistes et d'antagonistes d'omoxine
US7846438B2 (en) 2004-08-03 2010-12-07 Biogen Idec Ma Inc. Methods of promoting neurite outgrowth with soluble TAJ polypeptides
US8722615B2 (en) 2009-12-02 2014-05-13 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
US8883982B2 (en) 2011-06-08 2014-11-11 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life

Also Published As

Publication number Publication date
GB9927681D0 (en) 2000-01-19
AU1531901A (en) 2001-06-04

Similar Documents

Publication Publication Date Title
CA2220753C (fr) Nouveaux peptides et nouvelles compositions modulant l'apoptose
US20030022302A1 (en) Toll-like receptor
JPH10179178A (ja) ヒト７回膜貫通型レセプター
EP1109908A2 (fr) Genes induits par la leptine
US5965396A (en) Human lymph node derived GTPase
EP1290160B1 (fr) Polypeptides pellino humains
JP2001524813A (ja) ＩκＢキナーゼ、そのサブユニット、およびこれらを使用する方法
US5905146A (en) DNA binding protein S1-3
WO2001038526A1 (fr) Récepteur de tnf humain
CA2508848A1 (fr) Polypeptides pellino humains
US6872811B1 (en) HRPCa9 and HRPCa10 nucleic acids and polypeptides
US5654397A (en) Interleukin-1 receptor-associated protein kinase and assays
CA2225450C (fr) Proteine kinase associee au recepteur de l'interleukine-1 et dosages
WO1999041412A1 (fr) Nouveau gene npg-1 differentiellement exprime dans les tumeurs de la prostate
US6110690A (en) SODD-specific antibodies and methods
WO2000018800A1 (fr) Nouvelles proteines secretees immunomodulatrices et leurs applications
JP2003508053A (ja) Ｉｒｅｎタンパク質、その製造および用途
WO1999026980A1 (fr) Reactifs et procedes d'utilisation de proteines de la famille sap, nouveaux regulateurs de transduction de signaux
CA2428319C (fr) Compositions et methodes de diagnostic ou de traitement du psoriasis
JP2004089190A (ja) ヒト・ｍｙｔ−１キナーゼクローン
US5959081A (en) Zinc binding LIM protein S2-6
WO2000056764A1 (fr) Molecules d'adn codant pour des proteines clax humaines et leurs proteines de fusion solubles
US6071741A (en) Doc tumor suppressor protein and gene
US6812336B1 (en) Transcription factor coactivator protein, p/CIP
US6485921B1 (en) UBCLP and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase