Isolation and Characterization of the Genomic DNA Clones of Ribosomal Protein Gene L25 in Tobacco
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention is broadly concerned with the promoter of the ribosomal protein gene L25. More particularly, the present invention relates to an isolated DNA molecule and an expression vector, each of which comprises the promoter of the ribosomal protein gene L25; a plant cell and a plant, each of which is transformed with this expression vector; a seed obtained from this plant; and a method for producing a product from this plant or plant cell.
2. Description of the Related Art As components of ribosomes, ribosomal proteins (r-proteins) are critical in protein biosynthesis required for cell division and cell differentiation. Studying the expression of ribosomal protein genes and their regulation enables one to differentiate the functions of important housekeeping genes in plant growth and development. Moreover, some promoters of ribosomal protein genes, due to their high expression and complex regulation patterns, are among the most suitable candidates for expressing exogenous genes that are of economic or medical importance.
Different plant ribosomal protein genes appear to have different expression patterns that are regulated in a complicated fashion, a conclusion drawn from studying at least 12 small (5) ribosomal genes and 13 large (L) ribosomal genes from a variety of tissues in several plants (Lee et al. 1999. Gene 226: 155-163). Among these 25 ribosome protein genes. L3 and L16 in Arabidopsis (Kim et al. 1990. Gene 93: 177-182; Williams et al. 1995. Plant J. 8:65-76) and SI 5a in rapeseed (Bonham-Smith et al. 1992. Plant Mol. Biol. 18:909-919) were highly expressed in all rapidly proliferating organs, including shoot and root apical meristems. lateral root primordia. and early developing stages of reproductive organs. This pattern of ribosomal protein gene expression is consistent with that of most ribosomal protein genes in prokaryotes (Mager 1988. Biochim Biophys. Acta 949: 1-15). The rpL16 in Arabidopisis is encoded by two genes (rpLA and rpL16B). and both are mainly regulated in the level of transcription (Williams et al. 1995. Plant J. 8:65-76),
similar to the plastid ribosomal protein L21 (RPL21) in spinach (Lagrange et al. 1997. Plant Cell 9: 1469-1479). While RPL 16A was mainly found in proliferating tissues including the shoot and root apical meristems and auxin- induced lateral root primordia, RPL 16B was highly expressed in cells in the root stele, anthers, and auxin-induced lateral root primordia.
The expression of S19 and L7 in potato increased at the transcription level in the stolon tip during the early stages of tuberization but maintained at a low level in leaves, stems, and roots throughout the development (Taylor et al. 1992. Plant Physiol. 100:1 Hil l 76). Genes Sl l and S13 in maize were expressed at higher transcriptional level in roots and shoots of developing seedlings than in fully expanded leaf tissues (Lebrun et al. 1991. Plant Mol. Biol. 17:265-268; Joanin et al. 1993. Plant Mol. Biol. 21:701-704). The levels of L27 mRNA in pea were increased remarkably by decapitation, a treatment that leads to cell proliferation (Stafstrom et al. 1992. Plant Physiol. 100:1494-1502; Stafstrom et al. 1995. Plant Mol. Biol. 29:255-265). The transcript of S16 in rice was essentially the same across different tissues and development stages (Zhao et al. 1995. Plant Physiol. 107: 1471- 1472)
The further understanding of the mechanism of how genes are regulated at transcription level can be greatly enhanced by identifying cis-acting elements, their binding protein(s) and their interaction. By transient and stable transfection analysis of RPL21 promoter deletion mutants, Lagrange et al. (1997) identified a strong core promoter sufficient to drive high levels of gene expression and two non-overlapping positive and negative domains that modulate core promoter activity independently of light. Further, gel retardation analysis showed that a cis-acting element located in the positive domain (S2) binds a leaf-specific nuclear factor (S2F). The rpL34 promoter region recently has been characterized and two synergically functional, yet separable cis-acting elements, have been defined (Shi et al. 1999. Amer. Soc. Plant Physiol. Annual Meeting, Baltimore, MD).
In a previous study, one cDNA encoding tobacco ribosomal protein L25 (rpL25), which RNA is most abundant in three-day-old cell suspension culture and post germinating seedlings, was isolated and partially characterized. L25 mRNA levels increased in response to wounding and plant hormone treatment (Gao et al. 1993. American Chemical Society Symposium in Denver), a pattern similar to the expression of L27 gene. In this investigation, rpL25 genomic DNA clones were isolated and partially characterized. A
preliminary functional analysis of the promoter was performed to gain insights of the expression of rpL25 gene.
SUMMARY OF THE INVENTION The present invention is directed to an isolated DNA molecule comprising the promoter of the ribosomal protein gene L25 , wherein the promoter is preferably the promoter of Nicotiana tabacum, and the promoter ideally comprises the nucleotide sequence shown in Figure 3.
The invention also concerns an expression vector comprising the promoter of the ribosomal protein gene L25 and a structural gene operably linked thereto, wherein the promoter is preferably the promoter of Nicotiana tabacum, and the promoter ideally comprises the nucleotide sequence shown in Figure 3.
Additionally, the invention relates to a plant cell or whole plant transformed with one of the above-described expression vectors, and to seed obtained from one of these plants.
Finally, the invention is directed to a method for producing a product, e.g., a protein, from one of the above-described plants or plant cells, comprising providing the plant or plant cell, causing a product encoded by the structural gene to be produced in the plant or plant cell, and isolating the product from the plant or plant cell, thereby producing the product.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 illustrates the structure of the tobacco rpL25 gene. Exons are represented by numbered boxes. Introns and 5' and 3' nontranscribed regions are represented by lines. The open (white) regions of exon 1 and 3 correspond to untranslated sequences. ATG and TAA represent putative translation start and stop codons, respectively.
Figure 2 shows the sequence of the rpL25 gene. The DNA sequence of the rpL25 gene is shown. The 5' end of the rpL25 transcripts maps to nucleotide + 1. The introns and 5' and 3' untranscribed regions were represented as upper case letters while the transcribed regions were presented bolded lower case letter. The putative TATA box is underlined.
Figure 3 shows the nucleotide sequence of a DNA fragment of the rpL25 gene having promoter activity.
Figure 4 shows the results of the transient analysis of the rpL25 promoter. The GUS activity (pmol/min/mg protein) was averaged from at least three independent experiments ± standard deviation. Lanes 1 , 2 and 3 represent the activity from constructs rpL25-2GUS, rpL25-3GUS, rpL34-GUS, respectively.
Figure 5 illustrates histochemical staining of transgenic tobacco. Panels A to E are from transgenic plants containing the rpL25 promoter; Panels F to J are from transgenic plants containing rp!34 promoter. The plant materials are from 3-day post-germinating seeds (Panels A and F), seedlings at days 6 (Panels B and G), 9 (Panels C and H), 12 (Panels D and I), and 16 (Panels E and J) post germination.
Figure 6 illustrates relative GUS activity driven by the rpL25 promoter during/post seed germination. GUS activity of seedlings from seven transgenic plants was measured at various time intervals post-germination. The highest measured GUS activity was assigned a value of 100. The remaining GUS activities during/post seed germination are normalized to this value. The vertical bars show the standard deviation.
Other objects, features, and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, because various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT Example 1
This example describes the steps for isolating and sequencing of the rpL25 gene.
1.1 Isolation and sequencing of rpL25 coding region
DNA manipulations were conducted using standard procedures as described by Sambrook et al. 1989. Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, NY. Tobacco genomic DNA was isolated from young leaves of N. tabacum Xanthi according to standard methods (Chomczynski et al. 1987.
Anal. Biochem. 162: 156-159). About 2 μg of genomic DNA was used as a DNA template to amplify the coding region of the rpL25 gene by PCR, using specific 5' (5'- CTCAGGTAAGCTGGTAGATTTCTCGT -3' from position + 1 to +26) and 3' primers (5'-TACACGGAACAAAACTTGTCTCTGA-3' from position +623 to +647). Subsequently, the PCR product was subcloned into EcoRV digested pBluescript SK (-). This clone was sequenced using a primer walking strategy, starting with an oligonucleotide located beyond the polylinker cloning site. Sequence data were compiled and analyzed using Bestfit program sequence analysis package (Genetics Computer Group, Madison, Wisconsin) with adjustments made by inspection when appropriate.
1.2 Sequence and structure of rpL25 coding region
Total genomic DNA was used as a template in PCR to amplify the entire rpL25 coding region including its exons and introns by using two primers corresponding to the very 5' and 3' end of rpL25 cDNA. A 2.1-kb PCR product (rpL25-l) was subcloned and completely sequenced. The comparison between the sequence of rpL25 cDNA and rpL25-l reveals that rpL25-l contains the whole rpL25 cDNA with two exceptions: the last 47 nucleotides at 3 '-end of cDNA are located outside the 3' primer and the rpL25 gene has two introns and three exons. Intron 1 and 2 are 1149 bp and 236 bp long, respectively. Εxons 1 , 2 and 3 are 67 bp, 364 bp and 263 bp long, respectively (Figure 1). As shown in Figure 2, the sequence of three exons was perfectly matched with that of cDNA as reported by Gao et al. (1993. American Chemical Society Symposium in Denver) and two predicted introns have the 5'-GT-AG-3' consensus intron boundary sequences (Shapiro et al. 1987. Nucleic Acids Res. 15:7155-7174).
Example 2
This example describes the steps taken to isolate the promoter region of the rpL25 gene.
2.1 Isolation of the rpL25 promoter region by PCR
Two PCR-based approaches were taken to isolate the rpL25 promoter region. One was standard inverse PCR in which total tobacco genomic DNA was used as a template. The 5- primer is 5'-GTGAGGTTGACTCCTGACTATGATGCTTTGGA-3' (corresponding to position + 1 to +26 at 3' end of cDNA), while the 3' primer is
5 ' -GTCJAGAT AGCTGGAGCC ATTTGGATAGGT AC AGTATG AAAC-3 ' (corresponding to position +30 to +65 relative to the transcriptional start site and containing a Xbal site at 5' end). The total genomic DNA was digested with EcoRI and self-ligated by T4 ligase. The second PCR analysis was performed by using the phage DNA isolated from tobacco genomic library (Xanthi-nc in ΕMBL3 clone vector, Clonetech) as a template. The 5' primer was designed based on the adjacent vector region of the genomic DNA fragment cloning site, while the 3' primer was based on the very 5' end of rpL25 cDNA (5'-GTCTAGATAGCTGGAGCCATTTGGATAGGTACAGTATGAAAC-3') from position +30 to +65 relative to the transcriptional start site) and containing a Xbal restriction site at 5' end. Phage DNA was prepared by extraction of phenol and phenol: chloroform (1 : 1 v/v), following 5 min of heat at 100°C. Two products, rpL25-2 from the standard inverse PCR and rpL25-3 from genomic library-based PCR, were subcloned and sequenced as described earlier.
2.2 Sequencing analysis of the rpL25 promoter
Two PCR fragments were produced, a 1.2-kb DNA fragment (rpL25-2) from total genomic DNA based PCR and a 0.9-kb fragment (rpL25-3) from genomic DNA library based PCR, respectively. Comparison of their sequences indicates that rpL25-3 is completely contained in rpL25-2. The 5' ends of the promoter regions of rpL25-2 and rpL25-3 are located in the region of -1075 and -942, respectively (Figure 2). Only the sequence of rpL25-2 was shown in Figure 2. The putative TATA box (TATAAAT) is present at position -140 and -134 upstream of the putative transcriptional start site.
Example 3
This example describes the materials and strategies used for gene cloning, protoplast transient assays and stable transformation assays of the expression of a reporter gene under
the control of the tobacco rpL25 promoter. This system can be used to study the function of promoter fragments by evaluating the transcriptional activity of its driven reporter gene.
3.1 Bacterium strain and plant materials
Escherichia coli DH5α was used as the host for routine cloning experiments. The A. tumefaciens strain PC2760 was the host for the binary vectors. N. tabacum cell suspension culture designated ΝT1 was used for electroporation experiments. N. tabacum cv SRI and Xanthi-nc were used as the hosts for Agrobacterium-mediated transformation and for genomic DΝA isolation, respectively.
3.2 Construction of rpL25 promoter/GUS fusion genes
To prepare the transcriptional fusion construct rpL25-3GUS, the 0.9-kb φL25-3 was amplified by PCR using φL25-3 as a DΝA template and placed a Xbαl restriction site one nucleotide upstream of the putative translation start site. An oligonucleotide (5 '-GTCTAGATTGGATAGGTACAGTATGAAACCCT-3 ') complementary to the 5 ' untranslated region of the φL25 gene and containing Xbαl site at 5' end was synthesized and used a 3' primer. The oligonucleotide complementary to the adjacent vector region of the genomic cloning described earlier served as the opposing primer in PCR. The amplified 0.9-kb PCR product was subcloned into EcoRV digested pBluescript SK (-), excised by restriction enzymes digestion of Pstl (from the cloning vector) and Xbαl (newly introduced at one nucleotide upstream of the putative translation start site), and inserted into the same sites of pBI221, producing φL25-3GUS. Similarly, φL25-2GUS was prepared except that the primer (5'-TACACGGAACAAAACTTGTCTCTGA-3' from position +623 to +647) described earlier served as the opposing primer, where φL25-2 was used as the DΝA template. The Xbαl/Eco d (filled-in) 1.2-kb amplified PCR product was inserted into the Xbαl/HindUI (blunt end) sites of pB 1221, producing φL25-2GUS. Both φL25-2GUS and φL25-3GUS were used for transient assays. Further, the Hindlll/Sαcl φL25-3 promoter/GUS reporter gene fragment in φL25-3GUS was cloned as a cassette into the same sites of the plant expression vector pGA482 (An et αl. 1987. Meth. Εnzymol. 153:293-305), producing φL25-3BGUS for stable transformation in tobacco.
3.3 Transient and stable transformation assays in tobacco
Electroporation of tobacco protoplasts was performed as described in Ebert et al. (1987. Proc. Natl. Acad. Sci. USA 84:5745-5749) with a slight modification. Test DNA (20 μg) and carrier DNA (10 μg) were used in each electroporation. Protoplasts were incubated in the dark at 29 °C for 48 h before they were collected for protein extraction and MUG assays. The Hindlll/Sacl promoter-GUS reporter fragments in pBI221 were inserted into the plant expression vector pGA482. Transfer of these constructs into A. tumefaciens strain CP2670 was conducted using the freeze-and-thaw method as described by Ebert et al. (1987. Proc. Natl. Acad. Sci. USA 84:5745-5749). Plasmid DNA from the transformed Agrobacterium clones was isolated and digested with various specific restriction enzymes and analyzed in agarose gel to confirm transformation of each construct. Tobacco leaf disc transformation and plant regeneration were performed as described by An et al. (1987. Meth. Enzymol. 153:293-305). At least 30 independent transformants were regenerated. T, seeds were collected and grown under sterile conditions on agar media containing MS medium (Murashige et al. 1962. Physiol. Plant 15:473-497) with 50 μg ml"1 kanamycin and 250 μg ml"1 cefotaxin. Kanamycin resistant T, seedlings were selected, transferred to soil and grown to maturity.
3.4 Fluorometric and histochemical analysis of GUS activity To prepare for histochemical staining, regenerated plants were allowed to self pollination and surface sterilized T, seeds were germinated on MS medium containing 50 μg/ml kanamycin and 250 μg/ml cefetaxin. Plants at different development stages, seeds and longitudinally excised flowers were collected and histochemically analyzed as described by Dai et al. (1996. Plant Mol. Biol. 32: 1055-1065). Fluorometric quantitation of GUS activity was performed according to Jefferson et al. (1987. EMBO J. 6:3901-3907). Fresh post germinating seeds and whole seedlings from independent transgenic tobacco were ground in lysis buffer (50 mM sodium phosphate, pH 7.0, 10 mM EDTA, 0.1 % TritonX- 100, 0.1 % sarkosyl and 10 mM DTT). Tobacco protoplast protein was extracted in the same buffer by 2X sonication on ice or 5 seconds. Protein concentrations were determined by the Bio-Rad method (Bradford 1976. Anal. Biochem. 72:248-254). Approximately 5-10 μg of protein was incubated in the presence of 1 mM 4-methylumbelliferyl β-D-glucuronide in 100 μl of lysis buffer at 37C.
Samples were taken at 0, 15, and 30 min and the enzymatic reaction was quenched in 0.2 M sodium carbonate (Na2CO3). The fluorometer was calibrated with 100, 200, 300, and 400 nM 4-methylumbelliferon in 0.2M sodium carbonate.
3.5 Transient analysis of GUS-fused φL25 promoter
To evaluate φL25 promoter expression in tobacco suspension culture, two transcriptional GUS reporter gene fusion constructs (φL25-2GUS and φL25-3GUS) were prepared by PCR, subcloned into the pBI221 vector and delivered into tobacco protoplasts by electroporation. MUG assays of protein extracted from tobacco protoplasts showed that high GUS activity was found in tobacco protoplasts containing either promoter (Figure 4). The activity is about half of the promoter of φL34, a strongly expressed tobacco ribosomal protein gene studied in our laboratory (Shi et al. 1999). While GUS activity was higher in the construct containing 0.9-kb φL25-3 than 1.2-kb φL25-2, the difference did not reach a significant level. These results suggest that the DNA fragment in the region of -1075 to -942 probably plays no role in promoter function.
3.6 Stable transformation analysis of φL25-2BGUS
The 0.9-kb φL25-3 promoter fragment was studied further, due to its higher activity in transient assays, to investigate spatial regulation of the φL25 promoter. The transcriptional fusion construct (φL25-2BGUS) was prepared by inserting the φL25-3 promoter/GUS reporter gene fragment as a cassette into a plant expression binary vector. The chimeric promoter-GUS construct was transferred into tobacco via Agrobacterium. At least 15 independent transformants were regenerated and allowed to self-pollination. No GUS staining was detected in primary transformants with a low level of GUS activity detected in very young leaves. Our research emphasis was activities seen during seed germination and in younger seedlings. T, seeds were germinated and the seedlings at different growth stages were harvested for both GUS activity measurement and histochemical analysis. The results of histochemical analysis are shown in Figure 5. In comparison with transgenic plants containing φL34 promoter, in which GUS staining was observed in the root meristemic region (Panels F-J, Figure 5), GUS activity in roots regulated by the φL25 promoter was undetectable using both GUS staining and histochemical analysis (Panels A-E, Figure 5). As for tissues with detectable GUS staining,
high variation in GUS activity across different transformants was found (data not shown), which is a common phenomenon and is probably due to the transcriptional activity of the region in which the construct was inserted. GUS staining was detectable in seeds after Id germination and detected strongly in cotyledons 3 d post-germination. As the seedlings grew, GUS staining in cotyledons peaked in days 6-8 post-germination, gradually decreased and became undetectable 2 weeks after germination (Panels A-E, Figure 5). In comparison, GUS staining in transgenic plants containing φL34 promoter can be detected in leaf primordia and developing leaves at later stages of growth and development (Panels F-J, Figure 5). Consistently, the GUS activity measurement for the φL25 construct during seed germination and seedling growth and development showed similar pattern (Figure 6). This pattern of φL25 promoter conferred expression corresponds well with the measured mRNA level (Gao et al. 1994. Plant. Mol. Biol. 25:761-770), suggesting that φL25-3 contains the full-length promoter. These results indicate that the expression of φL25 gene is tissue-specific and developmentally regulated, and that φL25-3 probably has the full function of the promoter region of the φL25 gene.