US5712112A - Gene expression system comprising the promoter region of the alpha-amylase genes - Google Patents

Gene expression system comprising the promoter region of the alpha-amylase genes Download PDF

Info

Publication number
US5712112A
US5712112A US08343380 US34338094A US5712112A US 5712112 A US5712112 A US 5712112A US 08343380 US08343380 US 08343380 US 34338094 A US34338094 A US 34338094A US 5712112 A US5712112 A US 5712112A
Authority
US
Grant status
Grant
Patent type
Prior art keywords
gene
α
amylase
method according
rice
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08343380
Inventor
Su May Yu
Li Fei Liu
Ming Tsair Chan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Science Council
Original Assignee
National Science Council
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Grant date

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/823Reproductive tissue-specific promoters
    • C12N15/8234Seed-specific, e.g. embryo, endosperm
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8237Externally regulated expression systems
    • C12N15/8238Externally regulated expression systems chemically inducible, e.g. tetracycline

Abstract

The present invention is directed to a method for producing a gene product by expressing a gene encoding the gene product in angiosperm host cells, comprising the steps of constructing a vector expressible in angiosperm host cells, the vector comprising a promoter region derived from an α-amylase gene of a plant, and a gene encoding a desired gene product; transforming a compatible angiosperm host cell with the vector; cultivating the resultant transformant host cell; subjecting the cultivated transformant host cell to a sugar-depleted or sugar-free condition to promote the expression of the gene under the control of the promoter region; and recovering the expressed gene product. The present invention also is directed to a method for the production of a transgenic plant of rice crop comprising the steps of infecting an immature embryo of rice crop with the genus Agrobacterium for transformation; co-culturing the infected embryo with a dicot suspension culture during the step of transformation; allowing the transformed embryo to grow into a callus in a selective medium comprising a sufficient amount of a plant growth hormone for the growth of rice crop; and allowing the cultured callus to regenerate root and shoot in a regeneration medium comprising a pre-determined amount of nutrients for the growth of rice crop. The invention is further directed to a transformed rice plant made by methods of this invention.

Description

This patent application is a continuation of U.S. patent application Ser. No. 07/973,324, filed Nov. 4, 1992, U.S. Pat. No. 5,460,952.

FIELD OF THE INVENTION

This invention relates to a method for producing a gene product, in particular to a method for the mass production of a desired gene product by expressing a gene encoding said gene product in plant host cells, whereby said desired gene product can be recovered from the culture medium of said plant host cells.

BACKGROUND OF THE INVENTION

The plant cell culture expression system has several advantages over the bacterial, yeast or Baculovirus expression systems. Bacteria do not, and yeasts only limitedly, carry out post-translational modifications of the expressed proteins. Plant cells are eukaryotic and able to perform sophisticated protein modifications which are often necessary for the proper function of proteins.

Although Baculovirus is a potent transformation vehicle for higher eukaryotes and generally performs satisfactory modifications of proteins, the cost for culturing baculovirus is much higher than that for plant cells. In addition, the host cells are eventually lysed by Baculovirus and thousands of host proteins along with the expressed transformation protein are mixed and released into the culture medium, which makes purification of the expressed transformation protein difficult.

The culture medium for plant cells contains mainly salts and vitamins and therefore, it costs much less than that used to culture insect cell lines which are used for the Baculovirus transfection. Moreover, the culture medium for plant cells will not need a supply of serum, whereas almost all animal cell cultures cannot survive without serum. In addition, since plant cells are eukaryotes, the expressed proteins therein will be appropriately post-translationally modified so as to render said proteins capable of functioning and being secreted out of the plant cells. Although no one has yet made a deeper understanding of the mechanism of protein secretion in plant cells, the common belief at present is that it could be similar to the secretory mechanism in animals.

Plant cell cultures are a potential commercial source of medicines, dyes, enzymes, flavoring agents and aromatic oils. Plant cell culture production of such compounds are sought when (1) they are produced by the plant in small quantities or in fleeting or unharvestable developmental stages of the plant's life cycle; (2) when they are produced by plants which are not amenable to agriculture or are native to vanishing or inaccessible environments; and (3) when the compounds cannot be satisfactorily synthesized in vitro or by other biosynthesis systems.

Attempts to produce products by plant cell culture, however, are often commercially unsuccessful due to such factors as insufficient production and secretion of the desired product, poor cell growth, and difficulties in maintaining the appropriate cell type in culture.

The callus alpha-amylase (α-amylase) expression system has features which make it of potential use to plant cell fermentation technology, namely its high level of expression, sustained expression, expression irrespective of either the tissue of origin of the cell culture or tissue formation in the cell culture, and its product secretion. Although rice callus itself may not be an ideal source of commercial α-amylase, the gene regulatory regions responsible for the high expression could be used, with the aid of recombinant DNA technology and plant transformation, to achieve high expression of other valuable proteins (Carl R. Simmons, et al (1991), Biotechnology and Bioengineering, 38: 545-551).

Starch includes straight-chain starch and branched starch, two types of polysacchardies, and is the basic stored nutrient component in cereal grains (T. Akazawa et al (1985), Ann. Rev. Plant Physiol., 36: 441-472). During the initial germinating period of cereal seeds, the aleurone layer cells will synthesize α-amylase. Alpha-amylase, α-glucosidase and enzymes restricting dextrinase are secreted into the endosperm and together hydrolyze starch to form glucose and maltose, so as to provide the nutrients needed for the growth of the germ (J. C. Rogers and C. Milliman, J. Biol. Chem., 259 (19): 12234-12240, 1984; Rogers, J. C., J. Biol. Chem., 260: 3731-3738, 1985). Other enzymes contributing to starch hydrolysis include β-amylase which can hydrolyze starch to form maltose and a small amount of glucose. In a dry seed, β-amylase normally exists in an inactive form in the endosperm due to protein disulfide bonding. When the seed germinates, the aleurone layer cells will be subjected to the induction by gibberellic acid (GA3) to produce protease, which can destroy the disulfide bond and release the active form of β-amylase. The above four enzymes take part in the hydrolysis of starch during the germination of seeds. However, α-amylase is the most active and holds the most important role (Akazawa, T., et al (1985), Ann. Rev. Plant Physiol., 36: 441-472).

It is known that GA3 exerts a direct influence over the expression of α-amylase (Chandler, P. M., et al (1984), Mol. Biol., 3: 401-418). When rice seeds are treated with GA3, the new synthesis of α-amylase mRNA by the aleurone layer cells increases to 50 to 100-fold of the control value (no GA3) (O'Neill, S. D., et al (1990), Mol. Gene. Genet., 221: 235-244). In reality, the regulation of α-amylase gene expression by GA3 has provided a very ideal model for studying the mechanism of hormonal regulation of gene expression in plants (Ho, T. H. D., et al (1987), "Regulation of gene expression in barley aleurone layers," In: Molecular Biology of Plant Growth Control, pp.35-49. St. Louis, Mo.: Alan R. Liss, Inc.).

Hitherto, α-amylase genes from rice, barley and wheat have been cloned and subjected to further study and analysis. The results show that these cereal-type α-amylase isozymes or isoforms are all manufactured by several types of α-amylase genes (Baulcombe, D. C., et al (1987) Mol. Gen. Genet., 209: 33-40); Huang, N., et al (1990a), Plant Mol. Biol., 14: 655-668; Knox, C. A. P., et al (1987), Plant Mol. Biol., 9: 3-17).

The α-amylase secreted from the aleurone layer cells during the germinating period of the seed of barley and wheat comprises two classes, the high isoelectric point and low isoelectric point. In barley, there are around 7 α-amylase genes which belong to the high isoelectric point and 3-4 genes which belong to the low isoelectric point (B. Khursheed and J. C. Rogers, J. Biol. Chem., 263: 18593-18960, 1988).

Currently, 7 α-amylase cDNA and 9 α-amylase genomic DNA groups of barley have been cloned (Chandler, P. M., et al (1984), Plant. Mol. Biol., 3: 401-418; J. Deikman and R. L. Jones, Plant Physiol., 78: 192-198, 1985; Khrusheed & Rogers (1988), supra; Knox, C. A. P., et al (1987), supra). The α-amylase genes of wheat are grouped into α-Amy1, α-Amy2 and α-Amy3. Alpha-Amy1 has a high isoelectric point while α-Amy2 has a low isoelectric point, and each has more than 10 genes which are expressed in germinating seeds. Alpha-amylase α-Amy3 includes 3-4 genes which are expressed in immature seeds (Baulcombe et al (1987), supra).

With regard to the study of rice α-amylase genes, the α-amylase genes thereof have not been classified into the high isoelectric point group and the low isoelectric point group as was done in the study of barleys and wheats. In reality, MacGregor, A. W., et al (Cereal Chem., 65: 326, 1988) applied the analytical method of isoelectric point electrophoresis and found that rice α-amylase isomers had a pI value of less than 5.5.

Therefore, it is possible that rice does not have any isoform of high isoelectric point. Huang, N., et al (Nucl. Acids. Res., 18: 7007-7014, 1990b) grouped the 10 rice α-amylase genes into 5 groups by cross hybridization experiment and confirmed their distribution in 5 chromosomes (Ranjhan et al, the original manuscript is still under preparation). O'Neill et al (Mol. Gene. Genet. 221: 235-244, 1990) made the first more detailed study of the cDNA pOS103 and pOS137 of rice α-amylase. The α-amylase manufactured from pOS103 and pOS137 has a precursor protein of a molecular weight of 48 KDa.

When this enzyme is secreted out of the cell, the signal peptide chain of the precursor protein will be cleaved off. Accordingly, the molecular weight of mature α-amylase is about 45-46 KDa and the isoelectric point thereof is predicted to be about 6.0. However, Kumagai, M. H., et al (Gene, 94: 209-216, 1990) subcloned pOS103 into the cells of Saccharomyces, to allow the Saccharomyces to secrete α-amylase into the culture medium, and it was found that the molecular weight of α-amylase is about 44-45 KDa and that the isoelectric point is about 4.7 to 5.0.

On the other hand, transformation of dicotyledonous plants with Agrobacterium tumefaciens is well established and widely used. A number of foreign genes carried between the T-DNA borders of the Ti plasmid in Agrobacterium have been delivered to plant cells, integrated into the chromosome, and stably inherited by subsequent generations. This, however, has not been the case for monocotyledonous plants in general. In the past, the monocots and particularly the graminaceous crop species have been considered to be outside the Agrobacterium host range (Bevan, M. W., Nucl. Acids Res., 12: 8711-8721, 1984; Declene, M., Phytopathol. Z. 113: 81-89). Gene transfer methods developed from economically important monocotyledonous species have been restricted to the directed transfer of DNA into protoplasts, or particle discharge methods of direct DNA transfer into intact cells of embryomic callus or suspension cells.

In recent years, more and more data on the transformation of monocots using Agrobacterium have been accumulated. The demonstration of Agrobacterium T-DNA integration into genomic DNA of Asparagus officinalis (Bytebier., B., et al (1987), Proc. Natl. Acad. Sci. USA, 84:5345-5349) and Dioscorea bulbifera (Schafer, W., et al (1987), Nature, 327: 529-531) first indicated that some monocot species possess the potential to be transformed by Agrobacterium. Later, a report of T-DNA integration into the genomic DNA of rice, Oryzae sativa (Raineri, D. M., et al (1990), Biotechnology, 8: 33-38), further showed that graminaceous crop plants can be transformed by Agrobacterium. Recently, foreign genes have been successfully transferred into corn, and regeneration of plants and detection of the transferred genes in the F1 progeny have been demonstrated (Gould, J. et al (1991), Plant Physiol., 95: 426-434). Therefore, the Agrobacterium-mediated gene transfer system seems to be applicable for transformation of monocot plants.

Agrobacterium-mediated transformation is a complex process and several factors are involved (for review, see Hooykaas, P. J. J., Plant Mol. Biol., 13: 327-336, 1989). Activation of the virulence system is one of the early important steps in plant tumor induction (Garfinkrl, D. J., J. Bacteriol., 144: 732-743, 1980). The vir genes on the Ti plasmid are silent until they become induced by certain plant factors, which in tobacco have been identified as the phenolic compounds acetosyringone and α-hydroxy-acetosyringone (Stachel, S. E., et al (1985), Nature, 318: 624-629). These compounds are released from plant tissue, especially after wounding, which has long been known to be a prerequisite for plant tumorigenesis via Agrobacterium. Although initially, it was generally thought that monocot species were not susceptible to Agrobacterium, some monocot species (e.g., Asparagus) are prone to tumor formation after T-DNA transfer (Hernalsteens, J. P., et al (1984), EMBO J., 3: 3039-3041). Tumor formation on discs of the monocot Dioscorea (yam) by Agrobacterium requires a pre-incubation with exudates from dicot plants (Schafer, W., et al (1987), Nature, 327: 529-531), indicating that some monocots probably do not produce enough inducers to activate the expression of the vir gene on the Ti plasmid transferred by Agrobacterium.

Toxins or inhibitors which inhibit the growth of Agrobacterium tumefaciens and the expresion of vir genes on the Ti plasmid have been shown to be present in wheat (Usami, S., et al (1988), Proc. Natl. Acad. Sci. USA, 85: 3748-3752), and corn (Sahi, S. U., et al (1991), Proc. Natl. Acad. Sci. USA, 87: 3879-3883), and might cause problems during attempts to transform monocots with Agrobacterium. Nevertheless, wheat and oats have been shown to contain substances which induce the expression of the vir locus of the Ti plasmid and the T-DNA processing reaction, although the inducing substance of wheat differs from acetosyringone (Usami, S., et al (1988), supra).

Previously, it was reported that potato suspension culture (PSC) is essential for the Agiobacterium-mediated transformation of Indica type rice (Chan, M. T., et al, "Transformation of Indica rice (Oryza sativa L.) mediated by Agrobacterium," Plant Cell Physiol. (1992), 33: 577-583). PSC is rich in the phenolic compounds acetosyringone (AS) and sinapinic acid (SA). Although the role of these two compounds in the success or efficiency of transformation is not yet known, the results imply that transformation of monocots, at least rice, using Agrobacterium can be improved by the addition of certain substances.

The age and physiological states of plant tissues have been shown to be important for Agrobacterium-mediated transformation (An, G. et al (1986), Plant Physiol., 81: 301-305; Chan, M. T., et al (1992), supra); H. H. Chang and M. T. Chan, Bot. Bull. Academia Sinica, 32: 171-178, 1991; Dale, P. J., et al (1989), Plant Sci., 63: 237; Gould, J. et al (1991), supra; Hernalsteens J. P., et al (1984), supra).

Thes studies suggest that infection with Agrobacterium and T-DNA transfer should take place in monocots if suitable tissues are used for transformation. It was previously shown that young tissues of rice root have a greater potential to be transformed by Agrobacterium if appropriate conditions are applied (Chan, M. T., et al (1992), supra), and it was assumed that young tissues may contain relatively fewer inhibitors or more virulence inducers. Therefore, a combination of immuture embryos and PSC for transformation of rice can be used in the present invention.

This invention is based on the inventors' discovery that, in addition to regulation by gibberellic acid (GA3) in germinating seeds of rice, the expression of α-amylase genes in suspension-cultured cells of rice is regulated by the level of carbohydrate present in the culture medium (Yu, Su-May et al. (1991), J. Biol. Chem., 266: 21131-21137).

The synthesis of α-amylases and levels of their mRNA are greatly induced under sucrose starvation. An increase of α-amylase synthesis is assumed to accelerate hydrolysis of cellular starch as an energy source when exogenous carbon source is depleted. Under normal growth condition with an adequate supply of sugars in the medium, the expression of α-amylase genes is subject to metabolite repression. It was further observed that α-amylases synthesized by the cultured rice cells are secreted into the culture medium and can account for about 15-20% of the total proteins present in the medium during periods of sugar depletion.

It would therefore be advantageous to develop a gene expression system in plant cell culture by constructing a vector expressible in plant host cells utilizing the promoter and the signal peptide sequences of an α-amylase gene. Any foreign gene can be linked downstream of said promoter and signal peptide encoding sequences. This construct would then be used to transform a compatible plant host cell.

Theoretically, the α-amylase promoter would control the expression of foreign genes in said plant cells and the secretion of the proteins into the medium. Such an expression system therefore has a high potential to express and/or secrete large quantities of any important protein into the medium, greatly facilitating purification of the expressed protein.

To aid in the procedure of screening and/or to enhance further the expression efficiency of the gene expression system constructed above, said gene expression system may further comprise a suitable marker gene, a reporter gene, an antibiotic-resistance gene and/or an enhancer gene, all of which can be those well known by an artisan of ordinary skill in the relevant art (Maniatis, T., et al, "Molecular Cloning: A Laboratory Mannual," pressed by Cold Spring Harbor Laboratory, 2nd edi., 1989).

SUMMARY OF THE INVENTION

Accordingly, in one aspect of the present invention, a method is provided for producing a gene product by expressing a gene encoding said gene product in plant host cells, comprising the steps of: constructing a vector expressible in plant host cells, said vector comprising a promoter region derived from an α-amylase gene of a plant, and a gene encoding a desired gene product; transforming a compatible plant host cell with said vector; cultivating the resultant transformant host cell; subjecting said cultivated transformant host cell to a sugar-depleted or sugar-free condition to promote the expression of said gene under the control of said promoter region; and recovering the expressed gene product.

In another aspect of the present invention, a method is provided for producing a gene product by expressing a gene encoding said gene product in plant host cells, comprising the steps of constructing a vector expressible in plant host cells, said vector comprising a promoter region derived from an α-amylase gene of a plant, and a gene encoding a desired gene product, said promoter region including the promoter and a DNA sequence encoding the signal peptide; transforming a compatible plant host cell with said vector; cultivating the resultant transformant host cell in a suitable culture medium; and directly recovering the-expressed gene product from said medium.

The rice α-amylases are encoded by a multigene family which contains at least ten distinct members. To understand how GA3 and sugars regulate α-amylase gene expression in rice, it is important to identify α-amylase cDNA clones representing different α-amylase genes. These clones, in turn, would be used to isolate their corresponding genomic clones.

In this invention, four of the α-amylase cDNA clones showing different restriction patterns were chosen for subcloning into the plasmid vector pBluescript (Invitrogen, San diego, Calif.). The resultant clones were designated as αAmy6-C (Oryza saliva α-amylase cDNA), αAmy7-C, αAmy8-C and αAmy10-C with insert sizes of 0.6, 1.0, 1.4 and 1.5 kb, respectively.

The 3' end regions of these cDNA clones were further subcloned and sequenced. The sequenced 3' regions of αAmy6-C, αAmy7-C and αAmy8-C are found identical to those of the reported rice α-amylase genes RAmy3B (Sutliff et al., 1991), RAmy1A (Huang et al., 1990a), and RAmy3E (Huang et al., 1990b), respectively. The genomic DNA corresponding to αAmy10-C has not yet been reported.

The expression pattern of these four α-amylase genes in cultured suspension cells of rice was determined with the use of the constructed gene-specific probes. Expression of αAmy7-C and αAmy8-C was induced by sugar depletion 6- and 37-fold, respectively, at day 12 and continued to increase at day 14. Expression of αAmy10-C was induced later with a 5-fold increase at day 14. Expression of αAmy6-C also increased 4-fold at day 12, however, it decreased to basal level at day 14. Expression of another α-amylase gene, αAmy3-C, was increased 5-fold after sugar starvation (S. M. Yu, unpublished result).

Therefore, among the five α-amylase genes examined so far, αAmy8-C is the most abundantly expressed gene after sugar depletion. In addition, it is worthwhile noting that αAmy8-C is one of the major genes whose transcripts upon inducement by sugar depletion constitute the 40-fold increase of total amylase transcripts as detected with probe of OSamy-C. The results show that expression of the four α-amylase genes in response to carbohydrate starvation in the cultured cells is temporally and quantitatively regulated.

Consequently, an expression vector containing the promoter region of the rice α-amylase gene (αAmy8) was constructed in order to express β-glucuronidase (GUS) in transformed rice cells. A hygromycin resistance gene hph placed downstream of the CaMV 35S RNA promoter is used as a selectable marker.

Different transformation methods, such as electroporation of protoplasts or intact cells, particle bombardment, micro-injection method, ultrasonic method, polyethylene glycol-mediated protoplast transformation, poly-L ornithine method, calcium phosphate method (Hain, R. et al (1985), Mol. Gen. Genet., 199: 161-168), and Agrobacterium-mediated transformation system can be applied to deliver the plasmid DNA into rice cells. GUS expression was detected in either bombarded or electroporated cells two days after transfection. The results indicate that the α-amylase promoter-GUS chimeric genes are functional in rice cells.

A reporter gene driven by an α-amylase promoter is further transferred and expressed in a Japonica type of rice (Oryzae sativa L. cv. Tainung 62) using the Agrobacterium-mediated gene transfer system. Said system comprises a plasmid containing chimeric genes of β-glucuronidase (GUS) and neomycin phosphotransferase (NPTII). The transformation efficieny of said Agrobacterium was improved by Co-incubation with potato suspension culture (PSC). The GUS and and NPTII genes, which are under the control of promoters of a rice α-amylase gene (αAmy8) and Agrobacterium nopaline synthase gene (NOS), respectively, were both expressed in transgenic calli and plants. The experimental data demonstrate the successful gene transfer and sexual inheritance of the chimeric genes made in accordance with this invention.

Features and advantages of the present invention will become apparent in the following detailed description with references to the accompanying drawings, in which:

BRIEF DESCRIPTION OF THE DRAWINGS

The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

FIGS. 1A and 1B show nucleotide sequences of the 3' regions of the rice α-amylase cDNA clones.

FIG. 2 shows the Southern blot analysis demonstrating specificity of the α-amylase gene-specific probes.

FIG. 3. shows the southern blot analysis of α-amylase genes in rice genome.

FIGS. 4A and 4B show the accumulation of α-amylase mRNA in germinating seeds and suspension cultured cells of rice. (4A) Time course of accumulation of α-amylase mRNA in GA3 -treated aleurone cells of rice. (4B) Relative mRNA levels of the α-amylase genes in the suspension cultured cells of rice during later growth stage.

FIGS. 5A, 5B and 5C show the binding of aleurone protein extract to the 5' specific DNA fragments of a rice α-amylase gene.

FIG. 6 shows the Binding of the GA3 -inducible aleurone proteins to the specific DNA fragment of HS501. +GA and -GA: protein extracts prepared from de-embryoed rice seeds after 3 days of imbibition with or without GA3, respectively.

FIG. 7 shows the structure of the binary vector pAG8 containing the αAmy8 (1.2 kb)/GUS chimeric gene. The 1.2 kb 5' -upstream fragment of the α-amylase gene αAmy8 was joined to the coding region of the E. coli β-glucuronidase gene (GUS) with the polyadenylation signals of nopaline synthase gene (NOS). This chimeric gene was inserted between the left border and the selectable marker gene of pBIN19. Abbreviations: RB and LB, right- and left-border of T-DNA, respectively; NPTII, neomycin phosphotransferase II gene; Pnos, promoter of NOS gene.

FIGS. 8A, 8B, 8C, 8D, 8E, and 8F show the selection and regeneration of a transgenic rice plant. (8A) Nontransformed control calli on the selective medium (N6RF) containing 40 μg/ml G418 three weeks after plating; (8B) Regeneration of shoot and roots from G418-resistant calli 8 weeks after inoculation with Agrobacterium; (8C) Transgenic plant grown on N6/G418 medium 9 weeks after inoculation; (8D) The transgenic plant grown in pot soil in greenhouse 16 weeks after inoculation; (8E) Tillering of the transgenic plant 18 weeks after inoculation; (8F) Seed-setting of the transgenic plant 24 weeks after inoculation.

FIG. 9 shows a DNA blot analysis for detection of GUS gene in the transgenic rice plants. Genomic DNA was isolated from young leaves of wild type and transgenic plants. Five μg of DNA digested with various restriction enzymes were loaded on each lane. The Sst I/BamH I fragment containing GUS gene in pBI221 was used as the probe. Lane 1:pAG8 digested with BamH I; Lanes 2 to 5: DNA from transgenic plant T1; Lanes 6 to 8: DNA from transgenic plant T2; Lanes 9 to 10: DNA from transgenic plant T3; Lane 11: DNA from transgenic plant T4; and Lane 12: DNA from a non-transformed control plant. Abbreviations of restriction enzymes: B, BamH I; H, Hind III; P, Pst I; Unc, undigested.

FIGS. 10A and 10B show the analysis of GUS and NPTII activities in the transgenic calli and plants. (10A) Analysis of GUS activity in transgenic rice. Protein extracts from transformed and non-transformed rice plants and calli were separated using 7.5% SDS-PAGE. The gel was reacted with 1 mM methyl umbelliferyl glucuronide (MUG) and photographed as described in "Materials and methods." Lane 1: standard E. coli β-glucuronidase; Lanes 2-5: protein extract from transformed plants; Lanes 6-7: protein extract from transformed calli; Lane 8: protein extract from non-transformed callus. Twenty μg per lane of protein was loaded in lanes 2 to 8. (10B) Analysis of neomycin phosphotransferase II activity in transgenic rice. Thirty μg protein extracts from transformed or non-transformed rice plants and calli were reacted with Γ-32 P!-ATP, dot blotted on Whatman P81 papers and autoradiographed as described in "Materials and methods." Row A: reactions with kanamycin; Row B: reactions without kanamycin; Lanes 1-3: protein extracts from transgenic plants; Lanes 5-6: protein extracts from transformed calli; Lane 4 and 7: protein extracts from non-transformed plants and callus, respectively.

FIGS. 11A-11J. Expression of the αAmy8 (1.2 kb)/GUS gene in various tissues of transgenic rice plant T1. Thin sections of each organ from transformed or non-transformed plants of 100 cm in height were stained with X-gluc as described in Materials and methods. (11A) Cross section of a leaf blade from a non-transformed plant; (11B) Cross section of a leaf blade from transgenic plant T1; (11C) Higher magnification of the boxed area in (11B); (11D) Cross section of stem of one of the tillers from a non-transformed plant; (11E) Cross section of stem of one the tillers from transgenic plant T1; (11F) Higher magnification of the boxed area in (11E); (11G) Cross section of a leaf sheath from transgenic plant T1; (11H) Cross section of young leaves embedded inside the leaf sheaths of one of the tillers from transgenic plant T1; (11I) Cross section of a root of transgenic plant T1; (11J) Unsectioned root hair from transgenic plant T1. Abbreviations: ph, phloem; mx, metaxylem tracheary element; sc, sclerenchyma; par, parenchyma.

FIG. 12 shows the analysis of GUS activity in R1 seeds of transgenic plant T1. The seeds were germinated in MS medium containing kanamycin and 2,4-D to induce callus formation. The calli were subjected to GUS histochemical staining assay as described in "Materials and methods." CK: callus derived from a seed of non-transformed plant; T: calli derived from seeds of transgenic plant T1.

FIGS. 13A and 13B show the PCR amplification of a 410 bp GUS DNA fragment from R1 progeny of transgenic rice plant T1. DNA was isolated from young leaves of R1 progeny of transgenic plant T1. PCR was performed as described in "Materials and methods." (13A) Amplified DNAs were electrophoresed in 1% agarose gel and detected by ethidium bromide staining. (13B) Same DNAs as in (13A) were blotted on Gene Screen membrane (Du Pont, Wilmington, Del.), hybridized with a 32 P-labeled GUS DNA probe, and autoradiographed. Lane 1: DNA template from non-transformed plant (NT) was used as a negative control; Lane 2: DNA template from plasmid pAG8; Lanes 3-10: DNA template from R1 progenies (no. 1-1 to 1-8) of transgenic rice plant T1.

FIG. 14 shows the expression of GUS in transgenic rice calli.

FIG. 15 shows the accumulation of GUS protein in transgenic rice cells and medium.

DETAILED DESCRIPTION OF THE INVENTION

This invention relates to the gene expression regulation of α-amylase promoter, more specifically rice α-amylase promoter, in plant cells and the application thereof.

Alpha-amylases are major amylolytic enzymes for the hydrolysis of stored starch in the endosperm during germination of cereal grains. Previously, we have shown that the expression of α-amylase genes in rice is under two different modes of regulation: I) hormonal regulation in germinating seeds, and II) metabolic repression in cultured cells by available carbohydrate nutrients (Yu, S.M., et al (1991), J. Biol. Chem., 266:21131-21137). Our previous observations suggested a potentially important control-mechanism of carbohydrate metabolism in higher plants, which might account for the repression of α-amylase gene expression in the embryo of germinating rice seeds (Karrer, E. E., et al (1991), Plant Mol. Biol., 16: 797-805).

Thus, to understand the molecular mechanisms which regulate the expression of α-amylase genes in rice, we have used transgenic rice carrying a reporter gene under the control of an α-amylase promoter for fuctional analysis of regulatory element in the α-amylase genes.

To do this, four α-amylase cDNA clones were isolated from a cDNA library derived from poly(A)+ RNA of giberellic acid (GA3)-treated rice aleurone layers. Nucleotide sequence analysis indicates that the four cDNAs were derived from different α-amylase genes. Expression of the individual α-amylase gene in germinating seeds and suspension-cultured cells of rice was studied using gene-specific probes.

In germinating seeds, expression of the α-amylase genes is positively regulated by GA3 in a temporally coordinated but quantitatively distinct manner. In cultured suspension cells, in contrast, expression of the α-amylase genes is negatively and differentially regulated by sugars present in medium. In addition, one strong and one weak carbohydrate-starvation responsive α-amylase genes are identified.

The interactions between the-promoter region (HS501) of a rice α-amlylase gene and GA3 -inducible DNA binding proteins in rice aleurone cells are also studied. DNA mobility-shift assay results showed that aleurone proteins interact with two specific DNA fragments within HS501. One fragment, located between nucleotide residues -131 and -170, contains two imperfect directly-repeated pyrimidine boxes and a putative gibberellin response element. The other fragment, located between residues -92 to -130, contains a putative enhancer sequence. The interactions between aleurone proteins and these two fragments are sequence specific and GA3 responsive.

We further successfully transferred and expressed a reporter gene driven by an α-amylase promoter in a Japonica type of rice (Oryzae sativa L. cv. Tainung 62) using the Agrobacterium-mediated gene transfer system. Immature rice embryos (10-12 days post-anthesis) were infected with Agrobacterium strains carrying a plasmid containing chimeric genes of β-glucuronidase (GUS) and neomycin phosphotransferase (NPTII). Co-incubation of potato suspension culture (PSC) with the Agrobacterium inoculum significantly improved the transformation efficiency of rice.

The GUS and NPTII genes, which are under the control of promotors of a rice α-amylase gene (αAmy8) and Agrobacterium nopaline synthase gene (NOS), respectively, were both expressed in transgenic calli and plants. Integration of foreign genes into the genomes of transgenic plants was confirmed by Southern blot analysis. Histochemical localization of GUS activity in one transgenic plant (T1) revealed that the rice α-amylase promoter functions in all cell types of the mature leaves, stems, sheaths and roots, but not in the very young leaves. This transgenic plant grew more slowly and produced less seeds than the wild type plant. GUS activity was also detected in calli derived from progeny (R1) of this plant. The GUS gene fragment was amplified by polymerase chain reaction using DNA isolated from the R1 progeny of the same transgenic plant. These data demonstrate successful gene transfer and sexual inheritance of the chimeric genes.

Accordingly, in the present invention we describe the transformation of rice with Agrobacterium and the successful expression of an α-amylase promoter-driven reporter gene in a regenerated plant and R1 progeny of a japonica type transgenic rice. To our knowledge, this is the first report to show Agrobacterium-mediated transformation of rice and to demonstrate inheritance of the transferred DNA by the progeny of the transgenic rice. It should therefore be comprehended that the chosen foreign gene (GUS) used in the present invention plays two roles in the present gene expression system: as a foreign gene to be inserted into the present gene expression system and as a reporting gene for indicating the successful transformation of said gene expression system.

EXAMPLE I

Methods:

a) Conditions for preparation of aleurone RNA, construction of the cDNA library, and screening for α-amylase cDNA clones were performed as follows:

Rice (Oryzae sativa cv. Labelle) seeds were surface sterilized in 2.5% sodium hypochloride for 20 min., washed extensively with sterile distilled H2 O, and incubated in sterile 10 μM GA3 /20 mM CaCl2 /20 mM sodium succinate for different lengths of time. The germinating embryos were cut off and the aleurone layers were peeled off the endosperm. The collected aleurone layers were immediately frozen in liquid N2 and stored at -70° C. until use. Total RNA was isolated from the frozen aleurone layers according to the method of Belanger, F. C., et al (Proc. Natl. Acad. Sci. USA, 83: 1354-1358, 1986). Poly (A)+RNA was purified with HYBOND-mAP affinity paper (Amersham). One microgram of poly(A)+ RNA was used to construct a cDNA library in lamda-gt11 using Amersham's cDNA synthesis and cloning systems. The cDNA library consisted of approximately 2×107 independent recombinant clones. Approximately 2×104 plaques were screened using the 32 P-labeled 1.5 kb fragment of the rice genomic clone, OSamy-C (J. K. Kim and R. Wu (1992), Plant Mol. Biol., 18: 399-402). The cDNA clones in lamda-gt11 were cleaved with EcoR I and subcloned into EcoR I site of pBluescript and maintained in E. coli strain XL1-B (Stratagene).

DNA sequencing was performed with the dideoxy nucleotide chain termination technique. Referring to FIGS. 1A and 1B, nucleotide sequence analysis and comparisons were carried out using programs from the Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin, Version 5.0, June 1987. Nucleotide sequences are aligned and gaps (dash lines) are introduced to maximize sequence similarity. The homologous sequences among the four clones are indicated by asterisks(*). The translation stop codons and polyadenylation signals are underlined. The 5' boundaries of the geneospecific regions are indicated by arrows and the restriction enzymes used for DNA truncation are indicated below their corresponding sites. The nucleotide sequence is numbered from the first base of the sequenced regions. Accession number for αAmy10-C in GeneBank, EMBL, and DDBJ is M81143.

b) Conditions for preparation of 32 P-labeled gene-specific probes were performed as follows:

The four α-amylase cDNAs were truncated at the 5' ends of the gene-specific regions using restriction enzymes indicated in FIGS. 1A and 1B. In vitro transcription of the four truncated cDNAs with the T3 RNA polymerase yields antisense-strand transcripts of sizes 210, 112, 119, and 50 nucleotides, representing αAmy6-C-3', αAmy7-C-3', αAmy8-C-3' and αAmy10-C-3', respectively. 32 P-UTP (Amersham, SP-6 tested) was used to label the probe.

Southern blot analysis which demonstrates the specificity of the α-amylase gene-specific probes was carried out as shown in FIG. 2, in which: Panel 1: the α-amylase cDNA was digested with EcoR I and OSamy-c was digested with BamH I and EcoR I, then electrophoresised on 1% agarose gel, and stained with ethidium bromide. Panels 2-5: four replicates of the same gel as shown in Panel 1 were blotted to GeneScreen membranes, hybridized with the 32P-labeled gene-specific probes at 42° C. for 12 hr. After hybridization, the membranes were washed in 0.1 X SSC and 0.1% SDS at 55° C. for 40 min. The vectors were also hybridized because the antisense RNA probes contained a sketch of 62 bp sequences of the multiple cloning sites of pBluescript between the T3 promoter and EcoR I site where the cDNAs were inserted. Molecular weight markers are shown on the left.

c) Southern blot analysis of α-amylase genes in rice genome was carried out as followes:

With referrence to FIG. 3, total rice genomic DNA was isolated from two month old greenhouse-grown plants. Rice leaves were ground in liquid N2 to fine powder, extracted with urea extraction buffer 42 g/ml urea, 5M NaCl, 1M Tris-Cl (pH 8.0), 0.5M EDTA (pH 8.0), and 20% sarkosine! and equal volumes of phenol-chloroform at room temperature for 15 min. After centrifugation, ammonium acetate (pH 5.2) and isopropanol were added to the supernatant. DNA precipitated immediately and was spooled with a glass hook, rinsed in 75% and 100% ethanol, and air-dried. DNA was resuspended in TE buffer and stored at 4° C. Ten micrograms of genomic DNA was digested with six restriction enzymes, fractionated by electrophoresis using 0.8% agarose gels, and transferred to GeneScreen membrane (DuPont). The membrane was probed with the 32 P-labeled 1.5 kb α-amylase cDNA insert of αAmy10-C. Molecular weight markers are shown on the left.

d) Accumulation of α-amylase mRNA in germinating seeds and suspension cultured cells of rice.

With referrence to FIGS. 4A and 4B, rice seeds were germinated in 10 μM GA3 for different lengths of time. The germinating embryos were cut off and total aleurone RNA was purified from the embryoless seeds according to the method of Belanger, F. C., et al. (Proc. Natl. Acad. Sci. USA, 83: 1354-1358, 1986). Rice suspension cells were cultured as described previously (Yu, S. M., et al (1991), J. Biol. Chem., 266: 21131-21137). RNA was purified from cells grown in the sucrose-containing medium for 8, 10, 12 and 14 days. Five micrograms of total RNA was applied to each lane. The RNA blot analysis was performed according to the method of Thomas P. S. (Methods Enzymol., 100: 255-266, 1983). The plasmid pOSamy-c containing an entire α-amylase coding region in pBluescript was originally subcloned from a rice genomic clone OSamy-c (J. K. Kim and R. Wu (1992), Plant Mol. Biol., 18: 399-402). The 1.5 kb α-amylase DNA insert of OSamy-c was excised from the plasmid vector by restriction enzymes BamH I and EcoR I, gel-purified as described by Maniatis et al. (Molecular Cloning: A Laboratory Mannual, pressed by Cold Spring Harbor Laboratory, 1982), and labeled with α-32 P!dCTP using the random primer method (A. P. Feinberg and B. Vogelstein (1983), Anal. Biochem., 132: 6-13). The gene-specific probes corresponding to each of the four rice α-amylase cDNAs were prepared and labeled as described above with referrence to FIGS. 1A and 1B and FIG. 2. Size of mRNA detected by all of the probes is 1.6 kb.

e) Binding of aleurone protein extract to the 5' specific DNA fragments of a rice α-amylase gene, in which methods for preparation of aleurone layer extract and DNA mobility-shift (gel retardation) assay were as described previously (Yu., S. M., et al (1990), supra).

The results were shown in FIGS. 5A, 5B, and 5C, in which:

(5A) Fragments A, B and C were three consecutive 40 bp synthetic DNA fragments at the 5' end of HS501. Filled box indicates the position of two imperfect directly-repeated pyrimidine boxes and a GARE-like element. Open box indicates the position of the 11 bp putative enhancer like element.

(5B) Interaction of aleurone proteins to fragments A, B, and C. The symbols (+) and (-) indicate reactions with or without protein extract, respectively. B1, B2, and B3 indicate positions of the three protein-DNA complexes. F indicates position of the free DNA probe.

(5C) The nucleotide sequences of fragments A, B, and C. Numbers indicate positions of the three fragments relative to the transcription start site. Underlines indicate positions of the pyrimidine boxes. Asterisks (*) indicate position of the GARE-like element. Dash line indicates position of the enhancer-like element.

Results:

(A) Cloning and characterization of the rice cDNA

The rice cDNA library was screened with the α-amylase gene OSamy-c (J. K. Kim and R. Wu (1992), Plant Mol. Biol., 18: 399-402) as the probe. Four of the α-amylase cDNA clones showing different restriction patterns were chosen for subcloning into the plasmid vector pBluescript. The resultant clones were designated as αAmy6-C (Oryzae sativa α-amylase cDNA), αAmy7-C, αAmy8-C and αAmy10-C with insert sizes of 0.6, 1.0, 1.4, and 1.5 Kb, respectively. The 3' end regions of these cDNA clones were further subcloned and sequenced (FIGS. 1A and 1B). The sequenced 3' regions of αAmy6-C, αAmy7-C and αAmy8-C are found identical to those of the reported rice α-amylase genes RAmy3B (Sutliff, T. D., et al (1991), Plant Mol. Biol., 16: 579-591), RAmy1A (Huang, N., et al (1990a) Plant Mol. Biol., 14: 655-668), and RAmy3E (Huang, N., et al (1990b), Nucl. Acids Res., 18: 7007-7014), respectively. The genomic DNA corresponding to αAmy10-C has not yet been reported. The DNA and deduced amino acid sequence of genomic rice α-amylase genes corresponding to αAmy6-C, αAmy7-C, αAmy8-C and αAmy10-C are respectively set out in detail in SEQ. ID. NO's.: 1 and 2, 3 and 4, and 5 and 6, respectively. The DNA sequence of αAmy10-C is set out in SEQ. ID. NO:7, in which αAmy10-C was sequenced once only.

B) Construction of the rice α-amylase gene-specific probes

Comparison of nucleotide sequences of the 3' untranslated regions shows very low identity (23-27%) among the four α-amylase cDNA clones (FIGS. 1A and 1B), except αAmy7-C and αAmy10-C which showed 69% identity. Restriction sites were selected for separation of the nonhomologous (gene-specific) regions from the homologous regions of these four cDNA clones and for the preparation of antisense RNA probes. The restriction enzymes used and the nucleotide sequences of the gene-specific regions are shown in FIGS. 1A and 1B.

The gene-specific sequences corresponding to each of the four cDNAs are designated as αAmy6-C-3', αAmy7-C-3', αAmy8-C-3' and αAmy10-C-3'. Appropriate regions were selected for αAmy10-C-3' in which there is very low homology with αAmy7-C-3'. Cross-hybridizations were then performed to determine the gene-specificity and the results showed that each probe only hybridized to its respective parental cDNA (FIG. 2). None of these gene-specific probes hybridized to OSamy-c, which was originally used as the probe to screen the cDNA library. The results demonstrated that the four gene-specific probes are able to discriminate different α-amylase genes.

(C) The rice α-amylases are encoded by a gene family

Identification of the four distinct α-amylase cDNAs indicates that the rice α-amylases are encoded by a gene family. To determine the number of α-amylase genes in rice, total genomic DNA isolated from rice leaves was digested with various restriction enzymes and probed with the entire αAmy10-C sequences at low stringency (FIG. 3). Eight or nine restriction fragments were observed when total DNA was digested with EcoR I. The result generally is in agreement with the reported restriction maps of the rice α-amylase genes (Huang, N., et al (1990a), supra). Since two α-amylase genes were shown to be linked on one EcoR I fragment (Huang, N., et al (1990b), supra), the entire rice genome is estimated to contain at least 10 genes. Parallel genomic DNA blots were also hybridized with the four rice α-amylase gene-specific probes. Each gene-specific probe hybridized specifically to only one restriction fragment (data not shown) further confirming that each probe is derived from one α-amylase gene.

(D) Expression of α-amylase genes in rice germinating seeds

To determine whether the expression of different members of a α-amylase gene family are regulated in a same manner during seed germination, gene-specific probes were used to study the expression of individual α-amylase genes in GA3 -treated germinating seeds. The accumulation of α-amylase mRNA in aleurones as a function of time after GA3 addition was determined by RNA blot analysis (FIG. 4A). Probe made from pOSamy-c containing the coding region of a rice α-amylase gene was expected to hybridize to mRNAs of most, if not all, α-amylase genes. The α-amylase mRNA was barely detectable at day 1, rapidly accumulated and reached their maximal levels at day 4, then rapidly turned over between day 4 and day 5. A rice actin cDNA clone, pcRAc1.3 (McElroy, D., et al (1990), Plant Mol. Biol., 14: 163-171), whose expression was not affected by GA3 was used as an internal control.

Level of mRNA showm in FIG. 4A was quantified by measuring the signal intensity of the autoradiogram using a densitometer. The relative mRNA accumulation of each α-amylase gene at each day was determined by comparison of mRNA levels with their peak level at day 4 (Table 1). The mRNA of each α-amylase gene accumulated at a similar rate, except that of αAmy8-C, which almost reached peak level at day 3. However, the mRNAs of αAmy6-C and αAmy8-C were turned over at higher (2-fold) rates than those of αAmy7-C and αAmy10-C. The mRNA levels of αAmy7-C and αAmy10-C were reduced to 1/2, in contrast, those of αAmy6-C and αAmy8-C were reduced to 1/4, of their highest levels at day 5. Afterward all the mRNA levels were reduced at similar low rates. The results show that expression of the four α-amylase geens in germinating seeds are temporally coordinated but quantitively distinct.

(E) Expression of α-amylase genes in cultured suspension cells of rice

Previously, we have shown that the expression of α-amylase genes in cultured suspension cells of rice is induced by the deprivation of carbohydrate nutrient (Yu, S. M., et al (1991), supra). In that report, OSamy-c was used as a probe to study the expression of the entire α-amylase gene family in suspension-cultured cells. Here, gene-specific probes were used to determine the expression pattern of different α-amylase genes. We have shown that the sugars (analyzed by the anthrone reaction) in the sucrose-containing medium were depleted to almost undetectable levels at day 12. A concomitant increase in α-amylase mRNA was observed at day 12 (Yu, S.M., et al (1991), supra). Therefore, RNA's purified from cells grown in the sucrose-containing medium for 8, 10, 12, and 14 days were used for the RNA blot analysis (FIG. 4B). A cDNA clone, pOScx, which was randomly chosen from the same cDNA library, and whose expression was not affected by sugar depletion, was used as an internal control.

Level of mRNA shown in FIG. 4B was also quantified and the relative mRNA accumulation of each α-amylase gene at each day was determined by comparison of mRNA levels with their basal level at day 8 (Table 2). Expression of αAmy7-C and αAmy8-C was induced 6- and 37-fold, respectively, at day 12 and continued to increase at day 14. Expression of αAmy10-C was induced later with a 5-fold increase at day 14. Expression of αAmy6-C also increase 4-fold at day 12, however, it decreased to basal level at day 14. Expression of another α-amylase gene, αAmy3-C, was increased 5-fold after sugar starvation (Yu, S. M., unpublished result). Therefore, among the five α-amylase genes examined so far, αAmy8-C is the most abundantly expressed gene after sugar depletion.

In addition, it is worthwhile noting that αAmy8-C is one of the major genes whose transcripts constitute the 40-fold increase of total α-amylase transcripts as detected with probe of OSamy-c. The results show that expression of the four α-amylase genes in response to carbohydrate starvation in the cultured cells is temporally and quantitatively regulated.

(F) Specific regions of the promoter of a rice α-amylase gene interacting with protein factors in the GA-treated aleurone layer

HS501 is a DNA fragment which is located at the 5' end promoter region of a rice α-amylase gene, OSAmy-b (Ou-Lee, T. M., et al. (1988), supra), and its DNA sequences have been presented (Yu, S. M., et al. (1990), supra). Nucleotide sequence of HS501 was later found identical to that of RAmy3C which encodes a complete rice α-amylase isozyme (Sutliff, T. D., et al. (1991), supra). DNA sequence of HS501 includes 260 nucleotides of the 5' non-coding region, and 270 nucleotides in the first and part of the second exons. HK350 is a 3' end-deleted derivative of HS501 and contains the entire 5' non-coding (260 bp) and the first exon regions (90 bp) of HS501. RNA blot analysis showed that α-amylase mRNA of aleurone cells, detected by probing with HK350, was also increased after GA3 treatment (FIG. 4A).

Previously, we have shown that the 5' end of HS501 is important for stable formation of a protein-DNA complex (Ou-Lee, T. M., et al. (1988), supra; Yu, S. M., et al. (1990), supra). To more precisely localize the protein binding sites in HS501, we synthesized three consecutive double-stranded 40 bp oligonucleotides, designated as A, B and C, corresponding to the 5' end of HS501 (FIG. 5A). Proteins were extracted from the aleurone tissues of GA3 -treated germinating seeds and interactions between aleurone proteins and the synthetic DNA fragments were detected by the gel retardation assay (FIG. 5B). Interaction of the extract with fragments B and C resulted in the formation of complexes B1, B2 and B3 (FIG. 5B, lanes 4 and 6). Very weak, if any, binding could be detected between the protein extract and fragment A (FIG. 5B, lane 2). Comparison of DNA fragments A, B and C reveals that the three fragments shared some similarity (FIG. 5C). It is not clear whether the weak binding of fragment A to the proteins was due to low affinity or non-specific binding. Nevertheless, the result indicates that there are protein binding sites within fragments B and C.

(G) GA3 -dependent and sequence-specific protein factors which bind to HS501

We carried out another protein/DNA binding assay to determine whether or not the DNA-binding protein is GA3 -inducible. Proteins were extracted from the aleurone tissues of de-embryoed seeds which had been treated either with or without GA3 for three days. Only the aleurone extract from GA3 -treated seeds gave rise to three complexes using fragment B (FIG. 6, lane 4) or C (data not shown). The aleurone extract did not bind to fragment A (data not shown). No DNA/protein interaction was detected between the aleurone extract from seeds untreated with GA3 and fragment B (FIG. 6, lane 2). The results indicate that the aleurone proteins which bind to fragments B and C are GA3 dependent.

Conclusions:

(1) The availability of gene-specific probes corresponding to each of the four α-amylase cDNAs has enabled us to examine the abundance of mRNA encoding specific α-amylase isozymes. Expression of the individual α-amylase gene was found to be coordinately regulated and their mRNAs were accumulated at similar rates and levels in the aleurone layer of germinating seeds of rice. However, differences in the turnover rates of mRNA of different a-amylase genes indicate a possible differential regulation on the expression of different α-amylase genes in germinating seeds. The four α-amylase genes expressed in germinating seeds were expressed constitutively at low levels in cultured cells when sugars were still present in medium. Expression of three of the four α-amylase genes were induced after sugars are depleted from the medium, and only αAmy6-C displays a different expression pattern from the other three genes. It is not known whether different α-amylase isozymes perform different functions in the starch hydrolysis in rice, or whether the regulatory machinery is differentially acting on a set of α-amylase genes which have similar structures and/or functions. Further investigations on the regulation and expression of different members of the α-amylase gene family in different tissues, and their structural and functional relationships, should help us to better understand the physiological roles of α-amylases in rice.

(2) GA3 and sugars regulate expression of the same α-amylase genes. Whether the two modes of regulation operate through an identical or different molecular mechanism is not known. As expression of αAmy8-C was GA3 regulated in germinating seeds and is one of the major metabolite-regulated genes in suspension-cultured cells, it would be a good model gene for such studies. Molecular mechanisms underlying the two different modes of regulation and interactions between them will be the focus for further studies.

(3) Aleurone tissues contain proteins that interact with fragments B and C of HS501 only in the presence of GA3. Fragment C contains an 11 bp fragment (GTTGCGTTTCT) from positions -108 to -118 which is similar to the animal core enhancer ##STR1## (Gillies, S. D., et al., Cell (1983), 33: 717-728; Weiher, H., et al (1983) Science, 219: 629-631). Fragment B contains two pyrimidine boxes ##STR2## from positions -145 to -152 and positions -157 to -164 which are similar to the consensus sequences ##STR3## found in several α-amylase genes of rice, wheat, barley and other GA-inducible genes such as β-glucanase, carboxypeptidase and aleurain (Huang, N., et al (1990a), supra). Promoter deletion analysis demonstrated that sequences encompassing two of the three pyrimidine boxes in the promoter region of a wheat α-amylase gene, αAmy2/54, are required for high level expression and GA3 regulation of this gene (A. K. Huttly and D. C. Baulcombe (1989), supra). Mutation of the pyrimidine box in the promoter region of a barley α-amylase gene, Amy32b, significantly decrease both the absolute level of expression and the effect of GA3 on expression (Lanahan, M. V., et al (1992), Plant Cell, 4: 203-211). In addition, sequence immediately 3' to the second pyrimidine box in fragment B of HS501, reads TAAATGAG from positions -138 to -145, sharing conservation with the putative GARE element TAACAGAG (Huang, N., et al (1990a), supra; Lanahan, M. V., et al (1992), supra) which is shown to mediate hormonal regulation of the α-amylase gene (Lanahan, M. V., et al (1992), supra; Skriver, K., et al (1991), supra). Whether or not the GA-responsive proteins, the pyrimidine boxes, and the putative GARE element represent the trans- and cis-regulatory elements responsible for GA stimulation of the rice α-amylase genes remain to be determined.

EXAMPLE II

In this experiment, the αAmy8 gene was selected from the foregoing four α-amylase genes for further studying the construction of a chimeric gene containing GUS/NPTII, the expression of which was under the control of the promoter region of said αAmy8 gene, and nopaline synthase gene (NOS), respectively.

A) Materials and Methods:

1) Plant materials:

The rice variety used for transformation was Oryzae sativa L. cv. Tainung 62. At 10-12 days post-anthesis, seeds were dehulled, sterilized with 1% NaOCl and 1 drop of Tween-20 for 90 min., and washed extensively with sterile distilled water. Immature embryos were excised aseptically in a lamina flow bench. Excised embryos were placed on N6RD medium (Chan, M. T., et al (1992), supra) containing N6 salts (Chu, C. C., et al, Scientia Sinica 18: 659-668, 1975), N6 vitamins, 3% sucrose, 0.8% agarose (w/v), 2 μg/12,4-D, and cultured at 25° C. for 16 hours under light (1000 lux). Two days later, the immature embryos were inoculated with Agrobacterium.

2) Bacterial strain and plasmid:

An isolated 1.2 kb fragment, just upstream of the coding region of a rice α-amylase gene αAmy8, was joined to the E. coli β-glucuronidase (GUS) (Jefferson, R. A., Plant Mol. Biol. Rptr., 5: 387-405, 1987) with a nopaline synthase (NOS) gene terminator to test the promoter's activity. This chimeric gene αAmy8 (1.2 kb)/GUS! was inserted between restriction sites Xba I and Sal I of multicloning regions of the binary vector plasmid pBIN19 (Bevan, M. W., Nucl. Acids Res., 12: 8711-8721, 1984) to generate a new plasmid pAG8 (FIG. 7). Plasmid pAG8 was transfected into Agrobacterium tumefaciens strain A281 (Hood, E. F., Bio/technology 2: 702-709, 1984) using the freeze-thaw method (Holster, M., et al (1978), Mol. Gen. Genet., 163: 181-187). Agrobacterium tumefaciens was grown overnight at 28° C. in YEB medium (Zaenen, J., J. Mo. Biol., 86: 109-127, 1974) containing 100 mg/1 kanamycin.

B) Transformation:

Twenty-five immature embryos were wounded by sterilized forceps and scalpels and co-cultivated overnight with 25 μl of overnight Agrobacterium culture in a petri dish containing 10 ml of potato suspension culture (PSC), then incubated at 26° C. in the dark for 3 days. For the control, 10 ml of fresh potato suspension culture medium (Chang, H. H., (1991), supra) without addition of potato suspension cells was used. Conditions for potato suspension culture have been described previously (Chang, H. H., (1991), supra).

The infected immature embryos were washed once with potato suspension culture medium containing 500 μg/ml cefotaxime to kill the Agrobacterium and then transferred to N6RF medium containing N6 salts, N6 vitamins, 42.5 μg/ml 4-fluorophenoxyacetic acid (4-FPA), 3% sucrose, 0.8% (w/v) agarose, 40 μg/ml G-418, and 500 μg/ml cefotaxime. The pH of the medium was adjusted to 5.7 before autoclaving. The embryos were cultured at 25° C. for 16 hours under light (2000 lux) and subcultured at weekly intervals.

C) Selection and regeneration of transformants:

Calli were formed from the cultured embryos 3 weeks after Agrobacterium inoculation. The calli were transferred to N6RFB medium (similar to N6RF but containing 13 μg/ml 4-FPA, 1 μg/ml 6-benzylamino-purine (6-BAP), 40 μg/ml G-418 and 200 mg/ml cefotaxime) for selection of transformants. After selection for 3 weeks, calli were transferred to N6 medium for shoot regeneration and root development. Regenerated plants were eventually transferred to pot soil in the greenhouse and grown to self-pollination. Segregation of the kanamycin resistant phenotype in the progeny was analysed by germinating the R1 seeds on MS medium containing 300 μg/ml kanamycin.

D) DNA isolation and analysis of gene incorporation

DNA from transgenic plants was isolated according to the CTAB method (M. G. Murry and W. F. Thompson, Nucl. Acids Res., 8: 4321-4325, 1980). DNA bolt analysis was performed as described by Maniatis et al (Molecular Cloning: A Laboratory Mannual, pressed by Cold Spring Harbor Laboratory, 1982). The probe for GUS was made from the BamH I-Sst I restriction fragment of the pBI221 plasmid (Clontech, Palo Alto, Calif.). The DNA probe was labeled with α32 P!dCTP using the random primer method (A. P. Feinberg and B. Vogelstein, Anal. Biochem., 132: 6-13, 1983).

To demonstrate the absence of any Agrobacterium contamination in the transformed plants, the same nylon filters hybridized with GUS DNA were stripped and rehybridized with the probe made from the Hind III 18 and Hind III 27 DNA fragment containing the vir B and vir D regions of pTiC58 (Depicker, A., et al (1980), Plasmid, 47: 193-211; Janssens, A., et al (1986), Plant Sci., 47: 185-193).

E) Assay for neomycin phosphotransferase II (NPTII) activity

The NPTII activity in the putatively transformed calli and plants was assayed in at least four replicates using a modification of a method described by Radke, S. E., et al (Theor. Appl. Genet., 75: 685-694, 1988). Leaf tissue (100 mg fresh weight) was ground in a 1.5 ml Eppendorf tube with an equal volume (100 μl) of extraction buffer (2.5 mM Tris (pH 6.8), 0.143 mM β-mercaptoethanol, 0.27 mM leupeptin), and centrifuged for 15 min. at 4° C. Thirty μg protein were mixed with 10 ml of reaction buffer A (67 mM Tris-maleate, 42 mM MgCl2, 400 mM NH4 Cl, 1.7 mM dithiothreitol, and 0.4 mg/ml kanamycin sulfate) or reaction buffer B (identical to reaction buffer A but without kanamycin).

Five μl of ATP solution (1.0 uCi Γ-32 P!ATP and 0.75 mM ATP in reaction buffer B) was added. The samples were incubated in a 30° C. water bath for 30 min., then blotted onto three layers of Whatman P81 ion exchange paper placed on top of one piece of Whatman 3 MM paper using a "Hybri-Dot" blotting apparatus (BRL). All the ion exchange papers were washed twice with distilled water for a total of 4 min. and incubated in a 10 ml solution containing 1 mg/ml) proteinase K and 1% SDS at 65° C. for 60 min. The papers were then washed once with distilled water at room temperature for 4 min. and three times with distilled water at 85° C. for 4 min. The 3 pieces of paper were air-dried, stacked in their original positions, and exposed to X-ray film (Kodak) with an intensifying screen.

F) Assay of β-glucuronidase (GUS) activity

To measure GUS activity in the putatively transformed calli and plants, at least two replicates of each sample were assayed according to R. A. Jefferson's method ("Analysis of gene organization and expression in plants," In: Plant Genetic Transformation and Gene Expression, A Laboratory Manaul, Blackwell Scientific Publications, Oxford, Draper, J., et al (eds) pp. 263-339, 1988). Samples were homogenized with GUS extraction buffer (50 nM sodium phosphate (pH 7.0), 10 mM EDTA, 10mM Triton X-100, 0.1% sarkosyl, and 10 mM β-mercaptoethanol). Twenty μg protein with an equal volume of SDS sample buffer (62.5% mM Tris-HCl, 0.23% SDS, 10% glycerol, 50 mM 5-mercaptoethanol, and 0.001% bromophenol blue) were incubated at room temperature for 15 min. Electrophoresis was run overnight at room temperature at 3 V/cm.

The gel was washed with 100 ml of GUS extraction buffer four times within 2 hours, incubated with GUS fluorometric buffer (1 mM methyl umbelliferylglucuronide in GUS extrac-tion buffer) on ice for 30 min., and incubated at 37° C. in the dark for 30 min. The reaction was stopped with 0.2 M Na2 CO3. The gel was illuminated by a 365 nm UV lamp with a Kodak 2E Wratten filter and photographed.

Localization of GUS expression in the transformed plants was evaluated by 5-bromo-4-chloro-3-indolyl glucuronide (X-gluc) histochemical assay (Benfey, P. N., et al (1989), EMBO J., 8: 2195-2202). Sections of leaf blade, sheath, stem or root of nontransformed or transformed 4-month-old plants were cut with a Vibratome (Oxford) sectioning device. Sections of 100 to 200 microns were incubated in a solution containing 1 mM X-gluc, 10 mM EDTA, 100 nM NaH2 PO4.H2 O (pH 7.0), and 0.1% Triton X-100 at 37° C. for 12 to 17 hrs. After staining, sections were rinsed in 70% ethanol for 5 min and chlorophyll in the sections was cleared by incubation for 10 min. in a solution of 5% formaldehyde, 5% acetic acid and 20% ethanol, followed by incubation for 2 min. in 50% ethanol, 2 min. in 100% ethanol, and two washings in distilled water. The sections were examined under a microscope. GUS activity in the R1 progeny was assayed by staining.

The R1 seeds were first germinated in MS medium containing 2 μg/ml 2,4-D and 300 μg/ml kanamycin to induce callus formation. Calli were formed from the germinating seeds after 1 week. A portion of each callus was removed and subjected to a modified GUS histochemical staining assay (Benfey, P. N., et al (1989), supra). Briefly, calli of the R1 progeny or control were incubated at 37° C. for 12 to 17 hrs. in a solution containing 1 mM X-gluc, 10 mM EDTA, 100 mM NaH2 PO4.H2 O (pH 7.0), and 0.1% Triton X-100. Photographs were taken with a Kodacolor 64 film under a dissecting Microscope (Olympus).

G) PCR

Two sequences in the GUS coding region were chosen to amplify a 410 bp fragment within the gene: The 5' primer (ACGTCCTGTAGAAACCCCAA) and the 3' primer (AGTTCAGTTCGTTGTTCACACA) located in the GUS coding region 3 bp and 417 bp downstream of the translation initiation site (ATG), respectively. One hundred μg of pAG8 were used as positive control; 100 ng of total rice DNA from young leaves of the R1 progeny were used. PCR was carried out in a 50 μl solution containing 50 mM KCl, 10 mM Tris-HCl, 15 mM MgCl2, 0.1% gelatin (w/v), 1% Triton X-100, 0.2 mM of each deoxynucleoside triphosphate (dATP, dCTP, dGTP, dTTP), 2.5 units of Taq DNA polymerase (Promega), and 0.25 mM of each primer.

The sample was preheated at 94° C. for 5 min. and subjected to PCR amplification for 27 cycles. Cycling was controlled by a programmable thermal cycler (MJ Research, Inc.) programmed with the following conditions: denaturation, 94° C. for 1 min.; annealing, 58° C. for 2 min.; extension, 72° C. for 3 min. The sample was then incubated at 58° C. for 2 min. and 72° C. for 10 min. Five μl of the PCR product was electrophoresed in a 1% agarose gel and detected by staining with ethidium bromide. Southern blots of PCR products were hybridized with a probe made from-the BamH I-Sst I GUS restriction fragment.

Results:

A) Transformation of immature rice embryos by Agrobacterium tumefaciens

Previously, we have shown that transformation of rice using Agrobacterium can be improved by the addition of PSC (Chan, M. T., et al (1992), supra). Here, presence of PSC with the Agrobacterium inoculum increased the transformation efficiency almost 3-fold (Table 3). Approximately 6.8% of immature rice embryos inoculated with Agrobacterium formed calli and proliferated on selective medium. The uninoculated or inoculated but non-transformed immature embryos turned brown and died within 3 weeks (FIG. 8A).

After culture of calli, shoots developed rapidly and roots formed spontaneously after 4 weeks (FIG. 8B). Among the 250 immature embryos inoculated, 17 calli and 4 plants were recovered from culture. The four transgenic plants were designated T1, T2, T3 and T4. These plants were ready to be transplanted into soil after 9 weeks of culture (FIG. 8C). Only one plant, T1, survived to flower and produce progeny (FIGS. 8D-8F). This transgenic plant exhibited normal phenotype and was fertile, except that it grew more slowly (about 14 weeks from being a 121 cm long plant to flowering) and produced less seeds (total 75 seeds) than a wild type plant. The other three transgenic plants were also transplanted into soil but did not survive.

B) DNA analysis of transformants

To provide physical evidence for the integration of foreign DNA into the genome, Southern blot analysis of restriction digests of genomic DNA from leaves of the 4 transgenic plants (T1, T2, T3 and T4) was performed using the GUS DNA from pBI221 as a probe (FIG. 9). The size of the undigested rice genomic DNA (Unc) was about 50 kb (FIG. 9, lanes 2 and 6). After digestion with BamHI (B), GUS DNA was detected as a fragment of the expected size 2.3 kb (FIG. 9, lanes 3, 7 and 9), the same size as that present in pAG8 (FIG. 9, lane 1). After digestion with Hind III (H) or Pst I (P), the 50 kb band disappeared and the lower molecular weight DNA fragments appeared (FIG. 9, lanes 4, 5, 8, 10 and 11).

Transgenic plant T4 appeared to have two integration sites for the GUS gene as two hybridization bands were detected when DNA was digested with Hind III (FIG. 9, lane 11). Since the GUS DNA probe only hybridized to DNA from the 4 transgenic plants but not to the non-transformed control plant (NT) (FIG. 9, lane 12), this indicates that the GUS gene was integrated into the rice genome.

To prove that the GUS DNA detected in FIG. 9 did not result from contamination with Agrobacterium in the transgenic plants, the same nylon filter was reprobed with vir B and vir D DNA. As the vir genes are not located on the Ti-plasmid, Southern blot analysis using vir DNA as a probe should provide a reliable way to detect Agrobacterium contamination. The Agrobacterium strain A281 used in this experiment was derived from strain C58 which carries pTiC58. A probe made from the Hind III 18 and Hind III 27 DNA fragments containing the vir B and vir D regions of pTiC58 should thus hybridize to DNA of Agrobacterium. However, no hybridization band was observed when using the vir DNA as a probe (data not shown), clearly demonstrating that the GUS DNA detected in the genome of the transgenic plants was not due to persisting Agrobacterium cells in the rice tissues.

C) Expression of GUS and NPTII in the transgenic calli and plants

The GUS coding sequence in pAG8 was placed downstream of the putative 5' promoter region of an α-amylase gene (αAmy8) so as to make a transcriptional fusion. To investigate the promoter function of the 1.2 kb long 5' region of this α-amylase gene, expression of the GUS gene was determined by the presence of GUS activity in the transgenic calli and plants.

GUS present in the cell extracts migrated in an SDS-polyacrylamide gel with an apparent molecular weight of 69 kDa (FIG. 10A). The levels of GUS activity that could be detected in the four transgenic plants and callus C1 were similar (FIG. 10A, lanes 2-6). The lower level of GUS activity in transgenic callus C2 (FIG. 10A, lane 7) seems to be coupled with its lower level of NPTII activity (FIG. 10B, lane 6. No GUS activity was detected in the non-transformed callus (NT) (FIG. 10A, lane 8). The results suggest that the 1.2 kb 5' region of αAmy8 contains an efficient promoter for regulating GUS gene expression.

Plasmid pAG8 contains the NPTII coding region driven by the nopaline synthase promoter. Consequently, selection for plants carrying foreign genes should be achieved using media containing G418. The NPTII activity was further determined in 8 randomly chosen transformed calli (R0) and 3 transgenic plants (T1, T2, and T3). All of the 8 transgenic calli expressed NPTII activity and data for 2 of them (C1 and C2) are presented (FIG. 10B, lanes 5 and 6). NPTII activity was also detected in the 3 transgenic plants (FIG. 10B, lanes 1, 2, and 3). No activity was observed in the non-transformed callus (FIG. 10B, lane 7) and plant (FIG. 10B, lane 4).

D) Histochemical localization of GUS in transgenic rice plant

To localize the cellular expression pattern of the GUS gene driven by the 5' region of αAmy8, various tissues of the transgenic plant (T1) were sectioned and subjected to histochemical staining (FIGS. 11A-11J). Blue staining of sections appeared 17 hr after incubation in the substrate. GUS expression was observed in all cell types of leaf blade (FIGS. 11B, 11C), stem (FIGS. 11E, 11F), and sheath (FIG. 11G). Tissue sections of leaf blade and stem from non-transformed control plants displayed no staining (FIGS. 11A, 11D). Transverse sections of root revealed that the epidermal cells were stained blue and the cortex cells were stained lightly (FIG. 11I). Unsectioned root hairs showed intense staining in the vascular cylinder and light staining in the cortex cells (FIG. 11J). No GUS expression was found in the sections of very young leaf blades which were embedded inside sheaths (FIG. 11H).

E) Analysis of R1 progeny

Of the 75 seeds harvested from the transgenic plant T1, 36 seeds were germinated on selective media (containing 300 μg/ml kanamycin) to induce callus formation. Within 10 days, 32 germinating seeds formed calli and continued to grow and were identified as resistant. The other 4 germinating seeds also formed calli, but turned brown and died later. About half of each kanamycin resistant callus was removed and assayed for GUS activity.

Of the 32 calli assayed, 28 showed blue staining and 4 calli remained yellow, similar to the non-transformed control (data for 4 of them are presented in FIG. 12). Calli derived from different transgenic R1 seeds showed considerable variation in GUS activity, as revealed by different degrees of blue staining (FIG. 12).

Among the remaining 39 seeds of T1, 18 seeds were germinated and grown in a greenhouse. DNA was isolated from young leaves of 13 of these R1 plants when they were 10 cm tall. The DNA was subjected to PCR amplification of a 410 bp fragment within the GUS coding region (FIG. 13A). Identification of the amplified DNA was established by blot hybridization to a 32 P-labeled GUS DNA probe (FIG. 13B). These results further confirmed the presence of GUS genes in the R1 progeny of the original transformant.

Discussion:

Although several methods for the transformation of rice using protoplasts or suspension cells are available at present, attempts to regenerate mature plants from the transformed protoplasts or suspension cells of many rice varieties have been unsuccessful. Methods based on the use of the soil bacterium Agrobacterium tumefaciens are still preferred in many instances, as Agrobacterium-mediated transformation does not require protoplasts and, in general, results in higher transformation efficiency and a more predictable pattern of foreign DNA integration than other transformation techniques (Czernilofsky, A. P., et al (1986), DNA, 5: 101-113). Here we show that transgenic rice plants are successfully produced using an Agrobacterium-mediated DNA transfer system.

Two factors may have contributed to the success in rice transformation and regeneration. The first factor is the addition of PSC during the co-cultivation of Agrobacterium with the immature rice embryos. PSC probably contains substances which enhance the Agrobacterium-mediated T-DNA transfer process, since PSC induced the formation of calli one week earlier and enhanced the frequency of transformation about 3-fold (Table 3). PSC is rich in acetosyringone and sinapinic acid (Chang, H. H., et al (1991), supra), which are generally believed to enhance transformation of various plant species (Stafer, W., et al (1985), supra). However, the role of these two compounds in the success or efficiency of transformation is not clear at this time. The transformation percentage of 1.6% that we obtained for producing transgenic plants would render the use of Agrobacterium to transfer genes into rice more feasible.

The second factor for successful transformation and regeneration is the use of immature rice embryos (10 to 12 days after pollination) as the transformation materials, since they may contain less inhibitors or more virulence inducers than mature embryos to T-DNA transfer. Immature embryos of maize have also been shown to be competent for Agrobacterium-mediated gene transfer and that competence depends on genotype and developmental stage. Meristematic tissue of the immature embryo becomes competent at developmental stages that correlate with the differentiation of the first one to two leaf initials (M. Schlappi and B. Horn (1992), Plant Cell, 4: 7-16).

Therefore, the immature embryos at some developmental stages may produce conditions which increase the success of T-DNA transfer, such as (a) the availability of vir gene-inducing substances, (b) low production of bacteriotoxic substances, (c) favorable endogenous hormone levels, and (d) the availability of receptors for attachment of Agrobacterium (M. Schlappi and B. Horn (1992), supra).

Although only four plants could be regenerated from the transformed calli in this experiment, all these plants were proved to be real transformants. Integration of chimeric genes into the genomes of the four transgenic plants was confirmed by hybridization of the restricted genomic DNA. In addition, our experiments ruled out the possibility of Agrobacterium contamination of the rice tissues as a possible source of the hybridization bands.

Detection of NPTII and GUS activities in the transgenic plants indicates that the integrated foreign genes were expressed. Our results also indicate that kanamycin can be used to select transformed rice cells from a mixed population of transformed and non-transformed cells. To avoid the occurrence of kanamycin escapees, it is important that selection be applied immediately after the co-cultivation.

Of the 4 regenerated transgenic plants, only one plant (T1) survived to flower and produce progeny. Transgenic plant T1 flowered in December, when the room temperature in the greenhouse was below 20° C., but we don't know whether this was one of the reasons for its low yield (75 seeds). The transgenic R1 progeny inherited and expressed the NPTII and GUS genes, as shown by their resistance to kanamycin and expression of GUS activity. A 3:1 ratio was expected in the progeny from self-pollination, assuming that the gene was transmitted as a single dominant locus.

In the GUS staining assay in conjunction with kanamycin selection of calli derived from immature embryos of 32 R1 progeny, 28 were GUS positive and kanamycin resistant, 4 were GUS negative but kanamycin resistant, and 4 were GUS negative and kanamycin sensitive. This 28:8 or 3.5:1 ratio indicates that GUS segregation in the R1 progeny of transgenic plant T1 is consistent with the predicted 3:1 Mendelian inheritance pattern in a heterozygous x heterozygeous cross.

The lack of GUS activity in the 4 kanamycin-selected R1 may indicate that the GUS gene was either absent or present but nonfunctional. Absence of the GUS gene in the kanamycin-resistant R1 could be due to deletion of the GUS gene via DNA rearrangement. PCR amplification of GUS DNA fragments was achieved from DNA of 13 out of 18 R1 plants tested. The 13:5 or 2.6:1 ratio is also close to the theoretical Mendelian segregation pattern.

The rice α-amylases are encoded by a multigene family which contains at least ten distinct members (Huang, N. et al (1990), Plant Mol. Biol., 14: 655-668). Genomic and cDNA clones representing different members of the α-amylase gene family have been isolated in our laboratory. Expression of the α-amylase gene, αAmy8, is GA3 -regulated in germinating seeds. This gene is also one of the major metabolite-regulated genes in cultured suspension cells of rice (Yu, S. M., et al., unpublished result). In our experiments, the DNA resulting from fusion of the 1.2 kb 5' flanking region of αAmy8 to the reporter gene GUS was transformed into rice. Expression of GUS in the transgenic rice indicates that this 1.2 kb fragment contains a functional promoter.

Thus, use of transgenic rice carrying a reporter gene under the control of an α-amylase promoter has provided a new tool for analyzing the regulatory elements in the α-amylase promoters. Such studies should lead to an understanding of the regulation of α-amylase gene expression in rice.

To our surprise, the histochemical localization of GUS activity indicated that the αAmy8 promoter was functional in all cell types of the mature leaves, stems, sheaths and roots of the transgenic rice plants. The only tissues which did not express GUS were the very young leaves embedded inside the sheaths. GUS was active in cells of the epidermis, mesophyll and vascular bundles of leaves. It was also active in the epidermis, cortex, and vascular cylinder of the roots. Therefore, the expression of αAmy8/GUS is not tissue-specific. Rather, it is temporally regulated in the transgenic plant, though it is not known at which growth stage of leaves αAmy8 begins its expression. Our histochemical studies were performed only with T1, the single transgenic plant that survived after being transferred to soil.

The possibility that αAmy8/GUS was inserted close to a very active enhancer in the rice genome, which could render high-level expression or loss of tissue-specific expression of the foreign gene cannot be ruled out. However, αAmy8 is apparently one of the major metabolite-regulated genes in cultured suspension cells (Yu, S. M., et al. (1992), Gene, inpress) and thus probably plays an important role in the carbohydrate metabolism of the vegetative tissues of rice.

Therefore, it is not totally surprising that the GUS gene driven by αAmy8 promoter is constitutively expressed in every cell type of different tissues of the transgenic plant. If this is also true for the naturally existing α-amylase gene in wild type plants, it would be interesting to know the physiological function of αAmy8 promoter in rice. The general distribution and levels of GUS activity obtained in different tissues of stably transformed rice plants indicate the potential of αAmy8 promoter as a positive control for studies in gene activity in transgenic rice.

In conclusion, this experiment demonstrates that immature rice embryos are susceptible to Agrobacterium-mediated transformation and that the foreign genes transferred are inherited by the next generation of the transformant.

In addition to the rice variety Tainung 62 (Japonica type) used in this experiment, T-DNA has also been successfully transferred into genomes of other rice varieties including Tainan 5 (Japonica type) and Taichung Native no. 1 (Indica type) using the same approach (M. T. Chan, H. H. Chang and S. M. Yu, unpublished result). Therefore, it is proposed that this simple approach can be applied to transform other rice varieties and, with modification, other monocot species.

EXAMPLE III

As noted from the beginning, an objective of the present invention is to provide a new gene expression system functional in plant host cells, thereby rendering the expressed gene product capable of being directly recovered from medium. To achieve this purpose, based upon the results obtained in Example II, further experiments were carried out to investigate the regulation of the promoter region of αAmy8 with respect to the expression of the foreign gene GUS in the present transgenic rice cells.

More specifically, it was studied whether or not the expression of said GUS gene under the control of said promoter will be influenced by a sugar-depleted or sugar-free condition. The following experiments adopted the materials and methods described in Example II.

Immature embryos of rice were transformed with Agrobacterium tumefaciens which carried the αAmy8/GUS chimeric gene (pAGS). Calli derived from the transformed embryos were then grown in liquid MS medium containing 2 μM 2,4-D to establish a suspension culture of rice. The cell cultures were subcloned every 5 days. For this experiment, suspension cells were transferred to medium with (+) or without (-) sucrose for two days. RNA was purified from the treated cells and the GUS mRNA was detected by Northern blot analysis using 32 P-labeled GUS DNA as probe. 10 μg of total RNA was loaded in each lane. The results are shown in FIG. 14. To detect whether the expressed GUS protein was maintained in the transformed cells or secreted into the culture medium, rice suspension cells were grown and treated under conditions identical to the above experiment. Proteins were extracted from the treated cells or collected from the medium, subjected to Western blot analysis and detected with the GUS antibody. 20 μg of total proteins were loaded in each lane. The results are shown in FIG. 15.

Results and Discussions:

Referring to FIG. 14, NT indicates the non-transformed cells; C3, C7 and C11 are three independent transformed cell lines. The C11 cell line was deposited in the Fermentation Research Institute Agency of Industrial Science and Technology (FERM), Japan on Nov. 4, 1992, with the accession number of FERM BP-4064 under the Budapest Treaty. No GUS mRNA was detected in the non-transformed cells, either in the presence or absence of sucrose (lane 1 and 2). GUS mRNA was detected in cells of the three cell lines grown in medium containing sucrose (lanes 3, 5 and 7). The mRNA levels increased in cells grown in sucrose-free medium (lanes 4, 6 and 8).

In FIG. 15, arrow (←) indicates the position of GUS protein. No GUS protein was detected in the non-transformed cells or their culture media, either in the presence or absence of sucrose (lanes 1, 2, 8 and 9). No GUS protein could be detected in the transformed cells or media in the presence of sucrose (lanes 3, 5, 10 and 12), either. As expected, the GUS protein could be easily detected in the transformed cells and media in the absence of sucrose (lanes 4, 6, 11 and 13).

Accordingly, it can be confirmed from the above obtained results that the present gene expression system can achieve at least two main advantages. First, the expression of the αAmy8/GUS chimetic gene is well controlled by the promoter region of αAmy8, especially under the sugar-depleted or sugar-free condition of the culture medium. Hence, the present gene expression system comprising the promoter of an α-amylase gene can promote the quantitative production, under sugar-depleted or sugar-free condition, of a desired gene product, such as the GUS protein exemplified here. Second, inasmuch as the promoter region of said chimetic gene also includes a DNA sequence encoding the signal sequence of α-amylase, the expressed gene product (GUS) will be secreted into the culture medium, rendering said gene product recoverable from the culture medium. As a result, the procedures for recovery and purification of the desired gene product can be simplified, and the contamination therein can also be diminished.

From the above teachings, it is apparent that various modifications and variations can be made without daparting from the spirit and scope of the present invention. It is therefore to be understood that this invention may be practiced otherwise than as specifically described.

              TABLE 1______________________________________Relative accumulation of α-amylase mRNA ingerminating rice seeds as detected by α-amylase gene-specific probes.      Days after germinationProbes       1     2       3   4      5   6______________________________________OSamy-c      0.sup.a              25      73  100    67  47αAmy6-C-3'        0     23      73  100    27  26αAmy7-C-3'        0     26      72  100    50  48αAmy8-C-3'        0     31      98  100    27  23αAmy10-C-3'        0     23      64  100    47  44______________________________________ .sup.a Level of amylase mRNA was determined by densitometric scanning of the autoradiograms shown in FIG. 6A, and corrected with the mRNA level of pcRAc1.3. The relative mRNA accumulation for each amylase gene was then determined by dividing the amylase mRNA level of each day by the mRNA level (peak level) of day 4.

              TABLE 2______________________________________Relative accumulation of α-amylase mRNA incultured suspension cells of rice at later growthstages as detected by α-amylase gene-specific probes.       Days in cultureProbes        8      10        12   14______________________________________OSamy-c       1.0.sup.a                3.8       39.5 38.8αAmy6-C-3'         1.0    1.3       4.1  1.2αAmy7-C-3'         1.0    1.8       6.2  9.8αAmy8-C-3'         1.0    2.2       37.0 44.5αAmy10-C-3'         1.0    1.3       1.2  5.0______________________________________ .sup.a Level of amylase mRNA was determined by densitometric scanning of the autoradiograms shown in FIG. 6B, and corrected with the mRNA level of pOScx3'. The relative mRNA accumulation for each amylase gene was then determined by dividing the amylase mRNA level of each day by the mRNA level (basal level) of day 8.

              TABLE 3______________________________________Effect of PSC on the efficiency of rice transformation by Agrobacterium          No. ofAgro-  Addi-   immature  No. of  Frequency forbacterium  tion    embryos   Transgenic                            induction of transgenicStrains  of PSC  inoculated                    callus                         plant                              callus (%)                                     plants (%)______________________________________A281   +       250       17   4    6.8    1.6(pAG8)A281   -       80        2    0    2.5    0(pAG8)______________________________________ *PSC = potato suspension culture

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 7(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2086 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: Rice (Oryzae sativa)(B) STRAIN: CV. M202(vii) IMMEDIATE SOURCE:(A) LIBRARY: (EMBL) genomic(B) CLONE: `-Amy6-C(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: join(481..495, 572..1510, 1610..1891)(ix) FEATURE:(A) NAME/KEY: mat_peptide(B) LOCATION: join(481..495, 572..1510, 1610..1891)(x) PUBLICATION INFORMATION:(A) AUTHORS: Yu et al., Su-May(B) TITLE: Regulation of `-amylase- encoding gene expressionin germinating seeds and cultured cells of rice(C) JOURNAL: Gene(D) VOLUME: in press(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:AAGCTTCTGAAGCTGATGCGATCAAACCTCAAAAGACCATGGGCAGCAGCACGGAAGTTA60CAAACCGAAGCCGCGCGGCGCGCATACGCATCAGAAAGGCGCGCAATAACGGACCACCCA120TACGGCGGCCGCGCTCTGTTCGCGGCGTCCCTGCGCCTGCATCGCACGCCATCCAAGGCT180GCATAGCACGACGCATACATATCTCACGCGCCCTTTTTATCTGCTTATAAATGAGATAGC240CCACATAGCAGCGCTGCCGTTTCTCCTCTTCTCTCGTTGGGGGCAACCGAACTTATCCAA300CAACGATCCATCCATTGGCCAAGTGGCTGCCGTGCTGCACCTATAAATTCACATGCACCG360GCATGCCACTCCACACAAGTGAGCTACTCGAAAGAAGCAGCAATGGCAAAGCGC414MetAlaLysArg26-25ATAGCCTCAATGAGCAGCCTCCTCCTTATCGCCTTGCTCTGTCTGAGC462IleAlaSerMetSerSerLeuLeuLeuIleAlaLeuLeuCysLeuSer20-15-10TCTCACTTGGCCCAAGCCCAGGTCCTCTTCCAGGTAAGCATCCTGTAGTACAA515SerHisLeuAlaGlnAlaGlnValLeuPheGln515TGTCACATTACATAAAAAAAAATGACTTGCGTTTGACATGACTGTTCTTGGTGTAG571GGGTTCAACTGGGAGTCGTGGAAGAAGCAGGGCGGGTGGTACAACTTC619GlyPheAsnTrpGluSerTrpLysLysGlnGlyGlyTrpTyrAsnPhe101520CTCCATGGCCACGTCGACGACATCGCCGCGACCGGTGTCACGCACGTC667LeuHisGlyHisValAspAspIleAlaAlaThrGlyValThrHisVal253035TGGCTCCCACCGCCGTCGCACTCCGTCGCCCCGCAGGGATACATGCCG715TrpLeuProProProSerHisSerValAlaProGlnGlyTyrMetPro404550GGCCGGCTCTACGACCTGGACGCTTCCAAGTACGGCACGGGGGCAGAG763GlyArgLeuTyrAspLeuAspAlaSerLysTyrGlyThrGlyAlaGlu556065CTCAGGTCGCTGATCGCCGCCTTCCACAGCAAAGGCATCAAGTGCGTC811LeuArgSerLeuIleAlaAlaPheHisSerLysGlyIleLysCysVal70758085GCCGACATCGTCATCAACCACCGGTGCGCGGATTACAAGGATAGCCGT859AlaAspIleValIleAsnHisArgCysAlaAspTyrLysAspSerArg9095100GGCATCTACTGCATTTTCGAGGGTGGCACGCCGGACAGCCGCCTCGAC907GlyIleTyrCysIlePheGluGlyGlyThrProAspSerArgLeuAsp105110115TGGGGCCCCGACATGATCTGCAGCGACGACACGCAGTACTCCAACGGC955TrpGlyProAspMetIleCysSerAspAspThrGlnTyrSerAsnGly120125130CGCGGTCACCGCGACACCGGCGCAGACTTCGGCGCGGCGCCCGACATC1003ArgGlyHisArgAspThrGlyAlaAspPheGlyAlaAlaProAspIle135140145GACCACCTCAACACGCGTGTGCAGACAGAGCTGTCCGACTGGCTCAAT1051AspHisLeuAsnThrArgValGlnThrGluLeuSerAspTrpLeuAsn150155160165TGGCTCAAGTCCGACGTCGGCTTCGACGGCTGGCGCCTCGACTTCGCC1099TrpLeuLysSerAspValGlyPheAspGlyTrpArgLeuAspPheAla170175180AAGGGATACTCGGCGGCCGTCGCCAAGACGTACGTCGACAACACCGAC1147LysGlyTyrSerAlaAlaValAlaLysThrTyrValAspAsnThrAsp185190195CCGTCCTTCGTCGTCGCCGAGATATGGAGCAACATGCGTTACGACGGC1195ProSerPheValValAlaGluIleTrpSerAsnMetArgTyrAspGly200205210AACGGTGAGCCGTCGTGGAACCAGGACGGTGACCGGCAGGAGCTGGTG1243AsnGlyGluProSerTrpAsnGlnAspGlyAspArgGlnGluLeuVal215220225AACTGGGCGCAGGCCGTCGGTGGCCCTGCGTCAGCGTTCGACTTCACG1291AsnTrpAlaGlnAlaValGlyGlyProAlaSerAlaPheAspPheThr230235240245ACCAAGGGCGAGCTGCAGGCGGCGGTGCAAGGTGAGCTGTGGCGGATG1339ThrLysGlyGluLeuGlnAlaAlaValGlnGlyGluLeuTrpArgMet250255260AAGGACGGCAACGGCAAGGCGCCGGGGATGATTGGCTGGCTGCCAGAG1387LysAspGlyAsnGlyLysAlaProGlyMetIleGlyTrpLeuProGlu265270275AAGGCCGTCACCTTCATCGACAACCATGACACTGGCTCCACACAGAAC1435LysAlaValThrPheIleAspAsnHisAspThrGlySerThrGlnAsn280285290TCATGGCCGTTCCCCTCCGACAAGGTCATGCAGGGCTACGCCTACATC1483SerTrpProPheProSerAspLysValMetGlnGlyTyrAlaTyrIle295300305CTCACACACCCTGGAGTACCCTGCATTGTGAGTCCTCAGCTGCATGA1530LeuThrHisProGlyValProCysIle310315ATACGAATGCCATAAAGAAAAATCTAATTTTCTCAACCAGTTTCTCCGACTAAATTCTGT1590TTATTGACTATGTGTGCAGTTCTACGACCATGTATTTGACTGGAACCTGAAG1642PheTyrAspHisValPheAspTrpAsnLeuLys320325CAGGAGATCAGCACATTAGCTGCAGTGAGATCAAGAAATGAGATTCAT1690GlnGluIleSerThrLeuAlaAlaValArgSerArgAsnGluIleHis330335340345CCCGGGAGCAAGCTGAAAATCCTTGCTGCTGAGGGAGACGTCTATGTC1738ProGlySerLysLeuLysIleLeuAlaAlaGluGlyAspValTyrVal350355360GCCATGATCGATGATAAGGTCATAACAAAGATTGGGACACGGTATGAC1786AlaMetIleAspAspLysValIleThrLysIleGlyThrArgTyrAsp365370375GTGGGCAACTTAATCCCGTCAGACTTCCATGTCGTTGCTCACGGCAAC1834ValGlyAsnLeuIleProSerAspPheHisValValAlaHisGlyAsn380385390AATTACTGCATTTGGGAAAAGAGCGGTCTCAGAGTTCCTGCAGGGCGG1882AsnTyrCysIleTrpGluLysSerGlyLeuArgValProAlaGlyArg395400405CACCACTATTAGGCGAAGAAAATTTTTCAGGACTATTTGGTGCCTGGAA1931HisHisTyr410TAAGATTTGAATTATATCCTAAATAACCAGATTATGATTGTATGAGATTTCTTAATCTGA1991GCAAAGCGTTGAGCATTGCTCCGATATTTCTATGTATTCTACCTGCCTGGGGATATGATA2051TTTGTATCCTCTAGAAGTAAAGATGATTTTAACTC2086(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 438 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAlaLysArgIleAlaSerMetSerSerLeuLeuLeuIleAlaLeu26-25-20-15LeuCysLeuSerSerHisLeuAlaGlnAlaGlnValLeuPheGlnGly10-515PheAsnTrpGluSerTrpLysLysGlnGlyGlyTrpTyrAsnPheLeu101520HisGlyHisValAspAspIleAlaAlaThrGlyValThrHisValTrp253035LeuProProProSerHisSerValAlaProGlnGlyTyrMetProGly404550ArgLeuTyrAspLeuAspAlaSerLysTyrGlyThrGlyAlaGluLeu55606570ArgSerLeuIleAlaAlaPheHisSerLysGlyIleLysCysValAla758085AspIleValIleAsnHisArgCysAlaAspTyrLysAspSerArgGly9095100IleTyrCysIlePheGluGlyGlyThrProAspSerArgLeuAspTrp105110115GlyProAspMetIleCysSerAspAspThrGlnTyrSerAsnGlyArg120125130GlyHisArgAspThrGlyAlaAspPheGlyAlaAlaProAspIleAsp135140145150HisLeuAsnThrArgValGlnThrGluLeuSerAspTrpLeuAsnTrp155160165LeuLysSerAspValGlyPheAspGlyTrpArgLeuAspPheAlaLys170175180GlyTyrSerAlaAlaValAlaLysThrTyrValAspAsnThrAspPro185190195SerPheValValAlaGluIleTrpSerAsnMetArgTyrAspGlyAsn200205210GlyGluProSerTrpAsnGlnAspGlyAspArgGlnGluLeuValAsn215220225230TrpAlaGlnAlaValGlyGlyProAlaSerAlaPheAspPheThrThr235240245LysGlyGluLeuGlnAlaAlaValGlnGlyGluLeuTrpArgMetLys250255260AspGlyAsnGlyLysAlaProGlyMetIleGlyTrpLeuProGluLys265270275AlaValThrPheIleAspAsnHisAspThrGlySerThrGlnAsnSer280285290TrpProPheProSerAspLysValMetGlnGlyTyrAlaTyrIleLeu295300305310ThrHisProGlyValProCysIlePheTyrAspHisValPheAspTrp315320325AsnLeuLysGlnGluIleSerThrLeuAlaAlaValArgSerArgAsn330335340GluIleHisProGlySerLysLeuLysIleLeuAlaAlaGluGlyAsp345350355ValTyrValAlaMetIleAspAspLysValIleThrLysIleGlyThr360365370ArgTyrAspValGlyAsnLeuIleProSerAspPheHisValValAla375380385390HisGlyAsnAsnTyrCysIleTrpGluLysSerGlyLeuArgValPro395400405AlaGlyArgHisHisTyr410(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4276 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: Rice (Oryzae sativa)(B) STRAIN: CV. M202(vii) IMMEDIATE SOURCE:(A) LIBRARY: (EMBL) genomic(B) CLONE: `-Amy7-C(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: join(2459..2473, 2582..2713, 2807..3619, 3704..3952)(ix) FEATURE:(A) NAME/KEY: mat_peptide(B) LOCATION: join(2459..2473, 2582..2713, 2807..3619, 3704..3952)(x) PUBLICATION INFORMATION:(A) AUTHORS: Yu et al., Su-May(B) TITLE: Regulation of `-amylase- encoding gene expressionin germinating seeds and cultured cells of rice(C) JOURNAL: Gene(D) VOLUME: in press(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GCATGCGAGAGGCACGGGGTTCGATTCCCCGCGTCTCCATCGGCACTGTTTTTTAACATC60AAACGCTGTTCGATCCACTATCTGTTAATTTCGCAAACACAACTAAATCTTTTTTTTTTT120TTGCCGGTGCGTGCAGTGTGACGTCCAAGGCATGGCGCATTGGCGCCTCCCCTCTTTCCC180TTGATCTTTTCATCAGTTCGTTCTTCTTGCAGAAAAGCTGTTCTGTTAAGTCGGTTCCGA240TCTGCTCTTGGGCTCTTGCCAGAAACAACCTGTGTACGCCAGACTTATCAAGCCAACCAT300CCTGATGAGCCTCTGCTTATACAAGCCTTTGACTCCAAAAAGGACGAGGCGGCTTGCAGC360CGCACGGAAATAAGCCGACCGATCCTTTATTGCTCTATCTTTTTCCCTTGGAATAAAAAA420CAGCCCAATTAAAATCTGGGATGAAACTATGGCTAGCTGTTCGCGGTGTCAGTTCTCGGG480ACGCTACCGTTGTTTTGTTTGAACCGGAATGTTCAGGGCGGTTCACACCATAGACTTGGA540GCCAAGTGGTTCCATCCACAAAATTTTCTCATCTTGAATATTCTGTTATCTGCCTCGACA600GACGCGCCATATCCTGTGTTCAGGAATGAATGTGCTACAGCCAACGTGCTGCATGAAATT660TGCTGAAATCGTGCTAAAATGTGCATGGCAACAGGAACCTGATGCCCTGGTCCTGTGGAA720CTGCCACGGGAAAGTATTTTTTATAGCTAGGTGCAATCGTATCTAGGTGTATACATGTCA780CCTACATAGCTACTCCCCTTTATCTTAAAATATAATAATTTTTAACTCTCAGTATTTGTC840CTAAAATATAACAAATTCTCCATCAACATTATCTTCCCAACCAATCACAACCCTTCATCA900TTAATTTTTTCCCCCTACCTCCACTACTCATCTAATCACAACCCTCCAACACTCACTTCT960ATCTACTTTCTTAATAACTGTCTTCAACCCTAAAACTTCTTATATTTTAGGACGGAGGGA1020GTATCTAAATATTTCATAAAAAAAATGTTAAGATAGATAAAGAAGATATAAACCCACTAT1080GCAAACATGCACATCAAAATTTAATTTACAGTAAAGAAACAGAAATAACATATTCTATTT1140GTGCTGGAGATGTACTGTTCACAATATTGTTTTTTTATTTTTTATTTATCTGATTATATA1200TCTGTTTCAGCCTTGCATGGTTGTGTATGTTTGTGTATAGACTTATGCCATTGTGATTGA1260TGCTACCAATTATTTTCAGACTATTTTTTTATAGAGGAATTTTATAGTTCTTGAGAAAAT1320ACCTTGAAGTATCTAAATTTTACACTAAAATTGTTGGTACCTTGAGGTACAAAGTACCTA1380GAGGTACCAAATTTTACTAGAAAATTGTGGCACCTTTAGGTACCTTCTCAAAAATAGTAC1440AATTATGGGCCGTTTTGGATTTAGTGCCAAAACGTGCTCTACAAATATTTTGATAGTTTG1500AACAGTGCATAAGACGGGTTTGGTTTGAAGCCAAATCATTGGCATTGCCAATGTCCAATT1560TGATATTTTCTATATTATGCTAAAAGCTTGGTTCTAAATTGGCCTCCAACCAAATACAAC1620TCTACTCTACCAAAAAATTTGTAGTGCCAAAACTTGCCTAGGTTTTGTCACTACCAACAT1680TTTGGTAAGTATTAAACCAAACAAGCCCTACATTTTTTTATGTACATTTAAGTTGTATGT1740AAATGATGGGTGCGGTTGCACCTAGGTGAAAAAAAATACATATTCGCCACAACTCGCAAC1800ATGTACCAATTCAGCAGCAAGTGTAAGAGAGAAGATTTCTCTCGTTTTACACGCGCACGT1860TCAATTCCTGAACTACTAAACGGTATGATTTTTTGCAAAAATTTTCTATAGGAAAGTTAC1920TTAAAAATTATATTAATCTATTTTTAAAATTTAAAATAGTTAATACTCAATTAATTATAC1980GTTAATGGCTCAGCTCGTTTTGCGTACATTCTCAATCGATTCTTTTCCTCTGCTCTCAAA2040TGCTCTGTGTGCGATCAGGTATTCATGTTCAGCTCGCACAAGCACAAGCAAGACAGATGG2100AATTCCTACTGACCTGCGCCTTTTGCATCGCTCCAACTCTCAAAGTCTCAAGGCCATTAA2160ATTGCCTATGGGCTCACCAGCCAATAACAAACTCCGGCTGTTATCCATCCAATCCAGTGT2220CCCAAAGCAACATTCAAGCCCAGCCAGGCCTCCAAAAGTTGCAAGTTGAGCATGGCAAAA2280TCCCCGGCAATTCTCGACTATAAATACCTGACCAGACACACCCAGGAGCTTCATCAATCA2340TCCATCTCCGAAGTGTGTCTGCAGCATGCAGGTGCTGAACACCATGGTGAACAAA2395MetValAsnLys25CACTTCTTGTCCCTTTCGGTCCTCATCGTCCTCCTTGGCCTCTCCTCC2443HisPheLeuSerLeuSerValLeuIleValLeuLeuGlyLeuSerSer20-15-10AACTTGACAGCCGGGCAAGTCCTGTTTCAGGTAAGAGATCGCCATGAGTT2493AsnLeuThrAlaGlyGlnValLeuPheGln515GGGTTTCAGGCTTCAGTGAACTGATCCGGTTTTGTACTGAGCCTAAGAGAATGATGCAGT2553GATGCTCTTGTGTTTGATGATGATGCAGGGATTCAACTGGGACTCGTGGAAG2605GlyPheAsnTrpAspSerTrpLys10GAGAATGGCGGGTGGTACAACTTCCTGATGGGCAAGGTGGACGACATC2653GluAsnGlyGlyTrpTyrAsnPheLeuMetGlyLysValAspAspIle152025GCCGCAGCCGGCATCACCCACGTCTGGCTCCCTCCGCCGTCTCACTCT2701AlaAlaAlaGlyIleThrHisValTrpLeuProProProSerHisSer30354045GTCGGCGAGCAAGGTGCGGTGCTCTGCTCTCTCGATCCCCTCGTCGTCGCAC2753ValGlyGluGlnCATTGCCGGCAAAATACATGCACAGGTCGTTGAATTGCTTGAATGCTTCTGCAGGC2809Gly50TACATGCCTGGGCGGCTGTACGATCTGGACGCGTCTAAGTACGGCAAC2857TyrMetProGlyArgLeuTyrAspLeuAspAlaSerLysTyrGlyAsn556065GAGGCGCAGCTCAAGTCGCTGATCGAGGCGTTCCATGGCAAGGGCGTC2905GluAlaGlnLeuLysSerLeuIleGluAlaPheHisGlyLysGlyVal707580CAGGTCATCGCCGACATCGTCATCAACCACCGCACGGCGGAGCACAAG2953GlnValIleAlaAspIleValIleAsnHisArgThrAlaGluHisLys859095GACGGCCGCGGCATCTACTGCCTCTTCGAGGGCGGGACGCCCGACTCC3001AspGlyArgGlyIleTyrCysLeuPheGluGlyGlyThrProAspSer100105110CGCCTCGACTGGGGCCCGCACATGATCTGCCGCGACGACCCCTACGGC3049ArgLeuAspTrpGlyProHisMetIleCysArgAspAspProTyrGly115120125130GATGGCACCGGCAACCCGGACACCGGCGCCGACTTCGCCGCCGCGCCG3097AspGlyThrGlyAsnProAspThrGlyAlaAspPheAlaAlaAlaPro135140145GACATCGACCACCTCAACAAGCGCGTCCAGCGGGACCTCATTGGCTGG3145AspIleAspHisLeuAsnLysArgValGlnArgAspLeuIleGlyTrp150155160CTCGACTGGCTCAAGATGGACATCGGCTTCGACGCGTGGCGCCTCGAC3193LeuAspTrpLeuLysMetAspIleGlyPheAspAlaTrpArgLeuAsp165170175TTCGCCAAGGGCTACTCCGCCGACATGGCAAAGATCTACATCGACGCC3241PheAlaLysGlyTyrSerAlaAspMetAlaLysIleTyrIleAspAla180185190ACCGAGCCGAGCTTCGCCGTGGCCGAGATATGGACGTCCATGGCGAAC3289ThrGluProSerPheAlaValAlaGluIleTrpThrSerMetAlaAsn195200205210GGCGGGGACGGCAAGCCGAACTACGACCAGAACGCGCACCGGCAGGAG3337GlyGlyAspGlyLysProAsnTyrAspGlnAsnAlaHisArgGlnGlu215220225CTGGTCAACTGGGTCGATCGTGTCGGCGGCGCCAACAGCAACGGCACG3385LeuValAsnTrpValAspArgValGlyGlyAlaAsnSerAsnGlyThr230235240GCGTTCGACTTCACCACCAAGGGCATCCTCAACGTCGCCGTGGAGGGC3433AlaPheAspPheThrThrLysGlyIleLeuAsnValAlaValGluGly245250255GAGCTGTGGCGCCTCCGCGGCGAGGACGGCAAGGCGCCCGGCATGATC3481GluLeuTrpArgLeuArgGlyGluAspGlyLysAlaProGlyMetIle260265270GGGTGGTGGCCGGCCAAGGCGACGACCTTCGTCGACAACCACGACACC3529GlyTrpTrpProAlaLysAlaThrThrPheValAspAsnHisAspThr275280285290GGCTCGACGCAGCACCTGTGGCCGTTCCCCTCCGACAAGGTCATGCAG3577GlySerThrGlnHisLeuTrpProPheProSerAspLysValMetGln295300305GGCTACGCATACATCCTCACCCACCCCGGCAACCCATGCATC3619GlyTyrAlaTyrIleLeuThrHisProGlyAsnProCysIle310315320GTGAGTAGCCAACTCGATCAGAAATTCTGAATCATCCTGCAAACTGATCGATGAACTGAT3679GATAAATTCTGTAAAATTGTTCAGTTCTACGACCATTTCTTCGATTGGGGT3730PheTyrAspHisPhePheAspTrpGly325CTCAAGGAGGAGATCGAGCGCCTGGTGTCAATCAGAAACCGGCAGGGG3778LeuLysGluGluIleGluArgLeuValSerIleArgAsnArgGlnGly330335340345ATCCACCCGGCGAGCGAGCTGCGCATCATGGAAGCTGACAGCGATCTC3826IleHisProAlaSerGluLeuArgIleMetGluAlaAspSerAspLeu350355360TACCTCGCGGAGATCGATGGCAAGGTGATCACAAAGATTGGACCAAGA3874TyrLeuAlaGluIleAspGlyLysValIleThrLysIleGlyProArg365370375TACGACGTCGAACACCTCATCCCCGAAGGCTTCCAGGTCGTCGCGCAC3922TyrAspValGluHisLeuIleProGluGlyPheGlnValValAlaHis380385390GGTGATGGCTACGCAATCTGGGAGAAAATCTGAGCGCACGATGACGAGAC3972GlyAspGlyTyrAlaIleTrpGluLysIle395400TCTCAGTTTAGCAGATTTAACCTGCGATTTTTACCCTGACCGGTATACGTATATACGTGC4032CGGCAACGAGCTGTATCCGATCCGAATTACGGATGCAATTGTCCACGAAGTACTTCCTCC4092GTAAATAAAGTAGGATCAGGGACATACATTTGTATGGTTTTACGAATAATGCTATGCAAT4152AAAATTTGCACTGCTTAATGCTTATGCATTTTTGCTTGGTTCGATTCTACTGGTGAATTA4212TTGTTACTGTTCTTTTTACTTCTCGAGTGGCAGTATTGTTCTTCTACGAAAATTTGATGC4272GTAG4276(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 428 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetValAsnLysHisPheLeuSerLeuSerValLeuIleValLeuLeu25-20-15-10GlyLeuSerSerAsnLeuThrAlaGlyGlnValLeuPheGlnGlyPhe515AsnTrpAspSerTrpLysGluAsnGlyGlyTrpTyrAsnPheLeuMet101520GlyLysValAspAspIleAlaAlaAlaGlyIleThrHisValTrpLeu253035ProProProSerHisSerValGlyGluGlnGlyTyrMetProGlyArg40455055LeuTyrAspLeuAspAlaSerLysTyrGlyAsnGluAlaGlnLeuLys606570SerLeuIleGluAlaPheHisGlyLysGlyValGlnValIleAlaAsp758085IleValIleAsnHisArgThrAlaGluHisLysAspGlyArgGlyIle9095100TyrCysLeuPheGluGlyGlyThrProAspSerArgLeuAspTrpGly105110115ProHisMetIleCysArgAspAspProTyrGlyAspGlyThrGlyAsn120125130135ProAspThrGlyAlaAspPheAlaAlaAlaProAspIleAspHisLeu140145150AsnLysArgValGlnArgAspLeuIleGlyTrpLeuAspTrpLeuLys155160165MetAspIleGlyPheAspAlaTrpArgLeuAspPheAlaLysGlyTyr170175180SerAlaAspMetAlaLysIleTyrIleAspAlaThrGluProSerPhe185190195AlaValAlaGluIleTrpThrSerMetAlaAsnGlyGlyAspGlyLys200205210215ProAsnTyrAspGlnAsnAlaHisArgGlnGluLeuValAsnTrpVal220225230AspArgValGlyGlyAlaAsnSerAsnGlyThrAlaPheAspPheThr235240245ThrLysGlyIleLeuAsnValAlaValGluGlyGluLeuTrpArgLeu250255260ArgGlyGluAspGlyLysAlaProGlyMetIleGlyTrpTrpProAla265270275LysAlaThrThrPheValAspAsnHisAspThrGlySerThrGlnHis280285290295LeuTrpProPheProSerAspLysValMetGlnGlyTyrAlaTyrIle300305310LeuThrHisProGlyAsnProCysIlePheTyrAspHisPhePheAsp315320325TrpGlyLeuLysGluGluIleGluArgLeuValSerIleArgAsnArg330335340GlnGlyIleHisProAlaSerGluLeuArgIleMetGluAlaAspSer345350355AspLeuTyrLeuAlaGluIleAspGlyLysValIleThrLysIleGly360365370375ProArgTyrAspValGluHisLeuIleProGluGlyPheGlnValVal380385390AlaHisGlyAspGlyTyrAlaIleTrpGluLysIle395400(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3314 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: Rice (Oryzae sativa)(B) STRAIN: CV. M202(vii) IMMEDIATE SOURCE:(A) LIBRARY: (EMBL) genomic(B) CLONE: `-Amy8-C(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: join(1152..1241, 1385..2323, 2409..2690)(ix) FEATURE:(A) NAME/KEY: mat_peptide(B) LOCATION: join(1227..1241, 1385..2323, 2409..2690)(x) PUBLICATION INFORMATION:(A) AUTHORS: Yu et al., Su-May(B) TITLE: Regulation of `-amylase- encoding gene expressionin germinating seeds and cultured cells of rice(C) JOURNAL: Gene(D) VOLUME: in press(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:GATATCCCGCCAGCACAGTGCCGGAAACTTTAATGCCGATGGGGCTTTTAATGCCGGTTG60AGAGCATATCGATACGGTTACGAATTGGCGGCACCCACAGATTCGCCAGCCCCGGCAGCC120GCACGGTGTTATCCAGTTCCTCAATGATTTTGTCCATCGTCATGCCTGGCCGCCACTGCT180CCTGCGGCTTAAGCTGGATGGTCGTTTCTACCATCTCCAGCGGACAGAATCGGTGGCCGG240TTTCCGTTTCCCGGTTTTGCCAAATACCCGCGCCACTTCAGGTACGCTCATAATTAGCTT300GTCGGTTTTTTGCAGCATACCGCCGCCTCTGCTGCGGAAATCCCCGGCAGCGTCGATGGC360ATATACACAAGTCGCCTTCATTGATCTGCGGTAAAAATTCCCGCCAACTTTATTGAGCGG420CCAGAGAANNGTAGCACCGAAAGCNCCGCCACCAGCAGCGTGGTTTTNNNCCAGTGCAGT480ACTTCAGCAACACGGATGATAAACACGAATCAAAAAGCGATTGTGCGGGTTACTGCTTTC540CGGCGGAATTTTGCCACGGATCTCCTTTCCAAAGAAAGTTTCCCTGCCGGCGCTTGATCC600GTCACACCGATGACGCGACGCGGTAGAGGCCGGTACCTGTTCGAACAACCAACTGATCTG660CGGCTCCTCCGCTTGCGGCTTGCCTCTTATCAACGTATCGCCGTTTCCGTCATGCGTGAT720CGGTGATCGATCACCGAGAGAGACCGGACGACGAGTCGAGAGAGCTCGCGCCGCCTCGAT780CGGCGCGGCGGTGACTCGAGCAGGGCCTGAAGTAGCTGCACGGCTCAAGGCGGCACTCCA840TCACCGGACACCGGGGTCCAGACTACTCGTTTCCGTTGGAGAAATAACCACCTTTATCCA900TGTTGCTTATCCGTGAATTGCAACAGCATTGATTGTTCGCGTTTAATTCGCCTCGGCCAT960GTAACCTCCGACCTGATCCTCTTGGACACTATAAATAGAGGCCAGTTCAGGCAATGCAAG1020AGCAGAGAAGCAGAGTACAGCAGGCAGCTCTTCTTCTCTTTGCGAAGGTTGGCTACTTGG1080CCAGCCATTAGGAAACAAGTTAGTTTGGAGAAGAAGCAGAGTTGAGACTGCATTTGCATT1140GCTCTGTAGCCATGGGCAAGCACCATGTCACCCTGTGTTGTGTCGTTTTT1190MetGlyLysHisHisValThrLeuCysCysValValPhe25-20-15GCTGTGCTCTGCCTGGCGTCCAGCTTAGCACAAGCCCAAGTTCTCTTC1238AlaValLeuCysLeuAlaSerSerLeuAlaGlnAlaGlnValLeuPhe10-51CAGGTAGTTTAATTTACTGACGCCTTGGTGAAAGTTTGTTAATACTTGATAAT1291GlnAATAATCTTGCACGGCAATATAATGTACGCGCCGCAGTCAGGAAGCTTGATTTGACCATG1351GGTTGCGTTTGGGTGTTTTTGCCGTACGTGCAGGGGTTTAACTGGGAGTCGTGG1405GlyPheAsnTrpGluSerTrp10AGGAAGCAAGGCGGGTGGTACAACTTTCTGCACGAGAAGGTGGAGGAG1453ArgLysGlnGlyGlyTrpTyrAsnPheLeuHisGluLysValGluGlu152025ATCGCCAGCACGGGCGCCACCCACGTCTGGCTCCCGCCGCCGTCGCAC1501IleAlaSerThrGlyAlaThrHisValTrpLeuProProProSerHis303540TCTGTCTCGCCGCAGGGTTACATGCCGGGGCGGCTCTACGACCTGGAC1549SerValSerProGlnGlyTyrMetProGlyArgLeuTyrAspLeuAsp45505560GCGTCCAAGTACGGCACGGAGGCGGAGCTCAAGTCGCTGATCGAGGCA1597AlaSerLysTyrGlyThrGluAlaGluLeuLysSerLeuIleGluAla657075TTCCACGACAAGAACGTCGAGTGCCTCGCCGACATCGTCATCAACCAC1645PheHisAspLysAsnValGluCysLeuAlaAspIleValIleAsnHis808590CGCTGCGCCGACTACAAGGACAGCCGCGGCGTGTACTGCGTGTTCGAG1693ArgCysAlaAspTyrLysAspSerArgGlyValTyrCysValPheGlu95100105GGCGGCACGCCCGACGGCCGCCTCGACTGGGGCCCCGACATGATCTGC1741GlyGlyThrProAspGlyArgLeuAspTrpGlyProAspMetIleCys110115120AGCGACGACACGCAGTACTCCAACGGCCGCGGCCACCGCGACACCGGC1789SerAspAspThrGlnTyrSerAsnGlyArgGlyHisArgAspThrGly125130135140GCCGGGTTCGGCGCCGCGCCCGACATCGACCACCTCAACCCGCGTGTC1837AlaGlyPheGlyAlaAlaProAspIleAspHisLeuAsnProArgVal145150155CAGCGGGAGCTCACCGACTGGCTCAACTGGCTCAGGACCCACCTCGGC1885GlnArgGluLeuThrAspTrpLeuAsnTrpLeuArgThrHisLeuGly160165170TTCGACGGATGGCGCCTCGACTTCGCGAAGGGCTACTCCGCGCCGCTG1933PheAspGlyTrpArgLeuAspPheAlaLysGlyTyrSerAlaProLeu175180185GCGAGGATCTACGTCGACAACACCAACCCGACGTTCGTCGTCGGCGAG1981AlaArgIleTyrValAspAsnThrAsnProThrPheValValGlyGlu190195200ATCTGGAGCTCGCTCATCTACAACGGCGACGGCAAGCCGTCGACCAAC2029IleTrpSerSerLeuIleTyrAsnGlyAspGlyLysProSerThrAsn205210215220CAGGACGCGGACAGGCAGGAGCTGGTGAACTGGGTGGAGGGCGTCGGC2077GlnAspAlaAspArgGlnGluLeuValAsnTrpValGluGlyValGly225230235AAGCCGGCGACGGCGTTCGACTTCACCACCAAGGGCATCCTCCAGGCC2125LysProAlaThrAlaPheAspPheThrThrLysGlyIleLeuGlnAla240245250GCCGTGCAGGGCGAGCTGTGGAGGCTCCACGACGGCAACGGCAAGGCG2173AlaValGlnGlyGluLeuTrpArgLeuHisAspGlyAsnGlyLysAla255260265CCCGGCCTCATGGGGTGGATGCCCGATCAGGCCGTAACCTTCGTCGAC2221ProGlyLeuMetGlyTrpMetProAspGlnAlaValThrPheValAsp270275280AACCACGACACCGGCTCGACCCAGTCGCTCTGGCCGTTCCCTTCCGAC2269AsnHisAspThrGlySerThrGlnSerLeuTrpProPheProSerAsp285290295300AAGGTCATGCAGGGCTACGCCTACATCCTCACTCACCCTGGCATCCCA2317LysValMetGlnGlyTyrAlaTyrIleLeuThrHisProGlyIlePro305310315TGCATCGTAAGTATCACCACCGAAATCTTTCTCATCAAATTCGTTCATATTGGTGA2373CysIleGCTCATTGCTGGTGCATGTGTACGTGTGTATGCAGTTCTACGACCATGTGTTC2426PheTyrAspHisValPhe320GACTGGAACCTGCAGCACGAGATCGCGACGCTGGCTGAAATCCGGTCA2474AspTrpAsnLeuGlnHisGluIleAlaThrLeuAlaGluIleArgSer325330335340AGGAACGGGATCCATGCGGAGAGCACGCTGGACATCCTCAAGGCCGAG2522ArgAsnGlyIleHisAlaGluSerThrLeuAspIleLeuLysAlaGlu345350355GGGGACATCTACGTCGCCATGATCGACGGCAAGGTGATCACCAAGCTC2570GlyAspIleTyrValAlaMetIleAspGlyLysValIleThrLysLeu360365370GGGCCGAGGTACGACGCCGGCGGGATCATCCCCTCCGACTTCCATGTC2618GlyProArgTyrAspAlaGlyGlyIleIleProSerAspPheHisVal375380385GTGGCGCACGGCAACGACTACTGCGTCTGGGAGAAGGAAGGCCTCAGG2666ValAlaHisGlyAsnAspTyrCysValTrpGluLysGluGlyLeuArg390395400GTTCCTGCCGGTAGAAAGCACTATTAGCTTTAGCTATAGCGATCGAGTTGCATG2720ValProAlaGlyArgLysHisTyr405410GTGCTTTGCAACCCTAGATAATATATATACGTACGTGGCTCTAGCTATGAATCATGCAAT2780TTTGCTGCGAGATGTGTACGAGCGAGCTTCGATCGATGTACGCTTCGTTATAACTAGCGT2840TCTTCGGAAATAAGTAATCGGAATGTACCCTGTTAATCCTGCAGAAATGTAGGATGAATG2900GAATTAACTAGCTACTGTTCGTTTCGATCCTCAAGAAAGACTTGCAAGATCTTGTCCAGT2960TGACTTCAGTTTTTTACTCCCGCTTTTAGCGTCTGGATACCGTGGTGGATTGAAAGCTCA3020ACTTGATCCCGTTTGGCCCAGCAATATTAGGCCGTAAGTAAAACGAATGACACCTGCATA3080TTCCGGCCCAAAGCGCACGCTCGTTGTCTCTCATTTAGCGGTCCAAAGATAATGGGACGA3140ATGTTCTTCACAGCAACGATTTAGCCTAACTATAATGGGGCACCTTTCCTTTATAACCCA3200AGGAATAAGTTCACTGGTCCCTTAATTTATCAGCGAGTCTGAAATTTATCCCTAAACCGA3260AATACTGTATATAATTGGTCCCCCAATTTTCAAAACGGTTCACTTAGAGGACCC3314(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 437 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetGlyLysHisHisValThrLeuCysCysValValPheAlaValLeu25-20-15-10CysLeuAlaSerSerLeuAlaGlnAlaGlnValLeuPheGlnGlyPhe515AsnTrpGluSerTrpArgLysGlnGlyGlyTrpTyrAsnPheLeuHis101520GluLysValGluGluIleAlaSerThrGlyAlaThrHisValTrpLeu253035ProProProSerHisSerValSerProGlnGlyTyrMetProGlyArg40455055LeuTyrAspLeuAspAlaSerLysTyrGlyThrGluAlaGluLeuLys606570SerLeuIleGluAlaPheHisAspLysAsnValGluCysLeuAlaAsp758085IleValIleAsnHisArgCysAlaAspTyrLysAspSerArgGlyVal9095100TyrCysValPheGluGlyGlyThrProAspGlyArgLeuAspTrpGly105110115ProAspMetIleCysSerAspAspThrGlnTyrSerAsnGlyArgGly120125130135HisArgAspThrGlyAlaGlyPheGlyAlaAlaProAspIleAspHis140145150LeuAsnProArgValGlnArgGluLeuThrAspTrpLeuAsnTrpLeu155160165ArgThrHisLeuGlyPheAspGlyTrpArgLeuAspPheAlaLysGly170175180TyrSerAlaProLeuAlaArgIleTyrValAspAsnThrAsnProThr185190195PheValValGlyGluIleTrpSerSerLeuIleTyrAsnGlyAspGly200205210215LysProSerThrAsnGlnAspAlaAspArgGlnGluLeuValAsnTrp220225230ValGluGlyValGlyLysProAlaThrAlaPheAspPheThrThrLys235240245GlyIleLeuGlnAlaAlaValGlnGlyGluLeuTrpArgLeuHisAsp250255260GlyAsnGlyLysAlaProGlyLeuMetGlyTrpMetProAspGlnAla265270275ValThrPheValAspAsnHisAspThrGlySerThrGlnSerLeuTrp280285290295ProPheProSerAspLysValMetGlnGlyTyrAlaTyrIleLeuThr300305310HisProGlyIleProCysIlePheTyrAspHisValPheAspTrpAsn315320325LeuGlnHisGluIleAlaThrLeuAlaGluIleArgSerArgAsnGly330335340IleHisAlaGluSerThrLeuAspIleLeuLysAlaGluGlyAspIle345350355TyrValAlaMetIleAspGlyLysValIleThrLysLeuGlyProArg360365370375TyrAspAlaGlyGlyIleIleProSerAspPheHisValValAlaHis380385390GlyAsnAspTyrCysValTrpGluLysGluGlyLeuArgValProAla395400405GlyArgLysHisTyr410(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1519 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(vi) ORIGINAL SOURCE:(A) ORGANISM: Rice (Oryzae sativa)(B) STRAIN: CV. Labelle(vii) IMMEDIATE SOURCE:(A) LIBRARY: (Lambda gt-11) cDNA(B) CLONE: `-Amy10-C(x) PUBLICATION INFORMATION:(A) AUTHORS: Yu et al., Su-May(B) TITLE: Regulation of `-amylase- encoding gene expressionin germinating seeds and cultured cells of rice(C) JOURNAL: Gene(D) VOLUME: in press(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:AGCAAACGCTTCTTGTCCCTGTCCCTGCTCATCCTCCTCCTCGGCTTCTCCTCCAGCTTG60GCAGCCGGGCAAGTCCTGTTTCAGGGCTTCAACTGGGAGTCGTGGAAGGAGAATGGCGGG120TGGTACAACATGCTGATGGGCAAGGTGGACGACATCGCCGCCGCCGGCATCACCCACGTC180TGGCTCCCTCCGCCGTCTCAATCTGTCGCCGAACAAGGCTACATGCCGGGGCGGCTGTAC240GATCTGGACGCTTCCAAGTACGGCAACGAGGCGCAGCTCAAGTCGCTGATCGAGGCGTTC300CACGGCAAGGGCGTCCAGGTGATCGCCGACATCGTCATCAACCACCGCACGGCGGCAGCA360AGCACAGGACGGCCGCGGCATCTACTGCCTCTTCGAGGGCGGGCAGCGCGACTCCCGCCT420CGACTGGGGCCCGCACATGATCTGCCGCGGCGACCCCTACGGCGACGGCACCGGCAACCG480ACACCGCTAGCCGACTTGGCCTGACATCGACCACCTCAACAAGCGCGTCACGAGCTCATC540GGCTGGCTCGACTGGCTCGACTGGCTCAAGCATAGGAACCAATTGGGCCTTCGACCCTGA600CTGGCCTCCTCGACTTCCGCCAACGCGCGCGTTACTCCCGCCGTACGTATCTGCAAAGAG660CTATCATCGACTGCCACCGAGACCGGACTATCGCCGATGGCCGAGACTATAGGACGTACG720CTGGCGTAGCGAGCTGCGGGACGGCTAAAGCCGGACTATGACCATGAACGCAACGACCGG780CAGTAGCTGGTCAACTGGGTCGACCGTGCGGCTGGACCAACATCATTCTAAATGCTTCGA840CTTCACCACCTAATGGGCATACTCAACGAATCGCCAGCTTGGTAGGTGCGAGCTATTGGC900GCCTCCTGGGCGTAGAGACGGCCAAGGCGCCACAGGCATGCATTACGGAGTAGTGGCCGG960CTAAGGGACGACCTTTGATCTGACGAACCACTGACTACCAGGCGTCGATCCGCAGCATCA1020TGTGGCTGTTTCCCTCCGACAAGGTCATGCAGGGTACGCTACAGTACTCACCACCCGGCA1080ACCCATGCACTTTCTACGACCATTTCTTCGACTGGGGCCACAAGGAGGAGATCGAGCGCC1140TGGTATCGACTCAAGAAACCGCAGGGATCCACCCGGCGAGCGAGCTGCGTATCATGGAGG1200CTGACAGCGATCTCTACCTCGCCGAGATCGACGGAAAGGTCATCACGAAGGTCGGACCAA1260GATACGACGTCGAGCACCTCATCCCGAAGCTTCCAGGTCGTCGCGCACGTGACGGCTACC1320GTCTGGGAGAAATTGAGCGGTGGAGAGGCCATTAAAGCAGATTTATTTCCTGCATTTTCA1380CCTCGACGTATAACATATACATGTGATGGCAACGAGTTGTATGCTGTATCTGATCTGAAC1440TATGTACGCGATTGTCCACAAAGTACTACCTCCGTAAATAAAGTGAGGATATGGAACATG1500CGTTTGCATGCATGGTTTT1519__________________________________________________________________________

Claims (42)

What is claimed is:
1. A method for producing a gene product by expressing a gene encoding said gene product in angiosperm host cells, comprising:
a) constructing a vector expressible in angiosperm host cells, said vector comprising a promoter region derived from an α-amylase gene of a plant, and a gene encoding a desired gene product;
b) transforming a compatible angiosperm host cell with said vector;
c) cultivating the resultant transformant host cell;
d) subjecting said cultivated transformant host cell to a sugar-depleted or sugar-free condition to promote the expression of said gene under the control of said promoter region; and
e) recovering the expressed gene product.
2. A method according to claim 1, wherein said promoter region is derived from an α-amylase gene of a monocot.
3. A method according to claim 2, wherein said promoter region is derived from an α-amylase gene of a graminaceous monocot.
4. A method according to claim 3, wherein said promoter region is derived from an α-amylase gene of a cereal crop.
5. A method according to claim 4, wherein said promoter region is derived from an α-amylase gene of rice crop.
6. A method according to claim 1, wherein said promoter region derived from the α-amylase gene includes the promoter of the α-amylase gene and a DNA sequence encoding the signal peptide of α-amylase.
7. A method according to claim 5, wherein said promoter region derived from the α-amylase gene includes the promoter of the α-amylase gene and a DNA sequence encoding the signal peptide of the α-amylase.
8. A method according to claim 6, wherein said expressed gene product is recovered from the culture medium of said transformant host cell.
9. A method according to claim 1, wherein said vector further comprises a marker gene, a reporter gene, an antibiotic-resistance gene, an enhancer or a regulatory sequence.
10. A method according to claim 9, wherein said vector comprises an antibiotic-resistance gene.
11. A method according to claim 10, wherein said antibiotic is kanamycin or hygromycin.
12. A method according to claim 9, wherein said vector comprises a reporter gene.
13. A method according to claim 12, wherein said reporter gene is the β-glucuronidase (GUS) gene.
14. A method according to claim 1, wherein the transformation of said compatible angiosperm host cell is enhanced by co-culture with a potato suspension culture.
15. A method according to claim 1, wherein the transfer of said vector to the host cell is carried out by electroporation, polyethylene glycol-mediated transformation, particle bombardment, micro-injection method, ultrasonic method, poly-L ornithine method, calcium phosphate method or Agrobacterium-mediated transformation system.
16. A method according to claim 15, wherein the transfer of said vector to the host cell is carried out by the Agrobacterium-mediated transformation system.
17. A method according to claim 1, wherein said vector further comprises an α-amylase structural gene derived from a plant.
18. A method according to claim 17, wherein said expressed gene product is recovered together with α-amylase or recovered as a fusion protein with the α-amylase.
19. A method according to claim 1, wherein said compatible angiosperm host cell is a rice, barley or wheat suspension cultured cell.
20. A method according to claim 19, wherein said compatible angiosperm host cell is a rice suspension cultured cell.
21. A method of claim 1, wherein said sugar-depleted or sugar free condition is a condition deficient of sucrose, glucose or fructose.
22. A method according to claim 1, wherein said gene product is a protein of animal, plant or microbial origin.
23. A method for producing a gene product by expressing a gene encoding said gene product in angiosperm host cells, comprising:
a) constructing a vector expressible in angiosperm host cells, said vector comprising a promoter region derived from an α-amylase gene of a plant, and a gene encoding a desired gene product, said promoter region derived from the α-amylase gene including the promoter of the α-amylase gene and a DNA sequence encoding the signal peptide of α-amylase;
b) transforming a compatible angiosperm host cell with said vector;
c) cultivating the resultant transformant host cell in a culture medium; and
d) recovering the expressed gene product from said medium.
24. A method according to claim 23, wherein said promoter region is derived from an α-amylase gene of a monocot.
25. A method according to claim 24, wherein said promoter region is derived from an α-amylase gene of a graminaceous monocot.
26. A method according to claim 25, wherein said promoter region is derived from an α-amylase gene of a cereal crop.
27. A method according to claim 26, wherein said promoter region is derived from an α-amylase gene of rice crop.
28. A method according to claim 23, wherein said vector further comprises a marker gene, a reporter gene, an antibiotic-resistance gene, an enhancer or a regulatory sequence.
29. A method according to claim 28, wherein said vector comprises an antibiotic-resistance gene.
30. A method according to claim 29, wherein said antibiotic is kanamycin or hygromycin.
31. A method according to claim 28, wherein said vector comprises a reporter gene.
32. A method according to claim 31, wherein said reporter gene is the β-glucuronidase (GUS) gene.
33. A method according to claim 23, wherein the transformation of said compatible angiosperm host cell is enhanced by co-culture with a potato suspension culture.
34. A method according to claim 23, wherein the transfer of said vector to the host cell is carried out by electroporation, polyethylene glycol-mediated transformation, particle bombardment, micro-injection method, ultrasonic method, poly-L ornithine method, calcium phosphate method or Agrobacterium-mediated transformation system.
35. A method according to claim 34, wherein the transfer of said vector to the host cell is carried out by the Agrobacterium-mediated transformation system.
36. A method according to claim 23, wherein said vector further comprises an α-amylase structural gene derived from a plant.
37. A method according to claim 36, wherein said expressed gene product is recovered together with α-amylase or recovered as a fusion protein with the α-amylase.
38. A method according to claim 23, wherein said compatible angiosperm host cell is a rice, barley or wheat suspension cultured cell.
39. A method according to claim 38, wherein said compatible angiosperm host cell is a rice suspension cultured cell.
40. A method of claim 23, wherein before the recovery of the expressed gene product, said cultivated transformant host cell is subjected to a sugar-depleted or sugar-free condition to promote the expression of said gene under the control of said promoter region.
41. A method of claim 40, wherein said sugar-depleted or sugar free condition is a condition deficient of sucrose, glucose or fructose.
42. A method according to claim 23, wherein said gene product is a protein of animal, plant or microbial origin.
US08343380 1992-11-04 1994-11-22 Gene expression system comprising the promoter region of the alpha-amylase genes Expired - Lifetime US5712112A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US07973324 US5460952A (en) 1992-11-04 1992-11-04 Gene expression system comprising the promoter region of the α-amylase genes
US08343380 US5712112A (en) 1992-11-04 1994-11-22 Gene expression system comprising the promoter region of the alpha-amylase genes

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US08343380 US5712112A (en) 1992-11-04 1994-11-22 Gene expression system comprising the promoter region of the alpha-amylase genes
US09072435 US6215051B1 (en) 1992-11-04 1998-05-04 Aarobacterium-mediated method for transforming rice
US09072917 US6288302B1 (en) 1992-11-04 1998-05-04 Application of α-amylase gene promoter and signal sequence in the production of recombinant proteins in transgenic plants and transgenic plant seeds

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US07973324 Continuation US5460952A (en) 1992-11-04 1992-11-04 Gene expression system comprising the promoter region of the α-amylase genes

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US50996295 Continuation-In-Part 1995-08-01 1995-08-01
US63979296 Division 1996-04-29 1996-04-29

Publications (1)

Publication Number Publication Date
US5712112A true US5712112A (en) 1998-01-27

Family

ID=25520757

Family Applications (2)

Application Number Title Priority Date Filing Date
US08343380 Expired - Lifetime US5712112A (en) 1992-11-04 1994-11-22 Gene expression system comprising the promoter region of the alpha-amylase genes
US09072435 Expired - Lifetime US6215051B1 (en) 1992-11-04 1998-05-04 Aarobacterium-mediated method for transforming rice

Family Applications After (1)

Application Number Title Priority Date Filing Date
US09072435 Expired - Lifetime US6215051B1 (en) 1992-11-04 1998-05-04 Aarobacterium-mediated method for transforming rice

Country Status (1)

Country Link
US (2) US5712112A (en)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2777155A1 (en) * 1998-04-09 1999-10-15 Meristem Therapeutics Seeds and plants whose germination is destroyed by the complete or partial absence of at least an indispensable reserve energetics has germination
US6215051B1 (en) 1992-11-04 2001-04-10 National Science Council Of R.O.C. Aarobacterium-mediated method for transforming rice
US6288302B1 (en) 1992-11-04 2001-09-11 National Science Council Of R.O.C. Application of α-amylase gene promoter and signal sequence in the production of recombinant proteins in transgenic plants and transgenic plant seeds
EP1164194A2 (en) * 2000-06-12 2001-12-19 Academia Sinica Protein production in transgenic plant seeds
WO2002016625A2 (en) 2000-08-25 2002-02-28 Basf Plant Science Gmbh Plant polynucleotides encoding prenyl proteases
US6359196B1 (en) 1999-09-23 2002-03-19 Finn Lok Germination-specific plant promoters
US6462257B1 (en) 1999-06-01 2002-10-08 Institute Of Paper Science And Technology, Inc. Vicilin-like seed storage protein gene promoter and methods of using the same
US20040107456A1 (en) * 2002-07-31 2004-06-03 Su-May Yu Plant MYB proteins
WO2004062365A2 (en) 2003-01-03 2004-07-29 The Texas A & M University System Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
US20050034192A1 (en) * 2003-01-03 2005-02-10 Damaj Mona B. Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
US7060876B2 (en) 1992-07-07 2006-06-13 Japan Tobacco Inc. Method for transforming monocotyledons
US7148064B1 (en) * 1999-05-26 2006-12-12 National Research Council Of Canada Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phospathe synthase gene
WO2008136790A1 (en) 2007-05-02 2008-11-13 Merial Limited Dna plasmids having improved expression and stability
US20090084124A1 (en) * 2007-09-27 2009-04-02 Sanyo Electric Co., Ltd. Showcase
US7611898B2 (en) 2005-05-09 2009-11-03 The Samuel Roberts Noble Foundation Agrobacterium transformation of stolons
US7939328B1 (en) 1993-09-03 2011-05-10 Japan Tobacco Inc. Method of transforming monocotyledons using scutella of immature embryos

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK1306440T3 (en) * 2000-08-03 2007-04-02 Japan Tobacco Inc A method for improving the gene transfer efficiency into plant cells
CN1273604C (en) 2000-08-03 2006-09-06 日本烟草产业株式会社 Method of improving gene transfer efficiency into plant cells
US7279336B2 (en) * 2000-09-14 2007-10-09 Gelvin Stanton B Methods and compositions for enhanced plant cell transformation
CA2867139A1 (en) 2011-04-11 2012-10-18 Targeted Growth, Inc. Identification and the use of krp mutants in plants
US10017804B2 (en) 2013-02-11 2018-07-10 Evolva Sa Efficient production of steviol glycosides in recombinant hosts

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5460952A (en) * 1992-11-04 1995-10-24 National Science Counsil Of R.O.C. Gene expression system comprising the promoter region of the α-amylase genes

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1341467C (en) 1988-07-29 2004-12-07 John C. Rogers Producing commercially valuable polypeptides with genetically transformed endosperm tissue
GB8922007D0 (en) 1989-09-29 1989-11-15 Cambridge Advanced Tech Light-activatable plant promoter
US5712112A (en) 1992-11-04 1998-01-27 National Science Council Of R.O.C. Gene expression system comprising the promoter region of the alpha-amylase genes
US5693506A (en) 1993-11-16 1997-12-02 The Regents Of The University Of California Process for protein production in plants

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5460952A (en) * 1992-11-04 1995-10-24 National Science Counsil Of R.O.C. Gene expression system comprising the promoter region of the α-amylase genes

Non-Patent Citations (122)

* Cited by examiner, † Cited by third party
Title
Akazawa et al., "Topographic Aspects of Biosynthesis, Extracellular Secretion, and Intracellular Storage of Proteins in Plant Cells", Ann. Rev. Psychol., 36:441-472 (1985).
Akazawa et al., Topographic Aspects of Biosynthesis, Extracellular Secretion, and Intracellular Storage of Proteins in Plant Cells , Ann. Rev. Psychol., 36:441 472 (1985). *
An et al., "Transformation of Tobacco, Tomato, Potato, and Arabidopsis thaliana Using a Binary Ti Vector System", Plant Physiol., 81:301-305 (1986).
An et al., Transformation of Tobacco, Tomato, Potato, and Arabidopsis thaliana Using a Binary Ti Vector System , Plant Physiol., 81:301 305 (1986). *
Ashikari, et al., "Rhizopus Raw-Starch-Degrading Glucoamylase: Its Cloning and Expression in Yeast, " Agric. Biol. Chem., 50(4):957-964 (1986).
Ashikari, et al., Rhizopus Raw Starch Degrading Glucoamylase: Its Cloning and Expression in Yeast, Agric. Biol. Chem., 50(4):957 964 (1986). *
Baulcombe et al., "A Novel Wheat α-amylase Gene (αAmy3)," Mol. Gen. Genet., 209:33-40 (1987).
Baulcombe et al., A Novel Wheat amylase Gene ( Amy3), Mol. Gen. Genet., 209:33 40 (1987). *
Belanger et al., "Heat Shock Causes Destabilization of Specific mRNAs and Destruction of Endoplasmic Reticulum in Barley Aleurone Cells", Proc. Nat'l. Acad. Sci. (USA), 83:1354-1358.
Belanger et al., Heat Shock Causes Destabilization of Specific mRNAs and Destruction of Endoplasmic Reticulum in Barley Aleurone Cells , Proc. Nat l. Acad. Sci. (USA), 83:1354 1358. *
Benfey et al., "The CaMV 35S Enhancer Contains at Least Two Domains Which can Confer Different Developmental and Tissue-Specific Expression Patterns", EMBO Journal, 8:2195-2202.
Benfey et al., The CaMV 35S Enhancer Contains at Least Two Domains Which can Confer Different Developmental and Tissue Specific Expression Patterns , EMBO Journal, 8:2195 2202. *
Bevan, "Binary Agrobacterium Vectors for Plant Transformation", Nucleic Acids Research, 12:8711-8721 (1984).
Bevan, Binary Agrobacterium Vectors for Plant Transformation , Nucleic Acids Research, 12:8711 8721 (1984). *
Briggs, D. "Barley Germination: Biochemical Changes and Hormonal Control" in Barley: Genetics, Biochemistry, Molecular Biology & Biotechnology, Shewry, P.R. (ed.) CAB Int'l 02/1992.
Briggs, D. Barley Germination: Biochemical Changes and Hormonal Control in Barley: Genetics, Biochemistry, Molecular Biology & Biotechnology, Shewry, P.R. (ed.) CAB Int l 02/1992. *
Bytebier et al., "T-DNA Organization in Tumor Cultures and Transgenic Plants of The Monocotyledon Asparagus officinalis", Proc. Nat'. Acad. Sci. (USA), 84:5345-5349 (Aug. 1987).
Bytebier et al., T DNA Organization in Tumor Cultures and Transgenic Plants of The Monocotyledon Asparagus officinalis , Proc. Nat . Acad. Sci. (USA), 84:5345 5349 (Aug. 1987). *
Chan et al., "Transformation of Indica Rice (Oryza sativa L.) Mediated by Agrobacteruim tumefaciens", Plant Cell Physiol., 33(5):577-583 (1992).
Chan et al., Transformation of Indica Rice ( Oryza sativa L.) Mediated by Agrobacteruim tumefaciens , Plant Cell Physiol., 33(5):577 583 (1992). *
Chandler et al., "The Effects of Gibberellic Acid and Abscisic Acid on α-amylase mRNA levels in Barley Aleurone Layers Studies Using an α-amylase cDNA Clone", Plant Mol. Biol., 3:407-418 (1984).
Chandler et al., The Effects of Gibberellic Acid and Abscisic Acid on amylase mRNA levels in Barley Aleurone Layers Studies Using an amylase cDNA Clone , Plant Mol. Biol., 3:407 418 (1984). *
Chang et al., "Agrobacterium tumefaciens-Mediated Transformation of Soybean (Glycine max (L.) Merr.) is Promoted by the Inclusion of Potato Suspension Culture",Bot. Bull. Adademia Sinica 32:171-178 (1991).
Chang et al., Agrobacterium tumefaciens Mediated Transformation of Soybean ( Glycine max (L.) Merr.) is Promoted by the Inclusion of Potato Suspension Culture , Bot. Bull. Adademia Sinica 32:171 178 (1991). *
Christou, et al., "The Development of a Variety-Independent Gene-Transfer Method for Rice", Tibtech, 10:239-246 (Jul. 1992).
Christou, et al., The Development of a Variety Independent Gene Transfer Method for Rice , Tibtech, 10:239 246 (Jul. 1992). *
Dale et al., "Agroinfection of Wheat: Inoculation of In Vitro Grown Seedlings and Embryos",Plant Science, 63:237-245 (1989).
Dale et al., Agroinfection of Wheat: Inoculation of In Vitro Grown Seedlings and Embryos , Plant Science, 63:237 245 (1989). *
Datta et al., "Genetically Engineered Fertile Indica-Rice Recovered From Protoplasts", Biotechnology 8:736-740 (Aug. 1990).
Datta et al., Genetically Engineered Fertile Indica Rice Recovered From Protoplasts , Biotechnology 8:736 740 (Aug. 1990). *
Deikman et al., "Control of α-Amylase mRNA Accumulation by Gibberellic Acid and Calcium in Barley Aleurone Layers", Plant Physiol., 78:192-198 (1995).
Deikman et al., Control of Amylase mRNA Accumulation by Gibberellic Acid and Calcium in Barley Aleurone Layers , Plant Physiol., 78:192 198 (1995). *
Depicker et al., "Molecular Cloning of Overlapping Segments of the Noplaine TiPlasmid pTiC58 as a Means to Restriction Endonuclease Mapping", Plasmid, 3:193-211 (1980).
Depicker et al., Molecular Cloning of Overlapping Segments of the Noplaine TiPlasmid pTiC58 as a Means to Restriction Endonuclease Mapping , Plasmid, 3:193 211 (1980). *
During, et al., "Synthesis and self-assembly of a functional monoclonal antibody in transgenic Nicotiana tabacum" Plant Molecular Biology 15:281-293 (1990).
During, et al., Synthesis and self assembly of a functional monoclonal antibody in transgenic Nicotiana tabacum Plant Molecular Biology 15:281 293 (1990). *
Garfinkel et al., "Agrobacterium tumefaciens Mutants Affected in Crown Gall tumorigenesis and Octopine Catabolism", Journal of Bacter., 144920:732-743 (Nov. 1980).
Garfinkel et al., Agrobacterium tumefaciens Mutants Affected in Crown Gall tumorigenesis and Octopine Catabolism , Journal of Bacter., 144920:732 743 (Nov. 1980). *
Gillies et al., "A Tissue-Specific Transcription Enhancer Element is Located in the Major Intron of a Rearrranged Immunoglobulin Heavy Chain Gene", Cell, 33:717-728 (Jul. 1983).
Gillies et al., A Tissue Specific Transcription Enhancer Element is Located in the Major Intron of a Rearrranged Immunoglobulin Heavy Chain Gene , Cell, 33:717 728 (Jul. 1983). *
Gould et al., "Transformation of Zea mays. Using Agrobacterium tumefaciens and the Shoot Apex", Plant Physiol., 95:426-434 (1991).
Gould et al., Transformation of Zea mays. Using Agrobacterium tumefaciens and the Shoot Apex , Plant Physiol., 95:426 434 (1991). *
Hain et al., "Uptake, Integration, Expression and Genetic Transmission of a Selectable Chimaeric Gene by Plant Protoplasts", Mol. Gen. Genet., 199:161-168 (1985).
Hain et al., Uptake, Integration, Expression and Genetic Transmission of a Selectable Chimaeric Gene by Plant Protoplasts , Mol. Gen. Genet., 199:161 168 (1985). *
Hernalsteens et al., "An Agrobacterium-transformed Cell Culture from the Monocot Asparagus officinalis ", EMBO Journal, 3(13):3039-3041 (1984).
Hernalsteens et al., An Agrobacterium transformed Cell Culture from the Monocot Asparagus officinalis , EMBO Journal , 3(13):3039 3041 (1984). *
Hiatt, et al., "Production of antibodies in transgenic plants," Nature 342:76-78 (Nov. 2, 1989).
Hiatt, et al., Production of antibodies in transgenic plants, Nature 342:76 78 (Nov. 2, 1989). *
Ho et al., "Regulation of Gene Expression in Barley Aleurone Layers", Mol. Biol. of Plant Growth Control, Alan R. Liss, Inc., pp. 35-49 (1987).
Ho et al., Regulation of Gene Expression in Barley Aleurone Layers , Mol. Biol. of Plant Growth Control, Alan R. Liss, Inc., pp. 35 49 (1987). *
Holsters et al., "Transfection and Transformation of Agrobacterium tumefaciens", Molec. Gen. Genet., 163:181-187 (1978).
Holsters et al., Transfection and Transformation of Agrobacterium tumefaciens , Molec. Gen. Genet., 163:181 187 (1978). *
Hooykaas, "Transformation of Plant Cells via Agrobacterium", Plant Molecular Biology , 13:327-336 (1989).
Hooykaas, Transformation of Plant Cells via Agrobacterium , Plant Molecular Biology , 13:327 336 (1989). *
Horsch et al., "A Simple and General Method for Transferring Genes into Plants", Science, 227:1229-1231 (Mar. 1989).
Horsch et al., A Simple and General Method for Transferring Genes into Plants , Science, 227:1229 1231 (Mar. 1989). *
Huang et al., "Classification and Characterization of the Rice α-Amylase Multigene Family", Plant Molecular Biology, 14:655-668 (1990).
Huang et al., "Structural Organization and Differential Expression of Rice α-Amylase Genes", Nucleic Acids Research, 18(23):7007-7014 (1990).
Huang et al., Classification and Characterization of the Rice Amylase Multigene Family , Plant Molecular Biology, 14:655 668 (1990). *
Huang et al., Structural Organization and Differential Expression of Rice Amylase Genes , Nucleic Acids Research, 18(23):7007 7014 (1990). *
Janssens et al., "Plant Cells Induce Transcription of the Agrobacterium Tumefaciens Nopaline pTiC58 Virulence Region", Plant Science , 47:185-193 (1986).
Janssens et al., Plant Cells Induce Transcription of the Agrobacterium Tumefaciens Nopaline pTiC58 Virulence Region , Plant Science , 47:185 193 (1986). *
Johnson et al., "Glycine Potentiates the NMDA Response in Cultured Mouse Brain Neurons", Nature , 325:529-531 (Feb. 1987).
Johnson et al., Glycine Potentiates the NMDA Response in Cultured Mouse Brain Neurons , Nature , 325:529 531 (Feb. 1987). *
Karrer et al., "Differential Expression of α-Amylase Genes in Germinating Rice and Barley Seeds", Plant Molecular Biology , 16:797-805 (1991).
Karrer et al., Differential Expression of Amylase Genes in Germinating Rice and Barley Seeds , Plant Molecular Biology , 16:797 805 (1991). *
Khursheed et al., "Barley α-Amylase Genes", J. Biol. Chem., 263(35):18953-18960 (Dec. 15, 1988.
Khursheed et al., Barley Amylase Genes , J. Biol. Chem., 263(35):18953 18960 (Dec. 15, 1988. *
Kim et al., "Nucleotide Sequence of a High-pI Rice (Oryza sative) -Amylase Gene", Plant Molecular Biology, 18:399-402 (1992).
Kim et al., Nucleotide Sequence of a High pI Rice ( Oryza sative ) Amylase Gene , Plant Molecular Biology, 18:399 402 (1992). *
Knox et al., "Structure and Organization of Two Divergent α-amylase Genes from Barley", Plant Molecular Biology, 9:3-17 (1987).
Knox et al., Structure and Organization of Two Divergent amylase Genes from Barley , Plant Molecular Biology, 9:3 17 (1987). *
Krebbers et al., "Production of Peptides in plant seeds, " TIBETCH, 8:1-3 (Jan. 1990).
Krebbers et al., Production of Peptides in plant seeds, TIBETCH, 8:1 3 (Jan. 1990). *
Kumagai et al., "Expression and Secretion of Rice α-amylase by Saccharomyces cerevisiae", Gene, 94:209-216 (1990).
Kumagai et al., Expression and Secretion of Rice amylase by Saccharomyces cerevisiae , Gene, 94:209 216 (1990). *
Lanahan et al., "A Gibberellin Response Complex in Cereal α-Amylase Gene Promoters", The Plant Cell, 4:203-211 (Feb. 1992).
Lanahan et al., A Gibberellin Response Complex in Cereal Amylase Gene Promoters , The Plant Cell, 4:203 211 (Feb. 1992). *
McElroy et al., "Structural Characterization of a Rice Actin Gene", Plant Molecular Biology, 14:163-171 (1990).
McElroy et al., Structural Characterization of a Rice Actin Gene , Plant Molecular Biology, 14:163 171 (1990). *
O Neill et al., The a amylase Genes in Oryza sativa: Characterization of cDNA Clones and mRNA Expression During Seed Germination , Mol. Gen. Genet., 221:235 244 (1990). *
O'Neill et al., "The a-amylase Genes in Oryza sativa: Characterization of cDNA Clones and mRNA Expression During Seed Germination", Mol. Gen. Genet., 221:235-244 (1990).
Pen et al., "Production of Active Bacillus Licheniformis Alpha-Amylase in Tobacco and Its Application in Starch Liquefaction , " Bio/Technology 10:292-296 (Mar., 1992).
Pen et al., Production of Active Bacillus Licheniformis Alpha Amylase in Tobacco and Its Application in Starch Liquefaction , Bio/Technology 10:292 296 (Mar., 1992). *
Radke et al., "Transformation of Brassica napus L. using Agrobacterium tumefaciens: Developmentally Regulated Expression of a Reintroduced Napin Gene", Theor. Appl. Genet., 75:685-694 (1988).
Radke et al., Transformation of Brassica napus L. using Agrobacterium tumefaciens: Developmentally Regulated Expression of a Reintroduced Napin Gene , Theor. Appl. Genet., 75:685 694 (1988). *
Raineri et al., "Agrobacterium-Mediated Transformation of Rice (Oryza SativaL.)", Biotechnology 8:33-38 (Jan. 1990).
Raineri et al., Agrobacterium Mediated Transformation of Rice ( Oryza Sativa L.) , Biotechnology 8:33 38 (Jan. 1990). *
Rogers et al., "Coordinate Increase in Major Transcripts from the High pI α-Amylase Multigene Family in Barley Aleurone Cells Stimulated with Gibberellic Acid", J. Biol. Chem. 259(19):12234-12240 (Oct. 10, 1984).
Rogers et al., Coordinate Increase in Major Transcripts from the High pI Amylase Multigene Family in Barley Aleurone Cells Stimulated with Gibberellic Acid , J. Biol. Chem. 259(19):12234 12240 (Oct. 10, 1984). *
Rogers, "Two Barley α-Amylase Gene Families are Regulated Differentally in Aleurone Cells", J. Biol. Chem., 260(6):3731-3738 (Mar. 25, 1985).
Rogers, Two Barley Amylase Gene Families are Regulated Differentally in Aleurone Cells , J. Biol. Chem., 260(6):3731 3738 (Mar. 25, 1985). *
Sahi et al., "Corn Metabolites Affect Growth and Virulence of Agrobacterium tumefaciens", Proc. Nat'l Acad. Sci. (USA), 87:3879-3883 (May 1990).
Sahi et al., Corn Metabolites Affect Growth and Virulence of Agrobacterium tumefaciens , Proc. Nat l Acad. Sci. (USA), 87:3879 3883 (May 1990). *
Salisbury et al., "Respiration", Plant Physiology, 2nd Edition, pp. 174-177 (1978).
Salisbury et al., Respiration , Plant Physiology, 2nd Edition, pp. 174 177 (1978). *
Schafer et al., "T-DNA Integration and Expression in a Monocot Crop Plant after Induction of Agrobacterium", Nature, 327:529-532 (Jun. 1987).
Schafer et al., T DNA Integration and Expression in a Monocot Crop Plant after Induction of Agrobacterium , Nature, 327:529 532 (Jun. 1987). *
Schlappi et al., "Competence of Immature maize Embryos for Agrobacterium-Mediated Gene Transfer", The Plant Cell, 4:7-16 (Jan. 1992).
Schlappi et al., Competence of Immature maize Embryos for Agrobacterium Mediated Gene Transfer , The Plant Cell, 4:7 16 (Jan. 1992). *
Sijmons, et al., "Production of Correctly Processed Human Serum Albumin in Transgenic Plants," Bio/Technology 8:217-221 (Mar., 1990).
Sijmons, et al., Production of Correctly Processed Human Serum Albumin in Transgenic Plants, Bio/Technology 8:217 221 (Mar., 1990). *
Stachel et al., "Identification of the Signal Molecules Produced by Wounded Plant Cells that Activate T-DNA Transfer in Agrobacterium tumefaciens", Nature, 318:624-629 (Dec. 1985).
Stachel et al., Identification of the Signal Molecules Produced by Wounded Plant Cells that Activate T DNA Transfer in Agrobacterium tumefaciens , Nature, 318:624 629 (Dec. 1985). *
Sutliff et al., "Characterization of an α-Amylase Multigene Cluster in Rice", Plant Molecular Biology, 16:579-591 (1991).
Sutliff et al., Characterization of an Amylase Multigene Cluster in Rice , Plant Molecular Biology, 16:579 591 (1991). *
Ueda, "Fungal glucoamylases and raw starch digestion, " TIBS, pp. 89-90 (Mar., 1981)
Ueda, Fungal glucoamylases and raw starch digestion, TIBS, pp. 89 90 (Mar., 1981) *
Usami et al., "Factor Inducing Agrobacterium tumefaciens vir Gene Expression is Present in Monocotyledonous Plants", Proc. Nat'l Acad. Sci. (USA) 85:3748-3752 (Jun. 1988).
Usami et al., Factor Inducing Agrobacterium tumefaciens vir Gene Expression is Present in Monocotyledonous Plants , Proc. Nat l Acad. Sci. (USA) 85:3748 3752 (Jun. 1988). *
Vandekerckhove, et al., "Enkephalins Produced in Transgenic Plants Using Modified 2S Seed Storage Proteins, " Bio/Technology 7:929-932 (Sep. 1989).
Vandekerckhove, et al., Enkephalins Produced in Transgenic Plants Using Modified 2S Seed Storage Proteins, Bio/Technology 7:929 932 (Sep. 1989). *
Wanbelt, et al., "Vicilin with carboxy-terminal KDEL is retained in the endoplasmic reticulum and accumulates to high levels in the leaves of transgenic plants, " The Plant Journal, 2(2):181-192 (1992).
Wanbelt, et al., Vicilin with carboxy terminal KDEL is retained in the endoplasmic reticulum and accumulates to high levels in the leaves of transgenic plants, The Plant Journal, 2(2):181 192 (1992). *
Weiher et al., "Multiple Point Mutation Affecting the Simian Virus 40 Enhancer", Science, 219:626-631 (Feb. 1983).
Weiher et al., Multiple Point Mutation Affecting the Simian Virus 40 Enhancer , Science, 219:626 631 (Feb. 1983). *
Yu et al., "Metabolic Depression of α-Amylase Gene Expression in Suspension-Cultured Cells of Rice", J. Biol. Chem., 266:21131-21137 (Nov. 5, 1991).
Yu et al., "Regulation of α-amylase-encoding Gene Expression in Germinating Seeds and Cultured Cell of Rice", Gene, 122:247-253 (1992).
Yu et al., Metabolic Depression of Amylase Gene Expression in Suspension Cultured Cells of Rice , J. Biol. Chem., 266:21131 21137 (Nov. 5, 1991). *
Yu et al., Regulation of amylase encoding Gene Expression in Germinating Seeds and Cultured Cell of Rice , Gene, 122:247 253 (1992). *
Zaenen et al., "Supercoiled Circular DNA in Crown-gall Inducing Agrobacterium Strains", J. Mol. Biol., 86:109-127 (1974).
Zaenen et al., Supercoiled Circular DNA in Crown gall Inducing Agrobacterium Strains , J. Mol. Biol., 86:109 127 (1974). *

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7060876B2 (en) 1992-07-07 2006-06-13 Japan Tobacco Inc. Method for transforming monocotyledons
US6288302B1 (en) 1992-11-04 2001-09-11 National Science Council Of R.O.C. Application of α-amylase gene promoter and signal sequence in the production of recombinant proteins in transgenic plants and transgenic plant seeds
US6215051B1 (en) 1992-11-04 2001-04-10 National Science Council Of R.O.C. Aarobacterium-mediated method for transforming rice
US7939328B1 (en) 1993-09-03 2011-05-10 Japan Tobacco Inc. Method of transforming monocotyledons using scutella of immature embryos
WO1999052344A1 (en) * 1998-04-09 1999-10-21 Groupe Limagrain Holding Seeds and plants whereof the germinating capacity is destroyed by total or partial lack of at least one energy reserve indispensable to germination
FR2777155A1 (en) * 1998-04-09 1999-10-15 Meristem Therapeutics Seeds and plants whose germination is destroyed by the complete or partial absence of at least an indispensable reserve energetics has germination
US7148064B1 (en) * 1999-05-26 2006-12-12 National Research Council Of Canada Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phospathe synthase gene
US6462257B1 (en) 1999-06-01 2002-10-08 Institute Of Paper Science And Technology, Inc. Vicilin-like seed storage protein gene promoter and methods of using the same
US6359196B1 (en) 1999-09-23 2002-03-19 Finn Lok Germination-specific plant promoters
EP1164194A3 (en) * 2000-06-12 2004-01-14 Academia Sinica Protein production in transgenic plant seeds
EP1164194A2 (en) * 2000-06-12 2001-12-19 Academia Sinica Protein production in transgenic plant seeds
WO2002016625A2 (en) 2000-08-25 2002-02-28 Basf Plant Science Gmbh Plant polynucleotides encoding prenyl proteases
US20040107456A1 (en) * 2002-07-31 2004-06-03 Su-May Yu Plant MYB proteins
US7291768B2 (en) 2002-07-31 2007-11-06 Academia Sinica Plant MYB proteins
US20050005322A1 (en) * 2003-01-03 2005-01-06 The Texas A&M University System Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
WO2004062365A2 (en) 2003-01-03 2004-07-29 The Texas A & M University System Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
US7253276B2 (en) 2003-01-03 2007-08-07 The Texas A&M University System Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
US20050034192A1 (en) * 2003-01-03 2005-02-10 Damaj Mona B. Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
US7323622B2 (en) 2003-01-03 2008-01-29 The Texas A&M University System Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
US7754946B2 (en) 2003-01-03 2010-07-13 The Texas A&M University System Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
US20100011460A1 (en) * 2003-01-03 2010-01-14 Damaj Mona B Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
EP2083072A1 (en) 2003-01-03 2009-07-29 The Texas A & M University System Stem-regulated, plant defense promotor and uses thereof in tissue-specific expression in monocots
US20070016979A1 (en) * 2003-01-03 2007-01-18 Damaj Mona B Stem-regulated, plant defense promoter and uses thereof in tissue-specific expression in monocots
US7611898B2 (en) 2005-05-09 2009-11-03 The Samuel Roberts Noble Foundation Agrobacterium transformation of stolons
WO2008136790A1 (en) 2007-05-02 2008-11-13 Merial Limited Dna plasmids having improved expression and stability
US20090084124A1 (en) * 2007-09-27 2009-04-02 Sanyo Electric Co., Ltd. Showcase

Also Published As

Publication number Publication date Type
US6215051B1 (en) 2001-04-10 grant

Similar Documents

Publication Publication Date Title
Ferreira et al. Developmental expression of the Arabidopsis cyclin gene cyc1At.
Hooker et al. Significance of the expression of the CER6 condensing enzyme for cuticular wax production in Arabidopsis
Takeda et al. Transcriptional activation of the tobacco retrotransposon Tto1 by wounding and methyl jasmonate
Jefferson et al. GUS fusions: beta‐glucuronidase as a sensitive and versatile gene fusion marker in higher plants.
Twell et al. Transient expression of chimeric genes delivered into pollen by microprojectile bombardment
US5723751A (en) Expression motifs that confer tissue and development-specific expression in plants
US5525716A (en) LPT2 promoter having aleurone-tissue-specific activity
US5110732A (en) Selective gene expression in plants
Kertbundit et al. In vivo random beta-glucuronidase gene fusions in Arabidopsis thaliana.
US5187267A (en) Plant proteins, promoters, coding sequences and use
US5866793A (en) Promoter for expressing foreign genes in monocotyledonous plants
US5436393A (en) Potato tuber specific transcriptional regulation
Benfey et al. The CaMV 35S enhancer contains at least two domains which can confer different developmental and tissue‐specific expression patterns
US20040123347A1 (en) Water-deficit-inducible plant promoters
Hamilton et al. Dissection of a pollen-specific promoter from maize by transient transformation assays
Elliott et al. cis-Acting Elements for Light Regulation of Pea Ferredoxin I Gene Expression Are Located within Transcribed Sequences.
US6329570B1 (en) Cotton modification using ovary-tissue transcriptional factors
US6259003B1 (en) Cotton plant promoters
US5693506A (en) Process for protein production in plants
US6225529B1 (en) Seed-preferred promoters
EP0335528A2 (en) DNA promoter fragments from wheat
US6403862B1 (en) Seed-preferred promoter from maize
EP0459643A2 (en) A recombinant promoter for gene expression in monocotyledonous plants
Lepetit et al. A plant histone gene promoter can direct both replication-dependent and-independent gene expression in transgenic plants
Chan et al. Agrobacterium-mediated production of transgenic rice plants expressing a chimeric α-amylase promoter/β-glucuronidase gene

Legal Events

Date Code Title Description
AS Assignment

Owner name: NATIONAL SCIENCE COUNCIL OF R.O.C., TAIWAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:YU, SU-MAY;LIU, LI-FEI;CHAN, MING-TSAIR;REEL/FRAME:007438/0284

Effective date: 19941220

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12