WO2001031038A1 - Genetic engineering immobilization of heteromer peptides - Google Patents

Abstract

A method of immobilizing heteromer peptides having a plural number of subunits, which are formed by cutting off precursor peptides, on a chitin or cellulose carrier by expressing a protein carrying a chitin-cellulose binding domain (CBD) fused therewith by using a genetic engineering technique. Heteromer peptides having a chitin-cellulose binding domain fused therewith; and a method of immobilizing these heteromer peptides. These heteromer peptides having a chitin-cellulose binding domain are useful in techniques for immobilizing catalytic enzymes for producing useful substances, etc. The method of immobilizing heteromer peptides is applicable to industrial uses.

Description

 Description Genetic engineering immobilization of heteromerbeptides

Technical field

 The present invention relates to the immobilization of heteromeric peptides. Specifically, the present invention relates to a heteropeptide fused with a chitin cellulose-binding domain, and a method for immobilizing the heteropeptide to chitin-cellulose. Background art

Immobilization of enzymes on carriers has important biotechnological implications, and various enzymes immobilized on carriers are used in industrial, research, and clinical settings. Enzymes may be immobilized by physical adsorption or covalent bonding. For example, in order to immobilize an enzyme by genetic engineering, a method in which a peptide having a binding activity to a carrier or a certain protein is fused to a target enzyme may be used. Examples of such peptides include affinity peptides that specifically adsorb to cellulose or chitin present in enzymes such as cellulase and chitinase (hereinafter “cellulose” chitin-binding domain (eel lulose or chitin binding domain (CBD) j) Cellulose ゃ chitin is inexpensive, non-toxic, and chemically stable, so it is suitable as a carrier for immobilizing enzymes. It is also easy to process into membrane, powder, bead, etc. In fact, technology has been developed to immobilize enzyme proteins fused with CBD while maintaining their activity (E Ong et al., 1991, Enzyme Microb. Technol. 13: 59-65) In addition, the cellulose-chitin binding domain has been isolated and identified from various enzymes in multiple organisms, and these have been immobilized by various enzymes. Use for Rukoto is shown. (For example P. Tomme et al, 1996, Ann NY Acad Sci 799:.... 418-424 see) However, this Until now, all enzymes that have been attempted to be immobilized using CBD are monomeric enzymes that work alone, and there is no example of immobilizing an enzyme having a subunit structure using CBD.

 Enzymes composed of heterogeneous proteins composed of multiple subnetts are often industrially important. For example, as such an enzyme, 7-?-(4-carboxybutanamide) -cephalosporanic acid acylase (abbreviated as "GL-7ACA acylase"), which is a heteroprotein composed of spikelets and subunits, is used. No. 7-Aminocephalosporanic acid (7-ACA) is an important intermediate of cephalo antibiotics, and is based on cephalosporanic acid (CC) produced by microorganisms as a starting material for chemical synthesis or enzymatic reactions. It is industrially synthesized and produced using GL-7ACA acylase is used in the process of catalyzing the deamination of aminoacyl reaction with glucuryl-7-ACA, an intermediate in the enzymatic synthesis of 7-ACA from CC, to produce 7ACA. Therefore, developing a technology to easily immobilize this enzyme while maintaining its activity has high utility from the viewpoint of industrial use. GL-7ACA acylase, like benicillin acylase and other cephalosporanic acylases, is an enzyme composed of heteropeptides.After the precursor gene is synthesized by the expression of the enzyme gene, GL-7ACA acylase is a specific enzyme. It is known that peptides are cleaved into multimers by a processing mechanism. It was thought that such an enzyme would not be able to express its activity if only one of the subunits was immobilized. Or, even if one subunit was fixed and the other subunit was fixed by bonding to it, there was a possibility that stability that could withstand industrial use could not be expected. Disclosure of the invention

An object of the present invention is to provide a heteromerbide fused with a chitin'cellulose binding domain (CBD) and use thereof. The present invention also provides a method for producing the heteromerbide peptide, a method for immobilizing the heteromerbide peptide, and the like. The task is to

 The present inventors have conducted intensive studies with the example of GL-7ACA acylase, aiming at immobilization of heteropeptides by applying a genetic engineering technique. Specifically, cellulose-chitin binding domain (CBD) was fused to the GL-7ACA acylase gene, this gene was expressed using Escherichia coli as a host, and GL-7ACA acylase was immobilized on chitin beads by the action of CBD. . In the present invention, a gene in which CBD was fused to three different sites of GL-7ACA acylase by genetic engineering was produced, and the expression thereof was attempted. The activity was successfully achieved in the adsorption state. The production of the heteropeptide of the present invention can be applied to various other acylases including cyclic lipopeptide acylase which mediates acylation of cyclic lipopeptide. Based on these facts, the present inventors have prepared a precursor peptide having a chitin-cellulose binding domain so that it can be immobilized on chitin or a cell mouth while maintaining its activity. The present inventors have found that it is possible to produce merbeptides and have completed the present invention.

 That is, the present invention provides a heteromeric peptide fused with a chitin / cellulose binding domain, a method for producing the heteromeric peptide, a method for immobilizing the heteromeric peptide, and a use of the heteromeric peptide. More specifically,

 [1] a heteromeric peptide in which at least one of the subunits constituting the heteromeric peptide produced by cleavage of the precursor peptide has a chitin / cellulose binding domain added thereto;

 (2) the peptide according to (1), wherein the heteropeptide is a protein produced by self-splicing;

 [3] the peptide of [2], wherein the protein produced by self-splicing is an aminoacylase;

[4] Aminoacylase is 7-/?-(4-carboxybutane amide) The peptide according to (3), which is a rosporan acid acylase,

 (5) the peptide according to (2), wherein the protein produced by self-splicing is cyclic lipobeptidase;

 [6] The cyclic lipopeptide acylase has the formula:

(Wherein R ¹ is Ashiru group, R ² is hydroxy or Ashiruokishi group, R ³ is hydrogen or hydroxy group, R ⁴ is hydrogen or hydroxy group, R ⁵ is hydrogen or hydroxy sul Honiruokishi group, and R ⁶ is hydrogen Or an acylase that catalyzes the acylation of compound IV represented by the formula (5), (7) the precursor peptide of the heteromeric peptide according to (1),

 [8] the precursor peptide according to [7], wherein the precursor peptide is any one of the following (a), (b), or (c):

 (a) a peptide comprising an amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, and SEQ ID NO: 28

(b) SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, and SEQ ID NO: 2 Any one of the amino acid sequences selected from the group consisting of the amino acid sequences described in 8, wherein one or more amino acids are deleted, substituted, or added, and binds to chitin or cellulose; That can constitute a heteromer having amino acid activity and aminoacylase activity

 (c) stringent conditions with DNA having any one of the nucleotide sequences selected from the group consisting of the nucleotide sequences of SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, and SEQ ID NO: 27 Peptide that is encoded by DNA that can be hybridized under the same conditions and has a binding activity to chitin / cellulose and an aminoacylase activity

 (9) a DNA encoding the precursor peptide according to (8),

 (10) an expression vector comprising the DNA of (9),

 (11) a host cell transformed with the expression vector according to (10),

[12] A method of culturing the host cell according to [11] in a medium, and recovering a heteromeric peptide or a precursor of the heteromerbide peptide from the host cell and / or a culture supernatant thereof. A method for producing a peptide of the present invention or a precursor peptide of the peptide of the present invention according to (1),

 (13) a method for producing an immobilized heteromeric peptide, comprising a step of contacting the heteromeric peptide or the heteromeric peptide precursor peptide according to (1) with chitin and / or cellulose,

 (14) an immobilized heteromeric peptide in which the chitin 'cellulose-binding domain in the heteromeric peptide according to (1) is bound to chitin and / or cellulose;

 [15] (a) contacting the heteromeric peptide substrate with the immobilized heteromeric peptide according to [14], and

(b) a step of recovering the reaction product in the step (a), a method for producing a reaction product produced by being catalyzed by the immobilized heteropeptide, (16) The chitin in the heteromeric peptide according to (4), the immobilized heteromeric peptide in which the cellulose-binding domain is bound to chitin and / or cellulose,

formula:

(Wherein is acetoxy, hydroxy or hydrogen, and R ₂ is a carboxyalkanol having 3 to 8 carbon atoms or D-glucyl mill), and a salt thereof are contacted with a compound represented by the formula:

(Wherein represents acetoxy, hydroxy or hydrogen), a method for producing a compound (I), characterized by obtaining a compound (I) or a salt thereof,

 (17) The chitin of the heteromeric peptide according to (6), wherein the cellulose-binding domain is immobilized to a chitin and / or cellulose immobilized heteropeptide,

formula:

(Wherein R ¹ is Ashiru group, R ² is hydroxy or Ashiruokishi group, R ³ is hydrogen or hydroxy group, R ⁴ is hydrogen or hydroxy group, R ⁵ is hydrogen or hydroxy sul Honiruokishi group, and R ⁶ is hydrogen Or a compound of the formula (IV) or a salt thereof,

(ΠΙ)

(Wherein R ² , R \ R \ R ⁵ and R ⁶ represent the same groups as described above), or a method for producing a compound (III), characterized by obtaining a salt thereof.

 [18] 7-?-(4-monocarboxybutanamide) A chitin / cellulose-binding domain is added to at least one of the subunits constituting the monocephalosporan acylase, and the chitin / cellulose-binding is added. Domain immobilized on chitin and / or cellulose,

Formula:

(Wherein, R _t represents acetoxy, hydroxy or hydrogen), an immobilized enzyme for the production of compound (I),

 [19] Formula:

(Wherein R ¹ is an acyl group, R ² is a hydroxy or acyloxy group, R ³ is hydrogen or Is a hydroxy group, R ⁴ is a hydrogen or hydroxy group, R ⁵ is a hydrogen or hydroxysulfonyloxy group, and R ⁶ is a hydrogen or rubamoyl group). A chitin / cellulose binding domain is added to at least one of the subunits constituting a catalytic lipopeptide acylase, and the chitin / cellulose binding domain is immobilized on chitin and / or cellulose.

(Wherein, R ² , R ³ , R \ R ⁵ and R ⁶ represent the same groups as described above).

The present invention relates to a heteromeric peptide in which at least one of the subunits constituting a heteromeric peptide produced by cleavage of a precursor peptide has a chitin / cellulose binding domain added thereto. The term “heteromeric peptide” in the present invention means that a single-chain precursor peptide is first synthesized by transcription and translation of a gene encoding the heteromer peptide, and then the precursor peptide is cleaved by processing. Heterogeneous peptide consisting of two or more subunits, which is produced by receiving the heterogeneous peptide, wherein at least one of the subunits constituting the heteromeric peptide is a kit. This is a heteromerbeptide to which a cellulose binding domain is added.

 Here, “chitin 'cellulose binding domain” refers to a peptide domain that binds to chitin and / or cellulose. Such a domain is a cellulase

(Cellulase), Xylanase, Glucanase and Chitinase (P. Tomme et al., 1996, Ann. NY Acad. Sci. 799: 418- 424; T. Watanabe et al., 1994, J. Bacteriol. 176: 4465-4472) The chitin / cellulose binding domain used in the present invention is not limited in its origin as long as it binds to chitin and Z or cellulose. . For example, a partial peptide (SEQ ID NO: 22) of chitinase Al (GenBank Ac. No. M57601, J05599) derived from Bacillus acilluscirculans can be mentioned. In order to immobilize the heteromer peptide on the carrier, it is also conceivable to use a peptide domain capable of binding to a high molecular polymer other than the chitin / cellulose binding domain. Substrate binding domains are included. For example, the PHA binding domain of poly (hydroxyalkanoic acid) (PHA) depolymerase (T. Fukui et al., 1988. Biochim. Biophys. Acta 952: 164-171; A. Behrends et al., 1996, FES Microbiol Lett. 143: 191-194; M. Shinomiya et al., 1997, FEMS Microbiol. Lett. 154: 98-94) and PUR surface binding of enzymes (such as PUR esterase) that degrade polyurein (PUR). It is conceivable to use domains (T. Nakajima-Kambe et al., 1999, Appl. Microbiol. Biotechnol. 51: 134-140) and other substrate binding domains of the family of solid polyester degrading enzymes. Also, the substrate binding domain of polyhydroxybutyric acid (PHB) depolymerase (K. Kasuya et al., 1999, Int. J. Biol. Macromol. 24: 329-36) can be used. When these peptide domains are used, a heteropeptide can be immobilized using a polymer to which each peptide domain binds as a carrier.

The heteromeric peptide of the present invention is a recombinant protein obtained by using a known gene recombination technique. It can be prepared as a quality. That is, a DNA coding for a chitin'cellulose binding domain is bound to a DNA coding for a subunit of the target heteropeptide so that the reading frame of the protein matches, and the subunit and the chitin are ligated. 'A fusion protein with the cellulose binding domain may be produced. The position where the chitin / cellulose binding domain is fused is not particularly limited as long as the heteromeric peptide is formed and the original activity of the peptide is maintained. For example, a chitin'cellulose binding domain can be added to the N-terminus or C-terminus of a single subunit, or inserted into a subunit polypeptide.

 As the origin of the heteropeptide of the present invention, any heteromeric peptide generated by cleavage of the precursor peptide can be used. Such peptides include, for example, hormones, cytokines, enzymes, signaling factors, receptors, and the like. Subunits also include those connected by, for example, a disulfide bond. Examples of such proteins include, but are not limited to, insulin, insulin receptor, NMDA (N-methyl-D-aspartate) receptor, HGF (hepatocyte growth factor), and the like.

 The peptide in which the chitin / cellulose binding domain is added to the natural peptide may be a peptide having a natural amino acid sequence, and the natural peptide may have one or more amino acids. May be a peptide modified by substitution, deletion, addition and / or insertion of a peptide. Such modification of the amino acid sequence can be performed to improve the stability and activity of the heteromer peptide. The heteromeric peptide of the present invention is preferably a protein produced by self-slicing. Self-splicing refers to autonomously cleaving the precursor peptide and generating a heteromer, and expressing the activity of the protein, without relying on the catalysis of other molecules such as protease.

Such proteins include intein (Intein; Pietrokovski, S., 1998, Protein Sci. 7: 64-71), N-terminal nucleophilic hydrolase; Ntn) (JA Brannigan et al., 1995, Nature 378: 416-419), and proteins such as maze. For example, intin has a yeast membrane ATPase (Chong, S. et al. ₃ 1998, J. Biol. Chem., 273: 10567-77; Chong, S. et al., 1996, J. Biol. Chem. 271). : 22159-68), and Pyrococcus kodakaraensis DNA polymerase (Nishioka, M. et al., 1998, Nucleic Acids Res. 26: 4409-12). In addition, N-terminal nucleophilic hydrolases include, for example, ί, ^^^; bacterial glycosylasparaginase (Liu, Y. et al., 1998, J. Biol. Chem. 273). : 9688-94), Proteasom

(proteasome) (Ditzel, L. et al., 1998, J. Mol. Biol. 279: 1187-91), and penicillin acylase.

 Among them, a preferred heteropeptide in the present invention is aminoacylase (Sudhakaran, V. K. et al., 1992, Process Biochemistry 27: 13-143). Aminoacylase is an enzyme that catalyzes a reaction that hydrolyzes an acylamino group into an amino group. In the present invention, aminoacylase includes, for example, penicillin acylase (Oh, SJ et al., 1987, Gene 56: 87-97; Verhaert, RM et al., 1997, Appl. Environ. Microbiol. 63: 3412-8 ), Cephalosporan acylase

(Matsuda, A et al., 1987, J. Bacteriol. 169: 5821-6; Sudhakaran, VK et al., 1992, Process Biochemistry 27: 131-143; Aramori, I. et al., 1991, J. Fermentation Bioengineering 72: 232-243), and Aculeasin A-like cyclic lipopolypeptide acylase zekinocandin B deacylase (lipopeptide acylase from uia? E / 2s / s) (Inokoshi, J. et al., 1992, Gene 119 : 29-35; JP-A-4-228072; International Publication No. W097 / 32975).

Among these aminoacylases, β- (4-carboxybutaneamide) -cephalosporanate acylase (abbreviated as “GL-7ACA acylase”) is an enzyme with high industrial utility as described above ( For example, Ishii, Y. et al., 1995, Eur. J. Biochem. 230: 773-8; Saito, Y. et al., 1996, Annals. NY Acad. Sci. 782: 226-240; see Tsuzuki Katsuaki et al., 1989, Nippon Nogeikagaku Kaishi 63: 1847-1853). As GL-7ACA acylase, for example, a protein derived from Pseudo marnas as mendocina) C427 strain specified by FERM BP-3425 is preferably used (see Japanese Patent Application Laid-Open No. Hei 7-313161). Examples of the heteromeric peptide of the present invention in which a chitin'cell-mouth binding domain is added to GL-7ACA acylase derived from the C427 strain include, for example, the amino acid set forth in SEQ ID NO: 17, 19, or 21. Heteromeric peptides generated from a precursor peptide consisting of a sequence are preferably used, but are not limited thereto. In addition, V22 derived from the genus Pseudomonas (Aramori, I. et al., 1991, J. Fermentation Bioengineering 72: 232-243), and A14 (Aramori, I. et al., 1992, J. Fermentation Bioengineering 73: 185- 192) can also be used o

The cyclic lipopeptide acylase is not particularly limited as long as it has an activity of deacylating the acylamino group of the cyclic lipopeptide. In the present invention, the term “cyclic lipopeptide” refers to a compound having a polypeptide ring and having an amino group as a side chain on the ring. The compound may further have another side chain. Examples of the cyclic lipopeptide include a compound represented by the structural formula (IV). This compound includes a FR901379 substance represented by the following structural formula [IVa] (described in JP-A-3-184921). More specific examples of the cyclic lipopeptide acylase include, for example, a cyclic lipopeptide acylase derived from the genus Sirep topees. Cyclic lipopeptide acylases from the genus are described, for example, in International Publication No. W097 / 32975 and International Patent Application No. PCT / JP00 / 04285. For example, the heteromeric peptide of the present invention in which a chitin / cellulose binding domain is added to a cyclic lipopeptide acylase derived from Streptooyces sp. NO. 6907 (see International Publication No. W097 / 32975) Heteromeric peptides generated from the precursor peptide having the amino acid sequence described in No. 28 are preferably used, but are not limited thereto.

The precursor peptide of the present invention can be a peptide having any amino acid sequence as long as it has chitin'cellulose binding activity and can form a heteromer having the intended activity. Therefore, (a) selected from the group consisting of the amino acid sequences of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, and SEQ ID NO: 28, which were shown as precursor peptides constituting aminoacylase In addition to the peptide containing any one of the above amino acid sequences, for example, the peptide described in the following (b) or (c) can also be used as a precursor peptide in the present invention.

 (b) one or several amino acids in any one of the amino acid sequences selected from the group consisting of the amino acid sequences of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, and SEQ ID NO: 28 Having a deletion, substitution, or addition of an amino acid sequence, and capable of forming a heteromer having chitin / cellulose binding activity and aminoacylase activity.

(c) stringent conditions with DNA having any one of the nucleotide sequences selected from the group consisting of the nucleotide sequences of SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, and SEQ ID NO: 27 Encoded by DNA that can hybridize under the hood, and exhibit binding activity to chitin / cellulose and aminoacylase activity A peptide capable of constructing a heteromer having the same A method for artificially producing a mutant includes, for example, site-directed mutagenesis. More specifically, the present invention provides any of the nucleotide sequences described in SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20 and SEQ ID NO: 27 by using the method, and Can be obtained. The gene encoding the precursor peptide of the present invention includes all of the DNA substantially consisting of the nucleotide sequences shown in SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20 and SEQ ID NO: 27 Or include a part. The gene encoding the precursor peptide of the present invention includes, in addition to the DNA having the above specific nucleotide sequence, a DNA having a nucleotide sequence capable of hybridizing with the DNA having the above specific nucleotide sequence under stringent conditions. including. In the present invention, a condition under which a DNA having a homology of about 60% or more in base sequence can hybridize is referred to as a stringent condition. The stringency can be adjusted by appropriately changing the temperature and salt concentration during the hybridization reaction and washing. Alternatively, the gene encoding the precursor peptide of the present invention has at least (1) 60% identity, (2) 70% identity, and (3) 80% identity in the above specific nucleotide sequence. (4) Includes a gene consisting of a nucleotide sequence having 90% identity or (5) 95% identity. The precursor peptide encoded by the gene includes a precursor peptide having chitin'cellulose binding activity and capable of constructing a heteromer having aminoacylase activity. The present invention also relates to a precursor peptide of the above-mentioned heteromeric peptide of the present invention. The present invention also relates to a DM encoding the precursor peptide, an expression vector containing the DNA, and a host cell transformed with the vector. The precursor peptide can be prepared by culturing a host cell transformed with an expression vector containing DM encoding the same in a medium, and collecting the precursor peptide from the culture. The source of the DNA encoding the precursor peptide may be cDNA or It may be nome DNA or synthetic DNA. In addition, the DNA encoding the precursor peptide of the present invention includes not only a DNA containing a nucleotide sequence of a natural gene, but also a DNA containing an arbitrary nucleotide sequence based on codon degeneracy.

 To construct the DNA encoding the precursor peptide, the DNA encoding the chitin'cellulose binding domain is added to the site where the chitin'cellulose binding domain is to be added using known genetic engineering techniques. What is necessary is just to insert so that frames may match. There is no restriction on the position where the chitin / cellulose binding domain is inserted, as long as the heterologous peptide is generated by the expression of the precursor peptide and the original enzyme activity is maintained, and the N-terminal, C-terminal, or intermediate position of each subunit Can be inserted. The chitin'cellulose binding domain can be inserted into at least one optional subunit that makes up the heteromeric peptide. It can also be inserted into multiple subunits. For example, in the case of GL-7ACA acylase, insertion of a chitin'cellulose binding domain at the N-terminus, C-terminus or in the middle of a spleen //? Subunit forms a heteromeric peptide and maintains enzymatic activity . Specific examples of the DNA encoding the precursor peptide of the heteromeric peptide include a DNA having the nucleotide sequence of SEQ ID NO: 16, 18, or 20. In addition, for example, a DM peptide encoding a precursor of a heteromeric peptide in which a chitin'cellulose binding domain is inserted at the C-terminus of a large subunit of a cyclic lipopeptide acylase derived from Streptomyces sp. NO. Specific examples include, for example, a DNA having the base sequence of SEQ ID NO: 27. The position at which the chitin / cellulose binding domain is inserted is not limited to this, and it can be inserted at the N-terminus, C-terminus, or middle of any subunit.

Hereinafter, details of the preparation method using the recombinant DNA technology will be described. The host cell is not particularly limited, but includes, for example, bacteria. Bacteria include strains belonging to the genus Escherichia (eg, E. coli JM109 ATCC 53323, E. coli HB101 ATCC 33694, E.coii MN102, E.coi / HB101-16 FERM BP-1872, E. coli 294). ATCC 31446) and strains belonging to the genus Bacillus (such as Bacillus subtilis). In addition, actinomycetes, for example, strains belonging to the genus Streptomyces (Streptomyces), such as Streptomyces lividans, may be mentioned. For example, a strain belonging to the genus Escherichia, specifically, E.co/j'HBlOl or E. coli JM109 is preferably used. When a protein is expressed using an expression vector system incorporating the T7 promoter, E. coli (for example, NEB ER2566, etc.) in which the DNA encoding T7 RNA polymerase has been integrated into the genome, etc. It is suitable.

 When bacteria, especially E.co, are used as host cells, the expression vector generally encodes at least a promoter--operator region, initiation codon, and amino acid sequence of a precursor of the heteromeric peptide of the present invention. It is composed of DNA, stop codon, one minute and one region, and a replicable unit.

 Promoter—The operator-one region contains a promoter, an operator, and a Shine-Dalgarno (SD) sequence (eg, AAGG). Preferably, the promoter / operator region is a promoter / operator / region which is conventionally used (eg, a PL-promoter of E. co7 /, a trp-promoter, or a T7 promoter). May be included. Suitable initiation codons include methionine codon (ATG).

 The DNA encoding the precursor peptide of the present invention is not particularly limited as long as it can encode the amino acid sequence of the precursor peptide of the present invention.

The DNA encoding the precursor peptide of the present invention can be prepared by a conventional method. For example, a DM synthesizer may be used to synthesize some or all of the DNA and / or to insert the DNA into a suitable vector (such as a plasmid) obtained from a transformant (eg, E. coli). The complete DNA sequence encoding the precursor of the type heteromeric peptide can be obtained in a suitable manner, for example, by a suitable enzyme (eg, restriction enzyme, alkaline phosphatase, polynucleotide kinase, DNA ligase, DNA polymerase, etc.). Place In addition to conventional methods, conventional mutation methods, such as the cassette mutation method! Vol. 153, p445-449 (1985)), PCR mutagenesis CHiguchi, R. et al., Nucleic Acids Res. Vol. 16, p7351- 7367 (1988)], and the DNA encoding the chitin 'cellulose binding domain is added by an appropriate method such as the CKunkel method, CKunkel, TA et al., Methods Enzymol. Vol. 154, p367 (1987). Can be prepared.

 Examples of the stop codon include commonly used stop codons (eg, TAG, TGA, etc.). The evening / mine / overnight region includes a natural or synthetic terminator (eg, synthetic fd phage evening / overnight).

 A replicable unit is a DNA compound capable of replicating its entire DNA sequence in a host cell, and is a natural or artificially modified plasmid (e.g., prepared from a natural plasmid). DNA fragments) and synthetic plasmids. Suitable plasmids include the plasmid pBR322 in E. coli or an artificially modified product thereof (a DNA fragment obtained by treating PBR322 with an appropriate restriction enzyme).

 The expression vector is composed of a promoter, an initiation codon, a DNA encoding the amino acid sequence of the precursor peptide of the present invention, a termination codon, and an evening / minine region. Can be prepared. An example is pET vector (Novagen). At this time, if desired, an appropriate DNA fragment (eg, phosphoric acid, another restriction site, etc.) can be obtained by a conventional method (eg, digestion with a restriction enzyme, ligation using T4 DNA ligase). It can also be used.

Transformants (transfectants) can be prepared by introducing the above-described expression vector into host cells. Introduction (transformation (transfection)) of an expression vector into a host cell can be performed using a conventionally known technique (for example, the Kushner method in the case of E. coli). The heteromeric peptide and / or its precursor peptide of the present invention is The transformant containing the expression vector prepared as described above can be produced by culturing the transformant in a nutrient medium.

 The nutrient medium consists of a carbon source (eg, glucose, glycerin, mannitol, fructose, lactose, etc.) and an inorganic or organic nitrogen source (eg, ammonium sulfate, ammonium chloride, casein hydrolyzate, yeast extract, polypropylene). Tonnes, pact trypton, beef extract, etc.). If desired, other nutrient sources [eg, inorganic salts (eg, sodium or potassium diphosphate, dipotassium hydrogen phosphate, magnesium chloride, magnesium sulfate, calcium chloride), vitamins (eg, vitamins) B 1), antibiotics (for example, ampicillin, kanamycin) and the like.

 Culturing of the transformant (transfectant) is performed by a method known in the art. Culture conditions, such as temperature, medium pH and culture time, are selected to maximize the recovery of the desired hetero-peptide or its precursor peptide, usually between pH 5.5 and 8.5 (preferably pH 7 to 7.5) and 5 to 40 ° C (preferably 10 to 30 ° C) for 5 to 50 hours. However, these conditions may vary depending on the transformant.

The transformed host cell is cultured in a medium, and the heteromeric peptide or the precursor of the heteromeric peptide is recovered from the host cell and / or a culture supernatant thereof, thereby obtaining the heteromeric protein of the present invention. Peptides or precursor peptides of the heteromeric peptides can be produced. When E. coli is used as a host, the telomeric peptide of the present invention or its precursor peptide is usually present in the periplasm or cytoplasm of a cultured transformant. Therefore, these peptides can be obtained, for example, by the following method. First, cells are collected by a conventional method such as filtration and centrifugation, and the cell wall and / or cell membrane of the cells are treated with, for example, ultrasound and / or lysozyme to obtain cell debris. Next, the obtained cell debris is dissolved in an appropriate aqueous solution (eg, 20 mM Tris-HCl (pH 8.0), 500 mM NaCl, 0.1 mM EDTA, 0.1% Triton X-100). And for purifying and isolating natural or synthetic proteins from the solution. The heteromeric peptide of the present invention or its precursor peptide is isolated and purified according to a commonly used method. Examples of the isolation and purification methods include dialysis, gel filtration, affinity column chromatography using a monoclonal antibody against the heteromeric peptide or its precursor peptide of the present invention, and column chromatography on a suitable adsorbent. First, high performance liquid chromatography is exemplified. By contacting the obtained heteromeric peptide or the precursor peptide of the heteromeric peptide with chitin and / or cellulose, the heteromeric peptide immobilized on chitin and / or cellulose is obtained. Can be manufactured. Preferably, the cell lysate can be directly mixed with a chitin or cellulose carrier in an appropriate buffer and purified by affinity for chitin or cellulose.

 The chitin / cellulose carrier may be any crystalline chitin / cellulose, and specific examples include bacteriocellulose, cotton fiber, and chitin'cellulose molded beads. The heteropeptide or the precursor peptide of the heteropeptide of the present invention is fixed by mixing it with a chitin 'cellulose carrier. These carriers are not limited to those composed of a single material, but may be a combination of multiple chitin / cellulose materials or a combination of other materials and a chitin / cellulose carrier. . Similarly, when a high molecular weight polymer binding domain other than the chitin / cellulose binding domain is used, it is possible to use a high molecular weight polymer formed into various forms.

The immobilized heteromeric peptide bound to chitin and / or cellulose prepared in this manner can be used for various purposes. For example, it is conceivable to produce various useful substances by using the immobilized heteropeptide of the present invention in which an enzyme involved in substance metabolism is immobilized. The method therefor comprises: (a) a step of bringing a substrate of the heteromeric peptide into contact with the immobilized heteropeptide of the present invention; and (b) a step of collecting a reaction product in the step (a). Including. The combination of the immobilized heteropeptide and its substrate is not particularly limited. For example, a DNA polymerase can be immobilized, and DNA and nucleotides can act on the immobilized heteropolymer to synthesize DNA. In addition, various acylases including GL-7ACA acylase can be immobilized to synthesize antibiotic derivatives.

 Applications other than the production of a substance include, for example, purification of a compound that binds to a heteromeric peptide. In addition, the functional analysis of the immobilized heteromeric peptide can also be performed using the peptide. Further, an immobilized heteromeric peptide may be used as a biosensor.

 The production of a useful substance using the immobilized heteromeric peptide of the present invention is carried out, for example, by using immobilized 7-?-(4-carboxybutanamide) -monocephalosporanase as a compound represented by the formula:

(I I)

(Wherein, is acetoxy, hydroxy or hydrogen, and R ₂ is carboxyalkanol having 3 to 8 carbon atoms or D-glutamyl).

(Wherein is as defined above) or a salt thereof, which can be suitably used for producing a compound (I).

7-?-(4-carboxybutanamide) to which chitin / cellulose binding domain is added—the preparation method of cephalosporanic acylase and the immobilization of the acylase can be performed, for example, according to the method described in Examples. It can be carried out. Examples of the carboxyalkanol having 3 to 8 carbon atoms in the present invention include those having a straight-chain or branched acyl group, and specifically include carboxyacetyl, carboxypropionyl, and carboxybutyl. Examples thereof include ril, carboxyisobutyryl, carboxyvaleryl, carboxyisovaleryl, carboxybivaloyl, carboxyhexanoyl, and carboxyhepnoyl.

 Suitable compounds (I) and salts of compound (II) include alkali metal salts (eg, sodium salt, potassium salt, lithium salt).

 The above compound (I) can be produced in an aqueous medium such as water or a buffer. That is, the production of compound (I) is usually carried out by suspending the immobilized enzyme in an aqueous medium such as water or a buffer containing compound (II).

 The production of compound (I) can be carried out by appropriately selecting a suitable pH, concentration of compound (II), reaction time and reaction temperature according to the properties of the immobilized enzyme to be used. The pH is usually 6 to 10, preferably 7 to 9, the reaction temperature is usually 5 to 40 ° C, preferably 5 to 37 ° C, and the reaction time is usually 0.5 to 50 hours.

 In the reaction mixture, the concentration of the compound (II) as a substrate can be suitably selected in the range of 1 to 100 mg Iml. The compound (I) thus produced is purified and isolated from the above reaction mixture by a conventional method.

Further, the production of a useful substance using the immobilized heteromeric peptide of the present invention can be performed, for example, by adding an immobilized cyclic lipopeptide acylase to a compound represented by the following formula:

(Wherein R ¹ is Ashiru group, R ² is hydroxy or Ashiruokishi group, R ³ is hydrogen or hydroxy group, R ⁴ is hydrogen or hydroxy group, R ⁵ is hydrogen or hydroxy sul Honiruokishi group, and R ⁶ is hydrogen Or a compound represented by the formula (IV) or a salt thereof:

(III)

(Wherein, R ² , l R ⁴ , R ⁵ and R ⁶ represent the same groups as described above), or a compound (III) characterized by obtaining a salt thereof. It can be suitably used for

 The method for preparing a cyclic lipobeptide acylase to which a chitin / cellulose binding domain has been added, and the immobilization of the acylase can be performed, for example, in accordance with the method described in Examples. In addition, it can be carried out according to the method described in International Publication No. W097 / 32975 and International Patent Application No. PCT / JP00 / 04285.

 Suitable salts of compound (IV) and compound (III) include conventional non-toxic mono- or di-salts, such as metal salts such as alkali metal salts (eg, sodium salt, potassium salt, etc.), Alkaline earth metal salts (eg, calcium salt, magnesium salt, etc.), ammonium salts, salts with organic bases (eg, trimethylamine salt, triethylamine salt, pyridine salt, picoline salt, dicyclohexylamine salt, Ν, Ν) Organic acid addition salts (eg, formate, acetate, trifluoroacetate, maleate, tartrate, methanesulfonate, benzenesulfonate, toluenesulfonate, etc.), inorganic Acid addition salts (eg, hydrochloride, hydrobromide, hydroiodide, sulfate, phosphate, etc.), amino acids (eg, arginine, alpha Salts with sparginic acid, glutamic acid and the like).

 The production of compound (II) can be carried out in an aqueous medium such as water or a buffer. That is, the production of compound (III) is usually carried out by suspending the immobilized enzyme in an aqueous medium such as water or a buffer containing compound (IV).

 The production of compound (III) can be carried out by appropriately selecting ρΗ, the concentration of compound (IV), the reaction time and the reaction temperature according to the properties of the immobilized enzyme to be used. ρΗ is usually 5 to 10, preferably ρΗ 6 to 9, the reaction temperature is usually 10 to 70 ° C, preferably 30 to 50 ° C, and the reaction time is usually 0.5 to 50 hours. .

In the reaction mixture, the concentration of compound (IV) as a substrate can be suitably selected in the range of 1 to 100 mg / ml. Compound (III) produced in this manner is as described above. The reaction mixture is purified and isolated from the reaction mixture by appropriately combining conventional methods such as concentration under reduced pressure, lyophilization, extraction, pH adjustment, adsorption resin, ion exchange resin, crystallization, and recrystallization. The chitin or cellose carrier subjected to the immobilization reaction in the present invention can be used repeatedly by eluting and regenerating the heteromerbide whose activity has been reduced and newly immobilizing the heteromerbide. It is. Eluents include protein denaturants (eg, guanidine hydrochloride solution, urea solution, etc.), surfactants (eg, sodium dodecyl sulfate solution, etc.), and low polar solvents (eg, demineralized water, depending on the properties of the chitin / cellulose binding domain). , Ethylene glycol solution, etc.), etc., and the re-immobilization of the heteropeptide can be performed in the same manner as when it is not used.

 All prior art documents cited in the present specification are incorporated herein by reference. BRIEF DESCRIPTION OF THE FIGURES

 FIG. 1 is a diagram showing the structure of an expression plasmid of a peptide (C427 GL-7ACA acylase) fused with a chitin cell-cell binding domain. CBD stands for chitin or cell-site binding domain, spikes and /? Stand for subunits and /? Subunits, respectively, and SP stands for spacer peptide. T7 represents the T7 promoter.

 Figure 2 shows the expression plasmid (pETSS427, pETN-427, pETC-427 and pETCα427) or empty vector (pET24a) of peptide (C427 GL-7ACA acylase) fused with chitin'cellulose binding domain. FIG. 9 is a photograph showing the results of SDS-PAGE (A) and Western analysis (B) of an E. coli extract using an anti-C427 GL-7ACA acylase polyclonal antibody.

FIG. 3 is a photograph showing an SDS-PAGE of a chitin bead extract of a peptide (C427 GL-7ACA acylase) fused with a chitin / cellulose binding domain expressed in E. coli. FIG. 4 is a diagram showing the structure of a plasmid pUAYCBD encoding a cyclic lipopeptide acylase (TA6907 acylase) fused with a chitin / cellulose binding domain.

 FIG. 5 is a diagram showing the structure of the actinomycete expression plasmid pJAYCBD encoding a cyclic lipopeptide acylase (TA6907 acylase) fused with a chitin / cellulose binding domain. BEST MODE FOR CARRYING OUT THE INVENTION

 Next, the present invention will be described more specifically with reference to examples, but the present invention is not limited to the following examples.

 [Example 1] Construction of CBD fusion GL-7ACA acylase expression plasmid

Construction of PUC427

 PYS9107K plasmid DNA (JP-A-7-313161) was digested with StuI and ClaI and cut into three fragments, and the cut ends were blunt-ended using Klenow fragment. This was electrophoresed on a 1% agarose gel and 2170 bp containing the ORF of C427 GL-7ACA acylase (JP-A-7-313161; Y. Ishii et al., 1994, J. Fermentation Bioengineering 77: 591-597). The fragment was collected. Separately, pUC19 plasmid DNA was digested with Kpnl, blunt-ended similarly, and fractionated by 1% agarose gel electrophoresis. Both DNA fragments were ligated with T4 DNA ligase and transformed into E. coli DH5 by the calcium method. Screening of ampicillin-resistant bacteria was performed based on the fact that a plasmid DNA purified from E. coli was digested with BamHI and a fragment of about 600 bp was cut out, and the plasmid was inverted in the direction opposite to the pUC19 5-galactosidase gene. C427 A plasmid incorporating the GL-7ACA acylase gene was selected and designated as PUC427.

Construction of PETSS427

Known for high expression of various gene products using E. coli as a host The C427 GL-7ACA acylase gene excluding the secretion signal was incorporated into a pET system (Novagen) plasmid.

 To introduce the ATG sequence, which is the initiation codon at the 5 'end of the heavy chain, an approximately 600 bp fragment was amplified by PCR using primers 1, 2, and pfu DNA polymerase using pUC427 plasmid DNA as a template. . The obtained fragment was digested with BamHI and NdeI and incorporated into PUC427 digested with the same restriction enzymes to obtain PUCSS427. Furthermore, this plasmid was digested with SacI and NdeI, and incorporated into pET24a plasmid digested with similar restriction enzymes to construct pETSS427 (FIG. 1). The nucleotide sequence of the coding region of the fusion protein of pETSS427 plasmid is shown in SEQ ID NO: 14, and the amino acid sequence encoded by this nucleotide sequence is shown in SEQ ID NO: 15.

Construction of pETN 427

 C427 GL-7ACA acylase A plasmid was constructed that ligated and expressed CBD at the 5 'and 5' ends of the DNA encoding the heavy chain. The heavy chain and the CBD were linked at the Kpn I site.

From the CBD coding region of pTYB2, an expression plasmid of the IMPACT ™ T7 system (manufactured by New England BioLabs) used for peptide purification, a PCR reaction using primers 3 and 4 resulted in an approximately 150 bp The fragment was amplified. pTYB2 carries a CBD derived from the 'sils' circulans chitinase A1 (T. Watanabe et al., 1994, J. Bacterid. 176: 4465-4472; GenBank Accession No. M57601, J05599). C427 GL-7ACA acylase Approximately 600 bp fragment was amplified by PCR using primers 5 and 2 with pUC427 plasmid as a template to introduce a KpnI site at the 5 'end of DNA encoding the heavy chain. did. The amplified CBD fragment was digested with NdeI and KpnI, and the 5 ′ terminal fragment of the C427 GL-7ACA acylase gene was digested with KpnI and BamHI. These were incorporated into £ 188427 plasmid digested with Nde I, 8 & 111 111 to give pETN-427 plasmid (Figure 1). The nucleotide sequence of the coding region of the fusion protein of pETN-427 plasmid is shown in SEQ ID NO: 16, and the amino acid sequence encoded by this nucleotide sequence is shown in SEQ ID NO: 17. SEQ ID NO: 16 1st to 165th position (arrangement (Column number: 1st to 55th in 17) corresponds to CBD.

Construction of pETC? 427

 A plasmid was constructed to ligate and express CBD at the third and third ends of the DNA encoding the C427 GL-7ACA acylase chain. The chain and CBD were linked at the Kpn I site.

 From the CBD coding region of pTYB2, the expression plasmid of the IMPACT ™ T7 system (New England BioLabs) used for peptide purification, a PCR reaction using primers 1 and 6 resulted in a CBD of approximately 150 bp. Fragment was amplified. To introduce a KpnI site at the 3 'end of the DNA encoding the C427 GL-7ACA acylase-chain, a fragment of about 150 bp was amplified by PCR using primers 8 and 9 with pUC427 plasmid as a template. . The amplified CBD fragment was digested with SacI and KpnI, and the 3 ′ end fragment of the C427 GL-7ACA acylase gene was digested with KpnI and MluI, respectively. These were incorporated into pUC427 plasmid digested with SacI and Mlul to obtain pUCC-427 plasmid. Furthermore, this plasmid was digested with SacI and NdeI, and incorporated into pET24a plasmid digested with the same restriction enzymes to obtain pETC-427 (FIG. 1). The nucleotide sequence of the coding region of the fusion protein of pETC / 5427 plasmid is shown in SEQ ID NO: 18, and the amino acid sequence encoded by this nucleotide sequence is shown in SEQ ID NO: 19. Positions 2077 to 2238 of SEQ ID NO: 18 (positions 693 to 746 of SEQ ID NO: 19) correspond to CBD.

Construction of pETC 427

 A plasmid was constructed to ligate and express CBD 3 amino acids (9 bp) upstream from the 3 end of the DNA encoding the C427 GL-7ACA acylase heavy chain. Both ends of the CBD were closed at the Kpn I site.

To introduce the Kpn I site into the CBD junction site, an approximately 600 bp fragment amplified by PCR using primers 1 and 10 using pUC427 plasmid as a template and primers 11 and 12 An approximately 500 bp fragment was prepared. These fragments were digested with NdeI and KpnI, respectively with KpnI and NcoI, and incorporated into pETSS427 plasmid cut with NdeI and NcoI to obtain pET427C and Kp. From the CBD coding region of pTYB2, an expression plasmid of the IMPACT ™ T7 system (New England BioLabs) used for peptide purification, a PCR reaction using primers 6 and 4 resulted in an approximately 150 bp CBD. The fragment was amplified. The amplified CBD fragment was digested with KpnI and incorporated into pET427C «Kp plasmid digested with ΚρηI to obtain ETC-427 plasmid (Fig. L). The nucleotide sequence of the coding region of the fusion protein of pETC-427 plasmid is shown in SEQ ID NO: 20, and the amino acid sequence encoded by this nucleotide sequence is shown in SEQ ID NO: 21. Positions 484 to 651 of SEQ ID NO: 20 (positions 162 to 217 of SEQ ID NO: 21) correspond to CBD.

Check the sequence

 The nucleotide sequence of the PCR amplified portion was confirmed by a fluorescent labeling cycle sequence method using the primers shown below.

PETSS427

 Primer 2 (antisense)? (5rev)

 Primer 13 (sense) T7promoter

pETN 427

 Primer 2 (antisense)? (5rev)

 Primer 13 (sense) T7promoter

 Primer 5 (sense) 427Kp5

pETCh 427

 Primer 13 (sense) T7promoter

 Primer 2 (antisense)? (5rev)

 Primer 12 (antisense) Nco (under3)

 Primer 4 (antisense) CBDKp3

pETC? 427

 Primer 1 (sense) CBDKp5

Primer 8 (sense) Mlu (upver2) Primer sequence

 The primer sequences used are shown below.

Primer 1 (sense) 427Nd5: 5, -GCGTCGCCGGTACCCTGGCCGAGCCGA-3 '(SEQ ID NO: 1)

Primer 1 (antisense)? (5rev): 5'-CGCCTCGTAGTAGGTGAAGTAG-3 '(SEQ ID NO: 2)

Primer 3 (sense) CBDNd5: 5'-TGAACTCACATATGACGACAAATCCTGGTG-3 '(SEQ ID NO: 3)

Primer 1 (antisense) CBDKp3: 5'-CCTTCCTGGGTACCTTGAAGCTGCCACAAG-3 '(SEQ ID NO: 4)

Primer 5 (sense) 427Kp5: 5, -GCGTCGCCGGTACCCTGGCCGAGCCGA-3 ⁵ (SEQ ID NO: 5)

Primers one 6 (sense) CBDKp5: 5'-TGAACTCAGGTACCACGACAAATCCTGGTG-3 5 ( SEQ ID NO: 6)

Primer 7 (antisense) CBDSTP3: 5, -TCATTGMGCTGCCACMGGC-3, (SEQ ID NO: 7)

Primer 1 (sense) Mlu (upver2): 5'-ATGAGCTACGGCAATTCTCG-3 '(SEQ ID NO: 8)

Primer 9 (antisense) 427Kp3: 5, -GGTCAGGCGGTMCCTGGCTTGMGTT-3, (SEQ ID NO: 9)

Primer 10 (antisense) 427insKp3: 5 in GGCGGGTCGGTACCGCCCAGGGTGCGGCCG GGCGACGCGA-3 '(SEQ ID NO: 10)

Primer 11 (sense) 427insKp5: 5'-GCCGCACCGGTACCGAGGGCGACCCGCCGGACCTGG-3, (SEQ ID NO: 11)

Primer 12 (antisense) Nco (under3): 5, -CCGTGATCATGTCGAAATACTGCTCG-3, (SEQ ID NO: 12) Primer 13 (sense) T7promoter: 5'-TAATACGACTCACTATAGGG-3 '(SEQ ID NO: 13)

[Example 2] Culture method of recombinant bacteria

 Each of the prepared plasmids was transformed into the host E. coli ER2566 strain by the calcium method. One loopful of each transformed strain was inoculated into 1 ^ medium in 31 ^ / 15 test tubes and cultured at 37 ° C for about 15 hours. Inoculate 1 mL of this culture into a 100 mL I 500 mL flask of LB medium at 30 ° C. . Was cultured until the concentration became 0.5 to 0.6, and IPTG was added thereto so that the concentration became 1 mM. Addition of IPTG induces the expression of the integrated gene. After the induction was started, the culture temperature was set to 20 to 25 ° C, and the cells were further cultured for 20 to 40 hours, and 0.2 to 0.5 U / mL—enzyme activity of the culture was expressed. Per 1 mol of 7ACA).

 After completion of the culture, the cells were collected by centrifuging the culture at 4,000 rpm for 10 minutes at 5 ° C, and 5 mL of 20 mM Tris-HCl buffer pH 8.5, 500 mM NaC 0.1% Triton X-100 Again. The suspension was crushed three times with an ultrasonic crusher under ice cooling for 1 minute, and then centrifuged at 12,000 rpm at 5 ° C for 10 minutes to obtain a supernatant fraction as an enzyme solubilizing solution.

[Example 3] Method of immobilizing enzyme on chitin beads

 Chitin beads equilibrated and dispersed with a buffer for cell suspension and adsorption (hereinafter referred to as adsorption buffer; 20 mM Tris-HCl buffer pH 8.5, 500 mM NaCl, 0.1% Triton X-100) (New England) BioLabs) was added with a solubilized enzyme solution such that the enzyme activity was 0.5 to 5 U / ml. This was mixed by shaking at 5 ° C for 5 hours or more, and the enzyme was adsorbed on chitin beads to obtain enzyme-immobilized beads.

The enzyme-immobilized beads were collected by centrifugation at 3000 rpm for 10 minutes at 5 ° C, and washed twice by resuspension with an adsorption buffer and re-centrifugation twice. [Example 4] Properties of immobilized enzyme

 The acylase activity of the immobilized beads that had been adsorbed, recovered, and washed with a solubilized enzyme solution from E. coli transformed with pETN «427, pETC-427, and pETC-427 was measured.

 Glucuryl-7ACA (substrate) powder is dissolved at a concentration of lOmg / mL in 0.15 MTris-HCl buffer (pH 8.7), and the enzyme-immobilized bead solution is activated to about 1-3 U / mL. It was prepared as follows. In a small test tube, O.lmL of the enzyme-immobilized bead solution was added and mixed with 0.9mL of the substrate solution pre-incubated at 37 ° C for about 5 minutes, and reacted at 37 ° C for 5 minutes. After a lapse of time, 1 mL of 4% acetic acid was added to stop the reaction, and the mixture was diluted three times with ion-exchanged water, and then the 7ACA concentration was quantified by HPLC under the following conditions.

7ACA HPLC quantification method

Column: ODS (Lichrospher RP-18) 5 m 4 ø x 250 mm

Mobile phase: 5 mM sodium hexanesulfonate

0.1 M cunic acid

14.4% acetonitrile

Diluent: 0.05 M citrate-0.1 sodium phosphate buffer (pH 3.0) Flow rate: 1.1 mL / min.

Detection: UV 254 nra

Injection volume: 5 μ.1

 From the amount of the generated 7ACA, the enzyme activity was measured by the activity calculation formula “7ACA concentration (〃g / ml) × 6 10/5 / 272.4 × dilution factor at the time of preparing the enzyme solution”. Here, "6" is the dilution factor after the reaction, "10" is the dilution factor of the enzyme solution during the reaction, "5" is the reaction time (min.), And "272.4" is the 7ACA molecular weight.

As a result, the activity of about 0.9 / mg-dry beads was confirmed in the immobilized beads that had adsorbed, recovered, and washed the solubilized enzyme solution from E. coli transformed with pETN-427, pETC-427, and pETC-427. No activity was confirmed with immobilized beads from E. coli transformed with PETSS427 (Table 1). In addition, the same activity was obtained using the enzyme solubilization solution before immobilization. As a result of the measurement, it was found that the expression activity of the enzyme hardly changed before and after adsorption to chitin beads. table 1

 Binding ability to chitin beads

 U I mg- dry beads

 PETSS427 0

 ρΕΤΝ 427 0.86

 pETCy5427 0.86

 pETC 427 0.85

When the solubilized enzyme solution from each transformed E. coli was detected by Western blotting using egret serum containing anti-C427 GL-7ACA acylase polyclonal antibody, pETN-427, pETC-427, and pETC-427 were detected. In the expression enzyme of the transformed Escherichia coli, the shift of the band that can be expected to link the heavy chain of the C427 GL-7ACA acylase and the CBD to the CBD was confirmed, but in the case of the PETSS427 transformed E. coli, the band shift Not confirmed (Figure 2).

 This revealed that the adsorption to chitin beads was due to the action of CBD linked to C427 GL-7ACA acylase.

 Furthermore, the immobilized beads were directly treated with SDS-PACE sample buffer and analyzed by SDS-PAGE. As a result, it was confirmed that the beads were highly purified (Fig. 3).

In addition, the activity of // lactamase, which shows the catalytic activity of decomposing the substrate and the product, which is commonly produced by the host Escherichia coli, was measured. First, the cells recovered from a 30 mL culture were disrupted, and the solubilized enzyme extracted with 1 mL of 20 mM Tris-HCl buffer pH 8.5, 500 mM NaC 0.1% Triton X-100 (adsorption buffer) The liquid was used as a culture solution sample. Using 1 mL of this solubilized enzyme solution, it was immobilized on chitin beads so that GL-7ACA acylase activity became 0.5 U / mg-dry beads. This was suspended in 1 mL of the adsorption buffer and used as a sample after immobilization. Next, 7ACA (substrate) powder was dissolved in 0.15 M phosphate buffer pH 8.0 to a concentration of 10 mg / mL, and this was used as a substrate solution. For 9 mL of substrate solution, culture medium sample Alternatively, after immobilization, 1 mL of an adsorption buffer was added and mixed as a sample or blank, and the mixture was shaken at 25 ° C for 120 minutes. After a lapse of time, 0.25 mL of the reaction solution was added to 1 mL of a 4% acetic acid solution to stop the reaction, and the solution was made up to 20 mL with ion-exchanged water.

The 7ACA concentration was quantified by HPLC in the same manner as above, and from the amount of decomposed 7ACA, the activity calculation formula “(Blank 7ACA concentration (〃g / ml) —sample 7ACA concentration (g / ml)) / 120 / 272.480 x 10/30 "to determine the enzyme activity. Here, "120" is the reaction time (min-), "272.4" is the 7ACA molecular weight, "80" is the dilution factor after the reaction, "10" is the sample dilution factor during the reaction, and "30" is the sample preparation for the culture solution. Represents the concentration factor.

 As a result, no enzyme activity was observed in the enzyme-immobilized beads, indicating that C427 GL-7ACA acylase was highly purified (Table 2). Table 2

 Raku-Yu-Men-Zero (mU 1 ml)

 Culture medium After fixation

 pETN 427 0.88 <0.10

 pETC? 427 1.31 <0.10

 pETC 427 1 .56 <0.10

[Example 5] Construction of CBD-fused cyclic lipobeptidoacylase-expressing transformant

 Streptomices sp. No. 6907 strain (FERM BP-5809; W097 / 32975); this strain is the Institute of Biotechnology, Industrial Technology Institute of the Ministry of International Trade and Industry (1-1-3 Tsukuba East, Ibaraki, Japan) , FR901379 acylase (see W097 / 32975) derived from the original deposit date of March 8, 1996, international deposit date (transferred February 3, 1997); Streptomices in the present invention. This acylase derived from sp. No. 6907 strain is also referred to as “TA6907 acylase”). I do. TA6907 acylase and CBD are linked at the Kpn I site.

IMPACT ™ T7 system (New England) used for peptide purification as CBD From the CBD coding region of pTYB2, an expression plasmid of Biolabs, a fragment of about 150 bp was obtained by PCR using Primer 14 (SEQ ID NO: 23) and Primer 15 (SEQ ID NO: 24). To amplify. The amplified fragment has a Kpn I site at the 5 'end and a stop codon and a Bajn HI site at the 3' end. From the TA6907 acylase coding region in pSB (see the publication of W097 / 32975), a fragment of about 900 bp from the unique site Not I site to the 3 'end was obtained from Primer 16 (SEQ ID NO: 25) and Amplification is performed by PCR reaction using No. 17 (SEQ ID NO: 26). A KpnI site has been introduced at the 3 'end of the amplified fragment.

Digest pSB with Not I and Bam HI to obtain a fragment of approximately 5000 bp. The amplified CBD fragments Bam HI and Kpn I, TA6907 acylase 3, was digested terminal fragment with Kpn I and Not I, 3 pieces of DNA obtained connecting the three Pisuraige one Chillon, obtain PUAYCBD (Figure 4) _c The nucleotide sequence from the Sac I site to the Bam HI site containing the pUAYCBD acylase coding region is shown in SEQ ID NO: 27, which is predicted to be the initiation codon of TA6907 acylase fused with the CBD encoded by this DNA. The translated amino acid sequence from the third position is shown in SEQ ID NO: 28. SEQ ID NO: 27, position 3337 1 to position 3526 (SEQ ID NO: 28, position 807 to position 858) correspond to CBD. Further, this plasmid was digested with Sac I and Bajn HI, and the excised fragment of about 3000 bp was incorporated into an actinomycete vector PIJ702 (see W097 / 32975) digested with Sac I and Bgl II. (Fig. 5).

 rGenetic Manipulation oi Streptomyces. A Laboratory Manual. Streptomyces lividans 1326 (J. General Microbiology 1983, 129, 2703-2713) according to the method described in Transform with pJAYCBD. One of the obtained transformants is selected and designated as Streptomyces lividans 1326 / pJAYCBD.

Primer sequence

The primer sequences used are shown below. Primer 1 (sense) CBDKp5: 5'-AAGCCAGGTACCACGACAAATCC-3 '(SEQ ID NO: 23)

Primer_2 (antisense) CBDBam3: 5, -MTTCGGGATCCCTATTGAAGCTGCC-3, (SEQ ID NO: 24)

Primer 3 (sense) AcyNot5: 5'-CCAATGCGGAGCGGCCGCTGACCGGGTACG-3 '(SEQ ID NO: 25)

Primer 4 (antisense) AcyKp3: 5, -CCGCCCACCGGTACCCCGCCGCTCGTGCAC-3 '(SEQ ID NO: 26)

[Example 6] Culture of transformed strain and expression of FR901379 acylase

5% sucrose, 1% glucose, 0.3% yeast extract (Difco Co.), 0.5% Bacto peptone (Difco Co.), 0.3% meat extract (Difco Co.), 5 mM MgCl _2, 0.5% glycine, the 50 / g / ml Transfer 10 ml of medium consisting of thiostrepton (pH 6.5) into a 100-ml triangular flask, and inoculate the cells of the transformant Streptomyces lividans 1326 / pJAYCBD at the 5 recitation angles. Incubate at 30 ° C for 3 days (260 rpm), measure the FR901379 acylase activity of the culture, and confirm the activity to produce FR179642 (desacylated FR901379 substance) (both refer to W097 / 32975) .

 The acylase activity can be measured as follows.

<Measurement of acylase activity>

 100mg / ml FR901379 (see W097 / 32975) 0.1 ml of aqueous solution, phosphate buffer (pH 6.0) 0.1 ml of methanol 0.1 ml, distilled water 0.6 ml, culture solution or immobilized enzyme suspension Add 0.1 ml and react at 37 ° C (125 rpm). After 15 minutes, the reaction is terminated by adding 1 ml of 4% acetic acid and 2 ml of distilled water. Then, the generated FR179642 (desacylated FR901379 substance) is quantified using high performance liquid chromatography (HPLC) under the following conditions.

Column: Kaseisorb LC P0 Super (4.6 K. I.D. x 250 thighs) (Tokyo Kasei) Column temperature; 50 ° C

 Eluent; distilled water: methanol: phosphoric acid = 960: 40: 1

 Flow rate: 1 ml / min

 Detection; UV-215 nm

[Example 7] Preparation of enzyme and immobilization of enzyme on chitin beads

 (1) Preparation of fermentation broth

500mL flask in a 50mL Chio thiostrepton (50〃G / mL) containing PM- 1 medium (6% eclipse # 3600, 3% defatted soybean flour, 0.5% CaC0 _3, 0.005% Chiosu Toreputon, pH unmodified) After inoculating the transformant Streptomyces' lividans 1326 / pJAYCBD at the 5 thigh angle, culture at 30 ° C for 3 days. Inoculated the 2.5 mL SG medium 50 mL (8% maltose, 3% defatted soy flour, 3% defatted wheat _{germ, 0.5% CaC0 3, 0. 005} % Chiosutore Easthampton, pH unmodified) in 500mL flask containing the And incubate at 30 ° C for 3 days.

(2) Immobilization of FR901379 acylase fused with CBD to chitin beads

 Add 8 mL of 4M KC1 to 24 mL of the fermentation broth, leave at 4 ° C overnight, and use the supernatant obtained by centrifugation (10,000 rpm, 10 minutes) as the KC1 extract. Add the solubilized enzyme solution to chitin beads (New England BioLabs) dispersed in water so that the enzyme activity is 0.5 to 5 U. This is mixed by shaking at 5 ° C for 5 hours or more to allow the enzyme to be absorbed on the chitin beads. Enzyme-immobilized beads are recovered by centrifugation at 3000 rpm for 10 minutes at 5 ° C, and resuspended in washing buffer (20 mM Tris-HC1 buffer pH 8.5, 500 mM NaC 0.1% Triton X 100). Wash by re-centrifugation twice.

CBD fusion acylase shows high adsorption activity to chitin beads. Purification with high purity can be confirmed by directly treating the immobilized beads with SDS-PAGE sample buffer and performing SDS-PAGE analysis. Industrial applicability According to the present invention, a heteropeptide fused with a chitin / cellulose binding domain is provided. According to the present invention, it is possible to immobilize an enzyme which is industrially useful and has a specific processing mechanism while maintaining its activity. Chitin and cellulose are industrially usable carriers, and the heteromeric peptide of the present invention using a chitin-cellulose binding domain exhibiting an adsorption ability is suitable for industrial use. Since the adsorption of chitin / cellulose binding domain to chitin / cellulose is specific, the adsorbed enzyme is purified to high purity. Therefore, it is also superior in that enzyme purification is not required as compared with ordinary enzyme immobilization technology. In particular, Escherichia coli contains an enzyme, lactamase, which degrades a compound having a cephaloskeleton, and removal of this enzyme was indispensable in the conventional immobilized enzyme method. Can be removed. In addition, in the conventional method of immobilizing on an ion-exchange carrier, the product yield was reduced by the adsorption of the substrate and the product on the carrier, but the immobilization method of the present invention does not adsorb the substrate and the product, It is possible to prepare an immobilized heteromeric peptide in high yield.

Claims

Claims A heteromeric peptide in which at least one of the subunits constituting the heteromeric peptide generated by cleavage of the precursor peptide has a chitin / cellulose binding domain added thereto.

 2. The peptide according to claim 1, wherein the heteromeric peptide is a protein produced by self-splicing.

 3. The peptide according to claim 2, wherein the protein produced by self-splicing is an aminoacylase.

 4. The peptide according to claim 3, wherein the aminoacylase is 7- (4-carboxybutanamide) monocephalosporanate acylase.

 3. The peptide according to claim 2, wherein the protein produced by self-splicing is cyclic lipobeptidylase.

 The cyclic lipopeptide acylase has the formula:

(Wherein R ¹ is an acyl group, R ² is a hydroxy group or an acyloxy group, and R ³ is hydrogen Or a hydroxyl group, R ⁴ represents hydrogen or a hydroxy group, R ⁵ represents a hydrogen or a hydroxysulfonyloxy group, and R ⁶ represents a hydrogen or a rubamoyl group. The peptide according to claim 5, which is:

 7. A precursor peptide of the heteromeric peptide according to claim 1.

 8. The precursor peptide according to claim 7, wherein the precursor peptide is any one of the following (a), (b), and (c):

 (a) a peptide comprising any one of the amino acid sequences selected from the group consisting of the amino acid sequences set forth in SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, and SEQ ID NO: 28

 (b) in any one of the amino acid sequences selected from the group consisting of the amino acid sequences of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, and SEQ ID NO: 28, wherein one or several amino acids are A peptide consisting of a deleted, substituted, or added amino acid sequence and capable of forming a heteromer having chitin or cellulose binding activity and aminoacylase activity

 (c) a stringent DNA with any of the nucleotide sequences selected from the group consisting of the nucleotide sequences of SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, and SEQ ID NO: 27 A peptide that is encoded by DNA that can hybridize under the conditions and that has a binding activity to chitin / cellulose and an aminosylase activity

 9. A DNA encoding the precursor peptide of claim 8.

 10. An expression vector comprising the DNA according to claim 9.

 11. A host cell transformed by the expression vector according to claim 10.

12. A method comprising culturing the host cell according to claim 11 in a medium, and recovering a heteromeric peptide or a precursor peptide of the heteromeric peptide from the host cell and / or a culture supernatant thereof. The heteromeric peptide of claim 1 or Is a method for producing a precursor peptide of the heteromer peptide.

 13. A method for producing an immobilized heteromer peptide, comprising a step of contacting the heteromeric peptide or the precursor peptide of the heteromeric peptide according to claim 1 with chitin and / or cellulose.

 14. An immobilized heteromeric peptide, wherein the chitin / cellulose binding domain in the heteropeptide of claim 1 is bound to chitin and / or cellulose.

 15. (a) contacting the heteromeric peptide substrate with the immobilized heteromeric peptide according to claim 14; and

 (b) A method for producing a reaction product produced by being catalyzed by an immobilized heteromeric peptide, comprising a step of collecting the reaction product in the step (a).

 16. The immobilized heteromeric peptide in which the chitin / cellulose binding domain in the heteromeric peptide according to claim 4 is bound to chitin and / or cellulose,

 Formula:

(Wherein R is acetooxy, hydroxy or hydrogen, and R ₂ is carboxyalkanol having 3 to 8 carbon atoms or D-glucamyl), or a salt thereof. Contact, the formula:

(Wherein, represents acetoxy, hydroxy or hydrogen) A process for producing a compound (I), which comprises obtaining (I) or a salt thereof.

The immobilized heteromeric peptide in which the chitin 'cellulose binding domain in the heteropeptide according to claim 6 is bound to chitin and / or cellulose,

Formula:

(Wherein R ¹ is an acyl group, R ² is a hydroxy or acyloxy group, R ³ is a hydrogen or hydroxy group, R ⁴ is a hydrogen or hydroxy group, R ⁵ is a hydrogen or hydroxy sulfonyloxy group, and R ⁶ Represents hydrogen or a valvamoyl group) by contacting the compound (IV) or a salt thereof represented by the formula:

(Wherein R ² , R \ R ⁴ , R ⁵ and R ⁶ represent the same groups as described above) or a salt thereof, to produce a compound (III) Law.

18.7- / 3- (4-carboxybutanamide) A chitin / cellulose binding domain is added to at least one of the subunits constituting monocephalosporanic acylase, and the chitin / cellulose binding domain is converted to chitin and cellulose. / Or immobilized on cellulose,

 Formula:

(I)

(Wherein 1 ^ represents acetoxy, hydroxy or hydrogen). An immobilized enzyme for producing compound (I).

19. Formula:

(Wherein R ¹ is an acyl group, R ² is a hydroxy or acyloxy group, R ³ is a hydrogen or hydroxy group, R ⁴ is a hydrogen or hydroxy group, R ⁵ is a hydrogen or hydroxy sulfonyloxy group, and R ⁶ Represents a hydrogen or a valvamoyl group). A chitin / cellulose binding domain is added to at least one of the subunits constituting the cyclic lipopeptide acylase which catalyzes the acylation of the compound (IV) or a salt thereof, · The cellulose binding domain is immobilized on chitin and / or cellulose.

(Wherein, R ² , R ³ , R \ R ⁵ and R ⁶ represent the same groups as described above). (III) An immobilized enzyme for production.