WO2001027151A1 - Nouveau membre de la famille de type kruppel de proteine humaine a doigt de zinc zfp-52 et polynucleotide codant pour le nouveau membre - Google Patents

Nouveau membre de la famille de type kruppel de proteine humaine a doigt de zinc zfp-52 et polynucleotide codant pour le nouveau membre Download PDF

Info

Publication number
WO2001027151A1
WO2001027151A1 PCT/CN2000/000308 CN0000308W WO0127151A1 WO 2001027151 A1 WO2001027151 A1 WO 2001027151A1 CN 0000308 W CN0000308 W CN 0000308W WO 0127151 A1 WO0127151 A1 WO 0127151A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
zinc finger
polynucleotide
finger protein
seq
Prior art date
Application number
PCT/CN2000/000308
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Bio Door Gene Technology Ltd. filed Critical Shanghai Bio Door Gene Technology Ltd.
Priority to AU78983/00A priority Critical patent/AU7898300A/en
Publication of WO2001027151A1 publication Critical patent/WO2001027151A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, zinc finger protein 52, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • Transcriptional regulation of eukaryotic genes is very important for the normal expression of genes and exerts biological functions. Usually, transcriptional regulatory factors complete this process. Transcriptional regulatory factors are involved in the body to determine which tissues and developmental stages of genes begin to transcribe. If the genes encoding such proteins are mutated, not only the gene itself cannot be expressed normally, but many genes regulated by it cannot be normal Perform transcription and expression. The regulation of gene expression by transcription factors is mainly accomplished through the binding of transcription factors to specific DNA sequences, the interaction between transcription factors, and the interaction of transcription factors with conventional transcriptional mechanisms.
  • D-binding proteins can be divided into two main categories: proteins containing helix-turn-helix motifs and zinc finger proteins [Kama l Chowdhury, He idi Rohdekard et al., Nuc le ic Ac ids Research, 1988, 16: 9995-10011].
  • Zinc finger proteins are members of multiple gene families encoding zinc ion-mediated nucleotide binding proteins. Zinc finger proteins can be divided into various families according to their structural characteristics. Various zinc finger proteins have been isolated from various organisms such as yeast, fruit fly, rat and human. The Drosophila Kruppe l gene has the highest number of similar zinc finger proteins, and these genes contain successively repeated C2-H2 zinc finger protein domains.
  • All members of the zinc finger protein Kruppel family contain a conserved finger repeat (F / Y) XCXXCXXXFXXXXXLXXHXXXHTGEKP with a length of 28-30 amino acids, some of which have highly conserved amino acid residues.
  • This sequence contains multiple copies in many different zinc finger proteins, with different copy numbers (different number of zinc fingers) and different functions.
  • the binding of zinc finger protein to DNA of different lengths depends on the number of finger structures.
  • the multi-finger structure may be related to the binding stability of the complex, which is the site of action of RM polymerase transcription. Studies have found that the zinc finger domain interconnect region of many zinc finger proteins is also highly conserved.
  • This region usually contains the following sequences: Hi s-Thr- Gly- G ly-Lys-Pro- (Tyr, Phe)-X_Cys, Among them, histidine and cysteine are the binding sites of metal ions, and X is a variable amino acid residue.
  • This region is necessary for the formation of zinc finger structures. The number of finger structures will directly affect the binding of zinc finger proteins to DNA of different lengths, and multi-finger structures and complexes. Related to the binding stability [Jeremy M. Berg, Annu. Rev. Bi ophys. Chem, 1990, 19: 405-421].
  • the human gene of the present invention has 46% identity and 64% similarity at the protein level with ZNF1 35, a member of the human zinc finger protein Kruppe l family. Moreover, the protein sequences of both of them contain the repeating sequences of the characteristic zinc fingers of the Kruppe l family of human zinc finger proteins and the structurally connected regions of the fingers. Based on the above points, the new gene of the present invention is considered to be a new member of the human zinc finger protein Kruppe l family and named ZFP-52. Based on this, it is inferred that it is similar to ZNF1 35, is also a member of the human zinc finger protein Kruppe l family, and has similar biological functions.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a method for producing zinc finger protein 52.
  • Another object of the present invention is to provide an antibody against the zinc finger protein 52, which is a polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, zinc finger protein 52.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of zinc finger protein 52.
  • a novel isolated zinc finger protein 52 is provided.
  • the polypeptide is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID NO: 2, or a conservative variant polypeptide thereof, or its activity Fragments, or their active derivatives, analogs.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • Zinc finger protein 52 is characterized by having a member of the zinc finger protein Kruppe l family containing 28-30 amino acids with a long guarded finger repeat (F / Y) XCXXCXXXFXXXXXLXXHXXXHTGEKP.
  • a polynucleotide encoding these isolated polypeptides, the polynucleotide comprising a nucleotide sequence having at least 70 nucleotides with a nucleotide sequence selected from the group consisting of % Identity: (a) a polynucleotide encoding the aforementioned zinc finger protein 52; (b) a polynucleotide complementary to the polynucleotide (a).
  • the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) having 182- in SEQ ID NO: 1 The sequence at position 1609; and (b) the sequence at positions 1-2389 in SEQ ID NO: 1.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of zinc finger protein 52 (ZFP-52) of the present invention and human zinc finger protein Kruppe l family member ZNF1 35.
  • the sequence above is zinc finger protein 52, and the sequence below is human zinc finger protein
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated zinc finger protein 52. 52. 3kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated zinc finger protein 52 means that zinc finger protein 52 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify zinc finger protein 52 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the zinc finger protein 52 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, zinc finger protein 52, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of zinc finger protein 52.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the zinc finger protein 52 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; Or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (II I) such a type in which the mature polypeptide and another compound (such as A compound that prolongs the half-life of a polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or a secretion sequence or a polypeptide used to purify the polypeptide) formed by fusing additional amino acid sequences into a mature polypeptide Sequences or protease sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2389 bases in length and its open reading frame (182-1609) encodes 475 amino acids.
  • the polypeptide has 46% homology with the human zinc finger protein Kruppe l family member ZNF135, and the polypeptide has the conserved finger structure sequence of the zinc finger protein Kruppel gene family, which can be deduced Human zinc finger protein 52 has a similar structure and function to the zinc finger protein Kruppe l gene family.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not Change the function of the polypeptide it encodes.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding zinc finger protein 52.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the zinc finger protein 52 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the D fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mR from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). It is also a common method to construct a CDM library (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the zinc finger protein 52 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA).
  • a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the zinc finger protein 52 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • the polynucleotide sequence encoding the zinc finger protein 52 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, etal.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding zinc finger protein 52 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA Synthetic technology, in vivo recombination technology, etc. (Sambroook, etal. Molecule Laring, a Labora tory Manua, cold Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a zinc finger protein 52 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following D transfection methods can be used: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant zinc finger protein 52 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant
  • the recombinant expression vector of the polynucleotide transforms or transduces a suitable host cell
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and its antagonists, agonists and inhibitors can be directly used in the treatment of diseases, for example, it can treat various malignant tumors and cancers; development disorders, various diseases caused by metabolic disorders of the immune system, etc.
  • the members of the zinc finger protein family are numerous and widely distributed in organisms, most of which are eukaryotic transcription regulators, which are responsible for activating or inhibiting the expression of various genes in eukaryotes.
  • eukaryotic transcription regulators which are responsible for activating or inhibiting the expression of various genes in eukaryotes.
  • the polypeptide of the present invention or a fragment or a derivative thereof can be used to prevent and treat various diseases caused by abnormal expression, differentiation and proliferation of cells.
  • diseases include but are not limited to the following: cancers of various cells and tissues, including leukemia, lymphoma, lymphosarcoma, myeloma, neuroma, glioma, meningiomas, neurofibromas, and astrocytomas; And diseases of various tissues and organs, including adrenal, thyroid, lung, pancreas, liver, prostate, uterus, bladder, kidney, testis, and gastrointestinal tract (small intestine, colon, rectum, and stomach); also include some related to metabolic disorders Diseases include diseases such as hyperthyroidism, hypothyroidism, gastritis, colon polyps, and gastroduodenal ulcers.
  • Abnormal ZFP-2 expression may also trigger a variety of acquired and hereditary diseases and immune system metabolism Disorder-induced diseases, such as: split-hand, congenital reproductive tract malformations, Bewe's syndrome and other diseases.
  • the present invention also provides screening compounds to identify improved (agonist) or repressor (antagonist zinc finger proteins)
  • Agonists increase zinc finger protein 52 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing zinc finger protein 52 can be cultured together with labeled zinc finger protein 52 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of zinc finger protein 52 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of zinc finger protein 52 can bind to zinc finger protein 52 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • zinc finger protein 52 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between zinc finger protein 52 and its receptor.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to zinc finger protein 52 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the zinc finger protein 52 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the zinc finger protein 52 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of zinc finger protein 52 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing a monoclonal antibody against zinc finger protein 52 include, but are not limited to, hybridoma technology (KoMer and Miles in. Nature, 1975, 256: 495-497), triple tumor technology, and human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrie et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against zinc finger protein 52.
  • Anti-zinc finger protein 52 antibodies can be used in immunohistochemical techniques to detect zinc finger protein 52 in biopsy specimens.
  • Monoclonal antibodies that bind to zinc finger protein 52 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Such as zinc finger protein 52 high Affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill zinc finger protein 52 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to zinc finger protein 52.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of zinc finger protein 52.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of zinc finger protein 52 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of zinc finger protein 52 detected in the test can be used to explain the importance of zinc finger protein 52 in various diseases and to diagnose diseases where zinc finger protein 52 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding zinc finger protein 52 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of zinc finger protein 52.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated zinc finger protein 52 to inhibit endogenous zinc finger protein 52 activity.
  • a variant zinc finger protein 52 may be a shortened zinc finger protein 52 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of zinc finger protein 52.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer the polynucleotide encoding the zinc finger protein 52 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a zinc finger protein 52 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding zinc finger protein 52 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit zinc finger protein 52 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can The sequences are obtained by in vitro or in vivo transcription.
  • This DM sequence has been integrated downstream of the R polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding zinc finger protein 52 can be used for the diagnosis of diseases related to zinc finger protein 52.
  • Polynucleotides encoding zinc finger protein 52 can be used to detect the expression of zinc finger protein 52 or the abnormal expression of zinc finger protein 52 in a disease state.
  • the DNA sequence encoding zinc finger protein 52 can be used to hybridize biopsy specimens to determine the expression of zinc finger protein 52.
  • Hybridization techniques include Sou thern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microcroix) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
  • Zinc finger protein 52 specific primers can also be used to detect the transcription products of zinc finger protein 52 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Zinc finger protein 52 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type zinc finger protein 52 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein. Therefore, the Nort Hern blotting and Western blotting can be used to indirectly determine whether the gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FI SH) of cDNA clones and metaphase chromosomes allows precise chromosomal localization in one step.
  • Verma et al. Human Chromos omes: a Manua l of Bas ic Techniques, Pergamon Pres s, New York (1988).
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckus i ck, Mende l ian Inher i tance in Man (available online with Johns Hopkins University Welch Med i ca l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Zinc finger protein 52 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and range of zinc finger protein 52 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Quik mRNA solat I ion Ki t Qiegene Products
  • isolating poly A) mRNA 0 2ug poly
  • a Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0655c02 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the sequence of the zinc finger protein 52 of the present invention and the protein sequence encoded by the same were applied to the Blast program (Basic local Alignment search tool) [Altschul, SF et al. J. MoL Biol. 1990; 215: 403-10] in Genbank , Swissport and other databases.
  • the gene with the highest homology to the zinc finger protein 52 of the present invention is a known member of the human zinc finger protein Kruppel family, ZNF135, whose accession code is 1109413 in Genbank.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 46% and a similarity of 64%.
  • Example 3 Cloning of a gene encoding zinc finger protein 52 by RT-PCR
  • CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5,-GGGGGGCACGGCCTTTCCAT -3, (SEQ ID NO. 3)
  • Pr imer2 5,-GAGAGAAAGCAAAACTGCCT -3, (SEQ IDNO. 4)
  • Pr imerl is a forward sequence starting at the lbp at the 5 'end of SEQ ID NO: 1;
  • Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tri s-Cl, (pH 8. 5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, l in a reaction volume of 50 ⁇ 1 Opmol Primer, 1U Taq DNA Polymerization Enzyme (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2389bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of zinc finger protein 52 gene expression
  • RNA in 20 mM 3- (N-morpholino) propanesulfonic acid (PH7.0 ) - was electrophoresed on a 1.2% agarose gel 5mM sodium acetate -ImM EDTA-2.2M formaldehyde and transferred to nitrocellulose 32 ⁇ - DNA probe labeled with a- 32 P dATP by random priming Preparation Method.
  • the DNA probe used was the PCR amplified zinc finger protein 52 coding region sequence (182bp to 1609bp) shown in Figure 1.
  • the 32P-labeled probe (about 2 x 10 6 cpm / ml) was transferred with The nitrocellulose membrane of RNA was hybridized overnight at 42 ° C in a solution containing 50% formamide-25raMKH 2 P0 4 (pH 7.4)-5 x SSC-5 x Denhardt 's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, it was analyzed and quantified by Phosphor Imager.
  • Example 5 Recombinant zinc finger protein 52 in vitro expression, isolation and purification
  • Priraer3 5'- CAGCCATGGATGGAAAAAAAAAAAGTCTC —3, (Seq ID No 5)
  • Primer4 5'- CCGAAGCTTTGTGAAAAGGCCTGATGAGATA -3 '(Seq ID No 6)
  • the 5' ends of these two primers contain Ncol and BamHI digestion sites, respectively, followed by the 5 'and 3' coding sequences of the target gene, Ncol And BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (product of Novagen, Cat. No. 69865.3).
  • PCR was performed using the PBS-0655C02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ l containing 10 pg of pBS-0655c02 plasmid, primers Primer-3 and Primer-4 were lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ncol and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively. Large fragments were recovered separately and ligated with T4 ligase. The ligation product was transformed into E. coli DH5CX by the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following zinc finger protein 52-specific peptides:
  • ELISA Use a 15 g / ml bovine serum albumin-polypeptide complex-coated titer plate for ELISA to determine rabbit serum Antibody titer.
  • Total IgG was isolated from antibody-positive rabbit sera with protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose 4B column, and anti-peptide antibodies were isolated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to zinc finger protein 52.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau membre de la famille kruppel de protéine humaine à doigt de zinc ZFP-52 et un polynucléotide codant pour cette protéine ainsi que le procédé d'obtention de ce polypeptide par technique recombinante d'ADN. L'invention concerne aussi le traitement de divers troubles, notamment les troubles de la prolifération, les troubles induits par un trouble métabolique du système immunitaire ainsi que les différents néoplasmes et cancers. L'invention concerne en outre un agoniste du polypeptide et son action thérapeutique. L'invention concerne finalement les applications de ce polynucléotide codant pour ce nouveau membre de la famille kruppel de protéine humaine à doigt de zinc ZFP-52.
PCT/CN2000/000308 1999-10-10 2000-10-08 Nouveau membre de la famille de type kruppel de proteine humaine a doigt de zinc zfp-52 et polynucleotide codant pour le nouveau membre WO2001027151A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU78983/00A AU7898300A (en) 1999-10-10 2000-10-08 A new polypeptide-human zinc finger protein kruppel family member zfp-52 and thepolynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99116949 1999-10-10
CN99116949.2 1999-10-10

Publications (1)

Publication Number Publication Date
WO2001027151A1 true WO2001027151A1 (fr) 2001-04-19

Family

ID=5279611

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000308 WO2001027151A1 (fr) 1999-10-10 2000-10-08 Nouveau membre de la famille de type kruppel de proteine humaine a doigt de zinc zfp-52 et polynucleotide codant pour le nouveau membre

Country Status (2)

Country Link
AU (1) AU7898300A (fr)
WO (1) WO2001027151A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994003599A1 (fr) * 1992-08-04 1994-02-17 Sagami Chemical Research Center ADNc HUMAIN ET PROTEINE POUR LAQUELLE CODE CET ADNc
WO1999021991A1 (fr) * 1997-10-29 1999-05-06 Shanghai Second Medical University Bmzf12: gene a doigt de zinc clone a partir de la moelle osseuse

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994003599A1 (fr) * 1992-08-04 1994-02-17 Sagami Chemical Research Center ADNc HUMAIN ET PROTEINE POUR LAQUELLE CODE CET ADNc
WO1999021991A1 (fr) * 1997-10-29 1999-05-06 Shanghai Second Medical University Bmzf12: gene a doigt de zinc clone a partir de la moelle osseuse

Also Published As

Publication number Publication date
AU7898300A (en) 2001-04-23

Similar Documents

Publication Publication Date Title
WO2001038522A1 (fr) Nouveau polypeptide, histone humaine h2a.21, et polynucleotide codant pour ce polypeptide
WO2001031030A1 (fr) Nouveau polypeptide, phosphodiesterase 21 humaine de type acide sphingomyelinase, et polynucleotide codant pour ce polypeptide
WO2001027151A1 (fr) Nouveau membre de la famille de type kruppel de proteine humaine a doigt de zinc zfp-52 et polynucleotide codant pour le nouveau membre
WO2001029228A1 (fr) Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide
WO2001038375A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 58 et polynucleotide codant pour ce polypeptide
WO2001030818A1 (fr) Nouveau polypeptide, proteine de liaison 33 a l'arn, et polynucleotide codant pour ce polypeptide
WO2001030834A1 (fr) Nouveau polypeptide, proteine 33 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001030837A1 (fr) Nouveau polypeptide, galectine 15, et polynucleotide codant pour ce polypeptide
WO2001031024A1 (fr) Nouveau polypeptide, threonine synthetase 71, et polynucleotide codant pour ce polypeptide
WO2001030827A1 (fr) Nouveau polypeptide, une proteine 56 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001031001A1 (fr) Nouveau polypeptide, facteur auxiliaire 28 du facteur de demarrage de la traduction, et polynucleotide codant pour ce polypeptide
WO2001038376A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 46, et polynucleotide codant pour ce polypeptide
WO2001032863A1 (fr) Nouveau polypeptide, proteine humaine 12 associee a l'apoptose (sag), et polynucleotide codant pour ce polypeptide
WO2001027283A1 (fr) Nouveau polypeptide, proteine 16 de type transcriptase humaine inverse, et polynucleotide codant pour ce polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001030826A1 (fr) Nouveau polypeptide, une serine/threonine kinase 29, et polynucleotide codant pour ce polypeptide
WO2001030832A1 (fr) Nouveau polypeptide, proteine a doigt de zinc hkznf-23, et un polynucleotide codant pour ce polypeptide
WO2001030841A1 (fr) Nouveau polypeptide, proteine 60 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001029080A1 (fr) Nouveau polypeptide, une proteine humaine hmg-13, et polynucleotide codant pour ce polypeptide
WO2001030819A1 (fr) Nouveau polypeptide, tropomoduline humaine 39, et polynucleotide codant pour ce polypeptide
WO2001030820A1 (fr) Nouveau polypeptide, une proteine 54 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001038369A1 (fr) Nouveau polypeptide porteur tricarboxylate 39 du rat- et polynucleotide codant ledit polypeptide
WO2001030838A1 (fr) Nouveau polypeptide, proteine g 17, et polynucleotide codant pour ce polypeptide
WO2001029075A1 (fr) Nouveau polypeptide, proteine 129 activant la proteine g, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP