WO2001025194A2 - Drug target isogenes: polymorphisms in the 5-hydroxytryptamine (serotonin) receptor 1b gene - Google Patents

Abstract

Polynucleotides comprising one or more of 3 novel single nucleotide polymorphisms in the human 5-hydroxytryptamine (serotonin) receptor 1B (HTR1B) gene are described. Compositions and methods for detecting one or more of these polymorphisms are also disclosed. In addition, various genotypes and haplotypes for the HTR1B gene that exist in the population are described.

Description

DRUG TARGET ISOGENES POLYMORPHISMS IN THE 5-HYDROXYTRYPTAMINE (SEROTONIN) RECEPTOR IB

GENE

RELATED APPLICATIONS

This application claims the benefit of U S Provisional Application Seπal No 60/158,114 filed October 7, 1999

FIELD OF THE INVENTION This invention relates to vaπation m genes that encode pharmaceutically important proteins

In particular, this invention provides genetic vaπants of the human 5-hydroxytryptamιne (serotonin) receptor IB (HTRIB) gene and methods for identifying which vaπant(s) of this gene is/are possessed by an individual

BACKGROUND OF THE INVENTION

Current methods for identifying pharmaceuticals to treat disease often start by identifying, cloning, and expressing an important target protein related to the disease A determination of whether an agonist or antagonist is needed to produce an effect that may benefit a patient with the disease is then made Then, vast numbers of compounds are screened against the target protein to fmd new potential drugs The desired outcome of this process is a drug that is specific for the target, thereby reducing the incidence of the undesired side effects usually caused by a compound^'s activity at non- intended targets

What this approach fails to consider, however, is that natural variability exists in any and every population with respect to a particular protein A target protein currently used to screen drugs typically is expressed by a gene cloned from an individual who was arbitraπly selected However, the nucleotide sequence of a particular gene may vary tremendously among

Subtle alteratιon(s) in the primary nucleotide sequence of a gene encoding a target protein may be manifested as significant vaπation in expression of or m the structure and/or function of the protein Such alterations may explain the relatively high degree of uncertainty inherent in treatment of individuals with drugs whose design is based upon a single representative example of the target For example, it is well-established that some classes of drugs frequently have lower efficacy m some individuals than others, which means such individuals and their physicians must weigh the possible benefit of a larger dosage against a greater πsk of side effects In addition, variable information on the biological function or effects of a particular protein may be due to different scientists unknowingly studying different isoforms of the gene encoding the protein Thus, information on the type and frequency of genomic vaπation that exists for pharmaceutically important proteins would be useful

The organization of single nucleotide vaπations (polymorphisms) in the pπmary sequence of a gene into one of the limited number of combinations that exist as units of inheπtance is termed a haplotype Each haplotype therefore contains significantly more information than individual unorganized polymorphisms Haplotypes provide an accurate measurement of the genomic vaπation in the tw o chromosomes of an individual It is well-established that many diseases are associated with specific vaπations in gene sequences However while there are examples m which individual polymorphisms act as genetic markers for a particular phenotype, in other cases an individual polymorphism may be found m a vaπetv ot genomic backgrounds and therefore show s no definitive coupling between the polymorphism and the causative site for the phenotype (Clark AG et al 1998 Am J Hum Genet 63 595-612, Ulbrecht M et al 2000 Am J Respir Cut Care Med 161 469-74) In addition, the marker may be predictive in some populations, but not in other populations (Clark AG et al 1998 supra) In these instances, a haplotype will provide a supenor genetic marker for the phenotype (Clark AG et al 1998 sup? a, Ulbrecht M et al 2000, sup? a, Ruano G & Stephens JC Gen Eng hews 19 (21), December 1999) Analysis of the association between each observed haplotype and a particular phenotype permits ranking of each haplotype by its statistical power of prediction for the phenotype Haplotypes found to be strongly associated with the phenotype can then have that positive association confirmed by alternative methods to minimize false positives For a gene suspected to be associated with a particular phenotype. if no observed haplotypes for that gene show association with the phenotype of interest, then it may be inferred that vaπation in the gene has little, if any, involvement with that phenotype (Ruaήo & Stephens 1999, supra) Thus, information on the observed haplotypes and their frequency of occurrence in \ anous population groups will be useful m a vaπety of research and clinical applications

One possible drug target for the treatment of migraine and other neurological disorders is the 5-hydroxytryptamme (serotonin) receptor (HTRIB) gene, which is also known as the serotomn 5-HT- lD-beta receptor (HTRlDβ), or its encoded product (Demchyshyn et al , P? oc Natl Acad Set USA 89 5522-5526, 1992, Hambhn et al , Bwchem Bιoph\s Res Commun 184 752-759, 1992. Weinshank et al . Proc Natl Acad Sci USA 89 3630-3634, 1992) This G-protein-coupled receptor is one of several 5-HT- l receptor subtypes for serotomn (5-hvdroxytryptamme or 5-HT), a key neurotransmitter implicated in the control of mood, sleep, appetite and a vaπety of traits and behaviors (for review , see Pauwels. P J , Gen Pharmacol 29 293-303, 1997. Hasler, W L , Dig Dts Set 44 108S- 1 13S 1999) Based on studies in mice lacking expression of HTRIB, this serotomn receptor subtype is believed to play a role in aggressive behavior as well as increased consumption of drugs of abuse such as alcohol and cocaine (Rocha et al . Nα-M. e 393 175-178, 1998, Scearce-Levie et al . Ann N Y Acad Set 868 701 - 715, 1999. Zhuang et al ,

21(2 Suppl) 52S-60S, 1999) In addition.

HTRIB exhibits high-affimty binding of sumatπptan and other "tπptan" drugs recently introduced for the treatment of emesis associated with migraine headaches and cyclic vomiting syndrome (Whale et al , P . . chophatmacolog 145 223-226, 1999, Hasler, supra. Deleu et al . Ada Neurol Belg 99(2) 85- 95, 1999)

The 5-hydroxytryptamιne (serotonin) receptor IB gene is located on chromosome 6ql3 and contains 1 exon that encodes a 390 ammo acid protein Reference sequences for the HTRIB gene (GenBank Accession No M75128 1 , SEQ ID NO 1 ), coding sequence, and protein are shown in Figures 1. 2 and 3. respectively

Several polymorphic sites have been reported for the coding region of the HTRIB gene One is a single nucleotide polymorphism (SNP) of C or T at position 747 of Fig 1 and the other is a SNP of G or C at position 1479 While neither of these SNPs change the ammo acid specified by the vaπant codon. a recent report stated that reduced expression of HTRIB protein was associated with the C747 or G 1479 allele (Huang et al . Neuropsvchopharmacology 21 238-246 ( 1999) A recent report concluded there was significant association between the G 1479C SNP and susceptibility to antisocial alcoholism (Lappalamen et al , Arch Gen Psvchιatr\ 55 989-994, 1998) Another polymorphism located at nucleotide position 989 of Fig 1 results in vaπation between phenylalamne and cysteme at ammo acid position 124 and the pharmacological properties of each HTRIB vaπant are significantly different In particular, the Cysl24 vaπant receptor exhibits higher binding affinity than the Phel24 vanant for several serotonin receptor hgands, including 5-HT, dihydroergotamine and sumatπptan, while in contrast, the serotonin receptor antagonist ketanseπn binds more strongly to the Phe vaπant than the Cys vaπant Because of the potential for polymoφhisms in the HT IB gene to affect the expression and function of the encoded protein, it would be useful to determine whether additional polymoφhisms exist in the HTRI B gene, as well as how such polymoφhisms are combined in different copies of the gene Such information would be useful for studying the biological function of HTRIB as well as in identifying drugs targeting this protein for the treatment of disorders related to its abnormal expression or function

SUMMARY OF THE INVENTION

Accordingly, the inventors herein have discovered 3 novel polymoφhic sites in the HTRIB gene These polymoφhic sites (PS) correspond to the following nucleotide positions in the indicated GenBank Accession Number 358 (PS I ), 458 (PS2). and 1 158 (PS4) m M75128 1 The polymoφhisms at these sites are thymine or guamne at PS 1 , adenine or thymine at PS2. and cytosine or adenine at PS4 In addition, the inventors have determined the identity of the alternative nucleotides present at these sites, as well as at the previously identified sites at nucleotides 747 (PS3) and 1479 (PS5) in Figure 1 , in a human reference population of 79 unrelated individuals self-identified as belonging to one of four major population groups African descent, Asian. Caucasian and

Hispamc/Latmo It is believed that HTRlB-encoding polynucleotides containing one or more of the novel polymoφhic sites reported herein will be useful m studying the expression and biological function of HTRIB. as well as in developing drugs targeting this protein In addition, information on the combinations of polymoφhisms m the HTRIB gene may have diagnostic and forensic applications

Thus, in one embodiment, the invention provides an isolated polynucleotide compπsing a nucleotide sequence which is a polymoφhic vaπant of a reference sequence for the HTRIB gene or a fragment thereof The reference sequence compπses SEQ ID NO 1 and the polymoφhic vaπant compπses at least one polymoφhism selected from the group consisting of guamne at PS I. thymine at PS2. and adenine at PS4 In a preferred embodiment, the polymoφhic vaπant compπses one or more additional polymoφhisms selected from the group consisting of cytosine at PS3 and guamne at PS5 A particularly preferred polymoφhic \ anant is a naturally-occurπng isoform (also referred to herein as an "isogene") of the HTRIB gene A HTRIB isogene of the invention compπses thymine or guamne at PS 1 , ademne or thymine at PS2, cytosine or thymine at PS3 cytosine or ademne at PS4 and guamne or cytosine at PS5 The invention also provides a collection of HTRIB isogenes, referred to herein as a HTRIB genome anthology A HTRI B isogene may be defined by the combination and order of these polymoφhisms in the isogene, which is referred to herein as a HTRIB haplotype Thus, the invention also provides data on the number of different HTR1 B haplotypes found in the above four population groups This haplotype data is useful m methods for deπving a HTRIB haplotype from an individual's genotype for the HTRIB gene and for determining an association between a HTRIB haplotype and a particular trait

In another embodiment, the invention provides a polynucleotide compπsing a polymoφhic vaπant of a reference sequence for a HTRIB cDNA or a fragment thereof The reference sequence compπses SEQ ID NO 2 (Fig 2) and the polymoφhic cDNA compπses at least one polymoφhism selected from the group consisting of adenine at a position corresponding to nucleotide 540 In a preferred embodiment, the polymoφhic vaπant compπses an additional polymoφhism of cytosine at a position corresponding to nucleotide 129 and guamne at a position corresponding to nucleotide 861

Polynucleotides complementary to these HTRIB genomic and cDNA vaπants are also provided by the invention

In other embodiments the invention provides a recombmant expression vector compπsing one of the polymoφhic genomic variants operably linked to expression regulatory elements as well as a recombmant host cell transformed or transfected with the expression vector The recombmant vector and host cell may be used to express HTRIB for protein structure analvsis and drug binding studies

In other embodiments, the invention provides methods, compositions, and kits for haplotyping and/or genotyping the HTRIB gene in an individual The methods involve identifying the nucleotide or nucleotide pair present at one or more polymoφhic sites selected from PS 1-PS2, and PS4 m one or both copies of the HTRIB gene from the individual The compositions contain ohgonucleotide probes and primers designed to specifically hybπdize to one or more target regions containing, or that are adjacent to, a polymoφhic site The methods and compositions for establishing the genotype or haplotype of an individual at the novel polymoφhic sites descπbed herein are useful for studying population diversity, anthropological lineage, the significance of diversity and lineage at the phenotypic level, paternity testing, forensic applications, and for identifying associations between the HTRIB genetic vaπation and a trait such as level of drug response or susceptibility to disease

In yet another embodiment, the mvention provides a method for identifying an association between a genotype or haplotype and a trait In preferred embodiments, the trait is susceptibility to a disease, seventy of a disease, the staging of a disease or response to a drug Such methods have applicability m developing diagnostic tests and therapeutic treatments for migraine and other neurological disorders

The present mvention also provides nonhuman transgenic animals compπsing one of the HTRIB genomic polymoφhic vaπants descπbed herein and methods for producing such animals The transgenic animals are useful for studvmg expression of the HTRIB isogenes in vivo, for in vivo screening and testing of drugs targeted agamst HTRIB protem, and for testing the efficacy of therapeutic agents and compounds for migraine and other neurological disorders in a biological system

The present invention also provides a computer system for storing and displaying polymoφhism data determined for the HTRI B gene The computer system compπses a computer processing unit, a display, and a database containing the polymoφhism data The polymoφhism data includes the polymoφhisms, the genotypes and the haplotypes identified for the HTRIB gene in a reference population In a preferred embodiment, the computer system is capable of producing a display showing HTRIB haplotypes organized according to their evolutionary relationships

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates a reference sequence for the HTRIB gene (Genbank Version Number

M75128 1, contiguous lines, SEQ ID NO 1 ), with the coding sequence indicated by shadmg and bold nucleotides indicating the polymoφhic sites and polymoφhisms identified by Applicants m a reference population

Figure 2 illustrates a reference sequence for the HTRIB coding sequence (contiguous lines, SEQ ID NO 2), with the polymoφhic sites and polymorphisms identified by Applicants in a reference population indicated by the vaπant nucleotide positioned below the polymoφhic site m the sequence Figure 3 illustrates a reference sequence for the HTRIB protein (contiguous lines, SEQ ID

NO 3).

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is based on the discovery of novel vaπants of the HTRIB gene. As descπbed in more detail below, the inventors herein discovered 3 novel polymoφhic sites by characterizing the HTRIB gene found in genomic DNAs isolated from an Index Repository that contains immortalized cell lines from one chimpanzee and 93 human individuals. The human individuals included a reference population of 79 unrelated individuals self-identified as belonging to one of four major population groups: Caucasian (22 individuals), African descent (20 individuals) Asian (20 individuals) Hispanic/Latino (17 individuals). To the extent possible, the members of this reference population were organized into population subgroups by the self-identified ethnogeographic origin of their four grandparents as shown in Table 1 below.

Table 1. Population Groups in the Index Repository

Population Group Population Subgroup No. of Individuals

African descent 20

Sierra Leone 1

Asian 20

Burma 1

China 3

Japan 6

Korea 1

Philippines 5

Vietnam 4

Caucasian 22

British Isles 3

British Isles/Central 4

British Isles/Eastern 1

Central/Eastern 1

Eastern 3

Central/Mediterranean 1

Mediterranean 2

Scandinavian 2

Hispanic/Latino 17

Caribbean 7

Caribbean (Spanish Descent) 2

Central American (Spanish Descent) 1

Mexican American 4

South American (Spanish Descent) 3

In addition, the Index Repository contains three unrelated indigenous American Indians (one from each of North. Central and South America), one three-generation Caucasian family (from the CEPH Utah cohort) and one two-generation African-American family.

Using the HTRIB genotypes identified in the Index Repository and the methodology described in the Examples below, the inventors herein also determined the haplotypes found on each chromosome for most human members of this repository. The HTRIB genotypes and haplotypes found in the repository include those shown in Tables 4 and 5, respectively. The polymoφhism and haplotype data disclosed herein are useful for studying population diversity, anthropological lineage, the significance of diversity and lineage at the phenotypic level, paternity testing, forensic applications, and for identifying associations between the HTRIB genetic variation and a trait such as level of drag response or susceptibility to disease. In the context of this disclosure, the following terms shall be defined as follows unless otherwise indicated

Allele - A particular form of a genetic locus, distinguished from other forms by its particular nucleotide sequence Candidate Gene - A gene which is hypothesized to be responsible for a disease, condition, or the response to a treatment, or to be correlated with one of these

Gene - A segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, mtrons, and other untranslated regions that control expression Genotype - An unphased 5 ^' to 3 ^' sequence of nucleotide paιr(s) found at one or more polymoφhic sites in a locus on a pair of homologous chromosomes in an individual. As used herein, genotype includes a full-genotype and/or a sub-genotype as descnbed below

Full-genotype - The unphased 5 ^' to 3 sequence of nucleotide pairs found at all known polymoφhic sites m a locus on a pair of homologous chromosomes in a single individual Sub-genotype - The unphased 5 to 3 ^' sequence of nucleotides seen at a subset of the known polymoφhic sites m a locus on a pair of homologous chromosomes in a single individual

Genotyping - A process for determining a genotype of an individual

Haplotype - A 5 to 3 sequence of nucleotides found at one or more polymoφhic sites in a locus on a single chromosome from a single individual As used herein, haplotype includes a full- haplotype and/or a sub-haplotype as descπbed below

Full-haplotype - The 5 to 3 ^' sequence of nucleotides found at all known polymoφhic sites m a locus on a single chromosome from a single individual

Sub-haplotype - The 5 to 3 sequence of nucleotides seen at a subset of the known polymoφhic sites in a locus on a single chromosome from a single individual Haplotype pair - The two haplotypes found for a locus in a single individual

Haplotyping - A process for determining one or more haplotypes in an individual and includes use of family pedigrees, molecular techniques and/or statistical inference

Haplotype data - Information concerning one or more of the following for a specific gene: a listing of the haplotype pairs in each individual in a population, a listing of the different haplotypes m a population, frequency of each haplotype in that or other populations, and any known associations between one or more haplotypes and a trait

Isoform - A particular form of a gene, mRNA, cDNA or the protein encoded thereby, distinguished from other forms by its particular sequence and/ or structure

Isogene - One of the isoforms of a gene found in a population An isogene contains all of the polymoφhisms present in the particular isoform of the gene

Isolated - As applied to a biological molecule such as RNA. DNA, ohgonucleotide, or protein, isolated means the molecule is substantially free of other biological molecules such as nucleic acids, proteins, hpids. carbohydrates, or other mateπal such as cellular debπs and growth media Generally, the term "isolated" is not intended to refer to a complete absence of such mateπal or to absence of water, buffers, or salts, unless they are present in amounts that substantially mterfere with the methods of the present mvention Locus - A location on a chromosome or DNA molecule corresponding to a gene or a physical or phenotypic feature

Naturally-occurring - A. term used to designate that the object it is applied to, e g , naturally- occumng polynucleotide or polypeptide. can be isolated from a source in nature and which has not been intentionally modified by man Nucleotide pair - The nucleotides found at a polymoφhic site on the two copies of a chromosome from an individual

Phased - As applied to a sequence of nucleotide pairs for two or more polymoφhic sites in a locus, phased means the combination of nucleotides present at those polymoφhic sites on a single copy of the locus is known Polymorphic site (PS) - A position within a locus at which at least two alternative sequences are found in a population, the most frequent of which has a frequency of no more than 99%

Polymorphic variant - A gene, mRNA, cDNA. polypeptide or peptide whose nucleotide or ammo acid sequence vanes from a reference sequence due to the presence of a polymoφhism in the gene Polymorphism - The sequence \ anation observed in an individual at a polymoφhic site

Polymoφhisms include nucleotide substitutions, insertions, deletions and microsatellites and may, but need not, result in detectable differences in gene expression or protein function

Polymorphism data - Information concerning one or more of the following for a specific gene location of polymoφhic sites, sequence vanation at those sites frequency of polymoφhisms in one or more populations, the different genotypes and/or haplotypes determined for the gene, frequency of one or more of these genotypes and/or haplotypes in one or more populations, any known assocιatιon(s) between a trait and a genotype or a haplotype for the gene

Polymorphism Database - A collection of polymoφhism data arranged in a systematic or methodical way and capable of being individually accessed by electronic or other means Polynucleotide - A nucleic acid molecule compπsed of smgle-stranded RNA or DNA or compπsed of complementary, double-stranded DNA

Population Group - A group of individuals shaπng a common ethnogeographic oπgin Reference Population - A group of subjects or individuals who are predicted to be representative of the genetic vaπation found m the general population Typically, the reference population represents the genetic -vaπation m the population at a certainty level of at least 85%, preferably at least 90%, more preferably at least 95% and even more preferably at least 99% Single Nucleotide Polymorphism (SNP) - Typically, the specific pair of nucleotides observed at a single polymoφhic site In rare cases, three or four nucleotides may be found

Subject - A human individual hose genotypes or haplotypes or response to treatment or disease state are to be determined

Treatment - A stimulus administered internally or externally to a subject Unphased - As applied to a sequence of nucleotide pairs for two or more polymoφhic sites in a locus, unphased means the combination of nucleotides present at those polymoφhic sites on a single copy of the locus is not known

The inventors herein have discovered 3 novel polymoφhic sites in the HTRI B gene The polymoφhic sites identified by the inventors are referred to as PS 1-5 to designate the order m which they are located in the gene (see Table 3 below), with the no\ el polymoφhic sites referred to as PSI - PS2, and PS4

Thus, m one embodiment, the invention provides an isolated polynucleotide compπsmg a polymoφhic of the HTRIB gene or a fragment of the gene which contains at least one of the novel polymoφhic sites descnbed herein The nucleotide sequence of a vaπant HTRIB gene is identical to the reterence genomic sequence for those portions of the gene examined, as descπbed in the Examples below, except that it compnses a different nucleotide at one or more of the novel polymoφhic sites PS 1 -PS2. and PS4, and may also compπse one or more additional polymoφhisms selected from the group consisting of cytosine at PS3 and guamne at PS5 Similarly, the nucleotide sequence of a vaπant fragment of the HTRIB gene is identical to the corresponding portion of the reference sequence except for having a different nucleotide at one or more of the novel polymoφhic sites descπbed herein Thus, the invention specifically does not include polynucleotides compπsmg a nucleotide sequence identical to the reference sequence (or other reported HTRIB sequences) or to portions of the reference sequence (or other reported HTRIB sequences), except for genotyping ohgonucleotides as descπbed below The location of a polymoφhism m a variant gene or fragment is identified by aligning its sequence against SEQ ID NO 1 The polymoφhism is selected from the group consisting of guamne at PS I . thymine at PS2, and adenine at PS4 In a preferred embodiment, the polymoφhic vaπant compπses a naturally-occurring isogene of the HTRIB gene which is defined by any one of haplotypes 1-8 shown m Table 5 below Polymoφhic vanants of the invention may be prepared by isolating a clone containing the

HTRIB gene from a human genomic library The clone ma\ be sequenced to determine the identity of the nucleotides at the polymoφhic sites descπbed herein Any particular vaπant claimed herein could be prepared from this clone by performing in vitro mutagenesis using procedures well-known in the art HTRIB isogenes may be isolated using any method that allows separation of the two "copies" of the HTRIB gene present m an individual, which, as readilv understood by the skilled artisan, may be the same allele or different alleles Separation methods include targeted in vivo cloning (TIVC) in yeast as descπbed in WO 98O1573. U S Patent No 5.866.404. and U S Patent No 5.972.614 Another method, which is descπbed in U S Patent No 5,972 614. uses an allele specific ohgonucleotide in combination with pπmer extension and exonuclease degradation to generate gous DNA targets et other methods are single molecule dilution (SMD) as descnbed m Ruaήo et al , Proc Natl Acad Sci 87 6296-6300 1990, and allele specific PCR (Ruaήo et al , 17 Nucleic Acids Res 8392. 1989, Ruaήo et al . 19 Nucleic Acids Res 6877-6882, 1991 Michalatos- Belom et al , 24 Nucleic Acids Res 4841 -4843, 1996)

The mvention also provides HTRIB genome anthologies, which are collections of HTRIB isogenes found in a given population The population may be any group of at least two individuals, including but not limited to a reference population, a population group, a family population, a clinical population and a same sex population A HTRIB genome anthology may compπse individual HTRIB isogenes stored m separate containers such as microtest tubes, separate wells of a microtitre plate and the like Alternatively two or more groups of the HTRIB isogenes in the anthology may be stored in separate containers Individual isogenes or groups of isogenes in a genome anthology may be stored in any convenient and stable form, mcludmg but not limited to in buffered solutions, as DNA precipitates, freeze-dπed preparations and the like A preferred HTRIB genome anthology of the invention compπses a set of isogenes defined by the haplotypes shown in Table 5 below

An isolated polynucleotide containing a polymoφhic vaπant nucleotide sequence of the invention may be operably linked to one or more expression regulatory elements in a recombmant expression vector capable of being propagated and expressing the encoded HTRIB protein m a prokaryotic or a eukaryotic host cell Examples of expression regulatory elements which may be used include, but are not limited to, the lac system, operator and promoter regions of phage lambda, yeast promoters, and promoters deπved from vaccinia virus, adenovirus. retroviruses, or SV40 Other regulatory elements include but are not limited to, appropπate leader sequences, termination codons. polvadenylation signals, and other sequences required for the appropπate transcnption and subsequent translation of the nucleic acid sequence in a given host cell Of course, the correct combinations of expression regulatory elements will depend on the host system used In addition, it is understood that the expression vector contains any additional elements necessary for its transfer to and subsequent replication in the host cell Examples of such elements include, but are not limited to, oπgins of replication and selectable markers Such expression vectors are commercially available or are readily constructed using methods known to those in the art (e g , F Ausubel et al , 1987, m "Current Protocols in Molecular Biology", John Wiley and Sons, New York, New York) Host cells which may be used to express the vaπant HTRIB sequences of the invention include, but are not limited to, eukaryotic and mammalian cells, such as animal, plant, insect and yeast cells, and prokarvotic cells, such as E coll. or algal cells as known in the art The recombmant expression vector may be introduced into the host cell using any method known to those in the art including, but not limited to, micromiection, electroporation, particle bombardment, transduction. and transfection using DEAE- dextran, hpofection. or calcium phosphate (see e g , Sambrook et al ( 1989) in "Molecular Clonmg A Laboratory Manual", Cold Spπng Harbor Press, Plamview. New York) In a preferred aspect, eukaryotic expression vectors that function in eukaryotic cells, and preferably mammalian cells, are used Non-limiting examples of such vectors include vaccmia virus vectors, adenovirus vectors, heφes virus vectors, and baculovirus transfer vectors Preferred eukaryotic cell lines include COS cells, CHO cells. HeLa cells, NIH/3T3 cells, and embryonic stem cells (Thomson, J A et al , 1998 Science 282 1 145- 1147) Particularly preferred host cells are mammalian cells

As will be readily recognized by the skilled artisan, expression of polymoφhic vaπants of the HTRIB gene will produce HTRIB mRNAs varying from each other at any polymoφhic site retained in the spliced and processed mRNA molecules These mRNAs can be used for the preparation of a HTRIB cDNA compπsmg a nucleotide sequence which is a polymoφhic vaπant of the HTRIB reference coding sequence shown in Figure 2 Thus, the invention also provides HTRIB mRNAs and corresponding cDNAs which compπse a nucleotide sequence that is identical to SEQ ID NO 2 (Fig 2), or its corresponding RNA sequence, except for having one or more polymoφhisms selected from the group consisting of ademne at a position corresponding to nucleotide 540.and may also compπse an additional polymoφhism of cytosine at a position corresponding to nucleotide 129 and guamne at a position corresponding to nucleotide 861 Fragments of these vaπant mRNAs and cDNAs are included in the scope of the invention, provided they contain the novel polymoφhisms descπbed herein The mvention specifically excludes polynucleotides identical to previously identified and characteπzed HTRIB cDNAs and fragments thereof Polynucleotides compπsing a vaπant RNA or DNA sequence may be isolated from a biological sample using well-known molecular biological procedures or may be chemically synthesized

Polymoφhic vaπants of fragments according to the mvention compπse at least one novel polymoφhism identified herein and have a length of at least 10 nucleotides and may range up to the full length of the gene Preferably, such fragments are between 100 and 3000 nucleotides m length, and more preferably between 200 and 2000 nucleotides in length, and most preferably between 500 and 1000 nucleotides in length

In descnbmg the polymoφhic sites identified herein, reference is made to the sense strand of the gene for convenience However, as recognized by the skilled artisan, nucleic acid molecules containing the HTRIB gene may be complementary double stranded molecules and thus reference to a particular site on the sense strand refers as well to the corresponding site on the complementary antisense strand Thus, reference may be made to the same polymoφhic site on either strand and an ohgonucleotide may be designed to hybπdize specifically to either strand at a target region contaimng the polymoφhic site Thus, the invention also includes single-stranded polynucleotides which are complementary to the sense strand of the HTRIB genomic vaπants descπbed herein

Polynucleotides compπsing a polymoφhic gene vaπant or fragment may be useful for therapeutic puφoses For example, where a patient could benefit from expression, or increased expression, of a particular HTRIB protein isoform, an expression vector encodmg the isoform may be administered to the patient The patient may be one who lacks the HTRIB isogene encodmg that isoform or may already have at least one copy of that isogene.

In other situations, it may be desirable to decrease or block expression of a particular HTRIB isogene. Expression of a HTRI B isogene may be turned off by transforming a targeted organ, tissue or cell population with an expression vector that expresses high levels of untranslatable mRNA for the isogene. Alternatively, oligonucleotides directed against the regulatory regions (e.g., promoter, mtrons, enhancers. 3 ^' untranslated region) of the isogene may block transcnption Oligonucleotides targeting the transcnption initiation site, e.g., between positions -10 and -H O from the start site are preferred. Similarly, inhibition of transcnption can be achieved using oligonucleotides that base-pair with regιon(s) of the isogene DNA to form tπplex DNA (see e g , Gee et al. m Huber. B.E. and B.I. Carr, Molecular and Immunologic Approaches, Futura Publishing Co , Mt Kisco, N.Y , 1994). Antisense oligonucleotides may also be designed to block translation of HTRIB mRNA transcπbed from a particular isogene It is also contemplated that πbozymes may be designed that can catalyze the specific cleavage of HTRIB mRNA transcπbed from a particular isogene

The oligonucleotides may be delivered to a target cell or tissue by expression from a vector introduced into the cell or tissue in vivo or ex vivo. Alternatively, the oligonucleotides may be formulated as a pharmaceutical composition for administration to the patient Ohgoπbonucleotides and/or oligodeoxynucleotides intended for use as antisense oligonucleotides may be modified to increase stability and half-life. Possible modifications include, but are not limited to phosphorothioate or 2' O-methyl linkages, and the inclusion of nontraditional bases such as mosme and queosine, as well as acetyl-. methyl-, thio-. and similarly modified forms of adenine, cytosine, guamne, thymme, and uracil which are not as easily recognized by endogenous nucleases

Effect(s) of the polymoφhisms identified herem on expression of HTRI B may be investigated by prepaπng recombmant cells and/or nonhuman recombmant organisms, preferably recombmant animals, contaimng a polymoφhic vaπant of the HTRIB gene As used herein, "expression" includes but is not limited to one or more of the following: transcnption of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into HTRIB protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.

To prepare a recombmant cell of the invention, the desired HTRIB isogene may be introduced into the cell m a vector such that the isogene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location. In a preferred embodiment, the HTRIB isogene is introduced into a cell in such a way that it recombmes with the endogenous HTRIB gene present in the cell. Such recombination requires the occurrence of a double recombination event, thereby resulting m the desired HTRIB gene polymoφhism. Vectors for the introduction of genes both for recombination and for extrachromosomal maintenance are known in the art. and any suitable vector or vector construct may be used in the invention. Methods such as electroporation, particle bombardment, calcium phosphate co-precipitation and viral transduction for introducing DNA mto cells are known in the art; therefore, the choice of method may he with the competence and preference of the skilled practitioner. Examples of cells into which the HTRIB isogene may be introduced include, but are not limited to. continuous culture cells, such as COS, NIH/3T3. and pπmary or culture cells of the relevant tissue type, 1 e., they express the HTRIB isogene Such recombmant cells can be used to compare the biological activities of the different protein vaπants

Recombmant nonhuman organisms, i.e , transgenic animals, expressing a vaπant HTRIB gene are prepared using standard procedures known in the art Preferably, a construct compπsing the vaπant gene is introduced into a nonhuman animal or an ancestor of the animal at an embryonic stage, i.e., the one-cell stage, or generally not later than about the eight-cell stage. Transgenic animals carrying the constructs of the invention can be made by several methods known to those having skill in the art. One method involves transfectmg mto the embryo a retrovirus constructed to contain one or more insulator elements, a gene or genes of interest, and other components known to those skilled m the art to provide a complete shuttle vector harboπng the insulated gene(s) as a transgene, see e.g., U.S Patent No. 5.610,053. Another method involves directly injecting a transgene into the embryo A third method involves the use of embryonic stem cells. Examples of animals mto which the HTRIB isogenes may be introduced include, but are not limited to, mice, rats, other rodents, and nonhuman pπmates (see "The Introduction of Foreign Genes mto Mice" and the cited references therein, In:

Recombmant DNA, Eds J.D Watson. M Gilman. J. Witkowski, and M. Zoller, W H Freeman and Company, New York, pages 254-272) Transgenic animals stably expressing a human HTRIB isogene and producing human HTRIB protein can be used as biological models for studying diseases related to abnormal HTRIB expression and/or activity, and for screening and assaying vaπous candidate drugs, compounds, and treatment regimens to reduce the symptoms or effects of these diseases.

An additional embodiment of the mvention relates to pharmaceutical compositions for treating disorders affected by expression or function of a novel HTRIB isogene descnbed herein The pharmaceutical composition may compnse any of the following active ingredients a polynucleotide compπsing one of these novel HTRIB isogenes; an antisense oligonucleotide directed agamst one of the novel HTRIB isogenes, a polynucleotide encoding such an antisense oligonucleotide. or another compound which inhibits expression of a novel HTRIB isogene descπbed herein Preferably, the composition contains the active ingredient in a therapeutically effective amount By therapeutically effective amount is meant that one or more of the symptoms relating to disorders affected by expression or function of a novel HTRIB isogene is reduced and/or eliminated. The composition also compnses a pharmaceutically acceptable earner, examples of which include, but are not limited to, saline, buffered saline, dextrose, and water. Those skilled in the art may employ a formulation most suitable for the active ingredient, whether it is a polynucleotide, oligonucleotide. protein peptide or small molecule antagonist The pharmaceutical composition may be administered alone or m combination with at least one other agent, such as a stabilizing compound Administration of the pharmaceutical composition may be by any number of routes including, but not limited to oral, intravenous intramuscular, mtra-arteπal. mtramedullary, mtrathecal, mtraventπcular. mtradermal. transdermal. subcutaneous, mtrapentoneal, intranasal, enteral, topical, sublmgual. or rectal Further details on techniques for formulation and administration may be found m the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co Easton. PA)

For any composition determination of the therapeutically effective dose of active ingredient and/or the appropnate route of administration is well withm the capability of those skilled in the art For example, the dose can be estimated initially either m cell culture assays or in animal models The animal model may also be used to determine the appropπate concentration range and route of administration Such information can then be used to determine useful doses and routes for administration in humans The exact dosage will be determined by the practitioner, in light of factors relating to the patient requiπng treatment, including but not limited to seventy of the disease state, general health, age, weight and gender of the patient, diet, time and frequency of administration, other drugs being taken by the patient, and tolerance/response to the treatment

Information on the identity of genotypes and haplotypes for the HTRI B gene of any particular individual as well as the frequency of such genotypes and haplotypes in any particular population of individuals is expected to be useful for a vaπety of basic research and clinical applications Thus, the mvention also provides compositions and methods for detecting the novel HTRIB polymoφhisms identified herein

The compositions compnse at least one HTRIB genotypmg oligonucleotide In one embodiment, a HTRIB genotypmg oligonucleotide is a probe or pnmer capable of hybndizmg to a target region that is located close to, or that contains one of the novel polymoφhic sites descnbed herein As used herein, the term "oligonucleotide" refers to a polynucleotide molecule having less than about 100 nucleotides A preferred oligonucleotide of the invention is 10 to 35 nucleotides long More preferably, the oligonucleotide is between 15 and 30, and most preferably, between 20 and 25 nucleotides m length The oligonucleotide may be compπsed of any phosphorylation state of nbonucleotides, deoxyπbonucleotides, and acyclic nucleotide denvatives. and other functionally equivalent denvatives Alternatively, oligonucleotides may have a phosphate-free backbone, which may be compπsed of linkages such as carboxymethyl, acetamidate, carbamate, polyamide (peptide nucleic acid (PNA)) and the like (Varma, R m Molecular Biology and Biotechnology. A Comprehensi". e Desk Reference. Ed R Meyers, VCH Publishers. Inc ( 1995), pages 617-620) Oligonucleotides of the invention may be prepared by chemical synthesis using any suitable methodology known m the art, or may be deπved from a biological sample, for example, by restnction digestion The oligonucleotides may be labeled, according to any technique known m the art. mcludmg use of radiolabels fluorescent labels, enzymatic labels, proteins, haptens. antibodies, sequence tags and the like

Genotypmg oligonucleotides of the invention must be capable of specifically hybπdizmg to a target region of a HTRIB polynucleotide, 1 e , a HTRIB isogene As used herein, specific hybπdization means the oligonucleotide forms an anti-parallel double-stranded structure with the target region under certain

conditions, while failing to form such a structure when incubated with a non-target region or a non-HTRIB polynucleotide under the same hybπdizmg conditions Preferably, the oligonucleotide specifically hybndizes to the target region under conventional high stπngenc> conditions The skilled artisan can readily design and test oligonucleotide probes and pπmers suitable for detecting polymoφhisms in the HTRIB gene using the polymoφhism information provided herein m conjunction with the known sequence information for the HTRIB gene and routine techniques

A nucleic acid molecule such as an oligonucleotide or polynucleotide is said to be a "perfect" or "complete" complement of another nucleic acid molecule if every nucleotide of one of the molecules is complementary to the nucleotide at the corresponding position of the other molecule A nucleic acid molecule is "substantially complementary" to another molecule if it hybndizes to that molecule with sufficient stability to remain in a duplex form under conventional low-stringency conditions Conventional hybndization conditions are descπbed, for example, by Sambrook J et al , m Molecular Clonmg A Laboratory Manual, 2^nd Edition, Cold Spπng Harbor Press, Cold Spnng Harbor, NY (1989) and by Haymes, B D et al in Nucleic Acid Hybndization, A Practical Approach, IRL Press, Washington, D C ( 1985) While perfectly complementary oligonucleotides are preferred for detecting polymoφhisms. departures from complete complementanty are contemplated where such departures do not prevent the molecule from specifically hybπdizing to the target region For example, an oligonucleotide primer may have a non-complementary fragment at its 5 end. with the remainder of the pnmer being complementary to the target region Alternatively, non-complementary nucleotides may be interspersed into the oligonucleotide probe or pnmer as long as the resulting probe or primer is still capable of specifically hybπdizmg to the target region

Preferred genotypmg oligonucleotides of the invention are allele-specific oligonucleotides As used herein, the term allele-specific oligonucleotide (ASO) means an oligonucleotide that is able, under sufficiently stπngent conditions, to hybndize specifically to one allele of a gene, or other locus, at a target region containing a polymoφhic site while not hybπdizmg to the corresponding region m another allele(s) As understood bv the skilled artisan, allele-specificity will depend upon a vaπety of readily optimized stπngency conditions, including salt and formamide concentrations, as well as temperatures for both the hybndization and washing steps Examples of hybndization and washing conditions typically used for ASO probes are found in Kogan et al , "Genetic Prediction of Hemophilia A" in PCR Protocols, A Guide to Methods and Applications. Academic Press, 1990 and Ruano et al , 87 Proc Natl Acad Sci USA 6296-6300, 1990 Typically, an allele-specific oligonucleotide will be perfectly complementary to one allele w hile containing a single mismatch for another allele

Allele-specific oligonucleotide probes which usually provide good discrimination between different alleles are those in which a central position of the oligonucleotide probe aligns with the polymoφhic site m the target region (e g , approximately the 7^th or 8^th position in a 15 mer, the 8^th or 9^th position in a 16mer, the 10^lh or 1 1 ^Λ position in a 20 mer) A prefened ASO probe for detecting HTRIB gene polymoφhisms compnses a nucleotide sequence, listed 5 to 3 . selected from the group consisting of

ACCCAGGTCTAAGAC (SEQ ID NO and its complement; ACCCAGGGCTAAGAC (SEQ ID NO and its complement; CGCACCCATGACCTC (SEQ ID NO and its complement; CGCACCCTTGACCTC (SEQ ID NO and its complement; TCTCTATCTCGCTGC (SEQ ID NO and its complement; and TCTCTATATCGCTGC (SEQ ID NO and its complement. An allele-specific oligonucleotide pnmer of the invention has a 3 terminal nucleotide, or preferably a 3 ' penultimate nucleotide. that is complementary to only one nucleotide of a particular SNP, thereby acting as a pnmer for polymerase-mediated extension only if the allele contaimng that nucleotide is present Allele-specific oligonucleotide pπmers hybπdizmg to either the coding or noncodmg strand are contemplated by the invention A preferred ASO primer for detectmg HTRIB gene polymoφhisms compπses a nucleotide sequence, listed 5 to 3 , selected from the group consisting of

TTAGCAACCCAGGTC (SEQ ID NO: 10); CACCGGGTCTTGAAC (SEQ ID NO:ll)

TTAGCAACCCAGGGC (SEQ ID NO: 12); CACCGGGTCTTGACC (SEQ ID NO: 13)

GGCTGCCGCACCCAT (SEQ ID NO: 14); AAACTAGAGGTCATG (SEQ ID NO: 15) GGCTGCCGCACCCTT (SEQ ID NO: 16); AAACTAGAGGTCAAG (SEQ ID NO:17)

GAAGAGTCTCTATCT (SEQ ID NO: 18); AGGGCGGCAGCGAGA (SEQ ID NO:19)

GAAGAGTCTCTATAT (SEQ ID NO:20); and AGGGCGGCAGCGATA (SEQ ID NO:21).

Other genotypmg oligonucleotides of the invention hybπdize to a target region located one to several nucleotides downstream of one of the novel polymoφhic sites identified herein Such oligonucleotides are useful m polymerase-mediated pnmer extension methods for detectmg one of the novel polymoφhisms descπbed herein and therefore such genotypmg oligonucleotides are referred to herein as "primer-extension oligonucleotides". In a preferred embodiment, the 3 -terminus of a primer-extension oligonucleotide is a deoxynucleotide complementary to the nucleotide located immediately adjacent to the polymoφhic site A particularly preferred oligonucleotide primer for detecting HTRIB gene polymoφhisms by pnmer extension terminates m a nucleotide sequence, listed

5 ' to 3 ^', selected from the group consisting of

GCAACCCAGG (SEQ ID NO:22); CGGGTCTTGA (SEQ ID NO:23);

TGCCGCACCC (SEQ ID NO: 24); CTAGAGGTCA (SEQ ID NO: 25); GAGTCTCTAT (SEQ ID NO: 26); and GCGGCAGCGA (SEQ ID NO^^"7).

In some embodiments, a composition contains two or more differently labeled genotypmg oligonucleotides for simultaneously probing the identity of nucleotides at two or more polymoφhic sites It is also contemplated that pnmer compositions mav contain two or more sets of allele-specific primer pairs to allow simultaneous targeting and amplification of two or more regions contaimng a polymoφhic site

HTRIB genotypmg oligonucleotides of the invention may also be immobilized on or synthesized on a solid surface such as a microchip, bead, or glass slide (see, e g WO 98/20020 and WO 98/20019) Such immobilized genotvping oligonucleotides may be used in a

of polymoφhism detection assays, including but not limited to probe hybndization and polymerase extension assays Immobilized HTRIB genotypmg oligonucleotides of the invention may compπse an ordered array of oligonucleotides designed to rapidly screen a DNA sample for polymoφhisms in multiple genes at the same time

In another embodiment, the invention provides a kit compπsing at least two genotypmg oligonucleotides packaged m separate containers The kit may also contain other components such as hybndization buffer (where the oligonucleotides are to be used as a probe) packaged in a separate container Alternatively, where the oligonucleotides are to be used to amplify a target region, the kit may contain, packaged in separate containers, a polymerase and a reaction buffer optimized for pnmer extension mediated by the polymerase. such as PCR

The above descnbed oligonucleotide compositions and kits are useful in methods for genotypmg and/or haplotypmg the HTRIB gene m an individual As used herein, the terms "HTRIB genotype" and "HTRIB haplotype" mean the genotype or haplotype contains the nucleotide pair or nucleotide, respectively, that is present at one or more of the novel polymoφhic sites descnbed herein and may optionally also include the nucleotide pair or nucleotide present at one or more additional polymoφhic sites in the HTRIB gene The additional polymoφhic sites may be currently known polymoφhic sites or sites that are subsequently discovered

One embodiment of the genotypmg method involves isolating from the individual a nucleic acid mixture compπsing the two copies of the HTRIB gene, or a fragment thereof, that are present m the individual, and determining the identity of the nucleotide pair at one or more of the polymoφhic sites selected from PS 1-PS2. and PS4 in the two copies to assign a HTRIB genotype to the individual As will be readily understood by the skilled artisan, the two "copies" of a gene in an individual may be the same allele or may be different alleles In a preferred embodiment of the genotypmg method, the identity of the nucleotide pair atone or more of the polymoφhic sites selected from the group consisting of PS3 and PS5 is also determined In a particularly preferred embodiment, the genotypmg method compnses determining the identity of the nucleotide pair at each of PS 1-5

Typically, the nucleic acid mixture is isolated from a biological sample taken from the individual, such as a blood sample or tissue sample Suitable tissue samples include whole blood, semen, saliva, tears, unne, fecal mateπal. sweat, buccal. skm and hair The nucleic acid mixture may be compnsed of genomic DNA, mRNA, or cDNA and. m the latter two cases, the biological sample must be obtained from an organ in which the HTRIB gene is expressed Furthermore it will be understood by the skilled artisan that mRNA or cDNA preparations would not be used to detect polymoφhisms located in introns or m 5 and 3 ' nontranscπbed regions If a HTRIB gene fragment is isolated, it must contain the polymoφhic sιte(s) to be genotyped

One embodiment of the haplotypmg method compπses isolating from the individual a nucleic acid molecule containing onlv one of the two copies of the HTRIB gene, or a fragment thereof, that is present in the individual and determining in that copy the identity of the nucleotide at one or more of the polymoφhic sites PS 1 -PS2, and PS4 in that copy to assign a HTRIB haplotype to the individual The nucleic acid may be isolated using any method capable of separating the two copies of the HTRIB gene or fragment such as one of the methods descπbed above for prepaπng HTRIB isogenes, with targeted in vivo cloning being the prefened approach As will be readily appreciated by those skilled in the art, any individual clone will only provide haplotype information on one of the two HTRIB gene copies present in an individual If haplotype information is desired for the individual's other copy, additional HTRIB clones will need to be examined Typically, at least five clones should be examined to have more than a 90% probability of haplotypmg both copies of the HTRIB gene m an individual In some embodiments, the haplotypmg method also compπses identifying the nucleotide at one or more of the polymoφhic sites PS3 and PS5 In a particularly prefened embodiment, the nucleotide at each of PS 1-5 is identified

In a pretened embodiment, a HTRIB haplotype pair is determined for an individual by identifying the phased sequence of nucleotides at one or more of the polymoφhic sites selected from PS 1-PS2, and PS4 in each copy of the HTRIB gene that is present in the individual In a particularly preferred embodiment, the haplotypmg method compπses identifying the phased sequence of nucleotides at each of PS 1 -5 in each copy of the HTRIB gene When haplotypmg both copies of the gene, the identifying step is preferably performed with each copy of the gene being placed in separate containers However, it is also envisioned that if the two copies are labeled with different tags, or are otherwise separately distinguishable or identifiable it could be possible in some cases to perform the method in the same container For example, if first and second copies of the gene are labeled with different first and second fluorescent dyes, respectively, and an allele-specific oligonucleotide labeled with yet a third different fluorescent dye is used to assay the polymoφhic sιte(s), then detecting a combination of the first and third dyes would identify the polymoφhism in the first gene copy while detecting a combination of the second and third dyes would identify the polymoφhism in the second gene copy

In both the genotypmg and haplotypmg methods, the identity of a nucleotide (or nucleotide pair) at a polymoφhic sιte(s) may be determined by amplifying a target regιon(s) containing the polymoφhic sιte(s) directly from one or both copies of the HTRIB gene, or fragment thereof, and the sequence of the amplified regιon(s) determined by conventional methods It will be readily appreciated by the skilled artisan that only one nucleotide will be detected at a polymoφhic site m individuals who are homozvgous at that site, while two different nucleotides will be detected if the individual is heterozygous for that site The polymoφhism

be identified directly, known as positive-type identification, or by inference, referred to as negatn e-type identification For example, where a SNP is known to be guamne and cytosine m a reference population, a site may be positively determined to be either guamne or cytosine for an individual homozygous at that site, or both guamne and cvtosine, if the individual is heterozygous at that site Alternatively, the site may be negatively determined to be not guamne (and thus cytosine/cytosme) or not cytosine (and thus guamne/guanine)

In addition, the identity of the allele(s) present at any of the novel polymoφhic sites descπbed herein may be indirectly determined by genotypmg a polymoφhic site not disclosed herein that is in linkage disequilibπum with the polymoφhic site that is of interest Two sites are said to be m linkage disequihbπum if the presence of a particular vaπant at one site enhances the predictability of another vaπant at the second site (Stevens, JC 1999, Mol Dtag 4 309- 17) Polymoφhic sites in linkage disequihbπum with the presently disclosed polymoφhic sites may be located in regions of the gene or in other genomic regions not examined herein Genotypmg of a polymoφhic site in linkage disequihbπum with the novel polymoφhic sites descnbed herein may be performed by, but is not limited to, any of the above-mentioned methods for detecting the identity of the allele at a polymoφhic site

The target regιon(s) may be amplified using any ohgonucleotide-directed amplification method, including but not limited to polymerase chain reaction (PCR) (U S Patent No 4,965,188), hgase chain reaction (LCR) (Barany et al . Proc Natl Acad Sci USA 88 189-193, 1991, WO90/01069), and oligonucleotide gation assay (OLA) (Landegren et al , Science 241 1077-1080, 1988) Oligonucleotides useful as pπmers or probes in such methods should specifically hybπdize to a region of the nucleic acid that contains or is adjacent to the polymoφhic site Typically, the oligonucleotides are between 10 and 35 nucleotides in length and preferably, between 15 and 30 nucleotides in length Most preferably, the oligonucleotides are 20 to 25 nucleotides long The exact length of the oligonucleotide will depend on many factors that are routinely considered and practiced by the skilled artisan

Other known nucleic acid amplification procedures may be used to amplify the target region mcludmg transcπption-based amplification systems (U S Patent No 5, 130.238, EP 329,822, U S Patent No 5, 169,766, WO89/06700) and isothermal methods (Walker et al , Pt oc Natl Acad Set USA 89 392-396, 1992)

A polymoφhism in the target region may also be assayed before or after amplification using one of several hybπdization-based methods known in the art Typically, allele-specific oligonucleotides are utilized in performing such methods The allele-specific oligonucleotides may be used as differently labeled probe pairs, with one member of the pair showing a perfect match to one vaπant of a target sequence and the other member showmg a perfect match to a different vaπant In some embodiments, more than one polymoφhic site may be detected at once using a set of allele- specific oligonucleotides or oligonucleotide pairs Preferably the members of the set have melting temperatures withm 5°C, and more preferably withm 2°C, of each other when hybndizing to each of the polymoφhic sites being detected.

Hybndization of an allele-specific oligonucleotide to a target polynucleotide may be performed with both entities m solution, or such hybndization may be performed when either the oligonucleotide or the target polynucleotide is covalently or noncovalently affixed to a solid support Attachment may be mediated, for example, by antibody-antigen interactions, poly-L-Lys, streptavidin or avidm-biotm, salt bndges. hydrophobic interactions, chemical linkages, UV cross-linking baking, etc. Allele-specific oligonucleotides may be synthesized directly on the solid support or attached to the solid support subsequent to synthesis Solid-supports suitable for use in detection methods of the invention include substrates made of silicon, glass, plastic, paper and the like, which may be formed, for example, mto wells (as in 96-well plates), slides, sheets, membranes, fibers, chips, dishes, and beads The solid support may be treated, coated or deπvatized to facilitate the immobilization of the allele-specific oligonucleotide or target nucleic acid

The genotype or haplotype for the HTRIB gene of an individual may also be determined by hybndization of a nucleic acid sample containing one or both copies of the gene to nucleic acid arrays and subarrays such as descnbed in WO 95/1 1995 The arrays would contain a battery of allele- specific oligonucleotides representing each of the polymoφhic sites to be included in the genotype or haplotype

The identity of polymoφhisms may also be determined using a mismatch detection technique, mcludmg but not limited to the RNase protection method using πboprobes (Winter et al , Proc. Natl. Acad. Sci. USA 82 7575, 1985, Meyers et al., Science 230.1242, 1985) and proteins which recognize nucleotide mismatches, such as the E coh mutS protein (Modπch, P Ann Rev Genet 25.229-253, 1991 ) Alternatively, vanant alleles can be identified by single strand conformation polymoφhism (SSCP) analysis (Onta et al . Genomics 5 874-879, 1989. Humphπes et al , in Molecular Diagnosis of Genetic Diseases. R Elles, ed , pp 321 -340, 1996) or denatuπng gradient gel electrophoresis (DGGE) (Wartell et al , Nucl Acids Res 18.2699-2706, 1990, Sheffield et al , Proc Natl Acad Sci USA 86:232-236, 1989)

A polymerase-mediated pnmer extension method may also be used to identify the polymoφhιsm(s) Several such methods have been descnbed in the patent and scientific literature and include the "Genetic Bit Analysis" method (W092/15712) and the ligase/polymerase mediated genetic bit analysis (U.S. Patent 5,679,524 Related methods are disclosed in W091/02087, WO90/09455, W095/17676. U S. Patent Nos 5.302,509, and 5,945,283 Extended primers containing a polymoφhism may be detected by mass spectrometry as descnbed in U S Patent No 5,605,798 Another pnmer extension method is allele-specific PCR (Ruaήo et al . Nucl Acids Res 17.8392, 1989; Ruaήo et al., Nucl Acids Res 19, 6877-6882, 1991 , WO 93/22456, Turki et al , J Clm Invest. 95^* 1635-1641, 1995) In addition, multiple polymoφhic sites may be investigated by simultaneously amplifying multiple regions of the nucleic acid using sets of allele-specific pπmers as descπbed in Wallace et al. (WO89/10414)

In another aspect of the invention, an individual's HTRIB haplotype pair is predicted from its HTRIB genotype using information on haplotype pairs known to exist in a reference population. In its broadest embodiment, the haplotypmg prediction method compπses identifying a HTRIB genotype for the individual at two or more polymoφhic sites selected from PS1-PS2, and PS4. enumerating all possible haplotype pairs which are consistent with the genotype, accessing data contaimng HTRIB haplotype pairs identified in a reference population, and assigning a haplotype pair to the individual that is consistent with the data. In one embodiment, the reference haplotype pairs include the HTRIB haplotype pairs shown in Table 4 Generally, the reference population should be composed of randomly-selected individuals representing the major ethnogeographic groups of the world A preferred reference population for use in the methods of the present invention compnses an approximately equal number of individuals from Caucasian, African Ameπcan, Asian and Hispanic-Latino population groups with the minimum number of each group being chosen based on how rare a haplotype one wants to be guaranteed to see For example, if one wants to have a q% chance of not missing a haplotype that exists in the population at a p% frequency of occurring in the reference population, the number of individuals (n) who must be sampled is given by 2n=log( 1 -q)/log( 1 -p) where p and q are expressed as fractions A preferred reference population allows the detection of any haplotype whose frequency is at least 10% with about 99% certainty and compπses about 20 unrelated individuals from each of the four population groups named above A particularly prefened reference population includes a 3-generatιon family representing one or more of the four population groups to serve as controls for checkmg quality of haplotypmg procedures.

In a preferred embodiment, the haplotype frequency data for each ethnogeographic group is examined to determine whether it is consistent with Hardy- Wemberg equi bπum. Hardy- Weinberg equihbπum (D.L. Haiti et al , Pnnciples of Population Genomics, Smauer Associates (Sunderland, MA), 3^rd Ed.. 1997) postulates that the frequency of findmg the haplotype pair H, / H, is equal to p_H_„ (H, / H₂ ) = 2/. (H, )p(H₂ ) if H, ≠ H₂ and p_H__w (H, I H₂ ) = p(H )p(H ) if H, = H₂

A statistically significant difference between the observed and expected haplotype frequencies could be due to one or more factors mcludmg significant inbreeding m the population group, strong selective pressure on the gene, sampling bias, and/or enors in the genotypmg process. If large deviations from Ηardy-We berg equihbπum are observed in an ethnogeographic group, the number of individuals in that group can be increased to see if the deviation is due to a sampling bias. If a larger sample size does not reduce the difference between observed and expected haplotype pair frequencies, then one may wish to consider haplotypmg the individual using a direct haplotypmg method such as, for example, CLASPER System^™ technology (U.S. Patent No 5.866,404), SMD, or allele-specific long- range PCR (Michalotos-Belom et al., Nucleic Acids Res 24-4841-4843, 1996).

In one embodiment of this method for predicting a ΗTR1B haplotype pair, the assigning step involves performing the following analysis First, each of the possible haplotype pairs is compared to the haplotype pairs in the reference population Generally, only one of the haplotype pairs m the reference population matches a possible haplotype pair and that pair is assigned to the individual Occasionally, only one haplotype represented m the reference haplotype pairs is consistent with a possible haplotype pair for an individual, and in such cases the individual is assigned a haplotype pair containing this known haplotype and a new haplotype deπved by subtracting the known haplotype from the possible haplotype pair In rare cases, either no haplotypes in the reference population are consistent with the possible haplotype pairs, or alternatively, multiple reference haplotype pairs are consistent with the possible haplotype pairs In such cases, the individual is preferably haplotyped using a direct molecular haplotypmg method such as, for example, CLASPER System technology (U.S Patent No 5,866.404), SMD, or allele-specific long-range PCR (Michalotos-Beloin et al , Nucleic Acids Res 24 4841 -4843, 1996) A preferred process for predicting HTRIB haplotype pairs from HTRIB genotypes is descπbed in copending U S Provisional Application Serial No 60/198.340 The mvention also provides a method for determining the frequency of a HTRIB genotype or HTRIB haplotype in a population The method compnses determining the genotype or the haplotype pair for the HTRIB gene that is present in each member of the population, wherein the genotype or haplotype compnses the nucleotide pair or nucleotide detected at one or more of the polymoφhic sites PS1-PS2. and PS4 m the HTRIB gene, and calculating the frequency any particular genotype or haplotype is found in the population The population may be a reference population, a family population, a same sex population, a population group, a trait population (e g , a group of individuals exhibiting a trait of interest such as a medical condition or response to a therapeutic treatment)

In another aspect of the invention, frequency data for HTRIB genotypes and/or haplotypes found in a reference population are used in a method for identifying an association between a trait and a HTRIB genotype or a HTRIB haplotype The trait may be any detectable phenotype, including but not limited to susceptibility to a disease or response to a treatment The method involves obtaining data on the frequency of the genotype(s) or haplotype(s) of interest in a reference population as well as in a population exhibiting the trait Frequency data for one or both of the reference and trait populations may be obtained by genotypmg or haplotypmg each individual m the populations using one of the methods descπbed above The haplotypes for the trait population may be determined directly or. alternatively, by the predictive genotype to haplotype approach descπbed above In another embodiment, the frequency data for the reference and/or trait populations is obtained by accessing previously determined frequency data, which may be in wπtten or electronic form For example, the frequency data may be present in a database that is accessible by a computer Once the frequency data is obtained, the frequencies of the genotype(s) or haplotype(s) of interest m the reference and trait populations are compared In a preferred embodiment, the frequencies of all genotypes and/or haplotypes observed in the populations are compared If a particular genotype or haplotype for the HTRIB gene is more frequent in the trait population than in the reference population at a statistically significant amount, then the trait is predicted to be associated with that HTRIB genotype or haplotype Preferably, the HTRIB genotype or haplotype being compared in the trait and reference populations is selected from the full-genotypes and full-haplotypes shown in Tables 4 and 5, respectively, or from sub-genotypes and sub-haplotypes denved from these genotypes and haplotypes In a prefened embodiment of the method, the trait of interest is a climcal response exhibited by a patient to some therapeutic treatment, for example, response to a drug targeting HTRIB or response to a therapeutic treatment for a medical condition As used herein, "medical condition" includes but is not limited to any condition or disease manifested as one or more physical and/or psychological symptoms for which treatment is desirable, and includes previously and newly identified diseases and other disorders As used herein the term "clinical response" means any or all of the following a quantitative measure of the response, no response, and adverse response (i.e., side effects).

In order to deduce a conelation between clinical response to a treatment and a HTRIB genotype or haplotype. it is necessary to obtain data on the clinical responses exhibited by a population of individuals who received the treatment, hereinafter the "clinical population" This climcal data may be obtained by analyzing the results of a clinical tπal that has already been run and or the climcal data may be obtained by designing and carrying out one or more new clinical tπals As used herein, the term "clinical tπal^" means any research study designed to collect clinical data on responses to a particular treatment, and includes but is not limited to phase I. phase II and phase III clinical tnals. Standard methods are used to define the patient population and to enroll subjects

It is prefened that the individuals included in the climcal population have been graded for the existence of the medical condition of interest This is important cases where the symptom(s) being presented by the patients can be caused by more than one underlying condition, and where treatment of the underlying conditions are not the same. An example of this would be where patients expeπence breathing difficulties that are due to either asthma or respiratory infections If both sets were treated with an asthma medication, there would be a spunous group of apparent non-responders that did not actually have asthma These people would affect the ability to detect any correlation between haplotype and treatment outcome This grading of potential patients could employ a standard physical exam or one or more lab tests Alternatively, grading of patients could use haplotypmg for situations where there is a strong conelation between haplotype pair and disease susceptibility or seventy

The therapeutic treatment of interest is administered to each individual in the tnal population and each individual^'s response to the treatment is measured using one or more predetermined cπteπa It is contemplated that m many cases, the tnal population will exhibit a range of responses and that the investigator will choose the number of responder groups (e.g , low, medium, high) made up by the vaπous responses In addition, the HTRIB gene for each individual in the tπal population is genotyped and or haplotyped. which may be done before or after admimsteπng the treatment.

After both the clinical and polymoφhism data have been obtained, correlations between individual response and HTRIB genotype or haplotype content are created. Correlations may be produced in several ways. In one method, individuals are grouped by their HTRIB genotype or haplotype (or haplotype pair) (also refened to as a polymoφhism group), and then the averages and standard deviations of clinical responses exhibited by the members of each polymoφhism group are calculated.

These results are then analyzed to determine if any observed vanation in clinical response between polymoφhism groups is statistically significant. Statistical analysis methods which may be used are described in L.D. Fisher and G. vanBelle. "Biostatistics A Methodology for the Health Sciences", Wiley-Interscience (New York) 1993 This analysis may also include a regression calculation of which polymoφhic sites in the HTRIB gene give the most sigmficant contπbution to the differences in phenotype One regression model useful in the invention is descπbed in PCT Application Senal No. PCT/US00/ 17540, entitled "Methods for Obtaimng and Using Haplotype Data".

A second method for finding correlations between HTRI B haplotype content and clinical responses uses predictive models based on error-minimizing optimization algoπthms. One of many possible optimization algonthms is a genetic algoπthm (R. Judson, "Genetic Algoπthms and Their Uses m Chemistry" m Reviews in Computational Chemistry, Vol. 10, pp 1 -73, K. B. Lipkowitz and D. B. Boyd, eds. (VCH Publishers. New York, 1997). Simulated annealing (Press et al., "Numeπcal Recipes in C: The Art of Scientific Computing", Cambπdge University Press (Cambndge) 1992, Ch. 10), neural networks (E. Rich and K Knight, "Artificial Intelligence", 2^nd Edition (McGraw-Hill, New York, 1991, Ch. 18), standard gradient descent methods (Press et al., supra Ch. 10), or other global or local optimization approaches (see discussion in Judson, supra) could also be used. Preferably, the correlation is found using a genetic algoπthm approach as descnbed in PCT Application Senal No. PCT/US00/17540. Correlations may also be analyzed using analysis of vaπation (ANOVA) techniques to determine how much of the vaπation in the clinical data is explained by different subsets of the polymoφhic sites in the HTRI B gene. As descnbed in PCT Application Senal No. PCT USOO/ 17540, ANOVA is used to test hypotheses about whether a response vaπable is caused by or conelated with one or more traits or vaπables that can be measured (Fisher and vanBelle, supra, Ch. 10). From the analyses descnbed above, a mathematical model may be readily constructed by the skilled artisan that predicts clinical response as a function of HTRIB genotype or haplotype content.

Preferably, the model is validated in one or more follow-up clinical tπals designed to test the model.

The identification of an association between a clinical response and a genotype or haplotype

(or haplotype pair) for the HTRIB gene may be the basis for designing a diagnostic method to determine those individuals who will or will not respond to the treatment, or alternatively, will respond at a lower level and thus may require more treatment, i.e., a greater dose of a drug. The diagnostic method may take one of several forms: for example, a direct DNA test (i.e.. genotypmg or haplotypmg one or more of the polymoφhic sites in the HTRIB gene), a serological test, or a physical exam measurement The only requirement is that there be a good correlation between the diagnostic test results and the underlying HTRIB genotype or haplotype that is in turn correlated with the clinical response In a preferred embodiment, this diagnostic method uses the predictive haplotypmg method descnbed above

Any or all analytical and mathematical operations involved m practicing the methods of the present invention may be implemented by a computer In addition, the computer may execute a program that generates views (or screens) displayed on a display device and with which the user can interact to view and analyze large amounts of information relating to the HTRIB gene and its genomic vaπation, including chromosome location, gene structure, and gene family, gene expression data, polymoφhism data, genetic sequence data, and clinical data population data (e g , data on ethnogeographic oπg , clinical responses, genotypes, and haplotypes for one or more populations) The HTRIB polymoφhism data descnbed herein may be stored as part of a relational database (e g , an instance of an Oracle database or a set of ASCII flat files) These polymoφhism data may be stored on the computer^'s hard dπve or may, for example, be stored on a CD ROM or on one or more other storage devices accessible by the computer For example, the data may be stored on one or more databases m communication with the computer via a network

Preferred embodiments of the mvention are descπbed m the following examples Other embodiments withm the scope of the claims herein will be apparent to one skilled in the art from consideration of the specification or practice of the invention as disclosed herein It is intended that the specification, together with the examples, be considered exemplary only, with the scope and spiπt of the invention being indicated by the claims which follow the examples

EXAMPLES The Examples herein are meant to exemplify the vanous aspects of carrying out the invention and are not intended to limit the scope of the invention in any way The Examples do not mclude detailed descπptions for conventional methods employed, such as in the performance of genomic DNA isolation, PCR and sequencing procedures Such methods are well-known to those skilled in the art and are descπbed m numerous publications, for example, Sambrook, Fntsch. and Mamatis, "Molecular Cloning A Laboratory Manual", 2^nd Edition, Cold Spnng Harbor Laboratory Press, USA, (1989)

Example 1 This example illustrates examination of vanous regions of the HTRIB gene for polymoφhic sites Amplification of Target Regions

The following target regions of the HTRIB gene were amplified using the PCR pnmer pairs listed below, with the sequences presented in the 5 ^' to 3^' direction and nucleotide positions shown for each region corresponding to the indicated GenBank Accession No Accession Number: M75128.1 Fragment 1 Forward Primer

191-212 ATCCAAAAGCGTCCAGGTTAGG (SEQ ID NO: 28) Reverse Primer Reverse complement of 1797-1818 CGTTTGCAGTGGGGTCGCCTAA (SEQ ID NO: 29) PCR product 1628 nt

These pnmer pairs were used m PCR reactions containing genomic DNA isolated from immortalized cell lines for each member of the Index Repository The PCR reactions were earned out under the following conditions

Reaction volume = 20 μl

10 x Advantage 2 Polymerase reaction buffer (Clontech) = 2 μl

100 ng of human genomic DNA = 1 μl lO mM dNTP = 0.4 μl Advantage 2 Polymerase enzyme mix (Clontech) = 0.2 μl

Forward Pnmer ( 10 μM) = 0.4 μl

Reverse Pnmer ( 10 μM) = 0.4 μl

Water =15.6μl Amplification profile

94°C - 2 mm. 1 cycle

10 cycles

94°C - 30 sec -i

64°C - 45 sec. I 35 cycles 72°C - 1 mm J

Sequencing of PCR Products

The PCR products were punfied by Solid Phase Reversible Immobilization using the protocol developed by the Whitehead Genome Center. A detailed protocol can be found at httpv. www.genome.wi mit.edu/sequencmg/protocols/pure/SPRJ_pcr.html Bπefly. five μl of carboxyl coated magnetic beads ( 10 mg/ml) and 60 μl of HYB BUFFER

(2.5M NaCl/20% PEG 8000) were added to each PCR reaction mixture (20 μl) The reaction mixture was mixed well and incubated at room temperature (RT) for 10 mm The microtitre plate was placed on a magnet for 2 mm and the beads washed twice with 150 μl of 70% EtOH. The beads were air dned for 2 mm and the DNA was eluted m 25 μl of distilled water and incubated at RT for 5 mm. The beads were magnetically separated and the supernatant removed for testing and sequencing. The puπfied PCR products were sequenced m both directions using the pnmer sets descnbed previously or those listed, m the 5 to 3 direction, below

Accession Number: M75128.1

Fragment 1

Forward primer

284-303 ACCCTCCTGCACTAGACGCC (SEQ ID NO: 30)

Reverse primer

Reverse complement of 726-751 GGACTACAT TACCAGGACTCCATCT (SEQ ID

NO:31)

Fragment 2 Forward primer

508-530 TCACGGAACTATCAACTGGGGAC (SEQ ID NO: 32) Reverse primer Reverse complement of 1019-1038 CTGCCTCCATCCTGCACCTC (SEQ ID NO: 33)

Fragment 3 Forward primer 908-928 TTGTGTCCATCCTGGTGATGC (SEQ ID NO: 34) Reverse primer

Reverse complement of 1332-1353 GATTTTGAAACAGACGCCCAAC (SEQ ID NO: 35) Fragment 4

Forward primer

1138-1161 TGGGTCTTCTCCATCTCTATCTCG (SEQ ID NO: 36)

Reverse primer

Reverse complement of 1635-1654 CTGCAAAGATGCCTGCTGGT (SEQ ID NO:37)

Fragment 5 Forward primer

1242-1261 CACGGTCTACTCCACGGTGG (SEQ ID NO: 38) Reverse primer

Reverse complement of 1703-1728 CCCTCATCAACCCCATAATCTATACC (SEQ ID NO: 39)

Analysis of Sequences for Polvmoφhic Sites

Sequences were analyzed for the presence of polymoφhisms using the Polyphred program (Nickerson et al , Nucleic Acids Res 14 2745-2751 , 1997) The presence of a polymoφhism was confirmed on both strands The polymoφhisms and their locations m the HTR 1 B gene are listed in Table 3 below Table 3. Polymorphic Sites identified in the HTRIB Gene.

R previously reported in the literature

Example 2

This example illustrates analysis of the HTRIB polymoφhisms identified in the Index Repository for human genotypes and haplotypes

The different genotypes contaming these polymoφhisms that were observed in the reference population are shown in Table 4 below, with the haplotype pair indicating the combination of haplotypes determined for the individual using the haplotype denvation protocol descπbed below In

Table 4, homozygous positions are indicated by one nucleotide and heterozygous positions are indicated by two nucleotides Missing nucleotides m any given genotype in Table 4 were inferred based on linkage disequihbnum and/or Mende an inheπtance

Table 4. Genotypes for the HTRIB Gene Genotype

Numb er Polymorpni c S i te Hap Pair

PS I PS2 PS 3 PS 4 PS 5

1 G/T A/T C /T c G/C 3 7

2 T A C r- G 4 4

3 G /T A C/T c G/C 1 7

4 G /T A c c G 1 4

5 G/ T A/T c c G 3 4

6 G A/T c c G 3

7 T A/T c G 4 5

8 T A C /T c G/C 4 7

9 T A c G 8 8

10 G T c c G 3 3

11 G A c c G 1 1

12 T A C /T c C 6 7

13 A C /T c G 4 8

14 A T c C 7 1

15 T A T A/C C 7 9

16 G/T T c c G 3 5

The haplotype pairs shown in Table 4 were estimated from the unphased genotypes using an extension of Clark's algoπthm (Clark. A G (1990) Mol Bto Evol 7, 1 1 1-122), as descπbed in U S Provisional Application Senal No 60/198,340 entitled "A Method and System for Determimng

Haplotypes from a Collection of Polymoφhisms" In this method, haplotypes are assigned directly from individuals who are homozygous at all sites or heterozygous at no more than one of the vaπable sites. In our analysis, the list of haplotypes is augmented with haplotypes obtained from a three- generation Caucasian family and a two-generation Afncan-Ameπcan family. This list of haplotypes is then used to deconvolute the unphased genotypes in the remaining (multiply heterozygous) individuals. By following this protocol, it was determined that the Index Repository examined herein and, by extension, the general population contains the 8 human HTRIB haplotypes shown in Table 5 below.

Table 5. Haplotypes for tne HTRIB Gene Haplotype Number Polymorphic Site

PS I PS2 PS 3 PS 4 PS 5

1 G A C C G

2 G T C C G

3 T A C C G

4 T T C C G

5 T A C C C

6 T A T c C

7 T A T c G

8 T A T A C

In view of the above, it will be seen that the several advantages of the mvention are achieved and other advantageous results attained.

As vanous changes could be made in the above methods and compositions without departing from the scope of the invention, it is intended that all matter contamed in the above descnption and shown m the accompanying drawings shall be inteφreted as illustrative and not in a limiting sense. All references cited in this specification, including patents and patent applications, are hereby incoφorated m their entirety by reference. The discussion of references herein is intended merely to summaπze the assertions made by their authors and no admission is made that any reference constitutes pnor art. Applicants reserve the πght to challenge the accuracy and pertinency of the cited references.

Claims

What is Claimed is

1 An isolated polynucleotide compnsing a nucleotide sequence selected from the group consisting of:

(a) a first nucleotide sequence which is a polymoφhic vaπant of a reference sequence for 5- hydroxytryptamine (serotonin) receptor IB (HTRIB) gene or a fragment thereof, wherein the reference sequence compπses SEQ ID NO.l. and the polymoφhic vaπant compπses at least one polymoφhism selected from the group consisting of guanme at PSI, thymme at PS2, and adenine at PS4, and

(b) a second nucleotide sequence which is complementary to the first nucleotide sequence.

2. The isolated polynucleotide of claim 1 which compπses a HTRIB isogene.

3. The isolated polynucleotide of claim 1 which is a DNA molecule and compπses both the first and second nucleotide sequences and further compπses expression regulatory elements operably linked to the first nucleotide sequence.

4. A recombmant nonhuman organism transformed or transfected with the isolated polynucleotide of claim 1, wherein the orgamsm expresses a HTRIB protein encoded by the first nucleotide sequence

5 The recombmant organism of claim 4 which is a nonhuman transgenic ammal.

6. The isolated polynucleotide of claim 1, wherein the first nucleotide sequence is a polymoφhic vanant of a fragment of the HTRIB gene, the fragment compπsing one or more polymoφhisms selected from the group consisting of guamne at PSI, thymine at PS2, and adenine at PS4.

7 An isolated polynucleotide compπsmg a nucleotide sequence which is a polymoφhic vaπant of a reference sequence for the HTRIB cDNA or a fragment thereof, wherein the reference sequence compπses SEQ ID NO: 2 and the polymoφhic vaπant compnses at least one polymoφhism selected from the group consisting of adenine at a position conesponding to nucleotide 540

8. A recombmant nonhuman organism transformed or transfected with the isolated polynucleotide of claim 7, wherein the organism expresses a 5-hydroxytryptamιne (serotonin) receptor IB (HTRIB) protein encoded by the polymoφhic vaπant sequence.

9. The recombmant nonhuman organism of claim 8 which is a nonhuman transgenic ammal.

10. A composition compπsing at least one genotypmg oligonucleotide for detecting a polymoφhism m the 5-hydroxytryptamme (serotomn) receptor IB (HTRIB) gene at a polymoφhic site selected from PS l-PS2, and PS4.

1 1. The composition of claim 10, wherein the genotypmg oligonucleotide is an allele-specific oligonucleotide that specifically hybndizes to an allele of the HTRIB gene at a region contaimng the polymoφhic site.

12. The composition of claim 1 1, wherein the allele-specific oligonucleotide compnses a nucleotide sequence selected from the group consisting of of SEQ ID NOS.4-9, the complements of SEQ ID NOS: 4-9, and SEQ ID NOS: 10-21 The composition of claim 10 wherein the genotypmg oligonucleotide is a pnmer-extension oligonucleotide A method for genotypmg the 5-hydroxytryptamine (serotomn) receptor IB (HTRIB) gene of an individual, compπsing determining for the two copies of the HTRIB gene present m the individual the identity of the nucleotide pair at one or more polymoφhic sites (PS) selected from PSl-PS2, and PS4 The method of claim 14 wherein the determimng step compnses

(a) isolating from the individual a nucleic acid mixture compπsing both copies of the HTRIB gene, or a fragment thereof, that are present in the individual.

(b) amplifying from the nucleic acid mixture a target region contaimng at least one of the polymoφhic sites,

(c) hybπdizing a pnmer extension oligonucleotide to one allele of the amplified target region,

(d) performing a nucleic acid template-dependent, pnmer extension reaction on the hybndized genotypmg oligonucleotide in the presence of at least two different terminators of the reaction, wherein said terminators are complementary to the alternative nucleotides present at the polymoφhic site, and

(e) detecting the presence and identity of the terminator in the extended genotypmg oligonucleotide A method for haplotypmg the 5-hydroxytryptamine (serotonin) receptor IB (HTRIB) gene of an individual which compπses determining, for one copy of the HTRIB gene present in the individual, the identity of the nucleotide at one or more polymoφhic sites (PS) selected from PS1-PS2, and PS4 The method of claim 16. wherein the determimng step compπses

(a) isolating from the individual a nucleic acid molecule contaimng only one of the two copies of the HTRIB gene, or a fragment thereof, that is present in the individual,

(b) amplifying from the nucleic acid molecule a target region containing at least one of the polymoφhic sites,

(c) hybπdizing a pnmer extension oligonucleotide to one allele of the amplified target region,

(d) performing a nucleic acid template-dependent, pnmer extension reaction on the hybndized genotypmg oligonucleotide in the presence of at least two different terminators of the reaction, wherein said terminators are complementary to the alternative nucleotides present at the polymoφhic site, and

(e) detecting the presence and identity of the terminator m the extended genotypmg oligonucleotide A method for predicting a haplotype pair for the 5-hydroxytryptamme (serotomn) receptor IB (HTRIB) gene of an individual compπsing

(a) identifying an HTR1 B genotype for the individual at two or more of polymoφhic sites selected from PS 1-PS2. and PS4. (b) enumerating all possible haplotype pairs which are consistent with the genotype,

(c) accessing data contaimng the HTRIB haplotype pairs determined in a reference population, and

(d) assigning a haplotype pair to the individual that is consistent with the data A method for identifying an association between a trait and at least one genotype or haplotype of the 5-hydroxytryptamme (serotonin) receptor IB gene which compπses companng the frequency of the genotype or haplotype m a population exhibiting the trait with the frequency of the genotype or haplotype in a reference population, wherein the genotype or haplotype compπses a nucleotide pair or nucleotide located at one or more polymoφhic sites selected from PS 1-PS2, and PS4, wherein a higher frequency of the genotype or haplotype m the trait population than in the reference population indicates the trait is associated with the genotype or haplotype The method of claim 19, wherein the haplotype is selected from haplotype numbers 1 -8 shown in Table 5 The method of claim 20, wherein the trait is a clinical response to a drug targeting HTRIB A computer system for stonng and analyzing polymoφhism data for the 5-hydroxytryptamine (serotonin) receptor IB gene, compnsing

(a) a central processing unit (CPU). (b) a communication interface,

(c) a display device,

(d) an input device, and

(e) a database contaimng the polymoφhism data, wherein the polymoφhism data compπses the genotypes and haplotype pairs shown in Table 4 and the haplotypes shown in Table 5 A genome anthology for the 5-hydroxytryptamine (serotonin) receptor I B (HTRI B) gene which compπses HTRIB isogenes defined by haplotypes 1-8 shown in Table 5