WO2001021639A1 - Drug target isogenes: polymorphisms in the interleukin-1 beta gene - Google Patents

Abstract

Polynucleotides comprising one or more of 4 novel single nucleotide polymorphisms in the human interleukin-1 beta (IL1B) gene are described. Compositions and methods for detecting one or more of these polymorphisms are also disclosed. In addition, various genotypes and haplotypes for the IL1B gene that exist in the population are described.

Description

DRUG TARGET ISOGENES POLYMORPHISMS IN THE INTERLEUKIN- 1 BETA GENE

RELATED APPLICATIONS This application claims the benefit of U S Provisional Application Seπal No 60\ 155,412 filed

September 22, 1999.

FIELD OF THE INVENTION

This invention relates to vaπation in genes that encode pharmaceutically important proteins In particular, this mvention provides genetic vaπants of the human interleukin- 1 beta (ILIB) gene and methods for identifying which vaπant(s) of this gene is/are possessed by an individual

BACKGROUND OF THE INVENTION

Current methods for identifying pharmaceuticals to treat disease often start by identifying, clomng, and expressing an important target protein related to the disease A determination of whether an agomst or antagonist is needed to produce an effect that may benefit a patient with the disease is then made. Then, vast numbers of compounds are screened against the target protem to find new potential drugs The desired outcome of this process is a drug that is specific for the target, thereby reducing the incidence of the undesired side effects usually caused by a compounds activity at non- intended targets.

What this approach fails to consider, however, is that natural variability exists in any and every population with respect to a particular protein A target protein currently used to screen drugs typically is expressed by a gene cloned from an individual who was arbitrarily selected However, the nucleotide sequence of a particular gene may vary tremendously among individuals Subtle alteratιon(s) in the primary nucleotide sequence of a gene encoding a target protein may be manifested as significant vaπation in expression of or in the structure and/or function of the protein Such alterations may explain the relatively high degree of uncertainty inherent m treatment of individuals with drugs whose design is based upon a single representative example of the target For example, it is well-established that some classes of drugs frequently have lower efficacy m some individuals than others, which means such individuals and their physicians must weigh the possible benefit of a larger dosage against a greater πsk of side effects. In addition, vaπable information on the biological function or effects of a particular protein may be due to different scientists unknowingly studying different isoforms of the gene encoding the protein. Thus, information on the type and frequency of genomic vaπation that exists for pharmaceutically important protems would be useful The organization of single nucleotide vaπations (polymorphisms) in the pπmary sequence of a gene into one of the limited number of combinations that exist as units of lnheπtance is termed a haplotype. Each haplotype therefore contams significantly more information than individual unorganized polymorphisms. Haplotypes provide an accurate measurement of the genomic vaπation in the two chromosomes of an individual.

It is well-established that many diseases are associated with specific vaπations in gene sequences. However while there are examples in which individual polymorphisms act as genetic markers for a particular phenotype, in other cases an individual polymorphism may be found in a vaπety of genomic backgrounds and therefore shows no definitive coupling between the polymorphism and the causative site for the phenotype (Clark AG et al 1998 Am J Hum Genet 63:595-612; Ulbrecht M et al. 2000 Am JRespir Crit Care Med 161. 469-74). In addition, the marker may be predictive in some populations, but not m other populations (Clark AG et al. 1998 supra). In these instances, a haplotype will provide a supeπor genetic marker for the phenotype (Clark AG et al. 1998 supra, Ulbrecht M et al. 2000, supra, Ruaήo G & Stephens JC Gen Eng News 19 (21), December 1999)

Analysis of the association between each observed haplotype and a particular phenotype permits ranking of each haplotype by its statistical power of prediction for the phenotype Haplotypes found to be strongly associated with the phenotype can then have that positive association confirmed by alternative methods to minimize false positives. For a gene suspected to be associated with a particular phenotype, if no observed haplotypes for that gene show association with the phenotype of interest, then it may be inferred that vaπation in the gene has little, if any, involvement with that phenotype (Ruano & Stephens 1999, supra). Thus, information on the observed haplotypes and their frequency of occurrence in vaπous population groups will be useful in a vaπety of research and clinical applications

One possible drug target for the treatment of inflammatory and immune disorders is the interleukin- 1 beta (ILIB) gene or its encoded product. ILIB is a promflammatory cytokine produced pπmaπly by mononuclear phagocytes in response to infectious agents ILIB is a major fever-mducing cytokine, which can lead to excessive loss of body weight and a negative nitrogen balance, as well as seizures in children. In combination with other cytokines, ILIB is believed to play a significant role in latter stages of the septic response and m propogating the inflammatory process that causes many of the pathologic and clinical manifestations of rheumatoid arthπtis. ILIB may also be a causative factor in postmenopausal osteoporosis and is believed to be involved in the pathogenesis of inflammatory bowel disease (IBD), msuhn-dependent diabetes melhtus (IDDM), multiple sclerosis, and local osteolytic hypercalcemia (LOH), which is a condition suffered by cancer patients in which cancers have spread to the bone or bone marrow

The gene encoding ILIB, which is also expressed by endothelial cells, B lymphocytes, natural killer cells, fibroblsts, smooth-muscle cells, keratmocytes and g al cells, is part of an IL-1 gene cluster located on the long arm of human chromosome 2 that includes genes encoding interleukin lα (IL-lα), ILIB and the IL-1 receptor antagonist (IL-lRa) (Loughrey et al, Cytokine 10:984-988, 1998). The ILIB gene consists of seven exons, the last six of which encode a precursor ILIB polypeptide of 269 ammo acids, which is believed to be processed into a mature form consisting of the carboxyl-terminal 153 amino acids (Bensi et al., Gene 52:95- 101, 1987; March et al., Nature 315:641-647, 1985). Reference sequences for the ILIB gene (GenBank Accession No M15840.1 ; SEQ ID NO: 1), coding sequence, and protein are shown in Figures 1, 2 and 3, respectively

Two smgle-nucleotide polymorphisms (SNPs) that affect expression of the ILIB gene have been reported. One is a polymorphism of C or T located at -511 in the promoter region. This polymorphism corresponds to nucleotide 343 in Figure 1. The 343T allele has recently been shown to be associated with an increased πsk of both hypochlorhydπa induced by H. pylon and gastπc cancer (El-Omar et al, Nature 2000 Mar 23;404(6776):398-402). H. pylon infection is associated with a vaπety of clinical outcomes including gastπc cancer and duodenal ulcer disease. Individuals with gastπtis predominantly localized to the antrum retain normal (or even high) acid secretion, whereas individuals with extensive corpus gastntis develop hypochlorhydπa and gastnc atrophy, which are presumptive precursors of gastπc cancer The association of the 343T allele with disease may be explained by the biological properties of IL 1 B , which is a powerful inhibitor of gastπc acid secretion. Host genetic factors that affect ILIB may determine why some individuals infected with H pylon develop gastπc cancer while others do not (El-Omar et al., supra)

The second SNP, oπginally identified as a Taql RFLP (Pociot et al., Eur. J Clin Invest 22:396-402, 1992) and now referred to as the +3953 polymorphism, has been reported to constitute a T or C at codon 105 in exon 5 (Kornman et al., J Clin Penodontol. 24:72-77, 1997; Loughrey et al., Cytokine 10.984-988, 1998, Santilla et al., Scand J Immunol 47 195-198, 1998) This information would mdicate to the skilled artisan that the location of the +3953 SNP corresponds to nucleotide 4336

Several groups have reported that certain alleles of one or both of these polymorphisms are associated with increased susceptibility to or increased seventy of vaπous inflammatory-related diseases, including inflammatory bowel disease (Nemetz et al., Immunogenetics 49:527-531 , 1999)1, early-onset penodontitis (Diehl et al., J Penodontol 70.418-430, 1999); the skm disease alopecia areata (Galbraith et al., Hum Hered 49:85-89, 1999); multiple sclerosis (Schπjver et al., Neurology 52.595-599, 1999); tuberculosis (Wilkinson et al.. J Exp Med 189- 1863-1874, 1999), diabetic nephropathy (Loughrey et al., Cytokine 10 984-988, 1998); erosive disease in rheumatoid arthπtis patients (Cantagrel et al., Arthritis & Rheumatism 42.1093-1 100, 1999); and Epstein-Barr virus (EBV) infection (Hurme et al., Scand J Immunol 48:219-222, 1998).

Because of the potential for polymorphisms in the ILIB gene to affect the expression and function of the encoded protein, it would be useful to determine whether additional polymorphisms exist in the ILIB gene, as well as how such polymorphisms are combined in different copies of the gene. Such information would be useful for studying the biological function of ILIB as well as m identifying drugs targeting this protein for the treatment of disorders related to its abnormal expression or function

SUMMARY OF THE INVENTION Accordingly, the inventors herein have discovered 4 novel polymorphic sites m the ILIB gene These polymorphic sites (PS) correspond to the following nucleotide positions in the indicated GenBank Accession Number 346 (PS2), 4259 (PS3), 6421 (PS5) and 6883 (PS6) in M15840 1 The polymorphisms at these sites are ademne or thymme at PS2, guamne or ademne at PS3, ademne or guamne at PS5 and cytosine or ademne at PS6 In addition, the inventors have determined the identity of the alternative nucleotides present at these sites, as well as at the previously identified sites at nucleotides 343 (PSI) and 4336 (PS4), in a human reference population of 79 unrelated individuals self-identified as belonging to one of four major population groups African descent. Asian. Caucasian and Hispanic/Latino It is believed that ILlB-encoding polynucleotides contaimng one or more of the novel polymorphic sites reported herein will be useful in studying the expression and biological function of ILIB, as well as in developing drugs targeting this protein In addition, information on the combinations of polymorphisms in the ILIB gene may have diagnostic and forensic applications Thus, in one embodiment, the invention provides an isolated polynucleotide compnsmg a nucleotide sequence which is a polymorphic vaπant of a reference sequence for the ILIB gene or a fragment thereof. The reference sequence compπses SEQ ID NO 1 and the polymorphic vanant compnses at least one polymoφhism selected from the group consisting of thymine at PS2, ademne at PS3, guamne at PS5 and ademne at PS6 In a prefeπed embodiment, the polymoφhic vaπant compπses one or both additional polymoφhisms selected from the group consisting of thymine at PSI and thymine at PS4 A particularly preferred polymoφhic vaπant is a naturally-occurnng isoform (also refeπed to herein as an "isogene") of the ILIB gene An ILIB isogene of the mvention compπses cytosme or thymme at PS 1 , ademne or thymine at PS2, guamne or ademne at PS3, cytosine or thymine at PS4, ademne or guamne at PS5 and cytosine or ademne at PS6 The invention also provides a collection of ILIB isogenes, referred to herein as an ILIB genome anthology

An ILIB isogene may be defined by the combination and order of these polymoφhisms m the isogene, which is referred to herein as an ILIB haplotype Thus, the invention also provides data on the number of different ILIB haplotypes found m the above four population groups This haplotype data is useful in methods for deπving an ILIB haplotype from an individual's genotype for the ILIB gene and for determining an association between an ILIB haplotype and a particular trait

Polynucleotides complementary to these ILIB genomic DNA vaπants are also provided by the invention In other embodiments, the invention provides a recombmant expression vector compπsmg one of the polymoφhic genomic vaπants operably linked to expression regulatory elements as well as a recombinant host cell transformed or transfected with the expression vector. The recombmant vector and host cell may be used to express ILIB for protem structure analysis and drug binding studies

In other embodiments, the invention provides methods, compositions, and kits for haplotyping and/or genotyping the ILIB gene in an individual. The methods involve identifying the nucleotide or nucleotide pair present at one or more polymoφhic sites selected from PS2, PS3, PS5, and PS6 in one or both copies of the ILIB gene from the individual. The compositions contain o gonucleotide probes and pnmers designed to specifically hybπdize to one or more target regions containmg, or that are adjacent to, a polymoφhic site The methods and compositions for establishing the genotype or haplotype of an individual at the novel polymoφhic sites descπbed herein are useful for studying the effect of the polymoφhisms in the etiology of diseases affected by the expression and function of the ILIB protein, studying the efficacy of drugs targeting ILIB, predictmg individual susceptibility to diseases affected by the expression and function of the ILIB protein and predicting individual responsiveness to drugs targeting ILIB

In yet another embodiment, the invention provides a method for identifying an association between a genotype or haplotype and a trait. In prefeπed embodiments, the trait is susceptibility to a disease, seventy of a disease, the staging of a disease or response to a drug Such methods have applicability m developing diagnostic tests and therapeutic treatments for inflammatory and immune disorders.

The present invention also provides transgenic animals compnsmg one of the ILIB genomic polymoφhic vanants descπbed herein and methods for producing such animals. The transgemc animals are useful for studying expression of the ILIB isogenes in vivo, for in vivo screening and testing of drugs targeted against ILIB protein, and for testing the efficacy of therapeutic agents and compounds for inflammatory and immune disorders m a biological system

The present invention also provides a computer system for stonng and displaying polymoφhism data determined for the ILIB gene. The computer system compnses a computer processing unit; a display; and a database contaimng the polymoφhism data. The polymoφhism data includes the polymoφhisms, the genotypes and the haplotypes identified for the ILIB gene in a reference population. In a preferred embodiment, the computer system is capable of producing a display showing ILIB haplotypes orgamzed according to their evolutionary relationships

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 illustrates a reference sequence for the ILIB gene (Genbank Version Number M 15840.1; contiguous lines; SEQ ID NO:l), with the start and stop positions of each region of coding sequence indicated below the sequence by the numbers within the brackets and the polymoφhic sites and polymoφhisms identified by Applicants in a reference population indicated by the vanant nucleotide positioned below the polymoφhic site in the sequence Figure 2 illustrates a reference sequence for the ILIB coding sequence (contiguous lines; SEQ ID NO:2), with the polymoφhic sites and polymoφhisms identified by Applicants in a reference population indicated by the variant nucleotide positioned below the polymoφhic site in the sequence.

Figure 3 illustrates a reference sequence for the ILIB protein (contiguous lines; SEQ ID NO:3).

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is based on the discovery of novel variants of the ILIB gene. As described in more detail below, the inventors herein discovered 4 novel polymoφhic sites by characterizing the ILIB gene found in genomic DNAs isolated from an Index Repository that contains immortalized cell lines from one chimpanzee and 93 human individuals. The human individuals included a reference population of 79 unrelated individuals self-identified as belonging to one of four major population groups: Caucasian (22 individuals), African descent (20 individuals) Asian (20 individuals) Hispanic/Latino (17 individuals). To the extent possible, the members of this reference population were organized into population subgroups by the self-identified ethnogeographic origin of their four grandparents as shown in Table 1 below.

Table 1. Population Groups in the Index Repository

In addition, the Index Repository contains three unrelated indigenous American Indians (one from each of North, Central and South America), one three-generation Caucasian family (from the CEPH Utah cohort) and one two-generation African-American family.

Using the ILIB genotypes identified in the Index Repository and the methodology described in the Examples below, the inventors herein also determined the haplotypes found on each chromosome for most human members of this repository. The ILIB genotypes and haplotypes found in the repository include those shown in Tables 3 and 4, respectively. The polymoφhism and haplotype data disclosed herein are useful for studying population diversity, anthropological lineage, the significance of diversity and lineage at the phenotypic level, paternity testing, forensic applications, and for identifying associations between the ILIB genetic variation and a trait such as level of drug response or susceptibility to disease.

In the context of this disclosure, the following terms shall be defined as follows unless otherwise indicated:

Allele - A particular form of a genetic locus, distinguished from other forms by its particular nucleotide sequence. Candidate Gene - A gene which is hypothesized to be responsible for a disease, condition, or the response to a treatment, or to be coπelated with one of these.

Gene - A segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression. Genotype - An unphased 5 ^' to 3 ^' sequence of nucleotide pair(s) found at one or more polymoφhic sites in a locus on a pair of homologous chromosomes in an individual. As used herein, genotype includes a full-genotype and/or a sub-genotype as described below.

Full-genotype - The unphased 5 ^' to 3 ' sequence of nucleotide pairs found at all known polymoφhic sites in a locus on a pair of homologous chromosomes in a single individual. Sub-genotype - The unphased 5 ' to 3 ' sequence of nucleotides seen at a subset of the known polymoφhic sites in a locus on a pair of homologous chromosomes in a single individual.

Genotyping - A process for determining a genotype of an individual.

Haplotype - A 5 ' to 3 ^' sequence of nucleotides found at one or more polymoφhic sites in a locus on a single chromosome from a single individual. As used herein, haplotype includes a full- haplotype and/or a sub-haplotype as described below.

Full-haplotype - The 5 ' to 3 ' sequence of nucleotides found at all known polymoφhic sites in a locus on a single chromosome from a single individual.

Sub-haplotype - The 5 ' to 3 ' sequence of nucleotides seen at a subset of the known polymoφhic sites in a locus on a single chromosome from a single individual. Haplotype pair - The two haplotypes found for a locus in a single individual.

Haplotyping - A process for determining one or more haplotypes in an individual and includes use of family pedigrees, molecular techniques and/or statistical inference.

Haplotype data - Information concerning one or more of the following for a specific gene: a listing of the haplotype pairs in each individual m a population, a listing of the different haplotypes in a population; frequency of each haplotype m that or other populations, and any known associations between one or more haplotypes and a trait.

Isoform - A particular form of a gene, mRNA, cDNA or the protein encoded thereby, distinguished from other forms by its particular sequence and/or structure.

Isogene - One of the isoforms of a gene found in a population. An isogene contains all of the polymoφhisms present in the particular isoform of the gene. Isolated - As applied to a biological molecule such as RNA, DNA, ohgonucleotide, or protein, isolated means the molecule is substantially free of other biological molecules such as nucleic acids, proteins, lipids, carbohydrates, or other mateπal such as cellular debns and growth media Generally, the term "isolated" is not mtended to refer to a complete absence of such mateπal or to absence of water, buffers, or salts, unless they are present in amounts that substantially interfere with the methods of the present invention

Locus - A location on a chromosome or DNA molecule coπesponding to a gene or a physical or phenotypic feature.

Naturally-occurring - A term used to designate that the object it is applied to, e.g., naturally- occurring polynucleotide or polypeptide, can be isolated from a source in nature and which has not been intentionally modified by man.

Nucleotide pair - The nucleotides found at a polymoφhic site on the two copies of a chromosome from an individual.

Phased - As applied to a sequence of nucleotide pairs for two or more polymoφhic sites in a locus, phased means the combination of nucleotides present at those polymoφhic sites on a smgle copy of the locus is known

Polymorphic site (PS) - A position within a locus at which at least two alternative sequences are found in a population, the most frequent of which has a frequency of no more than 99%

Polymorphic variant - A gene, mRNA, cDNA, polypeptide or peptide whose nucleotide or amino acid sequence vanes from a reference sequence due to the presence of a polymoφhism m the gene

Polymorphism - The sequence vanation observed m an individual at a polymoφhic site Polymoφhisms include nucleotide substitutions, insertions, deletions and microsatellites and may, but need not, result in detectable differences in gene expression or protein function.

Polymorphism data - Information concerning one or more of the following for a specific gene, location of polymoφhic sites; sequence vanation at those sites; frequency of polymoφhisms in one or more populations; the different genotypes and/or haplotypes determined for the gene; frequency of one or more of these genotypes and/or haplotypes in one or more populations; any known association(s) between a trait and a genotype or a haplotype for the gene.

Polymorphism Database - A collection of polymoφhism data arranged in a systematic or methodical way and capable of being individually accessed by electronic or other means. Polynucleotide - A nucleic acid molecule comprised of single-stranded RNA or DNA or comprised of complementary, double-stranded DNA.

Population Group - A group of individuals sharing a common ethnogeographic origin.

Reference Population - A group of subjects or individuals who are predicted to be representative of the genetic variation found in the general population. Typically, the reference population represents the genetic variation in the population at a certainty level of at least 85%, preferably at least 90%, more preferably at least 95% and even more preferably at least 99%.

Single Nucleotide Polymorphism (SNP) - Typically, the specific pair of nucleotides observed at a single polymoφhic site. In rare cases, three or four nucleotides may be found.

Subject - A human individual whose genotypes or haplotypes or response to treatment or disease state are to be determined.

Treatment - A stimulus administered internally or externally to a subject.

Unphased - As applied to a sequence of nucleotide pairs for two or more polymoφhic sites in a locus, unphased means the combination of nucleotides present at those polymoφhic sites on a single copy of the locus is not known. The inventors herein have discovered 4 novel polymoφhic sites in the ILIB gene. The polymoφhic sites identified by the inventors are referred to as PS 1 -6 to designate the order in which they are located in the gene (see Table 2 below), with the novel polymoφhic sites refeπed to as PS2, PS3, PS5, and PSό.

Thus, in one embodiment, the invention provides an isolated polynucleotide comprising a polymoφhic variant of the ILIB gene or a fragment of the gene which contains at least one of the novel polymoφhic sites described herein. The nucleotide sequence of a variant ILIB gene is identical to the reference genomic sequence for those portions of the gene examined, as described in the Examples below, except that it comprises a different nucleotide at one or more of the novel polymoφhic sites PS2, PS3, PS5, and PS6, and may also comprise one or both additional polymoφhisms selected from the group consisting of thymine at PSI and thymine at PS4. Similarly, the nucleotide sequence of a variant fragment of the ILIB gene is identical to the coπesponding portion of the reference sequence except for having a different nucleotide at one or more of the novel polymoφhic sites described herein. Thus, the invention specifically does not include polynucleotides comprising a nucleotide sequence identical to the reference sequence (or other reported ILIB sequences) or to portions of the reference sequence (or other reported ILIB sequences), except for genotyping oligonucleotides as described below. The location of a polymoφhism in a vaπant gene or fragment is identified by aligning its sequence against SEQ ID NO: l. The polymoφhism is selected from the group consisting of thymme at PS2, ademne at PS3, guamne at PS5 and ademne at PS6. In a prefeπed embodiment, the polymoφhic vanant compnses a naturally-occurπng isogene of the ILIB gene which is defined by any one of haplotypes 1-11 shown in Table 4 below.

Polymoφhic vaπants of the invention may be prepared by isolating a clone containing the ILIB gene from a human genomic library. The clone may be sequenced to determine the identity of the nucleotides at the polymoφhic sites descnbed herein. Any particular vanant claimed herein could be prepared from this clone by performing in vitro mutagenesis using procedures well-known in the art.

ILIB isogenes may be isolated using any method that allows separation of the two "copies" of the ILIB gene present in an individual, which, as readily understood by the skilled artisan, may be the same allele or different alleles. Separation methods include targeted in vivo cloning (TIVC) in yeast as descπbed m WO 98/01573, U.S. Patent No. 5,866,404, and U.S. Patent No. 5,972,614 Another method, which is descπbed in U.S. Patent No. 5,972,614, uses an allele specific ohgonucleotide in combination with pnmer extension and exonuclease degradation to generate hemizygous DNA targets. Yet other methods are single molecule dilution (SMD) as descnbed in Ruaήo et al., Proc. Natl. Acad. Sci. 87 6296-6300, 1990; and allele specific PCR (Ruaήo et al., 17 Nucleic Acids. Res. 8392, 1989, Ruano et al., 19 Nucleic Acids Res. 6877-6882, 1991; Michalatos-Beloin et al., 24 Nucleic Acids Res. 4841-4843, 1996).

The invention also provides ILIB genome anthologies, which are collections of ILIB isogenes found in a given population. The population may be any group of at least two individuals, including but not limited to a reference population, a population group, a family population, a clinical population, and a same sex population. An ILIB genome anthology may compnse individual ILIB isogenes stored in separate containers such as microtest tubes, separate wells of a microtitre plate and the like Alternatively, two or more groups of the ILIB isogenes in the anthology may be stored in separate containers. Individual isogenes or groups of isogenes in a genome anthology may be stored m any convenient and stable form, including but not limited to in buffered solutions, as DNA precipitates, freeze-dπed preparations and the like. A prefeπed ILIB genome anthology of the invention compπses a set of isogenes defined by the haplotypes shown m Table 4 below.

An isolated polynucleotide contaimng a polymoφhic vaπant nucleotide sequence of the invention may be operably linked to one or more expression regulatory elements in a recombinant expression vector capable of being propagated and expressmg the encoded ILIB protein in a prokaryotic or a eukaryotic host cell. Examples of expression regulatory elements which may be used include, but are not limited to, the lac system, operator and promoter regions of phage lambda, yeast promoters, and promoters denved from vaccima virus, adenovirus, retroviruses, or SV40. Other regulatory elements include, but are not limited to, appropnate leader sequences, termination codons, polyadenylation signals, and other sequences required for the appropπate transcπption and subsequent translation of the nucleic acid sequence m a given host cell Of course, the coπect combinations of expression regulatory elements will depend on the host system used. In addition, it is understood that the expression vector contains any additional elements necessary for its transfer to and subsequent replication in the host cell. Examples of such elements include, but are not limited to, oπgms of replication and selectable markers. Such expression vectors are commercially available or are readily constructed using methods known to those m the art (e.g., F Ausubel et al., 1987, in "Current Protocols in Molecular Biology", John Wiley and Sons, New York, New York). Host cells which may be used to express the vanant ILIB sequences of the invention include, but are not limited to, eukaryotic and mammalian cells, such as animal, plant, insect and yeast cells, and prokaryotic cells, such as E. coli, or algal cells as known in the art The recombinant expression vector may be introduced into the host cell using any method known to those in the art including, but not limited to, microinjection, electroporation, particle bombardment, transduction, and transfection using DEAE- dextran, hpofection, or calcium phosphate (see e g , Sambrook et al. (1989) in "Molecular Clonmg. A Laboratory Manual", Cold Spπng Harbor Press, Plainview, New York). In a prefeπed aspect, eukaryotic expression vectors that function in eukaryotic cells, and preferably mammalian cells, are used. Non-limiting examples of such vectors include vaccinia virus vectors, adenovirus vectors, heφes virus vectors, and baculovirus transfer vectors. Prefeπed eukaryotic cell lines include COS cells, CHO cells, HeLa cells, NIH/3T3 cells, and embryonic stem cells (Thomson, J. A. et al., 1998 Science 282: 1145-1147). Particularly prefeπed host cells are mammalian cells.

Genomic DNA fragments of the invention compπse at least one novel polymoφhic site identified herein and have a length of at least 10 nucleotides and may range up to the full length of the gene Preferably, a fragment according to the present invention is between 100 and 3000 nucleotides in length, and more preferably between 200 and 2000 nucleotides m length, and most preferably between 500 and 1000 nucleotides in length.

In descnbing the polymoφhic sites identified herein, reference is made to the sense strand of the gene for convenience. However, as recognized by the skilled artisan, nucleic acid molecules contaimng the ILIB gene may be complementary double stranded molecules and thus reference to a particular site on the sense strand refers as well to the coπesponding site on the complementary antisense strand. Thus, reference may be made to the same polymoφhic site on either strand and an ohgonucleotide may be designed to hybπdize specifically to either strand at a target region contaimng the polymoφhic site. Thus, the invention also includes single-stranded polynucleotides which are complementary to the sense strand of the ILIB genomic vaπants descnbed herem. Polynucleotides compnsmg a polymoφhic gene vanant or fragment may be useful for therapeutic puφoses. For example, where a patient could benefit from expression, or increased expression, of a particular ILIB protein isoform, an expression vector encoding the isoform may be administered to the patient. The patient may be one who lacks the ILIB isogene encoding that isoform or may already have at least one copy of that isogene.

In other situations, it may be desirable to decrease or block expression of a particular ILIB isogene. Expression of an ILIB isogene may be turned off by transforming a targeted organ, tissue or cell population with an expression vector that expresses high levels of untranslatable mRNA for the isogene. Alternatively, oligonucleotides directed against the regulatory regions (e.g., promoter, introns, enhancers, 3' untranslated region) of the isogene may block transcription. Oligonucleotides targeting the transcription initiation site, e.g., between positions -10 and +10 from the start site are prefeπed. Similarly, inhibition of transcription can be achieved using oligonucleotides that base-pair with region(s) of the isogene DNA to form triplex DNA (see e.g., Gee et al. in Huber, B.E. and B.I. Can, Molecular and Immunologic Approaches. Futura Publishing Co., Mt. Kisco, N.Y., 1994). Antisense oligonucleotides may also be designed to block translation of ILIB mRNA transcribed from a particular isogene. It is also contemplated that ribozymes may be designed that can catalyze the specific cleavage of ILIB mRNA transcribed from a particular isogene.

The oligonucleotides may be delivered to a target cell or tissue by expression from a vector introduced into the cell or tissue in vivo or ex vivo. Alternatively, the oligonucleotides may be formulated as a pharmaceutical composition for administration to the patient. Oligoribonucleotides and/or oligodeoxynucleotides intended for use as antisense oligonucleotides may be modified to increase stability and half-life. Possible modifications include, but are not limited to phosphorothioate or 2 ' O-methyl linkages, and the inclusion of nontraditional bases such as inosine and queosine, as well as acetyl-, methyl-, thio-, and similarly modified forms of adenine, cytosine, guamne, thymine, and uracil which are not as easily recognized by endogenous nucleases.

Effect(s) of the polymoφhisms identified herein on expression of ILIB may be investigated by preparing recombinant cells and/or organisms, preferably recombinant animals, containing a polymoφhic variant of the ILIB gene. As used herein, "expression" includes but is not limited to one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into ILIB protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function. To prepare a recombinant cell of the invention, the desired ILIB isogene may be introduced into the cell in a vector such that the isogene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location. In a preferred embodiment, the ILIB isogene is introduced into a cell in such a way that it recombines with the endogenous ILIB gene present in the cell. Such recombination requires the occuπence of a double recombination event, thereby resulting in the desired ILIB gene polymoφhism. Vectors for the introduction of genes both for recombination and for extrachromosomal maintenance are known in the art, and any suitable vector or vector construct may be used in the invention. Methods such as electroporation, particle bombardment, calcium phosphate co-precipitation and viral transduction for introducing DNA into cells are known in the art; therefore, the choice of method may lie with the competence and preference of the skilled practitioner. Examples of cells into which the ILIB isogene may be introduced include, but are not limited to, continuous culture cells, such as COS, NIH/3T3, and primary or culture cells of the relevant tissue type, i.e., they express the ILIB isogene. Such recombinant cells can be used to compare the biological activities of the different protein variants.

Recombinant organisms, i.e., transgenic animals, expressing a variant ILIB gene are prepared using standard procedures known in the art. Preferably, a construct comprising the variant gene is introduced into a nonhuman animal or an ancestor of the animal at an embryonic stage, i.e., the one- cell stage, or generally not later than about the eight-cell stage. Transgenic animals carrying the constructs of the invention can be made by several methods known to those having skill in the art. One method involves transfecting into the embryo a retrovirus constructed to contain one or more insulator elements, a gene or genes of interest, and other components known to those skilled in the art to provide a complete shuttle vector harboring the insulated gene(s) as a transgene, see e.g., U.S. Patent No. 5,610,053. Another method involves directly injecting a transgene into the embryo. A third method involves the use of embryonic stem cells. Examples of animals into which the ILIB isogenes may be introduced include, but are not limited to, mice, rats, other rodents, and nonhuman primates (see "The Introduction of Foreign Genes into Mice" and the cited references therein, In:

Recombinant DNA, Eds. J.D. Watson, M. Gilman, J. Witkowski, and M. Zoller; W.H. Freeman and Company, New York, pages 254-272). Transgenic animals stably expressing a human ILIB isogene and producing human ILIB protein can be used as biological models for studying diseases related to abnormal ILIB expression and/or activity, and for screening and assaying various candidate drugs, compounds, and treatment regimens to reduce the symptoms or effects of these diseases.

An additional embodiment of the invention relates to pharmaceutical compositions for treating disorders affected by expression or function of a novel ILIB isogene described herein. The pharmaceutical composition may comprise any of the following active ingredients: a polynucleotide comprising one of these novel ILIB isogenes; an antisense oligonucleotide directed against one of the novel ILIB isogenes, a polynucleotide encoding such an antisense oligonucleotide, or another compound which inhibits expression of a novel ILIB isogene described herein. Preferably, the composition contains the active ingredient in a therapeutically effective amount. By therapeutically effective amount is meant that one or more of the symptoms relating to disorders affected by expression or function of a novel ILIB isogene is reduced and/or eliminated. The composition also comprises a pharmaceutically acceptable carrier, examples of which include, but are not limited to, saline, buffered saline, dextrose, and water. Those skilled in the art may employ a formulation most suitable for the active ingredient, whether it is a polynucleotide, oligonucleotide, protein, peptide or small molecule antagonist. The pharmaceutical composition may be administered alone or in combination with at least one other agent, such as a stabilizing compound. Administration of the pharmaceutical composition may be by any number of routes including, but not limited to oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, intradermal, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, PA).

For any composition, determination of the therapeutically effective dose of active ingredient and/or the appropriate route of administration is well within the capability of those skilled in the art. For example, the dose can be estimated initially either in cell culture assays or in animal models. The animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans. The exact dosage will be determined by the practitioner, in light of factors relating to the patient requiring treatment, including but not limited to severity of the disease state, general health, age, weight and gender of the patient, diet, time and frequency of administration, other drugs being taken by the patient, and tolerance/response to the treatment.

Information on the identity of genotypes and haplotypes for the ILIB gene of any particular individual as well as the frequency of such genotypes and haplotypes in any particular population of individuals is expected to be useful for a variety of basic research and clinical applications. Thus, the invention also provides compositions and methods for detecting the novel ILIB polymoφhisms identified herein.

The compositions comprise at least one ILIB genotyping oligonucleotide. In one embodiment, an ILIB genotyping oligonucleotide is a probe or primer capable of hybridizing to a target region that is located close to, or that contains, one of the novel polymoφhic sites described herein. As used herein, the term "oligonucleotide" refers to a polynucleotide molecule having less than about 100 nucleotides. A prefeπed oligonucleotide of the invention is 10 to 35 nucleotides long. More preferably, the oligonucleotide is between 15 and 30, and most preferably, between 20 and 25 nucleotides in length. The oligonucleotide may be comprised of any phosphorylation state of ribonucleotides, deoxyribonucleotides, and acyclic nucleotide derivatives, and other functionally equivalent derivatives. Alternatively, oligonucleotides may have a phosphate-free backbone, which may be comprised of linkages such as carboxymethyl, acetamidate, carbamate, polyamide (peptide nucleic acid (PNA)) and the like (Varma, R. in Molecular Biology and Biotechnology, A Comprehensive Desk Reference, Ed. R. Meyers, VCH Publishers, Inc. (1995), pages 617-620). Oligonucleotides of the invention may be prepared by chemical synthesis using any suitable methodology known in the art, or may be derived from a biological sample, for example, by restriction digestion. The oligonucleotides may be labeled, according to any technique known in the art, including use of radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags and the like.

Genotyping oligonucleotides of the invention must be capable of specifically hybridizing to a target region of an ILIB polynucleotide, i.e., an ILIB isogene. As used herein, specific hybridization means the oligonucleotide forms an anti-parallel double-stranded structure with the target region under certain hybridizing conditions, while failing to form such a structure when incubated with a non-target region or a non-ILIB polynucleotide under the same hybridizing conditions. Preferably, the oligonucleotide specifically hybridizes to the target region under conventional high stringency conditions. The skilled artisan can readily design and test oligonucleotide probes and primers suitable for detecting polymoφhisms in the ILIB gene using the polymoφhism information provided herein in conjunction with the known sequence information for the ILIB gene and routine techniques.

A nucleic acid molecule such as an oligonucleotide or polynucleotide is said to be a "perfect" or "complete" complement of another nucleic acid molecule if every nucleotide of one of the molecules is complementary to the nucleotide at the coπesponding position of the other molecule. A nucleic acid molecule is "substantially complementary" to another molecule if it hybridizes to that molecule with sufficient stability to remain in a duplex form under conventional low-stringency conditions. Conventional hybridization conditions are described, for example, by Sambrook J. et al., in Molecular Cloning, A Laboratory Manual, 2^nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989) and by Haymes, B.D. et al. in Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985). While perfectly complementary oligonucleotides are prefeπed for detecting polymoφhisms, departures from complete complementarity are contemplated where such departures do not prevent the molecule from specifically hybridizing to the target region. For example, an oligonucleotide primer may have a non-complementary fragment at its 5 ' end, with the remainder of the primer being complementary to the target region. Alternatively, non-complementary nucleotides may be interspersed into the oligonucleotide probe or primer as long as the resulting probe or primer is still capable of specifically hybridizing to the target region.

Prefeπed genotyping oligonucleotides of the invention are allele-specific oligonucleotides. As used herein, the term allele-specific oligonucleotide (ASO) means an oligonucleotide that is able, under sufficiently stringent conditions, to hybridize specifically to one allele of a gene, or other locus, at a target region containing a polymoφhic site while not hybridizing to the coπesponding region in another allele(s). As understood by the skilled artisan, allele- specificity will depend upon a variety of readily optimized stringency conditions, including salt and formamide concentrations, as well as temperatures for both the hybridization and washing steps. Examples of hybridization and washing conditions typically used for ASO probes are found in Kogan et al., "Genetic Prediction of Hemophilia A" in PCR Protocols, A Guide to Methods and Applications, Academic Press, 1990 and Ruano et al., 87 Proc Natl Acad Sci USA 6296-6300, 1990 Typically, an allele-specific ohgonucleotide will be perfectly complementary to one allele while containing a single mismatch for another allele

Allele-specific oligonucleotide probes which usually provide good discrimination between different alleles are those in which a central position of the oligonucleotide probe aligns with the polymoφhic site in the target region (e g , approximately the 7^th or 8^th position in a 15 mer, the 8 or 9^th position in a 16mer, the 10^th or 11^th position m a 20 mer) A prefeπed ASO probe for detecting ILIB gene polymoφhisms compnses a nucleotide sequence, listed 5' to 3 , selected from the group consistmg of

AAGCCATAAAAACAG (SEQ ID NO: :4) and its complement, AAGCCATTAAAACAG (SEQ ID NO: :5) and its complement, TTTTGCCGCCTCGCC (SEQ ID NO: :6) and its complement, TTTTGCCACCTCGCC (SEQ ID NO: :7) and its complement, TTCACAC GAAAGTT (SEQ ID NO: :8) and its complement, TTCACACGGAAAGTT (SEQ ID NO: :9) and its complement, GCCTGGACTTTCCTG (SEQ ID NO: :10) and ts complement, and GCCTGGAATTTCCTG (SEQ ID NO: :11⁾ and its complement.

An allele-specific ohgonucleotide pnmer of the invention has a 3 terminal nucleotide, or preferably a 3 penultimate nucleotide, that is complementary to only one nucleotide of a particular SNP, thereby acting as a pπmer for polymerase-mediated extension only if the allele contaimng that nucleotide is present Allele-specific o gonucleotide primers hybπdizing to either the coding or noncoding strand are contemplated by the invention A prefeπed ASO pnmer for detecting ILIB gene polymoφhisms compnses a nucleotide sequence, listed 5 to 3', selected from the group consisting of

TTTTGAAAGCCATAA (SEQ ID NO: :12) CCCTCGCTGTTTTTA (SEQ ID NO: :13) TTTTGAAAGCCATTA (SEQ ID NO: :14) CCCTCGCTGTTTTAA (SEQ ID NO: :15) ATCAAATTTTGCCGC (SEQ ID NO: :16) TCGTGAGGCGAGGCG (SEQ ID NO: :17) ATCAAATTTTGCCAC (SEQ ID NO: :18) TCGTGAGGCGAGGTG (SEQ ID NO: :19) AATAAATTCACACAG (SEQ ID NO: :20) GGGCCCAACTTTCTG (SEQ ID NO: :21) AATAAATTCACACGG (SEQ ID NO:22) GGGCCCAACTTTCCG (SEQ ID NO: :23) GCTATAGCCTGGACT (SEQ ID NO:24) AGACAACAGGAAAGT (SEQ ID NO: :25) GCTATAGCCTGGAAT (SEQ ID NO:26) and AGACAACAGGAAATT (SEQ ID NO 27 )

Other genotyping oligonucleotides of the mvention hybndize to a target region located one to several nucleotides downstream of one of the novel polymoφhic sites identified herein Such oligonucleotides are useful in polymerase-mediated pπmer extension methods for detecting one of the novel polymoφhisms descπbed herein and therefore such genotyping oligonucleotides are refeπed to herein as "pπmer-extension oligonucleotides" In a prefeπed embodiment, the 3 -terminus of a pπmer-extension oligonucleotide is a deoxynucleotide complementary to the nucleotide located immediately adjacent to the polymoφhic site A particularly prefeπed ohgonucleotide pπmer for detectmg ILIB gene polymoφhisms by pπmer extension terminates in a nucleotide sequence, listed 5' to 3', selected from the group consistmg of

TGAAAGCCAT (SEQ ID NO:28); TCGCTGTTTT (SEQ ID NO:29) ; AAATTTTGCC (SEQ ID NO:30); TGAGGCGAGG (SEQ ID NO:31) ; AAATTCACAC (SEQ ID NO:32); CCCAACTTTC (SEQ ID NO:33); ATAGCCTGGA (SEQ ID NO:34); and CAACAGGAAA (SEQ ID NO:35).

In some embodiments, a composition contains two or more differently labeled genotyping oligonucleotides for simultaneously probing the identity of nucleotides at two or more polymoφhic sites It is also contemplated that pnmer compositions may contain two or more sets of allele-specific pnmer pairs to allow simultaneous targeting and amplification of two or more regions contaimng a polymoφhic site

ILIB genotyping oligonucleotides of the invention may also be immobilized on or synthesized on a solid surface such as a microchip, bead, or glass slide (see, e g , WO 98/20020 and WO

98/20019) Such immobilized genotyping oligonucleotides may be used in a vanety of polymoφhism detection assays, including but not limited to probe hybndization and polymerase extension assays Immobilized ILIB genotyping oligonucleotides of the invention may compnse an ordered aπay of oligonucleotides designed to rapidly screen a DNA sample for polymoφhisms in multiple genes at the same time

In another embodiment, the mvention provides a kit compnsmg at least two genotyping oligonucleotides packaged in separate containers The kit may also contain other components such as hybndization buffer (where the oligonucleotides are to be used as a probe) packaged in a separate container Alternatively, where the oligonucleotides are to be used to amplify a target region, the kit may contain, packaged in separate containers, a polymerase and a reaction buffer optimized for pπmer extension mediated by the polymerase, such as PCR

The above descπbed ohgonucleotide compositions and kits are useful in methods for genotyping and/or haplotyping the ILIB gene in an individual As used herein, the terms "ILIB genotype" and "ILIB haplotype" mean the genotype or haplotype contains the nucleotide pair or nucleotide, respectively, that is present at one or more of the novel polymoφhic sites descπbed herein and may optionally also include the nucleotide pair or nucleotide present at one or more additional polymoφhic sites in the ILIB gene The additional polymoφhic sites may be cuπently known polymoφhic sites or sites that are subsequently discovered

One embodiment of the genotyping method involves isolating from the individual a nucleic acid mixture compnsmg the two copies of the ILIB gene, or a fragment thereof, that are present in the individual, and determining the identity of the nucleotide pair at one or more of the polymoφhic sites selected from PS2, PS3, PS5, and PS6 m the two copies to assign an ILIB genotype to the individual As will be readily understood by the skilled artisan, the two "copies" of a gene in an individual may be the same allele or may be different alleles In a prefeπed embodiment of the genotyping method, the identity of the nucleotide pair atone or more of the polymoφhic sites selected from the group consisting of PSI and PS4 is also determined In a particularly prefeπed embodiment, the genotyping method compπses determining the identity of the nucleotide pair at each of PS 1-6 Typically, the nucleic acid mixture is isolated from a biological sample taken from the individual, such as a blood sample or tissue sample. Suitable tissue samples include whole blood, semen saliva, tears, urine, fecal material, sweat, buccal, skin and hair. The nucleic acid mixture may be comprised of genomic DNA, mRNA, or cDNA and, in the latter two cases, the biological sample must be obtained from an organ in which the ILIB gene is expressed. Furthermore it will be understood by the skilled artisan that mRNA or cDNA preparations would not be used to detect polymoφhisms located in introns or in 5 ^' and 3' nontranscribed regions. If an ILIB gene fragment is isolated, it must contain the polymoφhic site(s) to be genotyped.

One embodiment of the haplotyping method comprises isolating from the individual a nucleic acid molecule containing only one of the two copies of the ILIB gene, or a fragment thereof, that is present in the individual and determining in that copy the identity of the nucleotide at one or more of the polymoφhic sites PS2, PS3, PS5, and PS6 in that copy to assign an ILIB haplotype to the individual. The nucleic acid may be isolated using any method capable of separating the two copies of the ILIB gene or fragment such as one of the methods described above for preparing ILIB isogenes, with targeted in vivo cloning being the prefeπed approach. As will be readily appreciated by those skilled in the art, any individual clone will only provide haplotype information on one of the two ILIB gene copies present in an individual. If haplotype information is desired for the individual's other copy, additional ILIB clones will need to be examined. Typically, at least five clones should be examined to have more than a 90% probability of haplotyping both copies of the ILIB gene in an individual. In some embodiments, the haplotyping method also comprises identifying the nucleotide at one or both of the polymoφhic sites PSI and PS4. In a particularly prefeπed embodiment, the nucleotide at each of PS 1-6 is identified.

In a prefeπed embodiment, an ILIB haplotype pair is determined for an individual by identifying the phased sequence of nucleotides at one or more of the polymoφhic sites selected from PS2, PS3, PS5, and PS6 in each copy of the ILIB gene that is present in the individual. In a particularly prefeπed embodiment, the haplotyping method comprises identifying the phased sequence of nucleotides at each of PS 1-6 in each copy of the ILIB gene. When haplotyping both copies of the gene, the identifying step is preferably performed with each copy of the gene being placed in separate containers. However, it is also envisioned that if the two copies are labeled with different tags, or are otherwise separately distinguishable or identifiable, it could be possible in some cases to perform the method in the same container. For example, if first and second copies of the gene are labeled with different first and second fluorescent dyes, respectively, and an allele-specific oligonucleotide labeled with yet a third different fluorescent dye is used to assay the polymoφhic site(s), then detecting a combination of the first and third dyes would identify the polymoφhism in the first gene copy while detecting a combination of the second and third dyes would identify the polymoφhism in the second gene copy. In both the genotyping and haplotyping methods, the identity of a nucleotide (or nucleotide pair) at a polymoφhic site(s) may be determined by amplifying a target region(s) containing the polymoφhic site(s) directly from one or both copies of the ILIB gene, or fragment thereof, and the sequence of the amplified region(s) determined by conventional methods. It will be readily appreciated by the skilled artisan that only one nucleotide will be detected at a polymoφhic site in individuals who are homozygous at that site, while two different nucleotides will be detected if the individual is heterozygous for that site. The polymoφhism may be identified directly, known as positive-type identification, or by inference, refeπed to as negative-type identification. For example, where a SNP is known to be guanine and cytosine in a reference population, a site may be positively determined to be either guanine or cytosine for an individual homozygous at that site, or both guanine and cytosine, if the individual is heterozygous at that site. Alternatively, the site may be negatively determined to be not guanine (and thus cytosine/cytosine) or not cytosine (and thus guanine/guanine). In addition, the identity of the allele(s) present at any of the novel polymoφhic sites described herein may be indirectly determined by genotyping a polymoφhic site not disclosed herein that is in linkage disequilibrium with the polymoφhic site that is of interest. Two sites are said to be in linkage disequilibrium if the presence of a particular variant at one site enhances the predictability of another variant at the second site (Stevens, JC 1999, Mol. Diag. 4: 309-17). Polymoφhic sites in linkage disequilibrium with the presently disclosed polymoφhic sites may be located in regions of the gene or in other genomic regions not examined herein. Genotyping of a polymoφhic site in linkage disequilibrium with the novel polymoφhic sites described herein may be performed by, but is not limited to, any of the above-mentioned methods for detecting the identity of the allele at a polymoφhic site.

The target region(s) may be amplified using any oligonucleotide-directed amplification method, including but not limited to polymerase chain reaction (PCR) (U.S. Patent No. 4,965,188), ligase chain reaction (LCR) (Barany et al., Proc. Natl. Acad. Sci. USA 88: 189-193, 1991;

WO90/01069), and oligonucleotide ligation assay (OLA) (Landegren et al, Science 241:1077-1080, 1988). Oligonucleotides useful as primers or probes in such methods should specifically hybridize to a region of the nucleic acid that contains or is adjacent to the polymoφhic site. Typically, the oligonucleotides are between 10 and 35 nucleotides in length and preferably, between 15 and 30 nucleotides in length. Most preferably, the oligonucleotides are 20 to 25 nucleotides long. The exact length of the oligonucleotide will depend on many factors that are routinely considered and practiced by the skilled artisan.

Other known nucleic acid amplification procedures may be used to amplify the target region including transcription-based amplification systems (U.S. Patent No. 5,130,238; EP 329,822; U.S. Patent No. 5,169,766, WO89/06700) and isothermal methods (Walker et al., Proc. Natl. Acad. Sci. USA 89:392-396, 1992). A polymoφhism in the target region may also be assayed before or after amplification using one of several hybridization-based methods known in the art. Typically, allele-specific oligonucleotides are utilized in performing such methods. The allele-specific oligonucleotides may be used as differently labeled probe pairs, with one member of the pair showing a perfect match to one variant of a target sequence and the other member showing a perfect match to a different variant. In some embodiments, more than one polymoφhic site may be detected at once using a set of allele- specific oligonucleotides or oligonucleotide pairs. Preferably, the members of the set have melting temperatures within 5°C, and more preferably within 2°C, of each other when hybridizing to each of the polymoφhic sites being detected. Hybridization of an allele-specific oligonucleotide to a target polynucleotide may be performed with both entities in solution, or such hybridization may be performed when either the oligonucleotide or the target polynucleotide is covalently or noncovalently affixed to a solid support. Attachment may be mediated, for example, by antibody-antigen interactions, poly-L-Lys, streptavidin or avidin-biotin. salt bridges, hydrophobic interactions, chemical linkages, UV cross-linking baking, etc. Allele-specific oligonucleotides may be synthesized directly on the solid support or attached to the solid support subsequent to synthesis. Solid-supports suitable for use in detection methods of the invention include substrates made of silicon, glass, plastic, paper and the like, which may be formed, for example, into wells (as in 96-well plates), slides, sheets, membranes, fibers, chips, dishes, and beads. The solid support may be treated, coated or derivatized to facilitate the immobilization of the allele-specific oligonucleotide or target nucleic acid.

The genotype or haplotype for the ILIB gene of an individual may also be determined by hybridization of a nucleic sample containing one or both copies of the gene to nucleic acid arrays and subaπays such as described in WO 95/11995. The arrays would contain a battery of allele-specific oligonucleotides representing each of the polymoφhic sites to be included in the genotype or haplotype.

The identity of polymoφhisms may also be determined using a mismatch detection technique, including but not limited to the RNase protection method using riboprobes (Winter et al., Proc. Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al, Science 230: 1242, 1985) and proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modrich, P. Ann. Rev. Genet. 25:229-253, 1991). Alternatively, variant alleles can be identified by single strand conformation polymoφhism

(SSCP) analysis (Orita et al., Genomics 5:874-879, 1989; Humphries et al., in Molecular Diagnosis of Genetic Diseases, R. Elles, ed., pp. 321-340, 1996) or denaturing gradient gel electrophoresis (DGGE) (Wartell et al, Nucl. Acids Res. 18:2699-2706, 1990; Sheffield et al, Proc. Natl. Acad. Sci. USA 86:232-236, 1989). A polymerase-mediated primer extension method may also be used to identify the polymoφhism(s). Several such methods have been described in the patent and scientific literature and include the "Genetic Bit Analysis" method (W092/15712) and the ligase/polymerase mediated genetic bit analysis (U.S. Patent 5,679,524. Related methods are disclosed in WO91/02087, WO90/09455, W095/17676, U.S. Patent Nos. 5,302,509, and 5,945,283. Extended primers containing a polymoφhism may be detected by mass spectrometry as described in U.S. Patent No. 5,605,798. Another primer extension method is allele-specific PCR (Ruaήo et al., Nucl. Acids Res. 17:8392,

1989; Ruaήo et al, Nucl. Acids Res. 19, 6877-6882, 1991; WO 93/22456; Turki et al., J. Clin. Invest. 95: 1635-1641, 1995). In addition, multiple polymoφhic sites may be investigated by simultaneously amplifying multiple regions of the nucleic acid using sets of allele-specific primers as described in Wallace et al. (WO89/10414). In another aspect of the invention, an individual's ILIB haplotype pair is predicted from its

ILIB genotype using information on haplotype pairs known to exist in a reference population. In its broadest embodiment, the haplotyping prediction method comprises identifying an ILIB genotype for the individual at two or more polymoφhic sites selected from PS2, PS3, PS5, and PS6, enumerating all possible haplotype pairs which are consistent with the genotype, accessing data containing ILIB haplotype pairs identified in a reference population, and assigning a haplotype pair to the individual that is consistent with the data. In one embodiment, the reference haplotype pairs include the ILIB haplotype pairs shown in Table 3.

Generally, the reference population should be composed of randomly-selected individuals representing the major ethnogeographic groups of the world. A prefeπed reference population for use in the methods of the present invention comprises an approximately equal number of individuals from Caucasian, African American, Asian and Hispanic-Latino population groups with the minimum number of each group being chosen based on how rare a haplotype one wants to be guaranteed to see. For example, if one wants to have a q% chance of not missing a haplotype that exists in the population at a p% frequency of occurring in the reference population, the number of individuals (n) who must be sampled is given by 2n=log(l-q)/log(l-p) where p and q are expressed as fractions. A prefeπed reference population allows the detection of any haplotype whose frequency is at least 10% with about 99% certainty and comprises about 20 unrelated individuals from each of the four population groups named above. A particularly prefeπed reference population includes a 3-generation family representing one or more of the four population groups to serve as controls for checking quality of haplotyping procedures.

In a prefeπed embodiment, the haplotype frequency data for each ethnogeographic group is examined to determine whether it is consistent with Hardy- Weinberg equilibrium. Hardy- Weinberg equilibrium (D.L. Haiti et al., Principles of Population Genomics, Sinauer Associates (Sunderland, MA), 3^rd Ed., 1997) postulates that the frequency of finding the haplotype pair H, / H₂ is equal to p_H__w (H, / H₂ ) = 2p(H )p(H₂ ) if H, ≠ H₂ and p_H__w (H, / H₂ ) = p(H_λ )p(H₂ ) if H. = H₂ .

A statistically significant difference between the observed and expected haplotype frequencies could be due to one or more factors including significant inbreeding in the population group, strong selective pressure on the gene, sampling bias, and/or eπors m the genotyping process If large deviations from Hardy- Weinberg equihbπum are observed m an ethnogeographic group, the number of individuals in that group can be increased to see if the deviation is due to a sampling bias If a larger sample size does not reduce the difference between observed and expected haplotype pair frequencies, then one may wish to consider haplotyping the individual using a direct haplotyping method such as, for example, CLASPER System^™ technology (U S Patent No 5,866,404), SMD, or allele-specific long- range PCR (Michalotos-Beloin et al , Nucleic Acids Res 24 4841-4843, 1996)

In one embodiment of this method for predicting an ILIB haplotype pair, the assigning step involves performing the following analysis First, each of the possible haplotype pairs is compared to the haplotype pairs in the reference population Generally, only one of the haplotype pairs in the reference population matches a possible haplotype parr and that pair is assigned to the individual Occasionally, only one haplotype represented in the reference haplotype pairs is consistent with a possible haplotype pair for an individual, and m such cases the individual is assigned a haplotype pair contaimng this known haplotype and a new haplotype denved by subtracting the known haplotype from the possible haplotype pair In rare cases, either no haplotypes in the reference population are consistent with the possible haplotype pairs, or alternatively, multiple reference haplotype pairs are consistent with the possible haplotype pairs In such cases, the individual is preferably haplotyped using a direct molecular haplotyping method such as, for example, CLASPER System™ technology (U S Patent No 5,866,404), SMD, or allele-specific long-range PCR (Michalotos-Beloin et al ,

Nucleic Acids Res 24 4841-4843, 1996) A prefeπed process for predicting ILIB haplotype pairs from ILIB genotypes is descπbed m copendmg U S Provisional Application Seπal No 60/198,340 The invention also provides a method for determining the frequency of an ILIB genotype or ILIB haplotype in a population The method compπses determining the genotype or the haplotype pair for the ILIB gene that is present in each member of the population, wherem the genotype or haplotype compnses the nucleotide pair or nucleotide detected at one or more of the polymoφhic sites PS2, PS3, PS5, and PS6 in the ILIB gene, and calculating the frequency any particular genotype or haplotype is found in the population The population may be a reference population, a family population, a same sex population, a population group, a trait population (e g , a group of individuals exhibiting a trait of mterest such as a medical condition or response to a therapeutic treatment)

In another aspect of the invention, frequency data for ILIB genotypes and/or haplotypes found in a reference population are used in a method for identifying an association between a trait and an ILIB genotype or an ILIB haplotype The trait may be any detectable phenotype, including but not limited to susceptibility to a disease or response to a treatment The method involves obtaimng data on the frequency of the genotype(s) or haplotype(s) of interest in a reference population as well as in a population exhibiting the trait Frequency data for one or both of the reference and trait populations may be obtained by genotyping or haplotyping each individual in the populations using one of the methods descnbed above The haplotypes for the trait population may be determined directly or, alternatively, by the predictive genotype to haplotype approach descnbed above In another embodiment, the frequency data for the reference and or trait populations is obtained by accessing previously determined frequency data, which may be in wntten or electromc form For example, the frequency data may be present in a database that is accessible by a computer Once the frequency data is obtamed, the frequencies of the genotype(s) or haplotype(s) of interest in the reference and trait populations are compared In a prefeπed embodiment, the frequencies of all genotypes and/or haplotypes observed in the populations are compared If a particular genotype or haplotype for the ILIB gene is more frequent in the trait population than in the reference population at a statistically significant amount, then the trait is predicted to be associated with that ILIB genotype or haplotype Preferably, the ILIB genotype or haplotype bemg compared in the trait and reference populations is selected from the full-genotypes and full-haplotypes shown m Tables 3 and 4, respectively, or from sub-genotypes and sub-haplotypes denved from these genotypes and haplotypes In a prefeπed embodiment of the method, the trait of interest is a clinical response exhibited by a patient to some therapeutic treatment, for example, response to a drug targeting ILIB or response to a therapeutic treatment for a medical condition As used herein, "medical condition" includes but is not limited to any condition or disease manifested as one or more physical and/or psychological symptoms for which treatment is desirable, and includes previously and newly identified diseases and other disorders As used herein the term "climcal response" means any or all of the following a quantitative measure of the response, no response, and adverse response (l e , side effects)

In order to deduce a coπelation between climcal response to a treatment and an ILIB genotype or haplotype, it is necessary to obtain data on the clinical responses exhibited by a population of individuals who received the treatment, hereinafter the "climcal population" This climcal data may be obtained by analyzing the results of a clmical tπal that has already been run and/or the climcal data may be obtained by designing and carrying out one or more new clmical tπals As used herein, the term "clinical tnal" means any research study designed to collect clmical data on responses to a particular treatment, and includes but is not limited to phase I, phase II and phase III clmical tπals Standard methods are used to define the patient population and to enroll subjects It is prefeπed that the individuals included in the climcal population have been graded for the existence of the medical condition of interest This is important m cases where the symptom(s) being presented by the patients can be caused by more than one underlying condition, and where treatment of the underlying conditions are not the same An example of this would be where patients expenence breathing difficulties that are due to either asthma or respiratory infections If both sets were treated with an asthma medication, there would be a spunous group of apparent non-responders that did not actually have asthma These people would affect the ability to detect any coπelation between haplotype and treatment outcome. This grading of potential patients could employ a standard physical exam or one or more lab tests. Alternatively, grading of patients could use haplotyping for situations where there is a strong coπelation between haplotype pair and disease susceptibility or severity.

The therapeutic treatment of interest is administered to each individual in the trial population and each individual's response to the treatment is measured using one or more predetermined criteria. It is contemplated that in many cases, the trial population will exhibit a range of responses and that the investigator will choose the number of responder groups (e.g., low, medium, high) made up by the various responses. In addition, the ILIB gene for each individual in the trial population is genotyped and/or haplotyped, which may be done before or after administering the treatment. After both the clinical and polymoφhism data have been obtained, coπelations between individual response and ILIB genotype or haplotype content are created. Coπelations may be produced in several ways. In one method, individuals are grouped by their ILIB genotype or haplotype (or haplotype pair) (also refeπed to as a polymoφhism group), and then the averages and standard deviations of clinical responses exhibited by the members of each polymoφhism group are calculated.

These results are then analyzed to determine if any observed variation in clinical response between polymoφhism groups is statistically significant. Statistical analysis methods which may be used are described in L.D. Fisher and G. vanBelle, "Biostatistics: A Methodology for the Health Sciences", Wiley-Interscience (New York) 1993. This analysis may also include a regression calculation of which polymoφhic sites in the ILIB gene give the most significant contribution to the differences in phenotype. One regression model useful in the invention is described in PCT Application Serial No. PCT US00/ 17540, entitled "Methods for Obtaining and Using Haplotype Data".

A second method for finding coπelations between ILIB haplotype content and clinical responses uses predictive models based on eπor-minimizing optimization algorithms. One of many possible optimization algorithms is a genetic algorithm (R. Judson, "Genetic Algorithms and Their Uses in Chemistry" in Reviews in Computational Chemistry, Vol. 10, pp. 1-73, K. B. Lipkowitz and D. B. Boyd, eds. (VCH Publishers, New York, 1997). Simulated annealing (Press et al., "Numerical Recipes in C: The Art of Scientific Computing", Cambridge University Press (Cambridge) 1992, Ch. 10), neural networks (E. Rich and K. Knight, "Artificial Intelligence", 2^nd Edition (McGraw-Hill, New York, 1991, Ch. 18), standard gradient descent methods (Press et al., supra Ch. 10), or other global or local optimization approaches (see discussion in Judson, supra) could also be used. Preferably, the coπelation is found using a genetic algorithm approach as described in PCT Application Serial No. PCT/US00/17540. Coπelations may also be analyzed using analysis of variation (ANOVA) techniques to determine how much of the variation in the clinical data is explained by different subsets of the polymoφhic sites in the ILIB gene. As descπbed in PCT Application Seπal No. PCT/US00/17540. ANOVA is used to test hypotheses about whether a response vanable is caused by or coπelated with one or more traits or vanables that can be measured (Fisher and vanBelle, supra, Ch. 10).

From the analyses descnbed above, a mathematical model may be readily constructed by the skilled artisan that predicts climcal response as a function of ILIB genotype or haplotype content Preferably, the model is validated in one or more follow-up climcal tnals designed to test the model. The identification of an association between a climcal response and a genotype or haplotype (or haplotype pair) for the ILIB gene may be the basis for designing a diagnostic method to determine those individuals who will or will not respond to the treatment, or alternatively, will respond at a lower level and thus may require more treatment, i.e., a greater dose of a drug The diagnostic method may take one of several forms: for example, a direct DNA test (i.e., genotyping or haplotyping one or more of the polymoφhic sites in the ILIB gene), a serological test, or a physical exam measurement The only requirement is that there be a good coπelation between the diagnostic test results and the underlying ILIB genotype or haplotype that is in turn coπelated with the clmical response In a prefeπed embodiment, this diagnostic method uses the predictive haplotyping method descnbed above.

Any or all analytical and mathematical operations involved in practicing the methods of the present invention may be implemented by a computer. In addition, the computer may execute a program that generates views (or screens) displayed on a display device and with which the user can interact to view and analyze large amounts of information relating to the ILIB gene and its genomic vanation, including chromosome location, gene structure, and gene family, gene expression data, polymoφhism data, genetic sequence data, and clinical data population data (e.g , data on ethnogeographic oπgin, clinical responses, genotypes, and haplotypes for one or more populations) The ILIB polymoφhism data descπbed herein may be stored as part of a relational database (e.g., an instance of an Oracle database or a set of ASCII flat files). These polymoφhism data may be stored on the computer's hard dπve or may, for example, be stored on a CD ROM or on one or more other storage devices accessible by the computer. For example, the data may be stored on one or more databases m communication with the computer via a network.

Prefeπed embodiments of the mvention are descπbed in the following examples Other embodiments within the scope of the claims herein will be apparent to one skilled in the art from consideration of the specification or practice of the invention as disclosed herein. It is intended that the specification, together with the examples, be considered exemplary only, with the scope and spiπt of the invention being indicated by the claims which follow the examples

EXAMPLES

The Examples herein are meant to exemplify the vanous aspects of carrying out the invention and are not intended to limit the scope of the invention in any way. The Examples do not include detailed descriptions for conventional methods employed, such as in the performance of genomic DNA isolation, PCR and sequencing procedures. Such methods are well-known to those skilled in the art and are described in numerous publications, for example, Sambrook, Fritsch, and Maniatis, "Molecular Cloning: A Laboratory Manual", 2^nd Edition, Cold Spring Harbor Laboratory Press, USA, (1989).

Example 1 This example illustrates examination of various regions of the ILIB gene for polymoφhic sites.

Amplification of Target Regions

The following target regions of the ILIB gene were amplified using the PCR primer pairs listed below, with the sequences presented in the 5 ' to 3 ' direction and nucleotide positions shown for each region coπesponding to the indicated GenBank Accession No.

Accession Number: M15840.1 Fragment 1 Forward Primer

8-28 GTGCATGTATAAATCTGTGTG (SEQ ID NO:36) Reverse Primer

Complement of 577-557 AGGCAGAGAGGGAAGGAGAGG (SEQ ID NO:37)

PCR product 570 nt

Fragment 2 Forward Primer

97-118 TGTGGACATCAACTGCACAACG (SEQ ID NO:38)

Reverse Primer

Complement of 749-727 TGCTAAACCAAACCCCAACTAGC (SEQ ID NO:39)

PCR product 653 nt

Fragment 3

Forward Primer

628-649 TCGGGAAATATTCTGGGAATGG (SEQ ID NO:40)

Reverse Primer Complement of 1144-1122 AAGGCTGGAGGGACTTGTAATGG (SEQ ID NO:41)

PCR product 517 nt

Fragment 4 Forward Primer 4148-4171 AGTGTCAGGTCCATGTTCTTAGCC (SEQ ID NO:42)

Reverse Primer

Complement of 4713-4690 TGCTTGACCGTCTAATTTCTCAGG (SEQ ID NO:43)

PCR product 566 nt Fragment 5

Forward Primer

6344-6368 TCTCACCTACATTATGCTCCTCAGC (SEQ ID NO:44) Reverse Primer

Complement of 6953-6930 TGATGGACAGGAGATCCTCTTAGC (SEQ ID NO:45)

PCR product 610 nt These primer pairs were used in PCR reactions containing genomic DNA isolated from immortalized cell lines for each member of the Index Repository. The PCR reactions were carried out under the following conditions:

Reaction volume = 20 μl

10 x Advantage 2 Polymerase reaction buffer (Clontech) = 2 μl 100 ng of human genomic DNA = 1 μl lO mM dNTP = 0.4 μl

Advantage 2 Polymerase enzyme mix (Clontech) = 0.2 μl

Forward Primer (10 μM) = 0.4 μl

Reverse Primer (10 μM) = 0.4 μl Water =15.6μl

Amplification profile: 94°C - 2 min. 1 cycle

94°C - 30 sec. ^*» 70°C - 45 sec. L 10 cycles

72°C - 1 min. J

94°C - 30 sec. -ι

64°C - 45 sec. L 35 cycles

72°C - 1 min. J

Sequencing of PCR Products

The PCR products were purified by Solid Phase Reversible Immobilization using the protocol developed by the Whitehead Genome Center. A detailed protocol can be found at http://www.genome.wi.mit.edu/sequencing/protocols/pure/SPRI_pcr.html.

Briefly, five μl of carboxyl coated magnetic beads (10 mg/ml) and 60 μl of HYB BUFFER (2.5M NaCl/20% PEG 8000) were added to each PCR reaction mixture (20 μl). The reaction mixture was mixed well and incubated at room temperature (RT) for 10 min. The microtitre plate was placed on a magnet for 2 min and the beads washed twice with 150 μl of 70% EtOH. The beads were air dried for 2 min and the DNA was eluted in 25 μl of distilled water and incubated at RT for 5 min. The beads were magnetically separated and the supernatant removed for testing and sequencing. The purified PCR products were sequenced in both directions using the primer sets described previously or those listed, in the 5 ' to 3 ' direction, below.

Accession Number: Ml 5840.1 Fragment 1 Forward Primer 27-47 TGTCTTCCACTTTGTCCCACA (SEQ ID NO:46)

Reverse Primer

Complement of 503-482 GGCAGAGAGACAGAGAGACTCC (SEQ ID NO:47)

Fragment 2 Forward Primer

188-207 TTGCCCTTCCATGAACCAGA (SEQ ID NO:48)

Reverse Primer

Complement of 707-688 GCTGGAGCAGAGGCTTTGAC (SEQ ID NO:49) Fragment 3

Forward Primer

693-712 AGCCTCTGCTCCAGCTCTCC (SEQ ID NO:50)

Reverse Primer

Complement of 1092-1073 GCACCCTGTTTGCCACTGAA (SEQ ID NO:51)

Fragment 4

Forward Primer

4172-4191 ACCCCACTCCCAGCTTCATC (SEQ ID NO:52)

Reverse Primer Complement of 4665 -4646 CTGGCCAGTGCAATCAAATG (SEQ ID NO:53)

Fragment 5 Forward Primer

6429-6449 GGGCCCAGTTACAACTCAGGA (SEQ ID NO:54) Reverse Primer

Complement of 6926-6907 ACCCTAAGGCAGGCAGTTGG (SEQ ID NO:55)

Analysis of Sequences for Polymorphic Sites

Sequences were analyzed for the presence of polymoφhisms using the Polyphred program (Nickerson et al., Nucleic Acids Res. 14:2745-2751, 1997). The presence of a polymoφhism was confirmed on both strands. The polymoφhisms and their locations in the ILIB gene are listed in Table 2 below.

reviously reported in the literature

Example 2 This example illustrates analysis of the ILIB polymoφhisms identified in the Index Repository for human genotypes and haplotypes.

The different genotypes containing these polymoφhisms that were observed in the reference population are shown in Table 3 below, with the haplotype pair indicating the combination of haplotypes determined for the individual using the haplotype derivation protocol described below. In Table 3, homozygous positions are indicated by one nucleotide and heterozygous positions are indicated by two nucleotides.

The haplotype pairs shown in Table 3 were estimated from the unphased genotypes using an extension of Clark's algorithm (Clark, A.G. (1990) Mol Bio Evol 7, 111-122), as described in U.S. Provisional Application Serial No. 60/198,340 entitled "A Method and System for Determining

Haplotypes from a Collection of Polymoφhisms". In this method, haplotypes are assigned directly from individuals who are homozygous at all sites or heterozygous at no more than one of the variable sites. This list of haplotypes is then used to deconvolute the unphased genotypes in the remaining (multiply heterozygous) individuals. By following this protocol, it was determined that the Index Repository examined herein and, by extension, the general population contains the 11 human ILIB haplotypes shown in Table 4 below.

In view of the above, it will be seen that the several advantages of the invention are achieved and other advantageous results attained.

As various changes could be made in the above methods and compositions without departing from the scope of the invention, it is intended that all matter contained in the above description and shown in the accompanying drawings shall be inteφreted as illustrative and not in a limiting sense.

All references cited in this specification, including patents and patent applications, are hereby incoφorated in their entirety by reference. The discussion of references herein is intended merely to summarize the assertions made by their authors and no admission is made that any reference constitutes prior art. Applicants reserve the right to challenge the accuracy and pertinency of the cited references.

Claims

What is Claimed is.

1. An isolated polynucleotide compnsmg a nucleotide sequence selected from the group consisting of

(a) a first nucleotide sequence which is a polymoφhic vanant of a reference sequence for interleukin- 1 beta (ILIB) gene or a fragment thereof, wherein the reference sequence compπses SEQ ID NO.1, and the polymoφhic vaπant compπses at least one polymoφhism selected from the group consisting of thymine at PS2, ademne at PS3, guanine at PS5 and ademne at PS6; and

(b) a second nucleotide sequence which is complementary to the first nucleotide sequence

2. The isolated polynucleotide of claim 1 which compπses an ILIB isogene.

3 The isolated polynucleotide of claim 1 which is a DNA molecule and compπses both the first and second nucleotide sequences and further compnses expression regulatory elements operably linked to the first nucleotide sequence.

4 A recombinant nonhuman organism transformed or transfected with the isolated polynucleotide of claim 1, wherein the organism expresses an ILIB protein encoded by the first nucleotide sequence.

5 The recombinant organism of claim 4 which is a nonhuman transgenic ammal.

6 The isolated polynucleotide of claim 1 , wherein the first nucleotide sequence is a polymoφhic vanant of a fragment of the ILIB gene, the fragment compnsmg one or more polymoφhisms selected from the group consisting of thymine at PS2, ademne at PS3, guamne at PS5 and ademne at PS6.

7 A composition compnsmg at least one genotyping ohgonucleotide for detecting a polymoφhism in the interleukin- 1 beta (ILIB) gene at a polymoφhic site selected from PS2, PS3, PS5, and PS6.

8 The composition of claim 7, wherein the genotyping ohgonucleotide is an allele-specific ohgonucleotide that specifically hybπdizes to an allele of the ILIB gene at a region containing the polymoφhic site

9 The composition of claim 8, wherem the allele-specific ohgonucleotide compπses a nucleotide sequence selected from the group consisting of of SEQ ID NOS.4-1 1, the complements of SEQ ID NOS 4-1 1, and SEQ ID NOS: 12-27.

10. The composition of claim 7, wherem the genotyping ohgonucleotide is a pnmer-extension ohgonucleotide.

11. A method for genotyping the interleukin- 1 beta (ILIB) gene of an individual, compnsmg determining for the two copies of the ILIB gene present in the individual the identity of the nucleotide pair at one or more polymoφhic sites (PS) selected from PS2, PS3, PS5, and PS6

12. The method of claim 11, wherem the determining step compnses

(a) isolating from the individual a nucleic acid mixture compnsmg both copies of the ILIB gene, or a fragment thereof, that are present in the individual,

(b) amplifying from the nucleic acid mixture a target region containing at least one of the polymoφhic sites;

(c) hybπdizing a pπmer extension ohgonucleotide to one allele of the amplified target region;

(d) performing a nucleic acid template-dependent, pπmer extension reaction on the hybndized genotyping ohgonucleotide in the presence of at least two different terminators of the reaction, wherem said terminators are complementary to the alternative nucleotides present at the polymoφhic site; and

(e) detecting the presence and identity of the terminator m the extended genotyping ohgonucleotide.

13. A method for haplotyping the mterleukm-l beta (ILIB) gene of an individual which compπses determining, for one copy of the ILIB gene present in the individual, the identity of the nucleotide at one or more polymoφhic sites (PS) selected from PS2, PS3, PS5, and PS6.

14. The method of claim 13, wherein the determining step compnses

(a) isolating from the individual a nucleic acid molecule contaimng only one of the two copies of the ILIB gene, or a fragment thereof, that is present in the individual;

(b) amplifying from the nucleic acid molecule a target region containing at least one of the polymoφhic sites,

(c) hybndizing a pπmer extension ohgonucleotide to one allele of the amplified target region;

(d) performing a nucleic acid template-dependent, pπmer extension reaction on the hybndized genotyping oligonucleotide in the presence of at least two different terminators of the reaction, wherein said terminators are complementary to the alternative nucleotides present at the polymoφhic site; and

(e) detectmg the presence and identity of the terminator in the extended genotyping ohgonucleotide.

15. A method for predicting a haplotype pair for the interleukin- 1 beta (ILIB) gene of an individual compnsmg

(a) identifying an ILIB genotype for the individual at two or more of polymoφhic sites selected from PS2, PS3, PS5, and PS6; (b) enumeratmg all possible haplotype pairs which are consistent with the genotype,

(c) accessmg data containing the ILIB haplotype pairs determined in a reference population; and

(d) assigning a haplotype pair to the individual that is consistent with the data

16. A method for identifying an association between a trait and at least one genotype or haplotype of the interleukin- 1 beta gene which compnses companng the frequency of the genotype or haplotype a population exhibiting the trait with the frequency of the genotype or haplotype in a reference population, wherein the genotype or haplotype compπses a nucleotide pair or nucleotide located at one or more polymoφhic sites selected from PS2, PS3, PS5, and PS6, wherein a higher frequency of the genotype or haplotype in the trait population than in the reference population indicates the trait is associated with the genotype or haplotype.

17. The method of claim 16, wherein the haplotype is selected from haplotype numbers 1-11 shown in Table 4.

18. The method of claim 17, wherein the trait is a clinical response to a drug targeting ILIB.

19. A computer system for storing and analyzing polymoφhism data for the interleukin- 1 beta gene, comprising:

(a) a central processing unit (CPU); (b) a communication interface;

(c) a display device;

(d) an input device; and

(e) a database containing the polymoφhism data; wherein the polymoφhism data comprises the genotypes and haplotype pairs shown in Table 4 and the haplotypes shown in Table 4.

20. A genome anthology for the interleukin- 1 beta (ILIB) gene which comprises ILIB isogenes defined by haplotypes 1-11 shown in Table 4.