WO2001016299A1 - Utilisation d'adn codant pour l'osteoprotegerine pour prevenir ou inhiber des troubles metaboliques osseux - Google Patents

Utilisation d'adn codant pour l'osteoprotegerine pour prevenir ou inhiber des troubles metaboliques osseux Download PDF

Info

Publication number
WO2001016299A1
WO2001016299A1 PCT/US2000/023755 US0023755W WO0116299A1 WO 2001016299 A1 WO2001016299 A1 WO 2001016299A1 US 0023755 W US0023755 W US 0023755W WO 0116299 A1 WO0116299 A1 WO 0116299A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
osteoprotegerin
nucleic acid
bone
acid molecule
Prior art date
Application number
PCT/US2000/023755
Other languages
English (en)
Inventor
Patrick M. Doran
B. Lawrence Riggs
Sundeep Khosla
Stephen T. Russel
Original Assignee
Mayo Foundation For Medical Education And Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU69463/00A priority Critical patent/AU6946300A/en
Application filed by Mayo Foundation For Medical Education And Research filed Critical Mayo Foundation For Medical Education And Research
Priority to CA002383043A priority patent/CA2383043A1/fr
Publication of WO2001016299A1 publication Critical patent/WO2001016299A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • Living bone tissue exhibits a dynamic equilibrium between deposition and resorption of bone. These processes are mediated primarily by two cell types: osteoblasts, which secrete molecules that comprise the organic matrix of bone; and osteoclasts, which promote dissolution of the bone matrix and solubilization of bone minerals.
  • osteoblasts which secrete molecules that comprise the organic matrix of bone
  • osteoclasts which promote dissolution of the bone matrix and solubilization of bone minerals.
  • the rate of bone deposition exceeds the rate of bone resorption, while in older individuals and in several bone disorders the rate of resorption can exceed deposition. In the latter situation, the increased breakdown of bone leads to reduced bone mass and strength, increased risk of fractures, and slow or incomplete repair of broken bones.
  • Osteoclasts are large phagocytic multinucleated cells which are formed from hematopoietic precursor cells in the bone marrow. Although the growth and formation of mature functional osteoclasts is not well understood, it is thought that osteoclasts mature along the monocyte/macrophage cell lineage in response to exposure to various growth-promoting factors. Early development of bone marrow precursor cells to preosteoclasts are likely to be mediated by soluble factors such as tumor necrosis factor- (TNF- ⁇ ), tumor necrosis factor- ⁇ (TNF- ⁇ ), interleukin- 1 (IL-1), interleukin-4 (IL-4), interleukin-6 (IL-6), and leukemia inhibitory factor (LIF).
  • TNF- ⁇ tumor necrosis factor-
  • TNF- ⁇ tumor necrosis factor- ⁇
  • TNF- ⁇ tumor necrosis factor- ⁇
  • IL-1 interleukin- 1
  • IL-4 interleukin-4
  • IL-6 interleukin-6
  • M-CSF macrophage colony stimulating factor
  • cytokines including IL-1, IL-6, TNF- ⁇ , lymphotoxin, and M-CSF (Bataille et al., 1992; Gozzolino et al., 1989), have been implicated in the pathogenesis of myelomatous bony lesions through differentiation of osteoclast precursors and activation of mature osteoclasts (Figure 1) (Roodman, 1997). This enhanced osteoclastic activity gives rise to diffuse, severe osteopenia and/or discrete osteolytic lesions throughout the skeleton, thereby threatening its structural integrity (Foerster et al., 1999).
  • Bisphosphonates such as oral clodronate and intravenous pamidronate, have been used for myelomatous bone lesions. Although these agent have been found to be generally effective, pamidronate can cause flu-like symptoms during infusion, and a single 90 mg treatment is quite costly (The Medical Letter, 1998).
  • Other bone disorders that currently have limited treatment options include Paget's disease and osteoporosis. Severe Paget's is an incapacitating condition which can only be partially treated with repeated doses of bisphosphonates.
  • the present invention provides a method to inhibit, prevent or reverse a metabolic bone disorder or condition associated with aberrant or altered osteoclastogenesis, such as a disorder or condition characterized as having a net bone loss, e.g., osteopenia and localized osteolysis.
  • a metabolic bone disorder or condition associated with aberrant or altered osteoclastogenesis such as a disorder or condition characterized as having a net bone loss, e.g., osteopenia and localized osteolysis.
  • multiple myeloma is a condition associated with increased osteoclastic activity resulting in osteolytic lesions and hypercalcemia.
  • the method comprises contacting mammalian cells with an amount of a composition comprising a nucleic acid molecule encoding osteoprotegerin, a variant thereof, or a biologically active fragment thereof, so as to yield genetically altered (e.g., transduced or transfected) cells comprising the nucleic acid molecule.
  • the genetically altered cells can be introduced into a mammal so as to alter osteoclastogenesis in that mammal.
  • the introduction of cells that express osteoprotegerin e.g., in the bone microenvironment, can increase local levels of osteoprotegerin and thus inhibit, prevent or reverse osteoclastic overactivity, e.g., prevent, inhibit or reverse the bony lesions induced by myeloma cells or solid tumor osteolytic metastases.
  • the mammalian cells to be altered are preferably pluripotent cells such as bone marrow cells which comprise mesenchymal progenitor cells, e.g., isolated unfractionated bone marrow, or isolated mesenchymal precursor (progenitor) cells, although other cell types may be useful in the methods of the invention, including monocyte/macrophage precursors and other marrow cells, f ⁇ broblasts, keratinocytes and various neo-organoids, as well as tumor cells or tumor cell lines, e.g., human melanoma cells, human myeloma cells or breast cancer cells.
  • pluripotent cells such as bone marrow cells which comprise mesenchymal progenitor cells, e.g., isolated unfractionated bone marrow, or isolated mesenchymal precursor (progenitor) cells, although other cell types may be useful in the methods of the invention, including monocyte/macrophage precursors and other marrow cells, f ⁇ bro
  • Mesenchymal progenitor cells can be isolated from other marrow cells, and can be efficiently expanded in vitro (Hou et al., 1999). These cells can also be genetically altered, and when transplanted retain the ability to differentiate into mature bone cells (Allay et al., 1997). Moreover, intravenous infusion of human mesenchymal stromal cells resulted in engraftment of these cells to the bone marrow space (Horwitz et al, 1999).
  • a preferred method of the invention comprises contacting ex vivo a population of cells comprising mesenchymal progenitor cells, e.g., cells harvested from at least one mammal, with a composition comprising a nucleic acid molecule encoding osteoprotegerin, a variant thereof, or a biologically active fragment thereof, so as to yield a population comprising cells that are genetically altered with osteoprotegerin nucleic acid.
  • the cells may be introduced to a mammal, preferably after expansion of the genetically altered cells in vitro.
  • the invention provides for genetically altered allogeneic or autologous mammalian cells which may be introduced to a mammal, for example, by intravenous infusion.
  • autologous cells eliminates the need for the chronic immunosuppression required by allogeneic transplants. Additionally, when responding to osteoclastic bone resorption, genetically altered mesenchymal cells locally differentiate into osteoprotegerin expressing osteoblasts, thus increasing osteoprotegerin production in the relevant bone microenvironment.
  • composition of the invention preferably comprises a nucleic acid molecule which comprises a transcriptional regulatory region, element or sequence, e.g., a promoter and optionally an enhancer, operably linked to a nucleic acid sequence which encodes osteoprotegerin.
  • the invention also provides a therapeutic method in which a composition of the invention is administered to a mammal in need thereof in an amount effective to inhibit, prevent or treat a condition associated with altered osteoclastogenesis.
  • osteoprotegerin in a mammal after transplant of cells subjected to ex vivo manipulation or after in vivo introduction of a composition of the invention, allows for a significantly reduced dosing frequency, with potential for several weeks between each administration, and even single-dose treatment, due to stable osteoprotegerin serum levels, thereby avoiding the frequent peaks and troughs consequent to the short circulating half-life of osteoprotegerin, and in contrast to parenteral administration of the protein (Simonet et al., 1997).
  • tissue-specific transcriptional promoters targeting of osteoprotegerin expression to the bone marrow microenvironment through tissue-specific transcriptional promoters or ex vivo transduction of cells with known tissue tropism (e.g., mesenchymal or hematopoietic progenitor cells with tropism for the medullary compartment) may be useful.
  • Cell-, tissue-, or organ-specific expression of osteoprotegerin may be accomplished by employing a cell-, tissue-, or organ-specific transcriptional regulatory element, sequence or region, such as with an ApoE promoter for hepatic expression (Simonet et al., 1997) or an osteocalcin promoter for skeletal expression.
  • a skeletal-specific promoter may result in elevated osteoprotegerin levels in the bone microenvironment, while avoiding undue elevations in systemic osteoprotegerin concentrations, which could lead to osteopetrosis.
  • Other preferred transcriptional regulatory elements are those comprising chemically responsive regulatory sequences, for example, regulatory sequences responsive to tetracycline/doxycycline, to dexamethasone (e.g., the MMTV LTR), and rapamycin or analogs thereof (Ariad, Boston, MA).
  • the present invention provides a therapeutic method to prevent, inhibit or treat bone diseases or conditions caused by osteoclastic overactivity, e.g., osteolytic metastatic lesions and hypercalcemia in multiple myeloma patients, and other hematologic malignancies and solid malignancies, involutional osteoporosis, Paget's disease of bone, osteopenia associated with inflammatory arthropathies, glucocorticoids, and other immunosuppressants, bone loss related to prolonged skeletal unloading, bone resorption due to refractory hyperparathyroidism, such as with chronic renal insufficiency and unresectable parathyroid carcinoma and the like.
  • osteoclastic overactivity e.g., osteolytic metastatic lesions and hypercalcemia in multiple myeloma patients, and other hematologic malignancies and solid malignancies, involutional osteoporosis, Paget's disease of bone, osteopenia associated with inflammatory arthropathies, glucocorticoids, and other immunos
  • Figure 1 shows the cytokine network in myeloma bone disease.
  • Cytokines produced by myeloma cells, marrow stromal cells, osteoblasts, and osteoclasts enhance the growth of myeloma cells and osteoclast formation.
  • FIG. 2 depicts mechanisms of osteoprotegerin (OPG) and the ligand thereof OPGL in regulating osteoclastogenesis.
  • OPG osteoprotegerin
  • Stromal cells and mature osteoblasts express cell membrane-bound OPGL (cOPGL) and soluble OPGL (sOPGL).
  • cOPGL cell membrane-bound OPGL
  • sOPGL soluble OPGL
  • Both forms of OPGL bind to their cognate receptor, osteoclast differentiation activator receptor (ODAR), located on osteoclast precursor cells and in the presence of permissive factors such as CSF-1, promote osteoclastogenesis.
  • ODAR osteoclast differentiation activator receptor
  • Figure 3 depicts exemplary vectors for use in the methods of the invention.
  • a plasmid vector 2) A lentivirus vector.
  • An adenovirus shuttle vector (Quantum Biotechnologies, Montreal Canada).
  • Figure 4 shows the correlation between OPG expression and viral dose in infected ARH-77 cells.
  • Figure 5 shows OPG expression over time in infected ARH-77 cells.
  • Figure 6 depicts survival times in treatment versus control groups.
  • Figure 7 shows total body bone mineral density (BMD) in control mice (left-hand column), negative control mice (uninjected, middle column), and treatment mice (right-hand column).
  • BMD total body bone mineral density
  • Figure 8 shows femur BMD in control mice (left-hand column), negative control mice (uninjected, middle column), and treatment mice (right-hand column).
  • Figure 9 shows tibia BMD in control mice (left-hand column), negative control mice (uninjected, middle column), and treatment mice (right-hand column).
  • Figure 10 shows vertebral BMD in control mice (left-hand column), negative control mice (uninjected, middle column), and treatment mice (right- hand column).
  • a condition associated with aberrant or altered osteoclastogenesis includes, but is not limited to osteoclastic bony lesions, e.g., lesions associated with solid tumors such as breast cancer, Paget's disease, involutional osteoporosis, myeloma osteolysis and hypercalcemia, osteopenia associated with arthropathies, glucocorticoids and other immunosuppressants, bone loss related to prolonged skeletal unloading, and bone resorption due to refractory hyperparathyroidism, e.g., in chronic renal insufficiency and unresectable parathyroid carcinoma, as well as any other condition characterized by either relative or absolute osteoclast overactivity.
  • osteoclastic bony lesions e.g., lesions associated with solid tumors such as breast cancer, Paget's disease, involutional osteoporosis, myeloma osteolysis and hypercalcemia, osteopenia associated with arthropathies, glucocorticoids and other immunosuppressants,
  • pluripotent cells are cells which have multiple developmental of functional capacities, i.e., the cells are capable of developing into more than one cell type, tissue or organ. Pluripotent cells are not totipotent cells, i.e., capable of developing into any cell of an organism. A fertilized ovum is a totipotent cell. Preparations of mesenchymal precursor cells and bone marrow cells contain pluripotent cells.
  • isolated and/or purified refer to in vitro isolation of a nucleic acid, e.g., DNA molecule from its natural cellular environment, and from association with other components of a cell or virus, such as nucleic acid or polypeptide, so that it can be sequenced, replicated, and/or expressed.
  • a nucleic acid e.g., DNA molecule from its natural cellular environment
  • other components of a cell or virus such as nucleic acid or polypeptide
  • isolated nucleic acid is RNA or DNA containing greater than about 50, preferably about 300, and more preferably about 500 or more, sequential nucleotide bases that encode osteoprotegerin, or a variant thereof, or a biologically active portion thereof, that is complementary or hybridizes, respectively, to osteoprotegerin nucleic acid and remains stably bound under stringent conditions, as defined by methods well l ⁇ iown in the art, e.g., in Sambrook et al. (1989).
  • the "biological activity" of nucleic acid encoding osteoprotegerin, a variant or a portion thereof can be measured by methods known to the art including, but not limited to, methods described herein.
  • the RNA or DNA is "isolated” in that it is free from at least one contaminating nucleic acid with which it is normally associated in the natural source of the RNA or DNA and is preferably substantially free of any other RNA or DNA.
  • the phrase "free from at least one contaminating source nucleic acid with which it is normally associated” includes the case where the nucleic acid is reintroduced into the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell, e.g., in a viral vector or plasmid.
  • An example of isolated nucleic acid within the scope of the invention is nucleic acid that encodes a polypeptide having at least about 80%, preferably at least about 90%), and more preferably at least about 95%, amino acid sequence identity with human osteoprotegerin.
  • recombinant nucleic acid e.g., "recombinant DNA sequence or segment” refers to a nucleic acid, e.g., to DNA, that has been derived or isolated from any appropriate viral or cellular source, that may be subsequently chemically altered in vitro, so that its sequence is not naturally occurring, or corresponds to naturally occurring sequences that are not positioned as they would be positioned in a genome which has not been genetically altered with exogenous DNA or in a non-recombinant viral genome.
  • An example of DNA "derived” from a source would be a DNA sequence that is identified as a useful fragment within a given virus or organism, and which is then chemically synthesized in essentially pure form.
  • DNA includes completely synthetic DNA sequences, semi-synthetic DNA sequences, DNA sequences isolated from biological sources, and DNA sequences derived from RNA, as well as mixtures thereof.
  • a “variant" nucleic acid molecule is a molecule having at least one base substitution (relative to another molecule, generally a "wild-type" nucleic acid sequence).
  • Variant nucleic acid molecules may be are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of the nucleic acid molecule. Osteoprotegerin
  • osteoprotegerin DNA encoding osteoprotegerin has been described (see, for example, Simonet et al. (1997) and published international application No. WO 96/26271). Osteoprotegerin dramatically increases the bone density in transgenic mice overexpressing osteoprotegerin, which mice displayed a non-lethal osteopetrosis that was characterized by increased bone density and decreased osteoclast differentiation (Simonet et al., 1997). Moreover, exogenous administration of osteoprotegerin has been shown to increase bone density in normal mice, as well as to protect rats against ovariectomy-induced bone loss (Simonet et al., 1997). Nevertheless, exogenous osteoprotegerin therapy shows some limitations, such as the short half-life of the endogenous osteoprotegerin protein and frequent parenteral administration.
  • osteoprotegerin knockout mice develop increased bone resorption and severe osteoporosis (Mizuno et al., 1998; Bucay et al., 1998).
  • An analysis of osteoprotegerin activity in in vitro osteoclast formation revealed that osteoprotegerin does not interfere with the growth and differentiation of monocyte/macrophage precursors, but likely blocks the differentiation of osteoclasts from monocyte/macrophage precursors.
  • osteoprotegerin appears to have specificity in regulating the extent of osteoclast fonnation.
  • Osteoprotegerin whose human gene is on chromosome 8q23-24, is a disulfide-linked homodimer of 1 10 kDa with 4 tandem cysteine-rich TNF receptor motifs at the N-terminus, as well as 2 death domain homologous regions.
  • the amino-terminal domain spanning about residues 22-194 of the full- length polypeptide shows homology to other members of the tumor necrosis factor receptor (TNFR) family, especially TNFR-2, through conservation of cysteine rich domains characteristic of TNFR family members.
  • the carboxyl terminal domain spanning residues 194-401 has no significant homology to any known sequences.
  • osteoprotegerin Unlike a number of other TNFR family members, osteoprotegerin has no lipophilic domain and appears to be exclusively a secreted protein and does not appear to be synthesized as a membrane associated form.
  • the ligand for osteoprotegerin is called OPGL (Lacey et al., 1998) (also refened to as TNF-related activation-induced cytokine (TRANCE) and receptor activator of NF- ⁇ B ligand (RANKL)).
  • TRANCE TNF-related activation-induced cytokine
  • RNKL receptor activator of NF- ⁇ B ligand
  • osteoclastogenesis This expression is regulated by known bone-resorting factors such as vitamin D, IL-11, prostaglandin E 2 (PGE 2 ), and parathyroid hormone (PTH) (Yasuda et al., 1998).
  • OPGL binds to the cell surface of osteoclastic lineage cells and, in the presence of the permissive factor colony-stimulating factor- 1 (CSF-1), induces osteoclastogenesis in vitro in the absence of stromal cells, glucocorticoids and vitamin D, factors previously considered essential for osteoclastogenesis (Lacey et al., 1998; Yasuda et al., 1998).
  • OPGL stimulates bone resorption both in vitro and in vivo (Lacey et al., 1998). The latter, after subcutaneous injection of recombinant OPGL into normal mice, was associated with massive bone loss and profound rapid-onset hypercalcemia (Lacey et al., 1998). Thus, OPGL and osteoprotegerin, through coupled but diametrically opposite functions, regulate bone mass by modulating osteoclastogenesis.
  • OPGL appears to be the final common pathway through which multiple mediators produce bone resorption by osteoclast recruitment and activation, whereas osteoprotegerin functions as the naturally occurring soluble receptor that acts as a decoy for OPGL, thus counterbalancing its effects and preserving bone mass (Figure 2) (Hofbauer et al, 1998). Nucleic Acid Molecules of the Invention
  • the invention provides for an isolated nucleic acid molecule encoding a polypeptide having at least one of the biological activities of osteoprotegerin.
  • the biological activities of osteoprotegerin include, but are not limited to, any activity involving bone metabolism and in particular, include increasing bone density or mass.
  • the present invention employs a nucleic acid molecule comprising a nucleic acid sequence encoding osteoprotegerin, a variant thereof, or a biologically active fragment thereof.
  • a nucleic acid molecule of the invention can be obtained from any vertebrate source, preferably a mammalian source.
  • a preferred nucleic acid molecule of the invention includes a nucleic molecule encoding a mammalian osteoprotegerin, e.g., a human, non-human primate, rat, mouse or other mammalian osteoprotegerin, the complementary strands thereof, or a portion thereof, preferably including nucleic acids which hybridize under stringent conditions to human, rat or mouse osteoprotegerin DNA but which do not undergo detectable hybridization with other known members of the TNF receptor superfamily. Therefore, the invention provides for nucleic acids which encode rat, mouse and human osteoprotegerin as well as nucleic acid sequences hybridizing thereto which encode a polypeptide having at least one of the biological activities of osteoprotegerin.
  • a mammalian osteoprotegerin e.g., a human, non-human primate, rat, mouse or other mammalian osteoprotegerin, the complementary strands thereof, or a portion thereof, preferably including nucleic acids which hybridize under
  • Hybridization conditions for nucleic acids are described in Sambrook et al. (1989).
  • the conditions for hybridization are generally of high stringency using temperatures, solvents and salt concentrations wherein the hybridizing sequences are about 12-20°C below the melting temperature (T m ) of the perfectly matched duplex.
  • high stringency hybridization conditions include 5xSSC, 50% formamide and 42°C (see Sambrook et al., 1989). Equivalent stringency to these conditions may be readily obtained by adjusting salt and organic solvent concentrations and temperature.
  • hybridizing nucleic acids of the invention may be variable since hybridization may occur in part or all of the polypeptide-encoding regions, and may also occur in adjacent noncoding regions, i.e., hybridizing nucleic acids may be truncations or extensions of the sequences. Truncated or extended nucleic acids are encompassed by the invention provided they retain one or more of the biological properties of osteoprotegerin.
  • the hybridizing nucleic acids may also include adjacent noncoding regions which are 5' and/or 3' to the osteoprotegerin coding region.
  • the noncoding regions may include regulatory regions involved in osteoprotegerin expression, such as promoters, enhancers, translational initiation sites, transcription termination sites and the like.
  • nucleic acids of the invention examples include cDNA, genomic DNA, synthetic DNA and RNA.
  • cDNA is obtained from libraries prepared from mRNA isolated from various tissues expressing osteoprotegerin. In humans, tissue sources for osteoprotegerin include kidney, liver, placenta and heart.
  • Genomic DNA encoding osteoprotegerin is obtained from genomic libraries which are commercially available from a variety of species.
  • Synthetic DNA is obtained by chemical synthesis of overlapping oligonucleotide fragments followed by assembly of the fragments to reconstitute part of all of the coding region and flanking sequences (see U.S. Patent No. 4,695,623 describing the chemical synthesis of interferon genes).
  • RNA is obtained most easily by procaryotic expression vectors which direct high-level synthesis of mRNA, such as vectors using T7 promoters and RNA polymerase.
  • variants of osteoprotegerin nucleic acid sequences include nucleic acid sequences having a least one addition, substitution, insertion or deletion of nucleotides such that the resulting sequences encode polypeptides having one or more amino acid residues which have been added, deleted, inserted or substituted and the resulting variant polypeptide has the activity of osteoprotegerin.
  • the nucleic acid variants may be naturally occurring, such as by splice variation or polymorphism, or may be constructed using site-directed mutagenesis techniques available to the skilled worker. It is anticipated that nucleic acid variants will encode amino acid changes in regions of the molecule which are least likely to disrupt biological activity.
  • variants include a nucleic acid encoding a membrane-bound form of osteoprotegerin having an extracellular domain along with transmembrane and cytoplasmic domains.
  • variants include nucleic acids encoding truncated forms of osteoprotegerin having one or more amino acids deleted from the carboxyl terminus, e.g., nucleic acids encoding osteoprotegerin having from 1 to 216 amino acids deleted from the carboxyl terminus.
  • nucleic acids encoding truncated forms of osteoprotegerin having one or more amino acids deleted from the amino terminus e.g., truncated forms including those lacking part of all the 21 amino acids comprising the leader sequence.
  • the invention provides for nucleic acids encoding osteoprotegerin having from 1 to 10 amino acids deleted from the mature amino terminus (at residue 22) and, optionally, having from 1 to 216 amino acids deleted from the carboxyl terminus (at residue 401).
  • the nucleic acids may encode a methionine residue at the amino terminus.
  • Oligonucleotide-mediated mutagenesis is a preferred method for preparing variants. This technique is well known in the art as described by Adelman et al. (1983).
  • osteoprotegerin DNA is altered by hybridizing an oligonucleotide encoding the desired mutation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native DNA sequence of osteoprotegerin. After hybridization, a
  • DNA polymerase is used to synthesize an entire second complementary strand of the template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in the osteoprotegerin DNA.
  • oligonucleotides of at least 25 nucleotides in length are used.
  • An optimal oligonucleotide will have 12 to 15 nucleotides that are completely complementary to the template on either side of the nucleotide(s) coding for the mutation. This ensures that the oligonucleotide will hybridize properly to the single-stranded DNA template molecule.
  • the oligonucleotides are readily synthesized using techniques known in the art such as that described by Crea et al. (1978).
  • the DNA template can be generated by those vectors that are either derived from bacteriophage M13 vectors (the commercially available M13mpl 8 and M13mpl9 vectors are suitable), or those vectors that contain a single- stranded phage origin of replication as described by Viera et al. (1987). Thus, the DNA that is to be mutated may be inserted into one of these vectors to generate single-stranded template. Production of the single-stranded template is described in Sections 4.21-4.41 of Sambrook et al. (1989). Alternatively, single-stranded DNA template may be generated by denaturing double-stranded plasmid (or other) DNA using standard techniques.
  • the oligonucleotide is hybridized to the single- stranded template under suitable hybridization conditions.
  • a DNA polymerizing enzyme usually the Klenow fragment of DNA polymerase I, is then added to synthesize the complementary strand of the template using the oligonucleotide as a primer for synthesis.
  • a heteroduplex molecule is thus formed such that one strand of DNA encodes the mutated form of osteoprotegerin, and the other strand (the original template) encodes the native, unaltered sequence of osteoprotegerin.
  • This heteroduplex molecule is then transformed into a suitable host cell, usually a prokaryote such as E. coli JM101.
  • the cells are grown, they are plated onto agarose plates and screened using the oligonucleotide primer radiolabeled with 32-phosphate to identify the bacterial colonies that contain the mutated DNA.
  • the mutated region is then removed and placed in an appropriate vector, generally an expression vector of the type typically employed for transformation of an appropriate host.
  • the method described immediately above may be modified such that a homoduplex molecule is created wherein both strands of the plasmid contain the mutations(s).
  • the modifications are as follows:
  • the single-stranded oligonucleotide is annealed to the single-stranded template as described above.
  • a mixture of three deoxyribonucleo tides, deoxyriboadenosine (dATP), deoxyriboguanosine (dGTP), and deoxyribothymidine (dTTP) is combined with a modified thiodeoxyribocytosine called dCTP-( ⁇ S) (which can be obtained from the Amersham Corporation). This mixture is added to the template- oligonucleotide complex.
  • this new strand of DNA Upon addition of DNA polymerase to this mixture, a strand of DNA identical to the template except for the mutated bases is generated.
  • this new strand of DNA will contain dCTP-( ⁇ S) instead of dCTP, which serves to protect it from restriction endonuclease digestion.
  • the template strand can be digested with ExoIII nuclease or another appropriate nuclease past the region that contains the site(s) to be mutagenized. The reaction is then stopped to leave a molecule that is only partially single-stranded.
  • a complete double-stranded DNA homoduplex is then formed using DNA polymerase in the presence of all four deoxyribonucleotide triphosphates, ATP, and DNA ligase.
  • This homoduplex molecule can then be transformed into a suitable host cell such as E. coli JM101.
  • the nucleic acid sequences of the invention may be used for the detection of osteoprotegerin sequences in biological samples in order to determine which cells and tissues are expressing osteoprotegerin mRNA.
  • the sequences may also be used to screen cDNA and genomic libraries for sequences related to osteoprotegerin. Such screening is well within the capabilities of one skilled in the art using appropriate hybridization conditions to detect homologous sequences.
  • the nucleic acids are also useful for modulating the expression of osteoprotegerin levels by anti-sense therapy or gene therapy.
  • the nucleic acids are also used for the development of transgenic animals which may be used for the production of the polypeptide and for the study of biological activity. Expression Cassettes, Vectors and Host Cells
  • the expression cassette preferably comprises a recombinant DNA comprising a transcriptional regulatory region, e.g., a promoter, operably linked to a nucleic acid sequence encoding osteoprotegerin.
  • a transcriptional regulatory region e.g., a promoter
  • the recombinant DNA sequence or segment is in the form of chimeric DNA.
  • the vector may be prepared by introducing, i.e., linking, the cassette to another nucleic acid molecule, e.g., a plasmid or viral vector.
  • plasmid vectors are available for expressing osteoprotegerin in host cells (see, for example, volume 185 in: Methods in Enzymology (1990)).
  • Viral vectors e.g., retroviral and adenovirus-based gene transfer vectors, may be used for the expression of osteoprotegerin in human cells, e.g., for gene therapy.
  • the recombinant DNA sequence or segment may be circular or linear, double- stranded or single-stranded.
  • the expression cassette of the invention comprises a transcription regulatory element, sequence or region, e.g., a promoter, transcription termination sequence, and/or enhancer, operably linked the nucleic acid molecule encoding osteoprotegerin.
  • the expression cassette may comprise a promoter that is active in mammalian cells, or may utilize a promoter already present in the genome that is the transformation target.
  • promoters include the CMV promoter, as well as the SV40 late promoter and retroviral LTRs (long terminal repeat elements), although many other promoter elements, such as those providing cell- or tissue- specific expression, e.g., the Apo(E) or osteocalcin promoter, well known to the art may be employed in the practice of the invention.
  • chimeric means that a cassette or vector comprises DNA from at least two different species, or comprises DNA from the same species, which is linked or associated in a manner which does not occur in the "native" or wild type of the species.
  • elements functional in the host cells such as introns and the like, may also be a part of the expression cassette. Such elements may or may not be necessary for the function of the expression cassette, but may provide improved expression cassette by affecting transcription, stability of the mRNA, or the like. Such elements may be included in the expression cassette as desired to obtain the optimal performance of the recombinant DNA in the cell.
  • Control sequences is defined to mean DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
  • the control sequences that are suitable for prokaryotic cells include a promoter, and optionally an operator sequence, and a ribosome binding site.
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • Control sequences also include sequences for viral replication.
  • sequences directing expression and secretion of osteoprotegerin may be homologous, i.e., the sequences are identical or similar to those sequences in the genome involved in osteoprotegerin expression and secretion, or they may be heterologous.
  • operably linked is defined to mean that the nucleic acid molecule is placed in a functional relationship with another nucleic acid molecule.
  • DNA for a presequence or secretory leader is operably linked to DNA for a peptide or polypeptide if it is expressed as a preprotein that participates in the secretion of the peptide or polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • operably linked means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
  • Vectors for the expression of osteoprotegerin in cells contain at a minimum sequences required for vector propagation, e.g., a replication origin. These vectors also preferably include a selection marker or reporter gene, a promoter and a transcription termination site therefor.
  • a selectable marker gene or a reporter gene facilitate identification and selection of genetically altered cells from the population of cells sought to be altered. Alternatively, the selectable marker or reported may be carried on a separate piece of DNA and used in a co-transformation procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells.
  • Useful selectable markers are well known in the art and include, for example, antibiotic and herbicide- resistance genes, such as neo, hpt, dhfr, bar, aroA, dapA and the like. See also, the genes listed on Table 1 of Lundquist et al. (U.S. Patent No. 5,848,956).
  • Reporter genes are used for identifying potentially transformed cells and for evaluating the functionality of regulatory sequences. Reporter genes which encode for easily assayable proteins are well known in the art.
  • a reporter gene is a gene which is not present in or expressed by the recipient organism or tissue and which encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity.
  • Preferred genes include the chloramphenicol acetyl transferase gene (cat) from Tn9 of E. coli, the beta-glucuronidase gene (gus) of the uidA locus of E. coli, and the luciferase gene from firefly Photinus pyralis . Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.
  • Vectors suitable for expression in host cells are readily available and the nucleic acid molecule of the invention is inserted into the vectors using standard recombinant DNA techniques.
  • Vectors for tissue-specific expression of osteoprotegerin are also included.
  • Such vectors include promoters which function specifically in liver, kidney, bone or other organs, and viral vectors, for the expression of osteoprotegerin in targeted in mammalian, e.g., human, cells.
  • Preferred vectors for use in the invention include viral vectors.
  • For human gene therapy it is desirable to use an efficient means of precisely inserting a single copy gene into the host genome.
  • Viral vectors, and especially retroviral vectors have become the most widely used method for inserting genes into human cells.
  • viral vectors are derived from poxviruses, Herpes simplex virus I, adeno viruses and adeno-associated viruses. Most of the current and proposed gene therapy clinical protocols employ retroviral vectors, although unlike lentivirus and adenovirus, retrovirus generally do not infect non-dividing cells.
  • Retroviruses are single-stranded RNA viruses which replicate viral RNA into DNA by reverse transcription. Upon replication in the host cell, the viral DNA is inserted into the host chromosome, where it becomes a provirus. Due to their efficiency at integrating into host cells, retroviruses are considered to be one of the most promising vectors for human gene therapy. These vectors have a number of properties that lead them to be considered as one of the most promising techniques for genetic therapy of disease. These include: (1) efficient entry of genetic material present in the vector into cells; (2) an efficient process of entry into target cell nucleus; (3) relatively high levels of gene expression; (4) minimal pathological effects on target cells; and (5) the potential to target to particular cellular subtypes through control of the vector-target cell binding and tissue specific control of gene expression.
  • Retroviral genomes consist of czs-acting and trans-acting gene sequences.
  • the cis regions include the long terminal repeat (LTR) transcriptional promoter and DNA integration sites, the two primer binding sites required for reverse transcription of DNA from viral RNA, and the packaging signals required for efficient packaging of viral RNA into virions.
  • the LTR is found at both ends of the proviral genome. 7 ⁇ w.s-functions include the proteins encoded by the gag, pol, and env genes, which are located between the LTRs. Gag and ol encode, respectively, internal viral structural and enzymatic proteins. Env encodes the viral glycoprotein which confers infectivity and host range specificity on the virus.
  • a retroviral vector generally consists of cis sequences and the replacement of the trans sequences with a gene(s) of interest. The trans functions can be provided by expression of the trans sequences in a helper cell or by a helper virus.
  • the vector can be readily introduced into the host cells, e.g., mammalian, bacterial, plant, yeast or insect cells, by any procedure useful for the introduction into a particular cell, e.g., physical or biological methods, to yield a genetically altered cell having the vector stably integrated into its genome or present as an episome which can persist in the genetically altered cells, so that the nucleic acid molecule of the present invention is maintained and/or expressed by the host cell.
  • the host cells e.g., mammalian, bacterial, plant, yeast or insect cells
  • Physical methods to introduce a DNA into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.
  • Biological methods to introduce the DNA of interest into a host cell include the use of DNA and RNA viral vectors.
  • the main advantage of physical methods is that they are not associated with pathological or oncogenic processes of viruses. However, they are less precise, often resulting in multiple copy insertions, random integration, disruption of foreign and endogenous gene sequences, and unpredictable expression.
  • the term "host cell” includes cell lines, primary cells and prokaryotic cells.
  • Cell line is intended to refer to well-characterized homogenous, biologically pure populations of cells. These cells may be eukaryotic cells that are neoplastic or which have been “immortalized” in vitro by methods known in the art, or prokaryotic cells.
  • the host cell is preferably of mammalian origin, but host cells of non-mammalian origin are also envisioned.
  • Preferred primary cells are bone marrow cells, e.g., cells including mesenchymal precursor cells, preferably those of humans.
  • Genetically altered is used herein to include any host cell, the genome of which has been altered or augmented, e.g., by viral transduction, transfection or other transformation techniques known to the art, by the presence of at least one DNA sequence, which DNA is also referred to in the art of genetic engineering as “heterologous DNA,” “recombinant DNA,” “exogenous DNA,” “genetically engineered,” “non-native,” or “foreign DNA”.
  • the host cells of the present invention may be produced by transfection with a DNA sequence in a plasmid expression vector, a viral expression vector, or as an isolated linear DNA sequence, or by infection with a recombinant virus, i.e., virus comprising recombinant nucleic acid.
  • osteoprotegerin is produced recombinantly by culturing a host cell that is genetically altered with an expression vector containing a nucleic acid sequence encoding osteoprotegerin under conditions such that osteoprotegerin is produced.
  • Osteoprotegerin is produced in the supernatant of genetically altered mammalian host cells or in inclusion bodies of genetically altered bacterial host cells. Osteoprotegerin so produced may be purified by procedures known to one skilled in the art. It is anticipated that the exemplified plasmids and host cells described are for illustrative purposes and that other available plasmids and host cells could also be used.
  • assays include, for example, "molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical” assays, such as detecting the presence of a polypeptide expressed from a gene present in the vector, e.g., by immunological means (immunoprecipitations, immuno affinity columns, ELISAs and Western blots) or by any other assay useful to identify molecules falling within the scope of the invention.
  • “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR
  • biochemical assays, such as detecting the presence of a polypeptide expressed from a gene present in the vector, e.g., by immunological means (immunoprecipitations, immuno affinity columns, ELISAs and Western blots) or by any other assay useful to identify molecules falling within the scope of the invention.
  • RNA produced from introduced DNA segments may be employed.
  • PCR it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA.
  • PCR techniques while useful, will not demonstrate integrity of the RNA product.
  • Further information about the nature of the RNA product may be obtained by Northern blotting. This technique demonstrates the presence of an RNA species and gives information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and only demonstrate the presence or absence of an RNA species.
  • An in vitro culture model of osteoclast formation (osteoclast forming assay) (Udagawa et al., 1989; Udagawa et al., 1990) may be employed to detect osteoprotegerin activity, e.g., in cells transduced with a viral vector encoding osteoprotegerin.
  • the culture system employs a combination of bone marrow cells and cells from bone manow stromal cell lines. A description of a modification of this culture system has been described in Lacey et al. (1995).
  • Bone manow cells flushed from the femurs and tibiae of mice, are cultured overnight in culture media (alpha MEM with 10% heat inactivated fetal bovine serum) supplemented with 500 U/ml CSF-1 (colony stimulating factor 1, also called M-CSF), a hematopoietic growth factor specific for cells of the monocyte/macrophage family lineage. Following this incubation, the non- adherent cells are collected, subjected to gradient purification, and then cocultured with cells from the bone manow cell line ST2 (1 x 10 6 non-adherent cells: 1 x 10 5 ST2 cells/ml media).
  • CSF-1 colony stimulating factor 1, also called M-CSF
  • the media is supplemented with dexamethasone (100 nM) and the biologically-active metabolite of vitamin D3 known as 1, 25 dihydroxyvitamin D3 (1,25 (OH) 2 D3, 10 nM).
  • prostaglandin E2 250 nM is added to some cultures.
  • the coculture period usually ranges from 8-10 days and the media, with all of the supplements freshly added, is renewed every 3-4 days.
  • the cultures are assessed for the presence of tartrate acid phosphatase (TRAP) using either a histochemical stain (Sigma Kit # 387A, Sigma, St. Louis, MO) or a TRAP solution assay.
  • the TRAP histochemical method allows for the identification of osteoclasts phenotypically which are multinucleated (> 3 nuclei) cells that are also TRAP+.
  • the solution assay involves lysing the osteoclast- containing cultures in a citrate buffer (100 mM, pH 5.0) containing 0.1% Triton X-100. Tartrate resistant acid phosphatase activity is then measured based on the conversion of /?-nitrophenylphosphate (20 nM) to / ⁇ -nitrophenol in the presence of 80 mM sodium tartrate which occurs during a 3-5 minute incubation at room temperature. The reaction is terminated by the addition of NaOH to a final concentration of 0.5 M. The optical density at 405 nm is measured and the results are plotted.
  • the method described by Lacey et al. (1995) employs bone manow macrophages as osteoclast precursors.
  • the osteoclast precursors are derived by taking the nonadherent bone manow cells after an overnight incubation in CSF- 1/M-CSF, and culturing the cells for an additional 4 days with 1 ,000 - 2,000 U/ml CSF-1. Following 4 days of culture, termed the growth phase, the non- adherent cells are removed.
  • the adherent cells which are bone marrow macrophages, can then be exposed for up to 2 days to various treatments in the presence of 1,000 - 2,000 U/ml CSF-1. This 2 day period is called the intermediate differentiation period.
  • ST-2 cells (1 X 10 5 cell/ml), dexamethasone (100 nM) and 1,25 (OH) 2 D3 (10 nM) are added for the last 8 days for what is termed the terminal differentiation period.
  • Test agents can be added during this terminal period as well. Acquisition of phenotypic markers of osteoclast differentiation are acquired during this terminal period.
  • inoculation of ARH-77 cells into immunodeficient mice yields a murine model for human myeloma (Alsina et al., 1996; Huang et al., 1993), inoculation of a human breast cancer cell line, MD A-MB-231 cells (American Type Culture Collection, HTB- 26), into immunodeficient mice, e.g., nude mice, results in osteolytic bone metastases characteristic of those observed in breast cancer patients (Guise et al., 1996), and inoculation of B16-G3.26 melanoma cells into Sl/Sl d , W/W v , and congenic +/+ mice results in multi-tissue metastases, including bone and bone manow metastases (Arguello et al., 1992).
  • ARH-77 cells, MDA-MB-231 cells or B16-G3.26 melanoma cells can be transfected or transduced with a nucleic acid molecule encoding osteoprotegerin and the transfected or transduced cells introduced into an appropriate host organism, e.g., immunocompromised mice.
  • mice transplanted with transfected or transduced cells is compared to mice transplanted with control cells, e.g., Ca 2+ concentration in whole blood, radiographs and osteolytic lesion area, bone histology and histomorphometry (see Guise et al., 1996; Yin et al., 1999) may be assessed to determine whether the expression of osteoprotegerin inhibits, prevents or reverses osteolytic lesion formation or development.
  • control cells e.g., Ca 2+ concentration in whole blood, radiographs and osteolytic lesion area, bone histology and histomorphometry (see Guise et al., 1996; Yin et al., 1999) may be assessed to determine whether the expression of osteoprotegerin inhibits, prevents or reverses osteolytic lesion formation or development.
  • the invention also provides for compositions comprising a nucleic acid molecule of the invention, e.g., in a liposome, a recombinant virus or isolated nucleic acid, together with a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative and/or adjuvant.
  • cells that are genetically altered with the nucleic acid molecule of the invention.
  • the compositions and/or genetically altered cells are suitable for the delivery of part or all of the osteoprotegerin coding region to an organism, preferably a mammal such as a human, e.g., as part of a gene therapy regimen.
  • Both systemic and local administration, e.g., intralesional administration such as to a bony or tumor lesion or to the bone manow space, are envisioned.
  • nucleic acid molecule may be accomplished through the introduction of cells genetically altered with the nucleic acid molecule (see, for example, Allay et al., 1997; Hou et al., 1999; WO 93/02556), the administration of the nucleic acid molecule itself (see, for example, Feigner et al., U.S. Patent No. 5,580,859, Pardoll et al. (1995); Stevenson et al. (1995); Moiling (1997); Donnelly et al. (1995); Yang et al. (1996); Abdallah et al. (1995)), through infection with a recombinant virus or via liposomes.
  • Pharmaceutical formulations, dosages and routes of administration for nucleic acids are generally disclosed, for example, in Feigner et al., supra.
  • Administration of the nucleic acid molecule e.g., a composition comprising such a molecule or a cell genetically altered with such a molecule, in accordance with the present invention may be continuous or intermittent, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners.
  • the administration may be essentially continuous over a period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.
  • the amount administered is preferably a "therapeutically effective amount", which means an amount which provides a therapeutic effect for a specified condition and route of administration.
  • One or more suitable unit dosage forms comprising the compositions or genetically altered cells of the invention, can be administered by a variety of routes including oral (e.g., oral delivery of virus), or parenteral, including by rectal, transdermal (e.g., transdermal administration of virus), subcutaneous, (e.g., via a collagen leased implant) intravenous, intramuscular, intraperitoneal, intrathoracic, intraarterial, intracardiac, intralesional, intrapulmonary and intranasal routes.
  • the formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods well known to pharmacy.
  • Such methods may include the step of bringing into association the nucleic acid molecule, recombinant virus or genetically altered cell with liquid carriers, solid matrices, semi-solid carriers, finely divided solid caniers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system.
  • the nucleic acid molecule of the invention can also be formulated as elixirs or solutions for convenient oral administration, or the nucleic acid molecule, recombinant virus or genetically altered cell as a solution appropriate for parenteral administration, for instance by intramuscular, subcutaneous (e.g., via a collagen-based implant) or intravenous routes.
  • the pharmaceutical formulations can also take the form of an aqueous or anhydrous solution or dispersion, or alternatively the form of an emulsion or suspension.
  • the nucleic acid molecule, recombinant virus or genetically altered cell may be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampules, pre-filled syringes, small volume infusion containers or in multi-dose containers with an added preservative.
  • the active ingredients may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
  • formulations can contain pharmaceutically acceptable vehicles and adjuvants which are well known in the prior art. It is possible, for example, to prepare solutions using one or more organic solvent(s) that is/are acceptable from the physiological standpoint, chosen, in addition to water, from solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name "Dowanol”, polyglycols and polyethylene glycols, C,-C 4 alkyl esters of short-chain acids, preferably ethyl or isopropyl lactate, fatty acid triglycerides such as the products marketed under the name "Miglyol", isopropyl myristate, animal, mineral and vegetable oils and polysiloxanes.
  • organic solvent(s) that is/are acceptable from the physiological standpoint, chosen, in addition to water, from solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name "Dowanol”, polyg
  • the formulations according to the invention can also contain thickening agents such as cellulose and/or cellulose derivatives. They can also contain gums such as xanthan, guar or carbo gum or gum arabic, or alternatively polyethylene glycols, bentones and montmorillonites, and the like. It is possible to add, if necessary, an adjuvant chosen from antioxidants, surfactants, other preservatives, film-forming, keratolytic or comedolytic agents, perfumes and colorings. Also, other active ingredients may be added, whether for the conditions described or some other condition.
  • thickening agents such as cellulose and/or cellulose derivatives. They can also contain gums such as xanthan, guar or carbo gum or gum arabic, or alternatively polyethylene glycols, bentones and montmorillonites, and the like. It is possible to add, if necessary, an adjuvant chosen from antioxidants, surfactants, other preservatives, film-forming, keratolytic or comedolytic agents, perfume
  • the galenical forms chiefly conditioned for topical application take the form of creams, milks, gels, dispersion or microemulsions, lotions thickened to a greater or lesser extent, impregnated pads, ointments or sticks, or alternatively the form of aerosol formulations in spray or foam form or alternatively in the form of a cake of soap.
  • the nucleic acid molecule, recombinant virus or genetically altered cell of the invention is conveniently delivered from an insufflator, nebulizer or a pressurized pack or other convenient means of delivering an aerosol spray.
  • Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • the nucleic acid molecule of the invention may take the form of a dry powder, for example, a powder mix of the therapeutic agent and a suitable powder base such as lactose or starch.
  • the powder composition may be presented in unit dosage form in, for example, capsules or cartridges, or, e.g., gelatine or blister packs from which the powder may be administered with the aid of an inhalator, insufflator or a metered-dose inhaler.
  • the nucleic acid molecule, recombinant virus or genetically altered cell of the invention may be administered via nose drops, a liquid spray, such as via a plastic bottle atomizer or metered-dose inhaler.
  • atomizers are the Mistometer (Wintrop) and the Medihaler (Riker).
  • Drops such as eye drops or nose drops, may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents.
  • Liquid sprays are conveniently delivered from pressurized packs. Drops can be delivered via a simple eye dropper-capped bottle, or via a plastic bottle adapted to deliver liquid contents dropwise, via a specially shaped closure.
  • the nucleic acid molecule of the invention may further be formulated for topical administration in the mouth or throat.
  • the active ingredients may be formulated as a lozenge further comprising a flavored base, usually sucrose and acacia or tragacanth; pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia; and mouthwashes comprising the composition of the present invention in a suitable liquid carrier.
  • a flavored base usually sucrose and acacia or tragacanth
  • pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia
  • mouthwashes comprising the composition of the present invention in a suitable liquid carrier.
  • formulations and compositions described herein may also contain other ingredients such as antimicrobial agents, or preservatives.
  • the active ingredients may also be used in combination with other therapeutic agents, for example, bronchodilators.
  • solutions in an adjuvant such as sesame or peanut oil or in aqueous propylene glycol can be employed, as well as sterile aqueous solutions.
  • aqueous solutions can be buffered, if desired, and the liquid diluent first rendered isotonic with saline or glucose.
  • Solutions of the vector as a free acid (DNA contains acidic phosphate groups) or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose.
  • a dispersion of viral particles can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils.
  • sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the canier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by use of agents delaying abso ⁇ tion, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the nucleic acid molecule, recombinant virus or genetically altered cell in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze drying technique which yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile- filtered solution thereof.
  • dilute sterile, aqueous solutions (usually in about 0.1 % to 5% concentration), otherwise similar to the above parenteral solutions, are prepared in containers suitable for incorporation into a transdermal patch, and can include known caniers, such as pharmaceutical grade dimethylsulfoxide (DMSO).
  • DMSO dimethylsulfoxide
  • the dosage of the nucleic acid molecule e.g., between 0.1 ⁇ g to 10 mg, preferably between 1 ⁇ g to 1 mg
  • recombinant virus e.g., between 10 4 to 10 14 IU/ml, preferably between 10 5 IU/ml to 10 14 IU/ml
  • genetically altered cells e.g., between about 10 4 to 10 10 , preferably about 10 5 to 10 9 , cells/kg
  • the dosage of the nucleic acid molecule e.g., between 0.1 ⁇ g to 10 mg, preferably between 1 ⁇ g to 1 mg
  • recombinant virus e.g., between 10 4 to 10 14 IU/ml, preferably between 10 5 IU/ml to 10 14 IU/ml
  • genetically altered cells e.g., between about 10 4 to 10 10 , preferably about 10 5 to 10 9 , cells/kg
  • Bone tissue provides support for the body and consists of mineral (largely calcium and phosphorus), a matrix of collagenous and noncollagenous proteins, and cells.
  • mineral largely calcium and phosphorus
  • a matrix of collagenous and noncollagenous proteins a matrix of collagenous and noncollagenous proteins
  • cells Three types of cells found in bone, osteocytes, osteoblasts and osteoclasts, are involved in the dynamic process by which bone is continually formed and resorbed. Osteoblasts promote formation of bone tissue whereas osteoclasts are associated with resorption. Resorption, or the dissolution of bone matrix and mineral, is a fast and efficient process compared to bone formation and can release large amounts of mineral from bone. Osteoclasts are involved in the regulation of the normal remodeling of skeletal tissue and in resorption induced by hormones.
  • resorption is stimulated by the secretion of parathyroid hormone in response to decreasing concentrations of calcium ion in extracellular fluids.
  • inhibition of resorption is the principal function of calcitonin.
  • metabolites of vitamin D alter the responsiveness of bone to parathyroid hormone and calcitonin.
  • the amount of bone in the skeleton reflects the balance (or imbalance) of bone formation and bone resorption. Peak bone mass occurs after skeletal maturity prior to the fourth decade. Between the fourth and fifth decades, the equilibrium shifts and bone resorption dominates. The inevitable decrease in bone mass with advancing years starts earlier in females than males and is distinctly accelerated after menopause in some females (principally those of Caucasian and Asian descent).
  • Osteopenia is a condition relating generally to any decrease in bone mass to below normal levels. Such a condition may arise from a decrease in the rate of bone synthesis or an increase in the rate of bone destruction or both.
  • the most common form of osteopenia is primary osteoporosis, also referred to as postmenopausal and senile osteoporosis. This form of osteoporosis is a consequence of the universal loss of bone with age and is usually a result of increase in bone resorption with a normal or reduced rate of bone formation.
  • About 25 to 30 percent of all white females in the United States develop symptomatic osteoporosis. A direct relationship exists between osteoporosis and the incidence of hip, femoral, neck and inter-trochanteric fracture in women 45 years and older. Elderly males also develop symptomatic osteoporosis between the ages of 50 and 70.
  • the cause of postmenopausal and senile osteoporosis is unknown.
  • Several factors have been identified which may contribute to the condition. They include alteration in hormone levels accompanying aging and negative calcium balance attributed to decreased intestinal abso ⁇ tion of calcium and other minerals.
  • Treatments have usually included hormone therapy or dietary calcium and vitamin D supplement in an attempt to retard the process. To date, however, an effective treatment for bone loss does not exist.
  • the invention provides for a method of treating various bone disorders or conditions.
  • the bone disorder or condition may be any disorder or condition characterized by a net bone loss (osteopenia or osteolysis), e.g., due to altered osteoclastogenesis.
  • treatment with osteoprotegerin is anticipated when it is necessary to suppress the rate of bone reso ⁇ tion.
  • treatment may be done to reduce the rate of bone reso ⁇ tion where the reso ⁇ tion rate is above normal or to reduce bone reso ⁇ tion to below normal levels in order to compensate for below normal levels of bone formation
  • Conditions which are associated with altered or abenant (e.g., increased) osteoclastogenesis include the following: osteoporosis, such as primary osteoporosis, endocrine osteoporosis (hyperthyroidism, hype ⁇ arathryoidism, Cushing's syndrome, and acromegaly), and osteoporosis due to immobilization; Paget's disease of bone (osteitis deformans) in adults and juveniles; osteomyelitis, or an infectious lesion in bone, leading to bone loss; hypercalcemia resulting from solid tumors (breast, lung and kidney) and hematologic malignancies (multiple myeloma, lymphoma and leukemia), idiopathic hypercalcemia, and hypercalcemia associated with hyperthyroidism and renal function disorders; osteopenia following surgery, induced by steroid administration, and associated with disorders of the small and large intestine and with chronic hepatic and renal diseases; osteonecrosis, or bone cell
  • compositions and genetically altered cells of the invention may be used alone, in combination or in conjunction with other factors for the treatment of bone disorders, e.g., factors including but are not limited to the bone mo ⁇ hogenic factors designated BMP-1 through BMP- 12, transforming growth factor- ⁇ (TGF- ⁇ ) and TGF- ⁇ family members, interleukin- 1 inhibitors, TNF ⁇ inhibitors, parathyroid hormone and analogs thereof, parathyroid hormone related protein and analogs thereof, E series prostaglandins, bisphosphonates (such as alendronate and others), and bone-enhancing minerals such as fluoride.
  • TGF- ⁇ transforming growth factor- ⁇
  • TGF- ⁇ transforming growth factor- ⁇
  • TGF- ⁇ transforming growth factor- ⁇ family members
  • interleukin- 1 inhibitors TNF ⁇ inhibitors
  • parathyroid hormone and analogs thereof parathyroid hormone related protein and analogs thereof
  • E series prostaglandins bisphosphonates (such as alendronate and others), and bone-enhancing minerals such as fluoride.
  • E. coli transformed with the pGEM-T-easy-osteoprotegerin plasmid was grown overnight in a 1 liter volume of LB medium with amplicillin 100 ⁇ g/ml at 37°C with rotation.
  • the pGEM-T-easy-osteoprotegerin plasmid was then isolated and purified by alkaline lysis using the Qiagen (Valencia, CA) maxi prep plasmid DNA extraction kit.
  • a 5 ⁇ g quantity of pGEM-T-easy-Osteoprotegerin was digested with the restriction endonuclease EcoRI at 37°C for 1 hour, and the digestion product was isolated by electrophoresis on 1.5% agarose gel.
  • the osteoprotegerin band was extracted and purified using the Qiagen DNA gel purification kit, following the manufacturer's protocol.
  • pCI.tTA.neo.mGM-CSF (henceforth referred to as pCI) (kindly provided by S. Aga-Mohammadi) and pHR'-CMV.LacZ (henceforth refened to as pHR') (a generous gift from D. Trono) were chosen as the plasmid and retroviral vectors, respectively.
  • pCI pCI.tTA.neo.mGM-CSF
  • pHR'-CMV.LacZ pHR'
  • a 3 ⁇ g quantity of pCI was digested with BamHI at 37°C for 1 hour, yielding the linearized pCI backbone and the mGM-CSF insert, which is flanked by two BamHI restriction sites.
  • a 3 ⁇ g quantity of pHR' was digested simultaneously with BamHI and Xhol at 37°C for 1 hour, yielding the linearized pHR' backbone and the LacZ insert, which is flanked by a BamHI site at the 5' terminus and by a Xhol site at the 3' terminus.
  • the products of both digestion reactions were run on 0.7% agarose gel.
  • the linearized pCI and pHR', which localized to their expected size positions, were extracted, and purified from the gel using the Qiagen DNA gel purification kit.
  • the osteoprotegerin gene was amplified by polymerase chain reaction (PCR), using 5' and 3' primers containing two tandem Bam HI sites and two tandem Xhol sites (5' Bam HI: GGATCCGGATCCGTATATATAACGTGATGAGC (SEQ ID NOT); 3' Bam HI: GGATCCGGATCCTTATCATCCATGGGATCTCG (SEQ ID NO:2); 5' Xhol: CTCGAGCTCGAGGTATATATAACGTGATGAGC (SEQ ID NO:3); 3' Xhol: CTCGAGCTCGAGTTATCATCCATGGGATCTCG (SEQ ID NO:4)).
  • PCR polymerase chain reaction
  • pCI and pHR'backbones were treated with 1 ⁇ g of alkaline phosphatase (New England Biolabs, Beverly MA) for 1 hour, in order to prevent self-ligation and recircularization. The enzymes used at each reaction were heat-inactivated between each step. The pCI backbone and osteoprotegerin insert were then combined in solution in a 3-to-l molar ratio in favor of the insert. A similar solution was prepared with the pHR' backbone and the osteoprotegerin insert. DNA recombination was performed with the DNA rapid ligation kit (Boehringer, Indianapolis, IN) at room temperature over 5 minutes.
  • PCI-osteoprotegerin and pHR' -osteoprotegerin recombinant vectors were then used to transform supercompetent Sure2 E. coli (Stratagene, San Diego, CA), following the manufacturer's protocol.
  • the transformed cells were selected through growth on ampicillin-containing LB-agar plates.
  • the resulting colonies were grown and screened for the pCI-osteoprotegerin and pHR'- osteoprotegerin recombinant plasmids using restriction sites unique and asymmetrical within the backbones and osteoprotegerin insert: for pCI- osteoprotegerin, Bsu36I for presence of osteoprotegerin, and BstEII for orientation of the insert; for pHR' -osteoprotegerin, BstEII for presence of osteoprotegerin, and Kpnl for its orientation.
  • 293 T cells were then transfected with the pHR' -osteoprotegerin construct, thus producing replication-incompetent retroviral vectors.
  • An adenoviral vector for osteoprotegerin was synthesized in the following way.
  • the pGEM-T-easy-osteoprotegerin parent construct was digested with EcoRI, and the osteoprotegerin insert was isolated and purified after gel electrophoresis as described above.
  • the osteoprotegerin sequence was then amplified by PCR, using 5' and 3' primers both containing two tandem BamHI restriction sites.
  • the amplified osteoprotegerin product with added BamHI sites at both termini was then ligated into the pCR2.1 TA backbone (Invitrogen, Carlsbad, CA) in a 1-to-l insert-to-backbone ratio.
  • the ligation products were then used to transform Inv2- ⁇ F' competent E.
  • the transformed cells were then color- selected through growth on X-gal-coated, ampicillin-containing LB-agar plates. The resulting colonies were grown and screened for the PCR2.1 -osteoprotegerin recombinant plasmids using restriction sites unique and asymmetrical within the backbone and osteoprotegerin insert, using Bsu36I for the presence of osteoprotegerin. Osteoprotegerin DNA was subsequently digested from the pCR2.1 backbone using BamHI endonuclease. The osteoprotegerin insert was then ligated into the shuttle vector of the pQBI-AdCMV5-adenovirus.
  • the orientation within the shuttle vector was determined using orientation cutting with Aatl.
  • the shuttle vector and adenovirus backbones were then packaged and grown in 293 T cells and functional clones were localized by the presence of cell lysis.
  • the resulting vector consists of the osteoprotegerin insert within a replication-incompetent adenovirus.
  • Example 2 In Vivo Murine Model for Human Multiple Myeloma Materials and Methods Cell Line
  • the human myeloma cell line ARH-77 is obtained from the American
  • Type Culture Collection (Rockville, MD). Cells are maintained in RPMI-1640 (Gibco, Grand Island, NY) supplemented with 100 ⁇ M L-glutamine, 10% fetal bovine serum, 100 ⁇ g/ml of penicillin, and 100 ⁇ g/ml of streptomycin. Prior to inoculation into mice, ARH-77 cells are washed and suspended at an appropriate concentration in sterile PBS. Conditioned media from the cultures is collected and concentrated 4X using a Microconcentrator Centriprep 3 (Amicon, Danvers, MA). Mice
  • SCID mice 6 to 8 wk of age, are obtained from a specific-pathogen-free colony. Inadiation and Inoculation
  • Recipient mice are exposed to 150-250 cGy (rads) of radiation from a Y source. Cells are inoculated into mice 24 hours after total-body irradiation.
  • mice are given a single i.v. injection of 0.1 to 10 x 10 6 cells in the tail vein.
  • mice are then followed-up weekly by measurement of serum calcium levels and whole body x-rays.
  • all mice are anesthetized with methoxyflurane (Pitman Moore, Mundelein, IL) and killed by cervical dislocation.
  • Manow cell and manow plasma were then isolated from long bones. Vertebral bones are dissected free of sunounding tissue and used for bone histomo ⁇ hometry studies. Histopathology
  • Bones from all animals are fixed in 10% phosphate-buffered formalin for 24 to 48 hours, decalcified in 14% EDTA for 2 to 3 weeks, processed through graded alcohols, and embedded in paraffin wax.
  • Serial sections (3 ⁇ m thick) of vertebral bodies are cut at various levels and stained with hematoxylin, eosin, orange G, and phloxine for histologic analysis. Consecutive sections (2 ⁇ m thick) are also taken at various levels to allow the examination of the same cell for expression of TRAP, a marker enzyme of osteoclasts. These sections are deparaffmized in xylene and immersed in acetone for 5 minutes.
  • the air-dried peripheral blood smears from SCID mice are stained with a Baxter staining kit (Baxter, Miami, FL). Briefly, smears are fixed with Diff-Quik fixative (1.8 mg/liter of triarylmethane dye: 100% PDC in methyl alcohol) for 5 seconds, air dried for 5 minutes, and then stained with Diff-Quik Solution I (1 g/liter of xanthene dye: 100% PDC:buffer:0.01% NaN 3 ) for 5 seconds and Diff-Quik Solution II (1.25 g/liter of triazine dye mixture:100% PDC:0.625 g/liter of azure Ag 0.625 g/liter of methylene blue:buffer) for 5 seconds. Slides are then rinsed in distilled H 2 O. Collection of bone manow plasma and assay of early osteoclast precursors (colony-forming unit-granulocyte-macrophage [CFU-GM])
  • Femurs are removed aseptically and dissected free of adhering tissue.
  • the ends of the femurs are cut with a scalpel blade and the manow is flushed with 5 mL of ⁇ -minimal essential medium ( ⁇ -MEM) containing 0.1% (vol/vol) penicillin-streptomycin (Gibco) using a 25-gauge needle.
  • ⁇ -MEM ⁇ -minimal essential medium
  • Sibco penicillin-streptomycin
  • the cell suspension is centrifuged at 400 g for 10 minutes and bone manow plasma is collected and concentrated 5X using a Microconcentrator (Amicon, Danvers, MA). Bone manow cells (5 x 10 6 /mL) are resuspended in ⁇ -MEM containing
  • FCS Hyclone Laboratory
  • the nonadherent bone marrow cells (10 5 /mL) are plated on 35-mm tissue culture dishes (Falcon, Lincoln Park, NJ) in 1 mL of 0.8% methylcellulose (Aldrich co., Milwaukee, WI), supplemented with 20% FCS, 1% bovine serum albumin (BSA; Sigma Chemical Co., St Louis, MO), and 1.25 ng/mL of recombinant murine granulocyte-macrophage colony-stimulating factor (rmGM-CSF; Immunex Co., Seattle, WA) as the source of colony-stimulating activity.
  • BSA bovine serum albumin
  • rmGM-CSF murine granulocyte-macrophage colony-stimulating factor
  • Timed-pregnant rats are injected with 250 ⁇ Ci of 45 CaCl 2 at day 18 of gestation. One day later, the rats are killed by cervical dislocation and the embryos removed.
  • the explanted radii and ulnae are cultured on circles of mixed ester membrane filters (0.45 ⁇ m; Whatman, Hillsboro, OR) on stainless steel grids in 0.5 mL of chemically defined medium (Sigma) supplemented with 1 mg/mL BSA (Sigma) and penicillin-streptomycin (50 U/mL and 50 mg/mL, respectively) in 5% C0 2 in air at 37°C, as modified by Raisz and Niemann (1969).
  • the radii and ulnae are incubated for 24 hours in control media to allow for the removal of the exchangeable 45 Ca before transfening to equilibrated control or experimental media.
  • Experimental media contains varying concentrations of either bone manow plasma from osteoprotegerin expressing ARH-77 mice, or control ARH-77 mice, media conditioned by ARH-77 cells in vitro, or untreated culture media. Control or experimental media are then changed after 72 hours.
  • the bone explants are incubated for a total of 5 days. Bone-resorbing activity is measured as the percentage of total 45 Ca released from the bone into the media over the 5 days of incubation. Assay of bone-resorbing cytokines
  • human and murine cytokines that induce bone reso ⁇ tion are measured in the peripheral blood sera and bone manow plasma of osteoprotegerin expressing ARH-77, control ARH-77 mice, and the ARH-77 cell conditioned media using commercially available enzyme- linked immunosorbent assay (ELISA) kits (Endogen, Boston, MA).
  • ELISA enzyme- linked immunosorbent assay
  • the ARH-77 murine model consists of injecting a human myeloma cell line as a xenograft in severe combined immunodeficient (SCID) mice.
  • SCID severe combined immunodeficient
  • the bone loss, spinal compression, shortened survival, and serum monoclonal immunoglobulin peak characterizing this system have made it a favored multiple myeloma model.
  • the osteoclast overactivation that characterizes multiple myeloma is the common denominator of several other metabolic bone diseases such as Paget's disease and osteoporosis.
  • ARH-77 myeloma cells are transduced with recombinant virus comprising osteoprotegerin nucleic acid, and osteoprotegerin concentrations in the conditioned medium are determined, e.g., by Western blot/ELISA and by TRAP -based osteoclast formation cell culture assay. These results are compared to ARH-77 cells transduced with either the antisense osteoprotegerin sequence or with vectors lacking osteoprotegerin, and to untransduced (control) ARH-77 cells. Mice are then injected with either osteoprotegerin expressing ARH-77 cells or with control ARH-77 cells.
  • mice that survive inadiation develop hind limb paralysis 28 to 35 days after the injection of the cells and lose 10% of their lean body mass by the time they become paraplegic.
  • Serum calcium levels, serum bone reso ⁇ tion markers and total body X-ray are used to evaluate the mice prior to sacrifice, e.g., for hypercalcemia, bone reso ⁇ tion and formation of osteolytic lesions.
  • mouse bones are studied histomo ⁇ hometrically to determine the efficacy of osteoprotegerin gene expression in preventing the increased osteoclast numbers and activity in control mice.
  • Manow plasma is analyzed for cytokine levels and manow cells for osteoclast colony formation.
  • Manow plasma is also analyzed using a bone reso ⁇ tion assay.
  • Cytokine levels in the blood and serum are determined.
  • Control ARH-77 mice develop hypercalcemia approximately 5 days after becoming paraplegic. Multiple lytic lesions and diffuse osteopenia are detected in these hypercalcemic mice by x-rays. Hypercalcemia and lytic bone lesions are reduced or absent in mice transplanted with osteoprotegerin expressing ARH-77 cells relative to control mice.
  • Bone manow plasma from ARH-77 mice induces significant bone reso ⁇ tion in the fetal rat long bone reso ⁇ tion assay when compared with bone manow plasma from osteoprotegerin-transduced ARH-77 mice.
  • Conditioned media from ARH-77 cells induces significant bone reso ⁇ tion in the same assay when compared with untreated media.
  • Antibodies against TNF and lymphotoxin fail to block this effect significantly.
  • CFU-GM early osteoclast precursors
  • BM aspirates (10 ml from two 5 ml aspirations) are obtained from the posterior iliac crest of individuals who had given informed consent. Although a small amount of peripheral blood typically is aspirated along with the marrow- derived cells, the peripheral blood does not contain mesenchymal precursor cells (MPCs).
  • MPCs mesenchymal precursor cells
  • the medium is changed to remove nonadherent hematopoietic cells. Thereafter, the medium is changed twice weekly. Approximately 10-12 days after primary culture, the cells are detached from the plate with 0.25% trypsin containing 1 mM EDTA (Gibco) for 5 minutes at 37°C. They are diluted 1 :3 and cyclically replated in fresh medium when cells reached 80% confluence. Retroviral transduction of hMPC hMPCs are grown in DMEM + 20-30% heat-inactivated (HI) FBS for 18- 24 hours following first or second passage to increase cell proliferation and enhance the rate of gene transfer.
  • HI heat-inactivated
  • Osteoblasts from bone biopsies are prepared and maintained in culture as specifically described for this cell type by Robey and Termine (Robey et al., 1985). Bone fragments are dissected from soft tissue, progressively 'minced' to a fine granular consistency, digested with collagenase and placed into culture. Flow cytometric analysis indicates a lack of lymphohemopoietic cells in the osteoblast preparations.
  • Dual energy X-ray abso ⁇ tiometry Measurements of total body bone mineral content are done on a whole- body scanner (Hologic QDR 2000 Densitometer; Hologic, Inc., Waltham, Massachusetts), as described (Koo et al., 1998; Koo et al., 1995a; Koo et al., 1995b).
  • Results Patients are intravenously infused with autologous osteoprotegerin- transduced bone manow. All show engraftment with hemopoietic donor cells. Osteoblasts are cultured from fresh bone biopsy specimens. The individual adherent cells in the cultures have typical osteoblast mo ⁇ hology, express alkaline phosphatase and produce stainable matrix. Flow cytometric analysis of these cells indicates a lack of contaminating lymphohemopoietic cells.
  • Engraftment of autologous osteoprotegerin-transduced bone manow is associated with improvements in bone histology.
  • a specimen of trabecular bone taken after transplantation shows a reduced number of osteoclasts, and reso ⁇ tion lacunae.
  • Replication-incompetent lentiviruses were produced as follows. On day 1, 293T cells (ATCC) were transfected by calcium phosphate precipitation (Promega) with 3 plasmids: one bearing the lentiviral nucleocapsid genes, one with the VSV.G envelope, and one with the osteoprotegerin transgene downstream from a CMV promoter, flanked by 5' and 3' long terminal repeats (LTRs). The 293T cells were subsequently incubated overnight at 37 °C. On day 2, the transfection medium was removed by aspiration and replaced with growth medium (DMEM + 10% fetal calf senim (FCS) + 1% penicillin/streptomycin).
  • DMEM + 10% fetal calf senim (FCS) + 1% penicillin/streptomycin DMEM + 10% fetal calf senim
  • the ARH-77 cells were centrifuged at 1,000 ⁇ m for 5 minutes, washed with serum-free RPMI-1640, centrifuged again at the same settings, then resuspended in serum-free RPMI-1640 + polybrene 16 ⁇ g/ml, to a final density of 1 x 10 6 cells per ml.
  • Ten milliliters (1 x 10 7 cells) were then placed in a T-75 flask, to which 10 ml of the above viral supernatant were then added. Infections were performed in parallel with osteoprotegerin- and lacZ- bearing vectors.
  • Infected ARH-77 cells were incubated for 12 hours at 37°C, then virus was removed by sequential centrifugation and washing with serum-free RPMI-1640. The cells were resuspended and cultured in growth medium under the above conditions for 72 hours, then passaged 24 hours before injection into SCID mice.
  • Transduction efficiency was determined by infecting 1 x 10 6 ARH-77 cells with lentiviral vector bearing lacZ as the reporter gene. Transduced cells were cultured at 37 °C for 72 hours, then stained for X-gal using a standard staining protocol. Osteoprotegerin expression in vitro was determined by infecting 1 x 10 6 ARH-77 cells with lentiviral vector containing the osteoprotegerin transgene. Transduced cells were cultured at 37 °C for 72 hours in 1.5 ml of serum-free, phenol-free medium containing 0.125% bovine serum albumin (BSA). The conditioned medium was then harvested and separated from ARH-77 cells by centrifugation.
  • BSA bovine serum albumin
  • osteoprotegerin concentration of the conditioned medium was measured by enzyme-linked immunosorbent assay (ELISA, felicitly provided by Amgen Co ⁇ ., Thousand Oaks, CA). Readings were divided by 3 to yield ng/ml per 1 x 10 6 cells per day.
  • ELISA enzyme-linked immunosorbent assay
  • Readings were divided by 3 to yield ng/ml per 1 x 10 6 cells per day.
  • Injection of ARH-77 Cells Tnto SCTD Mice Five-week-old female C.B.I 7 SCID mice were obtained and housed according to institutional standards. The experimental protocol was approved by the Mayo Clinic Institutional Animal Care and Use Committee. Twenty four hours before injection, the mice underwent total-body inadiation with 250 rad (0.43 minute exposure to a 137 Cs source, 581 rad/min dose rate).
  • ARH-77 cells were centrifuged and washed once in PBS IX then resuspended in PBS IX at a final concentration of 1 x 10 7 cells per ml. The cells were kept on ice until the time of injection. The mice were placed under general anesthesia and immobilized in a supine position. A volume of 0.1 ml (1 x 10 6 cells) was injected in the left ventricle. A total of 20 mice were injected: 10 with wild-type ARH-77 cells (henceforth the control group), 10 with ARH-77 cells transduced by lentiviral vector with the osteoprotegerin transgene (treatment group). Assessment of Outcome of Experimental Mice
  • mice All 20 injected mice were evaluated immediately following intracardiac injection, then twice daily for the following 60-day experimental period. Two negative control mice (having received neither total-body inadiation nor intracardiac injections) of the same litter were used for comparison.
  • Clinical end-points included food intake, spontaneous and stimulated movement, changes in coat, weight loss, hindlimb paraplegia, and death (either spontaneous or euthanasia for humane reasons).
  • Radiologic end-points included plain skeletal x-rays (at time of sacrifice) and dual-energy x-ray abso ⁇ tiometry (DEXA) using an instrument specifically designed for mouse bone densitometry (PlXImus, Lunar, % CV 0.85).
  • ARH-77 human myeloma cells were infected with lentiviral vectors, then gene transfer efficiency was determined relative to viral dose. This was performed by infecting ARH-77 cells with lentiviral vector containing lacZ as the reporter gene, then by staining the cells for X-gal. Using this approach, the percentage of ARH-77 cells showing blue staining was roughly proportional to the amount of virus used for transduction (data not shown). With the highest vector dose, the percentage of blue-staining ARH-77 cells was 40%. Infection of ARH-77 Cells with Osteoprotegerin Lentiviral Vector
  • FIG. 4 shows the conelation between osteoprotegerin expression, measured in conditioned medium by ELISA, and osteoprotegerin lentiviral vector dose. The highest dose was subsequently used for transduction of the ARH-77 cells injected in the in vivo experiment. Expression of Osteoprotegerin by Infected ARH-77 Cells Over Time Aliquots of the wild-type ARH-77 cells injected in the control group mice and of the osteoprotegerin-transduced ARH-77 cells injected in the treatment group mice were cultured in parallel under similar in vitro conditions.
  • Osteoprotegerin concentration in conditioned medium was measured serially for each cell type over the entire 60-day in vivo experimental period ( Figure 5). Except for a transient drop at day 41, osteoprotegerin expression remained constant throughout the study period (4.31-5.74 ng/ml per 1 x 10 6 cells per day). In contrast, osteoprotegerin expression by the untransduced wild-type cells was 0.007-0.011 ng/ml per 1 x 10 6 per day. The mean osteoprotegerin expression by the transduced ARH-77 cells was thus over 500 times that of the wild-type ARH-77 cells, and was maintained at that level in vitro during the entire 60-day period, without the use of any selection pressure.
  • Treatment 8 which died from technical complications at the time of intracardiac injection of tumor cells, as well as treatment 9 and control 9, which both died prematurely at day 15 of an anesthesia overdose at the time of blood draw.
  • controls 2 and 6 and treatment 4 because of large thoracic tumor and the consequent likelihood of not having received sufficient tumor cells for systemic dissemination.
  • Autopsy, x-ray, or DEXA results are not available for controls 1, 3 and 4, however, those 3 animals showed typical signs of disseminated myeloma and none of the dyspnea characterizing animals dying of extra cardiac tumor. The time frame for death in these 3 mice was also typical for disseminated myeloma.
  • the ARH-77 murine model has yielded radiographically detectable osteolytic lesions in only a small percentage of injected animals. In the present cohort, only one of the control mice (5) showed such lesions, in the right proximal tibia. None of the treatment mice showed radiographic evidence of focal osteolysis.
  • Figures 7-10 compare BMDs for the control mice (left- hand column), negative control (uninjected, intact) mice (middle column), and treatment mice (right-hand column).
  • Figure 7 shows total-body BMD, excluding the skull, given the disproportionately high skull BMD in rodents and its overshadowing effects on results from the remainder of the skeleton.
  • the mean increase in total-body BMD was 11.1 % in Treatment compared to Control mice (% CV 0.85 for DEXA scanner used).
  • the mean increase in for femur, tibia, and vertebral BMD was 8.0%, 10.5%, and 13.5%, respectively ( Figures 8- 10).
  • Myeloma cells secrete a host of mediators, including interleukin- l ⁇ (IL- l ⁇ ), which promote differentiation of osteoclast precursors into mature osteoclasts, and which also enhance the latter' s bone resorbing activity.
  • mediators including interleukin- l ⁇ (IL- l ⁇ ), which promote differentiation of osteoclast precursors into mature osteoclasts, and which also enhance the latter' s bone resorbing activity.
  • mediators are thought to act in both a paracrine and endocrine fashion, thus accounting for the combination of focal and diffuse bone loss encountered in this condition.
  • osteoclasts release from the bone matrix growth factors that are beneficial to the mitotic activity of myeloma cells, hence resulting in a positive feedback loop between myeloma cells and osteoclasts.
  • the ARH-77 murine model was chosen for osteoprotegerin gene transfer, given how osteoclastic overactivation is simultaneously a critical element of myeloma pathophysiology and an ideal target for osteoprotegerin' s therapeutic potential.
  • rate of occurrence of radiographically-detectable osteolytic lesions was too low to detect a difference between treatment and control groups, diffuse bone loss could be assessed with accuracy using DEXA and was found to be prevented when the injected ARH-77 cells were made to express osteoprotegerin above levels expressed by wild-type ARH-77 cells.
  • the increase in BMD was well above the scanner's precision margin.
  • the greatest gain was noted at the vertebral level.
  • osteoprotegerin in the bone microenvironment is enough for osteoclastic inhibition, while not being sufficient to affect systemic levels.
  • the in vitro osteoprotegerin expression spanned the entire 60-day study period, the duration o ⁇ in vivo osteoprotegerin expression is unknown at this juncture, and could potentially be improved further. Nevertheless, 5 of the treatment animals had repeat DEXA scans performed following various intervals, and BMD was maintained at most sites (results not shown).
  • Osteoprotegerin gene transfer is also useful for other tumor models, such as human breast carcinoma and malignant melanoma murine models, which are characterized by a greater incidence of radiographically-detectable osteolytic lesions, as well as osteoporosis animal models.
  • osteoprotegerin viral vectors are administered systemically, targeting expression by using a bone-specific transcription promoter.
  • another osteoprotegerin gene transfer approach is the ex vivo transduction of bone manow progenitor cells, using the intrinsic bone manow tropism of those cells upon systemic reinjection.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Physical Education & Sports Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un procédé visant à inhiber ou à prévenir l'ostéoclastogenèse par l'expression d'ostéoprotégérine dans des cellules de mammifère.
PCT/US2000/023755 1999-08-30 2000-08-30 Utilisation d'adn codant pour l'osteoprotegerine pour prevenir ou inhiber des troubles metaboliques osseux WO2001016299A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU69463/00A AU6946300A (en) 1999-08-30 2000-08-29 Use of dna encoding osteoprotegerin to prevent or inhibit metabolic bone disorders
CA002383043A CA2383043A1 (fr) 1999-08-30 2000-08-30 Utilisation d'adn codant pour l'osteoprotegerine pour prevenir ou inhiber des troubles metaboliques osseux

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US15141599P 1999-08-30 1999-08-30
US60/151,415 1999-08-30

Publications (1)

Publication Number Publication Date
WO2001016299A1 true WO2001016299A1 (fr) 2001-03-08

Family

ID=22538668

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/023755 WO2001016299A1 (fr) 1999-08-30 2000-08-30 Utilisation d'adn codant pour l'osteoprotegerine pour prevenir ou inhiber des troubles metaboliques osseux

Country Status (3)

Country Link
AU (1) AU6946300A (fr)
CA (1) CA2383043A1 (fr)
WO (1) WO2001016299A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002081521A2 (fr) * 2001-04-03 2002-10-17 Société des Produits Nestlé S.A. Osteoprotegerine dans le lait
KR100427299B1 (ko) * 2001-08-10 2004-04-14 한국생명공학연구원 인체 골 재흡수 억제인자（ｈＯＰＧ）를 생산하는 재조합플라스미드 ｐＧＨＯＰＧ（ＫＣＴＣ １０１９ＢＰ）
US6884598B2 (en) 2000-09-22 2005-04-26 Immunex Corporation Screening assays for agonists and antagonists of receptor activator of NF-κB

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0784093A1 (fr) * 1995-12-22 1997-07-16 Amgen Inc. Ostéoprotégerin

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0784093A1 (fr) * 1995-12-22 1997-07-16 Amgen Inc. Ostéoprotégerin

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HESS P: "GENE THERAPY. A BRIEF REVIEW", CLINICS IN LABORATORY MEDICINE,GB,W.B. SAUNDERS CO., LONDON, vol. 16, no. 1, 1 March 1996 (1996-03-01), pages 197 - 211, XP000653352, ISSN: 0272-2712 *
SIMONET W ET AL: "Osteoprotegerin: a novel secreted protein involved in the regulation of bone density", CELL,US,CELL PRESS, CAMBRIDGE, NA, no. 89, 18 April 1997 (1997-04-18), pages 309 - 319, XP002077048, ISSN: 0092-8674 *
SMITH: "VIRAL VECTORS IN GENE THERAPY", ANNUAL REVIEW OF MICROBIOLOGY,US,ANNUAL REVIEWS INC., PALO ALTO, CA, vol. 49, 1995, pages 807 - 838, XP002091784, ISSN: 0066-4227 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6884598B2 (en) 2000-09-22 2005-04-26 Immunex Corporation Screening assays for agonists and antagonists of receptor activator of NF-κB
US7572594B2 (en) 2000-09-22 2009-08-11 Immunex Corporation Screening assays for agonists or antagonists or receptor activator of NF-κB
WO2002081521A2 (fr) * 2001-04-03 2002-10-17 Société des Produits Nestlé S.A. Osteoprotegerine dans le lait
WO2002081521A3 (fr) * 2001-04-03 2003-08-28 Nestle Sa Osteoprotegerine dans le lait
EP1757619A3 (fr) * 2001-04-03 2007-03-14 Société des Produits Nestlé S.A. Ostéoprotégerine dans le lait
US7749960B2 (en) 2001-04-03 2010-07-06 Nestec S.A. Osteoprotegerin in milk
KR100427299B1 (ko) * 2001-08-10 2004-04-14 한국생명공학연구원 인체 골 재흡수 억제인자（ｈＯＰＧ）를 생산하는 재조합플라스미드 ｐＧＨＯＰＧ（ＫＣＴＣ １０１９ＢＰ）

Also Published As

Publication number Publication date
AU6946300A (en) 2001-03-26
CA2383043A1 (fr) 2001-03-08

Similar Documents

Publication Publication Date Title
KR100319359B1 (ko) flt3수용체에대한리간드
US5591625A (en) Transduced mesenchymal stem cells
Souyri et al. A putative truncated cytokine receptor gene transduced by the myeloproliferative leukemia virus immortalizes hematopoietic progenitors
Umezawa et al. Multipotent marrow stromal cell line is able to induce hematopoiesis in vivo
Mosca et al. Mesenchymal stem cells as vehicles for gene delivery.
US5911983A (en) Gene therapy for Gaucher disease using retroviral vectors
US6156304A (en) Gene transfer for studying and treating a connective tissue of a mammalian host
US6084085A (en) Inducing resistance to tumor growth with soluble IGF-1 receptor
US8071085B2 (en) Primary cultured adipocytes for gene therapy
WO2009011546A2 (fr) Procédé pour favoriser l'auto-renouvellement de cellules souches adultes à l'aide de cellules stromales mésenchymateuses
Hentunen et al. Immortalization of osteoclast precursors by targeting Bcl-XL and Simian virus 40 large T antigen to the osteoclast lineage in transgenic mice.
WO1999000146A1 (fr) Developpement et utilisation de lignees cellulaires pancreatiques humaines
Valtieri et al. Efficient transfer of selectable and membrane reporter genes in hematopoietic progenitor and stem cells purified from human peripheral blood
KR19980703665A (ko) 세포 표면상 제 1 류 ｍｈｃ 단백질의 수준이 낮은 유전적으로변형된 세포의 이식
WO2001016299A1 (fr) Utilisation d'adn codant pour l'osteoprotegerine pour prevenir ou inhiber des troubles metaboliques osseux
JP4834291B2 (ja) Ｓｔａｔ３活性化幹細胞
AU716854B2 (en) Human pancreatic cell lines: developments and uses
US6723561B2 (en) Materials and methods relating to the transfer of nucleic acid into quiescent cells
WO2000012138A2 (fr) Cellules exprimant des molecules immuno-regulatrices et leurs utilisations
JPH11506902A (ja) イン・ビトロｔリンパ球生成系
CA2217131A1 (fr) Cellules modifiees et procedes anti-rejet de xenogreffes
Sandhu et al. Effect of interleukin-6 secreted by engineered human stromal cells on osteoclasts in human bone
Kopantzev et al. Interleukin-2-mediated modulation of plasma cell tumor growth in a model of multiple myeloma
Naito et al. A gene transfer system establishes interleukin-6 neither promotes nor suppresses renal injury
US6984379B1 (en) Gene therapy by administration of genetically engineered CD34+ cells obtained from cord blood

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2383043

Country of ref document: CA

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP