WO2001009353A1 - Sequences genetiques peroxydasiques du tabac - Google Patents

Sequences genetiques peroxydasiques du tabac Download PDF

Info

Publication number
WO2001009353A1
WO2001009353A1 PCT/EP2000/007310 EP0007310W WO0109353A1 WO 2001009353 A1 WO2001009353 A1 WO 2001009353A1 EP 0007310 W EP0007310 W EP 0007310W WO 0109353 A1 WO0109353 A1 WO 0109353A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
gene
peroxidase
nucleic acid
insect
Prior art date
Application number
PCT/EP2000/007310
Other languages
English (en)
Inventor
Lawrence Mark Lagrimini
Nalini Manoj Desai
Original Assignee
Syngenta Participations Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/365,150 external-priority patent/US6278041B1/en
Application filed by Syngenta Participations Ag filed Critical Syngenta Participations Ag
Priority to AU68327/00A priority Critical patent/AU6832700A/en
Publication of WO2001009353A1 publication Critical patent/WO2001009353A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention generally relates to novel peroxidase gene sequences and more particularly to synthetic peroxidase gene sequences optimized for expression in plants.
  • the present invention also relates to methods of making and methods of using the novel peroxidase gene sequences to control insects.
  • Insect pests are a major factor in the loss of the world's commercially important agricultural crops. Broad spectrum chemical pesticides have been used extensively to control or eradicate pests of agricultural importance. Although insecticides have been effective in controlling most harmful insects, there are considerable problems associated with the use of these compounds. Insecticides are expensive and costly to apply. Often repeated applications are necessary for effective control. There is also concern that insects have or will become resistant to many of the chemicals used in controlling them. Insecticides often kill beneficial insects which are pollinators or prey on the herbivorous insects. Additionally, there are environmental hazards associated with the long term use of chemical insecticides.
  • Peroxidases are a subclass of oxido-reductases that use a peroxide such as H 2 O 2 as substrate.
  • Peroxidases are heme-containing monomeric glycoproteins able to bind divalent cations (mainly Ca 2+ , but also Mn 2+ ) (Maranon and Van Huystee, Phytochemistry 37: 1217-1225 (1994)).
  • the prosthetic groups for peroxidase have different roles. While the heme group is involved in catalysis, the divalent cations stabilize the heme moiety, and the glycosyl groups may help to stabilize the peroxidase by decreasing its turnover rate (Maranon and Van Huystee, Phytochemistry 37: 1217-1225 (1994)).
  • Peroxidases are often grouped into anionic, cationic, and neutral forms according to their migration on isoelectric focusing gels. Although as enzymes they are considered to have wide substrate specificity, they do appear to have some substrate "preferences" for different isoenzymes (Van Huystee, Ann. Rev. Plant Physiol., 205-219 (1987)). There are several types of peroxidases and related enzymes including guaiacol peroxidase, NADH peroxidase, cytochrome-C peroxidase, catalase, glutathione peroxidase, L-ascorbate peroxidase, and manganese peroxidase.
  • peroxidases are monomeric proteins which are highly complex enzymes whose activities are closely regulated by the plant. Peroxidases are critical in the biosynthesis of plant cell walls. Peroxidases promote the peroxidative polymerization of the monolignols coniferyl, r-coumaryl, and sinapyl alcohol into lignin (Greisbach, In: The Biochemistry of Plants, Ed. Conn, Academic, New York pp. 457-480 (1991)). Different plant species have varying ratios of the monolignol species assembled in a semi-random fashion (Hwang et al., Carbohydrate Polymers 14:77-88 (1991)). Lignification serves to strengthen and reinforce cell walls. The overall result is a toughening of the plant tissue.
  • a tobacco anionic peroxidase has been utilized to transform N. tabacum and N. sylvestris (Lagrimini, Plant Cell 2:7-18 (1990); Lagrimini, Plant Physiology 96:577-583 (1991 ); both of which are incorporated herein by reference). These transgenic plants constitutiveiy overexpressed a tobacco anionic peroxidase from a CaMV 35S promoter. The same construct has also been utilized to transform tomato plants (Lagrimini et al., J. Am. Soc. Hort. Sci. 777/1012-1016 (1992); Lagrimini era/., Hortscience 28.218-221 (1993); both of which are incorporated herein by reference). Some tissues of these transgenic dicotyledonous plants expressing a tobacco anionic peroxidase gene were resistant to some insects (Dowd et al., presentation at the National Meeting of the Entomological Society of America, Indianapolis, December 1993).
  • the tobacco anionic peroxidase has been utilized to transform Zea maize (WO 98/27218). These transgenic plants constitutiveiy overexpressed a tobacco anionic peroxidase from a CaMV 35S promoter. Maize leaves expressing the tobacco anionic peroxidase enzyme conferred 100% mortality against Ostrinia nubilalis (European com borer) and Heliothis zea (Com earworm), and also had a strong antif eeding effect against Spodoptera frugiperda (Fall armyworm).
  • the present invention addresses the aforementioned needs by providing novel peroxidase gene sequences, including synthetic peroxidase gene sequences optimized for expression in plants.
  • the peroxidase enzymes encoded by the novel gene sequences are highly active against economically important insect pests such as Ostrinia nubilalis (European corn borer), Heliothis zea (Corn earworm), and Spodoptera frugiperda (Fall armyworm).
  • the peroxidase enzymes can be used in multiple insect control strategies, resulting in maximal efficiency with minimal impact on the environment.
  • the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a Nicotiana tomentisiformis anionic peroxidase.
  • the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes an anionic peroxidase that comprises the amino acid sequence set forth in SEQ ID NO:2.
  • the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes an anionic peroxidase, wherein the nucleotide sequence is SEQ ID NO:1.
  • the present invention is further directed to a nucleic acid molecule comprising a synthetic nucleotide sequence that encodes an anionic peroxidase, wherein the synthetic nucleotide sequence has been optimized for expression in plants.
  • the synthetic nucleotide sequence is SEQ ID NO:3 or SEQ ID NO:4.
  • the present invention is further directed to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes an anionic peroxidase, wherein said nucleotide sequence comprises a 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion of SEQ ID NO:3 or SEQ ID NO:4.
  • the present invention also provides a chimeric gene comprising a heterologous promoter sequence operatively linked to a nucleic acid molecule of the invention. Further, the present invention provides a recombinant vector comprising such a chimeric gene. Still further, the present invention provides a host cell comprising such a chimeric gene.
  • a host cell according to this aspect of the invention may be a bacterial cell, a yeast cell, or a plant cell, preferably a plant cell. Even further, the present invention provides a plant comprising such a plant cell.
  • the plant is one of the following agronomically important crops: maize, rice, wheat, barley, rye, rape, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, squash, pumpkin, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum, and sugarcane.
  • the plant is maize.
  • the present invention provides an anionic peroxidase produced by the expression of DNA molecules of the present invention.
  • the peroxidase of the invention has activity against Ostrinia nubilalis (European corn borer), Heliothis zea (Corn earworm), and Spodoptera frugiperda (Fall armyworm).
  • a peroxidase of the invention comprises the amino acid sequence set forth in SEQ ID NO:2.
  • the present invention provides a method of producing an insect- resistant plant, comprising introducing a nucleic acid molecule of the invention into the plant, wherein the nucleic acid molecule is expressible in the plant in an effective amount to control insects.
  • the insects are Ostrinia nubilalis (European corn borer), Heliothis zea (Corn earworm), and Spodoptera frugiperda (Fall armyworm).
  • the present invention provides a method of controlling insects comprising delivering to the insects an effective amount of a peroxidase according to the present invention.
  • the insects are Ostrinia nubilalis (European corn borer), Heliothis zea (Corn earworm), and Spodoptera frugiperda (Fall armyworm).
  • the peroxidase is delivered to the insects orally.
  • activity of the peroxidases of the invention is meant that the peroxidases function as orally active insect control agents, have a peroxidases effect, or are able to disrupt or deter insect feeding, which may or may not cause death of the insect.
  • a peroxidase of the invention is delivered to the insect, the result is typically death of the insect, or the insect does not feed upon the source that makes the peroxidase available to the insect.
  • Associated with / operatively linked refer to two nucleic acid sequences that are related physically or functionally.
  • a promoter or regulatory DNA sequence is said to be “associated with” a DNA sequence that codes for an RNA or a protein if the two sequences are operatively linked, or situated such that the regulator DNA sequence will affect the expression level of the coding or structural DNA sequence.
  • a “chimeric gene” is a recombinant nucleic acid sequence in which a promoter or regulatory nucleic acid sequence is operatively linked to, or associated with, a nucleic acid sequence that codes for an mRNA or which is expressed as a protein, such that the regulator nucleic acid sequence is able to regulate transcription or expression of the associated nucleic acid sequence.
  • the regulator nucleic acid sequence of the chimeric gene is not normally operatively linked to the associated nucleic acid sequence as found in nature.
  • a "coding sequence” is a nucleic acid sequence that is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA. Preferably the RNA is then translated in an organism to produce a protein.
  • control insects means to inhibit, through a toxic effect, the ability of insect pests to survive, grow, feed, and/or reproduce, or to limit insect-related damage or loss in crop plants.
  • To "control” insects may or may not mean killing the insects, although it preferably means killing the insects.
  • a peroxidase means that the peroxidase comes in contact with an insect, resulting in toxic effect and control of the insect.
  • the peroxidase can be delivered in many recognized ways, e.g., orally by ingestion by the insect or by contact with the insect via transgenic plant expression, formulated protein composition(s), sprayable protein composition(s), a bait matrix, or any other art-recognized toxin delivery system.
  • “Expression cassette” as used herein means a nucleic acid sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence.
  • the expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components.
  • the expression cassette may also be one which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
  • the expression cassette is heterologous with respect to the host, i.e., the particular nucleic acid sequence of the expression cassette does not occur naturally in the host cell and must have been introduced into the host cell or an ancestor of the host cell by a transformation event.
  • the expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus.
  • the promoter can also be specific to a particular tissue, or organ, or stage of development.
  • a “gene” is a defined region that is located within a genome and that, besides the aforementioned coding nucleic acid sequence, comprises other, primarily regulatory, nucleic acid sequences responsible for the control of the expression, that is to say the transcription and translation, of the coding portion.
  • a gene may also comprise other 5' and 3' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.
  • Gene of interest refers to any gene which, when transferred to a plant, confers upon the plant a desired characteristic such as antibiotic resistance, virus resistance, insect resistance, disease resistance, or resistance to other pests, herbicide tolerance, improved nutritional value, improved performance in an industrial process or altered reproductive capability.
  • the "gene of ausf may also be one that is transferred to plants for the production of commercially valuable enzymes or metabolites in the plant.
  • a "heterologous" nucleic acid sequence is a nucleic acid sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleic acid sequence.
  • a "homologous" nucleic acid sequence is a nucleic acid sequence naturally associated with a host cell into which it is introduced.
  • Homologous recombination is the reciprocal exchange of nucleic acid fragments between homologous nucleic acid molecules.
  • “Insecticidal” is defined as a toxic biological activity capable of controlling insects, preferably by killing them.
  • a nucleic acid sequence is "isocoding with" a reference nucleic acid sequence when the nucleic acid sequence encodes a polypeptide having the same amino acid sequence as the polypeptide encoded by the reference nucleic acid sequence.
  • nucleic acid molecule or an isolated enzyme is a nucleic acid molecule or enzyme that, by the hand of man, exists apart from its native environment and is therefore not a product of nature.
  • An isolated nucleic acid molecule or enzyme may exist in a purified form or may exist in a non-native environment such as, for example, a recombinant host cell.
  • nucleic acid molecule or “nucleic acid sequence” is a linear segment of single- or double-stranded DNA or RNA that can be isolated from any source.
  • the nucleic acid molecule is preferably a segment of DNA.
  • ORP means open reading frame.
  • a "plant” is any plant at any stage of development, particularly a seed plant.
  • a "plant cell” is a structural and physiological unit of a plant, comprising a protoplast and a cell wall.
  • the plant cell may be in form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, plant tissue, a plant organ, or a whole plant.
  • Plant cell culture means cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development.
  • Plant material refers to leaves, stems, roots, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant.
  • a "plant organ” is a distinct and visibly structured and differentiated part of a plant such as a root, stem, leaf, flower bud, or embryo.
  • Plant tissue as used herein means a group of plant cells organized into a structural and functional unit. Any tissue of a plant in planta or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue culture and any groups of plant cells organized into structural and/or functional units. The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as listed above or otherwise embraced by this definition is not intended to be exclusive of any other type of plant tissue.
  • a "promoter” is an untranslated DNA sequence upstream of the coding region that contains the binding site for RNA polymerase II and initiates transcription of the DNA. The promoter region may also include other elements that act as regulators of gene expression.
  • a "protoplast” is an isolated plant cell without a cell wall or with only parts of the cell wall.
  • Regulatory elements refer to sequences involved in controlling the expression of a nucleotide sequence. Regulatory elements comprise a promoter operably linked to the nucleotide sequence of interest and termination signals. They also typically encompass sequences required for proper translation of the nucleotide sequence.
  • the term "substantially similar”, when used herein with respect to a nucleotide sequence, means a nucleotide sequence corresponding to a reference nucleotide sequence, wherein the corresponding sequence encodes a polypeptide having substantially the same structure and function as the polypeptide encoded by the reference nucleotide sequence, e.g. where only changes in amino acids not affecting the polypeptide function occur.
  • the substantially similar nucleotide sequence encodes the polypeptide encoded by the reference nucleotide sequence.
  • the percentage of identity between the substantially similar nucleotide sequence and the reference nucleotide sequence desirably is at least 80%, more desirably at least 85%, preferably at least 90%, more preferably at least 95%, still more preferably at least 99%.
  • a nucleotide sequence "substantially similar" to reference nucleotide sequence hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 2X SSC, 0.1% SDS at 50°C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 1X SSC, 0.1% SDS at 50°C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1% SDS at 50°C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 0.1 X S
  • Synthetic refers to a nucleotide sequence comprising structural characters that are not present in the natural sequence. For example, an artificial sequence that resembles more closely the G+C content and the normal codon distribution of dicot and/or monocot genes is said to be synthetic.
  • Transformation is a process for introducing heterologous nucleic acid into a host cell or organism. In particular, “transformation” means the stable integration of a DNA molecule into the genome of an organism of interest.
  • Transformed / transgenic / recombinanf refer to a host organism such as a bacterium or a plant into which a heterologous nucleic acid molecule has been introduced.
  • the nucleic acid molecule can be stably integrated into the genome of the host or the nucleic acid molecule can also be present as an extrachromosomal molecule. Such an extrachromosomal molecule can be auto-replicating.
  • Transformed cells, tissues, or plants are understood to encompass not only the end product of a transformation process, but also transgenic progeny thereof.
  • non-transformed refers to a wild-type organism, e.g., a bacterium or plant, which does not contain the heterologous nucleic acid molecule.
  • Nucleotides are indicated by their bases by the following standard abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G).
  • Amino acids are likewise indicated by the following standard abbreviations: alanine (Ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D), cysteine (Cys; C), glutamine (Gin; Q), glutamic acid (Glu; E), glycine (Gly; G), histidine (His; H), isoleucine (He; I), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Tip; W), tyrosine (Tyr; Y),
  • SEQ ID NO:1 is the nucleotide sequence of a native Nicotiana tomentisiformis anionic peroxidase gene.
  • SEQ ID NO:2 is the amino acid sequence of the anionic peroxidase encoded by SEQ ID NO:
  • SEQ ID NO:3 is the nucleotide sequence of a synthetic Nicotiana sylvestris anionic peroxidase gene optimized for expression in plants.
  • SEQ ID NO:4 is the nucleotide sequence of a synthetic Nicotiana tomentisiformis anionic peroxidase gene optimized for expression in plants.
  • SEQ ID NO:5 is PCR primer N-TERM2B used in Example 1.
  • SEQ ID NO:6 is PCR primer C-TERM2B used in Example 1.
  • This invention relates to novel peroxidase gene sequences, including synthetic peroxidase gene sequences optimized for expression in plants.
  • the peroxidase enzymes encoded by the novel gene sequences are highly active against economically important insect pests such as Ostrinia nubilalis (European corn borer), Heliothis zea (Corn earworm), and Spodoptera frugiperda (Fall armyworm).
  • the peroxidase enzymes can be used in multiple insect control strategies, resulting in maximal efficiency with minimal impact on the environment.
  • the present invention is directed to a nucleic acid molecule comprising a nucleotide sequence isolated from Nicotiana tomentisiformis that encodes an anionic peroxidase.
  • a native Nicotiana tomentisiformis anionic peroxidase gene sequence is set forth in SEQ ID NO:1 and the encoded amino acid sequence is set forth in SEQ ID NO:2.
  • the present invention is directed to a nucleic acid molecule comprising a synthetic nucleotide sequence that encodes an anionic peroxidase, wherein the synthetic nucleotide sequence has been optimized for expression in plants.
  • a nucleic acid molecule comprising a synthetic nucleotide sequence that encodes an anionic peroxidase, wherein the synthetic nucleotide sequence has been optimized for expression in plants.
  • heterologous genes can be expressed in plants at high levels without modification, low expression in transgenic plants may result from nucleotide sequences having codons that are not preferred in the transgenic plants. It is known in the art that all organisms have specific preferences for codon usage, and the codons of the nucleotide sequences described in this invention can be changed to conform with particular plant preferences, while maintaining the amino acids encoded thereby.
  • coding sequences that have at least 35% about GC content, preferably more than about 45%, more preferably more than about 50%, and most preferably more than about 60%.
  • Nucleotide sequences which have low GC contents may express poorly in plants due to the existence of ATTTA motifs which may destabilize messages, and AATAAA motifs which may cause inappropriate polyadenylation.
  • preferred gene sequences may be adequately expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific codon preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et al. Nucl. Acids Res.
  • nucleotide sequences are screened for the existence of illegitimate splice sites that may cause message truncation. Changes required to be made within the nucleotide sequences such as those described above are made using techniques of site directed mutagenesis, PCR, and synthetic gene construction and the methods described in the published patent applications EP-385 962 (to Monsanto), EP-359472 (to Lubrizol, and WO 93/07278 (to Ciba-Geigy), each of which is incorporated herein by reference.
  • the methodology described in WO 93/07278 is used to create the synthetic nucleotide sequences shown in SEQ ID NO:3 and SEQ ID NO:4.
  • the synthetic nucleotide sequence shown in SEQ ID NO:3 encodes the same amino acid sequence as that encoded by the Nicotiana sylvestris anionic peroxidase gene disclosed in genbank accession J02979.
  • SEQ ID NO:3 is referred to as a synthetic Nicotiana sylvestris anionic peroxidase gene.
  • the synthetic nucleotide sequence shown in SEQ ID NO:4 encodes the same amino acid sequence as that encoded by SEQ ID NO:1 , i.e., SEQ ID NO:2.
  • SEQ ID NO:4 is referred to as a synthetic Nicotiana tomentisiformis anionic peroxidase gene.
  • the present invention also encompasses recombinant vectors comprising the nucleic acid sequences of this invention.
  • the nucleic acid sequences are preferably comprised in expression cassettes comprising regulatory elements for expression of the nucleotide sequences in a host cell capable of expressing the nucleotide sequences.
  • regulatory elements usually comprise promoter and termination signals and preferably also comprise elements allowing efficient translation of polypeptides encoded by the nucleic acid sequences of the present invention.
  • Vectors comprising the nucleic acid sequences are usually capable of replication in particular host cells, preferably as extrachromosomal molecules, and are therefore used to amplify the nucleic acid sequences of this invention in the host cells.
  • host cells for such vectors are plant cells.
  • such vectors are viral vectors and are used for replication of the nucleotide sequences in particular host cells, e.g. plant cells.
  • Recombinant vectors are also used for transformation of the nucleotide sequences of this invention into host cells, whereby the nucleotide sequences are stably integrated into the DNA of such host cells.
  • the host cells are plant cells, such as maize cells.
  • the peroxidase of the invention is expressed in a plant.
  • transgenic plants expressing effective amounts of the peroxidase protect themselves from insect pests.
  • insect starts feeding on such a transgenic plant, it also ingests the expressed peroxidase. This will deter the insect from further biting into the plant tissue or may even harm or kill the insect.
  • a nucleotide sequence of the present invention is inserted into an expression cassette, which is then preferably stably integrated in the genome of said plant.
  • the nucleotide sequence is included in a non-pathogenic self-replicating virus.
  • Plants transformed in accordance with the present invention may be monocots or dicots and include, but are not limited to, maize, wheat, barley, rye, sweet potato, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, pepper, celery, squash, pumpkin, hemp, zucchini, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tomato, sorghum, sugarcane, sugarbeet, sunflower, rapeseed, clover, tobacco, carrot, cotton, alfalfa, rice, potato, eggplant, cucumber, Arabidopsis, and woody plants such as coniferous and deciduous trees.
  • the transgenic plants of the invention are monocots such as maize, rice, wheat, barley, oats, and sorghum.
  • sequences adjacent to the initiating methionine may require modification.
  • they can be modified by the inclusion of sequences known to be effective in plants.
  • Joshi has suggested an appropriate consensus for plants (NAR 15: 6643-6653 (1987)) and Clontech suggests a further consensus translation initiator (1993/1994 catalog, page 210).
  • These consensuses are suitable for use with the nucleotide sequences of this invention.
  • the sequences are incorporated into constructions comprising the nucleotide sequences, up to and including the ATG (whilst leaving the second amino acid unmodified), or alternatively up to and including the GTC subsequent to the ATG (with the possibility of modifying the second amino acid of the transgene).
  • expression of the nucleotide sequences in transgenic plants is driven by promoters shown to be functional in plants.
  • the choice of promoter will vary depending on the temporal and spatial requirements for expression, and also depending on the target species.
  • expression of the nucleotide sequences of this invention in leaves, in ears, in inflorescences (e.g. spikes, panicles, cobs, etc.), in roots, and/or seedlings is preferred.
  • inflorescences e.g. spikes, panicles, cobs, etc.
  • dicotyledonous promoters are selected for expression in dicotyledons, and monocotyledonous promoters for expression in monocotyledons.
  • monocotyledonous promoters for expression in monocotyledons.
  • Preferred promoters that are expressed constitutiveiy include promoters from genes encoding actin or ubiquitin and the CaMV 35S and 19S promoters.
  • the nucleotide sequences of this invention can also be expressed under the regulation of promoters that are chemically regulated. This enables the peroxidases to be synthesized only when the crop plants are treated with the inducing chemicals.
  • Preferred technology for chemical induction of gene expression is detailed in the published application EP-332 104 (to Ciba- Geigy) and U.S. patent 5,614,395.
  • a preferred promoter for chemical induction is the tobacco PR-1a promoter.
  • a preferred category of promoters is that which is wound inducible. Numerous promoters have been described which are expressed at wound sites and also at the sites of phytopathogen infection. Ideally, such a promoter should only be active locally at the sites of infection, and in this way the peroxidases only accumulate in cells which need to synthesize the peroxidases to kill the invading insect pest.
  • Preferred promoters of this kind include those described by Stanford etal. Mol. Gen. Genet. 215: 200-208 (1989), Xu era/. Plant Molec. Biol. 22: 573-588 (1993), Logemann etal. Plant Cell 1: 151-158 (1989), Rohrmeier & Lehle, Plant Molec. Biol. 22: 783-792 (1993), Firek et al. Plant Molec. Biol. 22: 129-142 (1993), and Warner etal. Plant J. 3: 191-201 (1993).
  • Preferred tissue specific expression patterns include green tissue specific, root specific, stem specific, and flower specific. Promoters suitable for expression in green tissue include many which regulate genes involved in photosynthesis and many of these have been cloned from both monocotyledons and dicotyledons.
  • a preferred promoter is the maize PEPC promoter from the phosphoenoi carboxylase gene (Hudspeth & Grula, Plant Molec. Biol. 12: 579-589 (1989)).
  • a preferred promoter for root specific expression is that described by de Framond (FEBS 290: 103-106 (1991); EP-452269 to Ciba-Geigy).
  • a preferred stem specific promoter is that described in U.S. patent 5,625,136 (to Ciba-Geigy) and which drives expression of the maize trpA gene.
  • transgenic plants expressing at least one of the nucleotide sequences of the invention in a root-preferred or root-specific fashion. Further preferred embodiments are transgenic plants expressing the nucleotide sequences in a wound-inducible or pathogen infection-inducible manner.
  • constructions for expression of peroxidases in plants require an appropriate transcription terminator to be attached downstream of the heterologous nucleotide sequence.
  • terminators are available and known in the art (e.g. tm1 from CaMV, E9 from rbcS). Any available terminator known to function in plants can be used in the context of this invention.
  • Numerous other sequences can be incorporated into expression cassettes described in this invention. These include sequences which have been shown to enhance expression such as intron sequences (e.g. from Adh1 and bronze 1) and viral leader sequences (e.g. from TMV, MCMV and AMV).
  • nucleotide sequences of the present invention may be target expression of different cellular localizations in the plant. In some cases, localization in the cytosol may be desirable, whereas in other cases, localization in some subcellular organelle may be preferred. Subcellular localization of transgene encoded enzymes is undertaken using techniques well known in the art. Typically, the DNA encoding the target peptide from a known organelle-targeted gene product is manipulated and fused upstream of the nucleotide sequence. Many such target sequences are known for the chloroplast and their functioning in heterologous constructions has been shown. The expression of the nucleotide sequences of the present invention is also targeted to the endoplasmic reticulum or to the vacuoles of the host cells. Techniques to achieve this are well-known in the art.
  • Vectors suitable for plant transformation are described elsewhere in this specification.
  • binary vectors or vectors carrying at least one T-DNA border sequence are suitable, whereas for direct gene transfer any vector is suitable and linear DNA containing only the construction of interest may be preferred.
  • direct gene transfer transformation with a single DNA species or co-transformation can be used (Schocher et al. Biotechnology 4: 1093-1096 (1986)).
  • Agrobacterium-medlated transfer transformation is usually (but not necessarily) undertaken with a selectable marker which may provide resistance to an antibiotic (kanamycin, hygromycin or methotrexate) or a herbicide (basta).
  • markers examples include neomycin phosphotransferase, hygromycin phosphotransferase, dihydrofolate reductase, phosphinothricin acetyltransferase, 2, 2-dichloroproprionic acid dehalogenase, acetohydroxyacid synthase, 5-enolpyruvyl-shikimate-phosphate synthase, haloarylnitrilase, protoporhyrinogen oxidase, acetyl-coenzyme A carboxylase, dihydropteroate synthase, chloramphenicol acetyl transferase, and ⁇ -glucuronidase.
  • selectable or screenable marker for plant transformation is not, however, critical to the invention.
  • the recombinant DNA described above can be introduced into the plant cell in a number of art-recognized ways. Those skilled in the art will appreciate that the choice of method might depend on the type of plant targeted for transformation. Suitable methods of transforming plant cells include microinjection (Crossway et al., BioTechniques 4:320-334 (1986)), electroporation (Riggs et al., Proc. Natl. Acad. Sci.
  • a particularly preferred set of embodiments for the introduction of recombinant DNA molecules into maize by microprojectile bombardment can be found in Koziel etal., Biotechnology 11: 194-200 (1993), Hill et al., Euphytica 85:119-123 (1995) and Koziel et al., Annals of the New York Academy of Sciences 792:164-171 (1996).
  • An additional preferred embodiment is the protoplast transformation method for maize as disclosed in EP-292 435. Transformation of plants can be undertaken with a single DNA species or multiple DNA species (i.e. co-transformation) and both these techniques are suitable for use with the peroxidase coding sequence.
  • a nucleotide sequence of the present invention is directly transformed into the plastid genome.
  • Plastid transformation technology is extensively described in U.S. Patent Nos. 5,451 ,513, 5,545,817, and 5,545,818, in PCT application no. WO 95/16783, and in McBride etal. (1994) Proc. Natl. Acad. Sci. USA 91 , 7301-7305.
  • the basic technique for chloroplast transformation involves introducing regions of cloned plastid DNA flanking a selectable marker together with the gene of interest into a suitable target tissue, e.g., using biolistics or protoplast transformation (e.g., calcium chloride or PEG mediated transformation).
  • the 1 to 1.5 kb flanking regions facilitate homologous recombination with the plastid genome and thus allow the replacement or modification of specific regions of the plastome.
  • point mutations in the chloroplast 16S rRNA and rps12 genes conferring resistance to spectinomycin and/or streptomycin are utilized as selectable markers for transformation (Svab, Z., Hajdukiewicz, P., and Maliga, P. (1990) Proc. Natl. Acad. Sci. USA 87, 8526- 8530; Staub, J. M., and Maliga, P. (1992) Plant Cell 4, 39-45).
  • Plastid expression in which genes are inserted by homologous recombination into all of the several thousand copies of the circular plastid genome present in each plant cell, takes advantage of the enormous copy number advantage over nuclear-expressed genes to permit expression levels that can readily exceed 10% of the total soluble plant protein.
  • a nucleotide sequence of the present invention is inserted into a plastid targeting vector and transformed into the plastid genome of a desired plant host. Plants homoplastic for plastid genomes containing a nucleotide sequence of the present invention are obtained, and are preferentially capable of high expression of the nucleotide sequence.
  • the peroxidase coding sequence may be used alone or in combination. That is, one or more peroxidase coding sequences can be inserted into a plant to control different insect pests. This can be accomplished by (1 ) transforming a host plant with a DNA sequence comprising more than one peroxidase coding sequence, (2) transforming a host plant with a DNA sequence comprising a single peroxidase coding sequence and identifying multiple insertions of the DNA sequence into the host genome, or (3) repeated transformation of a host plant with a peroxidase coding sequence until the host plant comprises the desired number of peroxidase coding sequences.
  • the level of insect protection of a plant against a given insect and/or its spectrum of insecticidal activities can also be increased by combining a peroxidase coding sequence with other coding sequences encoding proteins capable of controlling insects.
  • Bacillus thuringiensis is a gram-positive, spore-forming bacterium which produces a parasporal crystal during sporulation (For review see, Koziel etal., Biotech, and Gen. Engin. Reviews 77:171-228 (1993)). These crystals are predominantly comprised of one or more porteins, called ⁇ -endotoxins or insecticidal crystal proteins, known to possess insecticidal activity when ingested by certain insects. Numerous strains of Bt are currently known. Each strain produces differing numbers of ⁇ -endotoxins with various insecticidal activities.
  • Bt endotoxins which can be used in combination with peroxidases include, but are not restricted to CrylA(b) (Koziel et al., Bio/Technology 11: 194-200 (1993)), CrylA(c) (U.S. Patent 5,530,197), Cryl H (also called Cry9C) (Lambert et al. Appl. Environ. Microbiol. 62: 80-86 (1996)), and CrylllA (Adang et al. Plant Mol. Biol. 27: 1131-1145 (1993).
  • CrylA(b) Koziel et al., Bio/Technology 11: 194-200 (1993)
  • CrylA(c) U.S. Patent 5,530,197
  • Cryl H also called Cry9C
  • CrylllA Adang et al. Plant Mol. Biol. 27: 1131-1145 (1993).
  • Pesticidal proteins produced during vegetative growth of Bacillus strains can also be used in combination with peroxidases.
  • VIPs can also be used in combination with peroxidases.
  • VIPs see, Warren etal., WO 94/21795; Warren et al., WO 96/10083; Estruch etal., U.S. Patent No. 5,877,012; and Estruch etal., Proc. Natl. Acad. Sci. USA 93: 5389-5394 (1996).
  • the peroxidase coding sequence can be used to transform a plant at the same time as another insect principle gene (cotransformation), the second insect principle gene can be introduced into a plant which has already been transformed with a peroxidase coding sequence, or by vice versa, or alternatively, transgenic plants, one expressing a peroxidase coding sequence and one expressing a second insect principle can be crossed to bring the coding sequences together in the same plant.
  • a chimeric gene comprising a peroxidase coding sequence of the invention may be propagated in that species or moved into other varieties of the same species, particularly including commercial varieties, using traditional breeding techniques.
  • Particularly preferred plants of the invention include the agronomically important crops listed above.
  • the genetic properties engineered into the transgenic seeds and plants described above are passed on by sexual reproduction and can thus be maintained and propagated in progeny plants.
  • the present invention also relates to a transgenic plant cell, tissue, organ, seed or plant part obtained from the transgenic plant. Also included within the invention are transgenic descendants of the plant as well as transgenic plant cells, tissues, organs, seeds and plant parts obtained from the descendants.
  • the peroxidase coding sequence in the transgenic plant is sexually transmitted.
  • the peroxidase coding sequence is sexually transmitted through a complete normal sexual cycle of the RO plant to the R1 generation.
  • the peroxidase coding sequence is expressed so that the level of peroxidase in the cells, tissues, seeds or plant is increased above the level in the cells, tissues, seeds or plant of a plant which only differ in that the peroxidase coding sequence is absent.
  • the invention further relates to a commercial bag comprising seed of a plant transformed with recombinant DNA comprising a coding sequence encoding peroxidase, wherein expression of peroxidase confers on said plant a phenotypic trait.
  • a commercial bag comprising seed of a transgenic plant wherein expression of peroxidase confers on said plant insect resistance or standability.
  • a further preferred object of the invention is such a commercial bag together with lable instructions for the use of the seed contained therein.
  • the transgenic plants of the invention can be used in methods for controlling insects such as Coleoptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera, Orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, and Trichoptera.
  • insect pests are European corn borer, stalk corn borer, black cutworm, corn earworm, fall armyworm, southwestern corn borer, lesser cornstalk borer, sugarcane borer, western corn rootworm, northern corn rootworm, southern corn rootworm, wireworms, northern masked chafer, southern masked chafer, Japanese beetle, corn flea beetle, maize billbug, corn leaf aphid, corn root aphid, chinch bug, redlegged grasshopper, migratory grasshopper, seedcorn maggot, corn blotch leafminer, grass thrips, thief ant and two-spotted spider mite.
  • the present invention relates to a method for controlling insects by feeding or contacting an insect with an insecticidal amount of transgenic plant cells, preferably monocotyledonous plant cells, wherein the genome of said plant cells encodes a peroxidase of the invention.
  • the peroxidase confers insect resistance to the transgenic plant cells.
  • the transgene encoding the peroxidase constitutes an additional gene inserted into the genome of a progenitor plant which does not naturally encode said peroxidase.
  • Insect resistant plants comprise increased insect resistance over that found in native non-manipulated plants due to increased levels of peroxidase.
  • Maize plants of the present invention are preferably resistant to an insect or insects selected from the group which includes but is not limited to Ostrinia nubilalis, European corn borer; Sesemia nonegrioides, stalk corn borer; Agrotis ipsilon, black cutworm; Helicoverpa zea, corn earworm; Spodoptera frugiperda, fall armyworm; Diatraea grandiosella, southwestern corn borer; Elasmopalpus lignosellus, lesser cornstalk borer; Diatraea saccharalis, sugarcane borer, Diabrotica virgifera virgifera, western corn rootworm, Diabrotica longicomis barberi, northern corn rootworm, Diabrotica undecimpunctata howardi, southern corn rootworm, Melanotus spp., wireworms, Cyclocephala borealis, northern masked chafer (white grub), Cyclocephala immaculata, southern masked chafer (white
  • Sorghum plants of the present invention are preferably resistant to an insect or insects selected from the group which includes but is not limited to Chilo pariellus, sorghum borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn earworm; Elasmopalpus lignosellus, lesser cornstalk borer; Feltia subterranean, granulate cutworm; Phyllophaga crinita, white grub; Eleodes, Conoderus, and Aeolus spp., wireworms; Oulema melanopus, cereal leaf beetle; Chaetocnema pulicaria, corn flea beetle; Sphenophorus maidis, maize billbug; Rhopatosiphum maidis, corn leaf aphid; Sipha flara, yellow sugarcane aphid; Blissus leucopterus leucopterus, chinch bug; Contarinia sorghicola
  • Wheat plants of the present invention are preferably resistant to an insect or insects selected from the group which includes but is not limited to Pseudaletia unipunctata, army worm; Spodoptera frugiperda, fall armyworm; Elasmopalpus lignosellus, lesser cornstalk borer; Agrotis orthogonia, pale western cutworm; Oulema melanopus, cereal leaf beetle; Hypera punctata, clover leaf weevil; Diabrotica undecimpunctata howardi, southern com rootworm; Russian wheat aphid; Schizaphis graminum, greenbug; Macrosiphum avenae, English grain aphid; Melanoplus femurrubrum, redlegged grasshopper; Melanoplus differentialis, differential grasshopper; Melanoplus sanguinipes, migratory grasshopper; Mayetiola destructor, Hessian fly; Sitodiplosis mosellana, wheat midge; Meromyza americana,
  • Rice plants of the present invention are preferably resistant to an insect or insects selected from the group which includes but is not limited to Diatraea saccharalis, sugarcane borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn earworm; Colaspis brunnea, grape colaspis; Lissorhoptrus oryzophilus, rice water weevil; Sitophilus oryzae, rice weevil; Nephotettix nigropictus, rice leaf hopper; Blissus leucopterus leucopterus, chinch bug; and Acrosternum hilare, green stink bug.
  • an insect or insects selected from the group which includes but is not limited to Diatraea saccharalis, sugarcane borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn earworm; Colaspis brunnea, grape colaspis; Lissorhoptrus oryzophilus, rice
  • Barley plants of the present invention are preferably resistant to an insect or insects selected from the group which includes but is not limited to Ostrinia nubilalis, European com borer; Agrotis ipsilon, black cutworm; Schizaphis graminum, greenbug; Blissus leucopterus leucopterus, chinch bug; Acrosternum hilare, green stink bug; Euschistus servos, brown stink bug; Hylemya platura, seedcorn maggot; Mayetiola destructor, Hessian fly; Thysanoptera, Thrips; and Petrobia latens, brown wheat mite.
  • an insect or insects selected from the group which includes but is not limited to Ostrinia nubilalis, European com borer; Agrotis ipsilon, black cutworm; Schizaphis graminum, greenbug; Blissus leucopterus leucopterus, chinch bug; Acrosternum hilare, green stink bug; Euschistus
  • Use of the advantageous genetic properties of the transgenic plants and seeds according to the invention can further be made in plant breeding which aims at the development of plants with improved properties such as tolerance of pests, herbicides, or stress, improved nutritional value, increased yield, or improved structure causing less loss from lodging or shattering.
  • the various breeding steps are characterized by well-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or selecting appropriate descendant plants. Depending on the desired properties different breeding measures are taken.
  • the relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc.
  • Hybridization techniques also include the sterilization of plants to yield male or female sterile plants by mechanical, chemical or biochemical means.
  • Cross pollination of a male sterile plant with pollen of a different line assures that the genome of the male sterile but female fertile plant will uniformly obtain properties of both parental lines.
  • the transgenic seeds and plants according to the invention can be used for the breeding of improved plant lines which for example increase the effectiveness of conventional methods such as herbicide or pestidice treatment or allow to dispense with said methods due to their modified genetic properties.
  • new crops with improved stress tolerance can be obtained which, due to their optimized genetic "equipment" , yield harvested product of better quality than products which were not able to tolerate comparable adverse developmental conditions.
  • Customarily used protectant coatings comprise compounds such as captan, carboxin, thiram (TMTD ® ), methalaxyl (Apron ® ), and pirimiphos-methyl (Actellic ® ). If desired these compounds are formulated together with further carriers, surfactants or application- promoting adjuvants customarily employed in the art of formulation to provide protection against damage caused by bacterial, fungal or animal pests.
  • the protectant coatings may be applied by impregnating propagation material with a liquid formulation or by coating with a combined wet or dry formulation. Other methods of application are also possible such as treatment directed at the buds or the fruit.
  • Example 1 Isolation of an Anionic Peroxidase cDNA from Nicotiana tomentisiformis
  • RNA is isolated from 4 week old leaves of N. tomentisiformis plants. Poly A+ RNA is then obtained from total RNA using an oligo-dT affinity column.
  • PCR primers N- TERM2B: gaagatctaagttgacaatcatgtctttt (SEQ ID NO:5) and C-TERM2B: gaagatctaattaaccctcttgcaatctc (SEQ ID NO:6)
  • N- TERM2B gaagatctaagttgacaatcatgtctttt (SEQ ID NO:5)
  • C-TERM2B gaagatctaattaaccctcttgcaatctc (SEQ ID NO:6)
  • SEQ ID NO:1 is the cDNA sequence of a Nicotiana tomentisiformis anionic peroxidase gene
  • SEQ ID NO:2 is the amino acid sequence of the Nicotiana tomentisiformis anionic peroxidase encoded by SEQ ID NO:1.
  • a maize optimized peroxidase gene is designed by downloading the sequence of the native peroxidase gene cloned from Nicotiana sylvestris, from genbank accession J02979. The deduced amino acid from this sequence is backtranslated using the "Backtranslation" program found in the University of Wisconsin GCG group of programs using a maize preference codon table (Murray et al., Nucl Acids Res. 17:477-498, 1989, incorporated herein by reference). Only the most frequently used maize codon is used for each amino acid, as described in WO 93/07278. The resultant sequence is referred to as a "pure" maize optimized sequence.
  • the "pure" maize optimized sequence is changed further at nucleotide 672 from G to C, at nucleotide 771 from G to C, and at nucleotide 792 from G to C to remove three Pst restriction sites. Further, the G at nucleotide 321 is changed to C to insert a unique Xho ⁇ restriction site.
  • the sequence GGATCCACC (comprising a SamHI restriction site and translation initiation codon neighbor Kozak consensus sequence) is inserted at the 5' end and a termination codon as well as sequence for restriction site Sad is added at the 3' end of the sequence.
  • the gene is designed to be cloned in three fragments.
  • the first fragment nucleotides 1-332, is flanked by SamHI and Xho ⁇ endonuclease restriction enzyme sites.
  • Fragment two nucleotides 319-666, is flanked by restriction sites for Xho ⁇ and Ps/1.
  • the third fragment is flanked by Ps ⁇ and Sad sites.
  • Each fragment is comprised of five pairs of oligonucleotides ranging in size between 40-88 nucleotides, but mostly about 60-65 nucleotides in length. Changes are made to thirteen more nucleotides during the designing of the oligonucleotides to reduce stable secondary structure formation in the single stranded DNA fragments. The sequences are checked to see that the resulting synthetic gene encodes a peptide sequence identical to that of the native gene.
  • the synthetic gene is constructed in three fragments. Each fragment is constructed by hybridization of ten pairs of oligomers 60-75 nucleotides in length representing both strands of the gene. A 15 nucleotide overlap is designed between sequential oligonucleotide pairs for correct orientation and assembly. Oligonucleotides may be synthesized by Genosys Biotechnologies Inc., TX. Each pair of oligomers is hybridized and phosphorylated using the enzyme polynucleotide kinase from New England Biolabs, Inc., MA using conditions specified by the vendor. Five kinased fragment pairs are then hybridized and ligated into a high copy plasmid vector containing an ampicillin resistance gene and transformed into competent DH5 ⁇ cells.
  • the cells are plated onto ampicillin containing media and incubated overnight at 37°C. Colonies are screened for inserted DNA.
  • the DNA is sequenced and clones containing the correct sequence are selected.
  • the three fragments are then joined by restriction digestion, ligation and transformation using the unique restriction sites between the fragnments, viz., Xho ⁇ to join fragments 1 and 2 and Ps ⁇ to join fragments 2 and 3.
  • the sequence of the complete gene is verified and the gene is cloned into plant expression vector cassettes for production of transgenic plants.
  • nucleotide sequence of a synthetic Nicotiana sylvestris peroxidase gene optimized for expression in plants is presented in SEQ ID NO:3.
  • Example 2 The DNA sequence obtained in Example 1 is used as a template for the synthesis of a maize optimized Nicotiana tomentisiformis gene. Alignment of the native Nicotiana tomentisiformis and Nicotiana sylvestris peroxidase genes shows that there is a difference of 18 amino acids between the two genes; four in fragment 1 , 11 in fragment two, and 2 in fragment three. Changes in fragments 1 and 3 are made by PCR mutagenesis using primers containing the specific changes. Fragment 2 is designed as described above in Example 2. The overlapping restriction sites between the fragments are the same as in the Nicotiana syvestris gene, Xho ⁇ between fragments 1 and 2 and Ps ⁇ between fragments 2 and 3. The complete gene is constructed as described above in Example 2.
  • nucleotide sequence of a synthetic Nicotiana tomentisiformis peroxidase gene optimized for expression in plants is presented in SEQ ID NO:4.
  • nucleic acid sequences described in this application can be incorporated into plant cells using conventional recombinant DNA technology. Generally, this involves inserting a coding sequence of the invention into an expression system to which the coding sequence is heterologous (i.e., not normally present) using standard cloning procedures known in the art.
  • the vector contains the necessary elements for the transcription and translation of the inserted protein-coding sequences.
  • a large number of vector systems known in the art can be used, such as plasmids, bacteriophage viruses and other modified viruses.
  • Suitable vectors include, but are not limited to, viral vectors such as lambda vector systems ⁇ gtH , ⁇ gtIO and Charon 4; plasmid vectors such as pBI121 , pBR322, pACYC177, pACYC184, pAR series, pKK223-3, pUC8, pUC9, pUC18, pUC19, pLG339, pRK290, pKC37, pKC101 , pCDNAII; and other similar systems.
  • the components of the expression system may also be modified to increase expression. For example, truncated sequences, nucleotide substitutions or other modifications may be employed.
  • the expression systems described herein can be used to transform virtually any crop plant cell under suitable conditions. Transformed cells can be regenerated into whole plants such that the nucleotide sequence of the invention confer insect resistance to the transgenic plants.
  • Coding sequences intended for expression in transgenic plants are first assembled in expression cassettes behind a suitable promoter expressible in plants.
  • the expression cassettes may also comprise any further sequences required or selected for the expression of the transgene.
  • Such sequences include, but are not restricted to, transcription terminators, extraneous sequences to enhance expression such as introns, vital sequences, and sequences intended for the targeting of the gene product to specific organelles and cell compartments.
  • the selection of the promoter used in expression cassettes will determine the spatial and temporal expression pattern of the transgene in the transgenic plant. Selected promoters will express transgenes in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example) and the selection will reflect the desired location of accumulation of the gene product. Alternatively, the selected promoter may drive expression of the gene under various inducing conditions. Promoters vary in their strength, i.e., ability to promote transcription. Depending upon the host cell system utilized, any one of a number of suitable promoters can be used, including the gene's native promoter. The following are non- limiting examples of promoters that may be used in expression cassettes.
  • Ubiquitin is a gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (e.g. sunflower - Binet et al. Plant Science 79: 87-94 (1991); maize - Christensen etal. Plant Molec. Biol. 12: 619- 632 (1989); and Arabidopsis - Norris etal., Plant Mol. Biol. 21 :895-906 (1993)).
  • the maize ubiquitin promoter has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP-342 926 (to Lubrizol) which is herein incorporated by reference. Taylor et al.
  • pAHC25 a vector that comprises the maize ubiquitin promoter and first intron and its high activity in cell suspensions of numerous monocotyledons when introduced via microprojectile bombardment.
  • the Arabidopsis ubiquitin promoter is ideal for use with the nucleotide sequences of the present invention.
  • the ubiquitin promoter is suitable for gene expression in transgenic plants, both monocotyledons and dicotyledons.
  • Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by the introduction of the appropriate ubiquitin promoter and/or intron sequences.
  • pCGN1761 contains the "double" CaMV 35S promoter and the tml transcriptional terminator with a unique EcoRI site between the promoter and the terminator and has a pUC-type backbone.
  • a derivative of pCGN1761 is constructed which has a modified polylinker which includes Notl and Xhol sites in addition to the existing EcoRI site. This derivative is designated pCGN1761 ENX.
  • pCGN1761 ENX is useful for the cloning of cDNA sequences or coding sequences (including microbial ORF sequences) within its polylinker for the purpose of their expression under the control of the 35S promoter in transgenic plants.
  • the entire 35S promoter-coding sequence-fm/ terminator cassette of such a construction can be excised by Hindlll, Sphl, Sail, and Xbal sites 5' to the promoter and Xbal, BamHI and Bgll sites 3' to the terminator for transfer to transformation vectors such as those described below.
  • the double 35S promoter fragment can be removed by 5' excision with Hindlll, Sphl, Sail, Xbal, or Pstl, and 3' excision with any of the polylinker restriction sites (EcoRI, Notl or Xhof) for replacement with another promoter.
  • modifications around the cloning sites can be made by the introduction of sequences that may enhance translation. This is particularly useful when overexpression is desired.
  • pCGN1761 ENX may be modified by optimization of the translational initiation site as described in Example 37 of U.S. Patent No. 5,639,949, incorporated herein by reference.
  • actin promoter is a good choice for a constitutive promoter.
  • the promoter from the rice Actl gene has been cloned and characterized (McElroy et al. Plant Cell 2: 163-171 (1990)).
  • a 1.3kb fragment of the promoter was found to contain all the regulatory elements required for expression in rice protoplasts.
  • numerous expression vectors based on the Actl promoter have been constructed specifically for use in monocotyledons (McElroy et al. Mol. Gen. Genet. 231 : 150-160 (1991)).
  • promoter- containing fragments is removed from the McElroy constructions and used to replace the double 35S promoter in pCGN1761 ENX, which is then available for the insertion of specific gene sequences.
  • the fusion genes thus constructed can then be transferred to appropriate transformation vectors.
  • the rice Actl promoter with its first intron has also been found to direct high expression in cultured barley cells (Chibbar et al. Plant Cell Rep. 12: 506-509 (1993)).
  • the double 35S promoter in pCGN1761 ENX may be replaced with any other promoter of choice that will result in suitably high expression levels.
  • one of the chemically regulatable promoters described in U.S. Patent No. 5,614,395 may replace the double 35S promoter.
  • the promoter of choice is preferably excised from its source by restriction enzymes, but can alternatively be PCR-amplified using primers that carry appropriate terminal restriction sites. Should PCR-amplification be undertaken, then the promoter should be re-sequenced to check for amplification errors after the cloning of the amplified promoter in the target vector.
  • the chemically/pathogen regulatable tobacco PR- la promoter is cleaved from plasmid pCIB1004 (for construction, see example 21 of EP- 332 104, which is hereby incorporated by reference) and transferred to plasmid pCGN1761 ENX (Uknes et al., 1992).
  • pCIB1004 is cleaved with Ncol and the resultant 3' overhang of the linearized fragment is rendered blunt by treatment with T4 DNA polymerase.
  • the fragment is then cleaved with Hindlll and the resultant PR-1a promoter- containing fragment is gel purified and cloned into pCGN1761ENX from which the double 35S promoter has been removed.
  • Various chemical regulators may be employed to induce expression of the selected coding sequence in the plants transformed according to the present invention, including the benzothiadiazole, isonicotinic acid, and salicylic acid compounds disclosed in U.S. Patent Nos. 5,523,311 and 5,614,395.
  • a promoter inducible by certain alcohols or ketones, such as ethanol, may also be used to confer inducible expression of a coding sequence of the present invention.
  • a promoter is for example the alcA gene promoter from Aspergillus nidulans (Caddick et al. (1998) Nat. Biotechnol 16:177-180).
  • the alcA gene encodes alcohol dehydrogenase I, the expression of which is regulated by the AlcR transcription factors in presence of the chemical inducer.
  • the CAT coding sequences in plasmid palcA:CAT comprising a alcA gene promoter sequence fused to a minimal 35S promoter are replaced by a coding sequence of the present invention to form an expression cassette having the coding sequence under the control of the alcA gene promoter. This is carried out using methods well known in the art.
  • a Glucocorticoid-lnducible Promoter Induction of expression of a nucleic acid sequence of the present invention using systems based on steroid hormones is also contemplated.
  • a glucocorticoid- mediated induction system is used (Aoyama and Chua (1997) The Plant Journal 11 : 605- 612) and gene expression is induced by application of a glucocorticoid, for example a synthetic glucocorticoid, preferably dexamethasone, preferably at a concentration ranging from 0.1 mM to 1 mM, more preferably from 10mM to 10OmM.
  • the luciferase gene sequences are replaced by a nucleic acid sequence of the invention to form an expression cassette having a nucleic acid sequence of the invention under the control of six copies of the GAL4 upstream activating sequences fused to the 35S minimal promoter.
  • the trans-acting factor comprises the GAL4 DNA-binding domain (Keegan et al. (1986) Science 231 : 699-704) fused to the transactivating domain of the herpes viral protein VP16 (Triezenberg et al. (1988) Genes Devel.
  • tissue- or organ-specificity of the fusion protein is achieved leading to inducible tissue- or organ-specificity of the insecticidal toxin.
  • a suitable root promoter is the maize metallothionein-like (MTL) promoter described by de Framond (FEBS 290:103-106 (1991)) and also described in U.S. Pat. No. 5,466,785, which is herein incorporated by reference.
  • This promoter is transferred to a suitable vector such as pCGN1761 ENX for the insertion of a selected gene and subsequent transfer of the entire promoter-gene-terminator cassette to a transformation vector of interest.
  • Wound-inducible promoters may also be suitable for gene expression. Numerous such promoters have been described (e.g. Xu etal. Plant Molec. Biol. 22: 573-588 (1993), Logemann etal. Plant Cell 1: 151-158 (1989), Rohrmeier & Lehle, Plant Molec. Biol.22: 783-792 (1993), Firek etal. Plant Molec. Biol. 22: 129-142 (1993), Warner etal. Plant J. 3: 191-201 (1993)) and all are suitable for use with the instant invention. Logemann etal. describe the 5' upstream sequences of the dicotyledonous potato wunl gene. Xu etal.
  • the gene sequence and promoter extending up to -1726 bp from the start of transcription are presented.
  • this promoter, or parts thereof can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a foreign gene in a pith-preferred manner.
  • fragments containing the pith-preferred promoter or parts thereof can be transferred to any vector and modified for utility in transgenic plants.
  • PPC phosphoenol carboxylase
  • WO 93/07278 describes the isolation of the maize calcium-dependent protein kinase (CDPK) gene which is expressed in pollen cells.
  • CDPK calcium-dependent protein kinase
  • the gene sequence and promoter extend up to 1400 bp from the start of transcription.
  • this promoter or parts thereof can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a nucleic acid sequence of the invention in a pollen-specific manner.
  • transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the transgene and its correct polyadenylation.
  • Appropriate transcriptional terminators are those that are known to function in plants and include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator and the pea rbcS E9 terminator. These can be used in both monocotyledons and dicotyledons.
  • a gene's native transcription terminator may be used.
  • intron sequences have been shown to enhance expression, particularly in monocotyledonous cells.
  • the introns of the maize Adhl gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells.
  • Intron 1 was found to be particularly effective and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis etal., Genes Develop.1: 1183-1200 (1987)).
  • the intron from the maize bronzel gene had a similar effect in enhancing expression.
  • Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.
  • leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells.
  • TMV Tobacco Mosaic Virus
  • MCMV Maize Chlorotic Mottle Virus
  • AMV Alfalfa Mosaic Virus
  • DNA encoding for appropriate signal sequences can be isolated from the 5' end of the cDNAs encoding the RUBISCO protein, the CAB protein, the EPSP synthase enzyme, the GS2 protein and many other proteins which are known to be chloroplast localized. See also, the section entitled “Expression With Chloroplast Targeting" in Example 37 of U.S. Patent No. 5,639,949.
  • cDNAs encoding these products can also be manipulated to effect the targeting of heterologous gene products to these organelles. Examples of such sequences are the nuclear-encoded ATPases and specific aspartate amino transferase isoforms for mitochondria. Targeting cellular protein bodies has been described by Rogers et al. (Proc. Natl. Acad. Sci. USA 82: 6512-6516 (1985)).
  • sequences have been characterized which cause the targeting of gene products to other cell compartments.
  • Amino terminal sequences are responsible for targeting to the ER, the apoplast, and extracellular secretion from aleurone cells (Koehler & Ho, Plant Cell 2: 769-783 (1990)). Additionally, amino terminal sequences in conjunction with carboxy terminal sequences are responsible for vacuolar targeting of gene products (Shinshi et al. Plant Molec. Biol. 14: 357-368 (1990)).
  • the transgene product By the fusion of the appropriate targeting sequences described above to transgene sequences of interest it is possible to direct the transgene product to any organelle or cell compartment.
  • chloroplast targeting for example, the chloroplast signal sequence from the RUBISCO gene, the CAB gene, the EPSP synthase gene, or the GS2 gene is fused in frame to the amino terminal ATG of the transgene.
  • the signal sequence selected should include the known cleavage site, and the fusion constructed should take into account any amino acids after the cleavage site which are required for cleavage. In some cases this requirement may be fulfilled by the addition of a small number of amino acids between the cleavage site and the transgene ATG or, alternatively, replacement of some amino acids within the transgene sequence.
  • Fusions constructed for chloroplast import can be tested for efficacy of chloroplast uptake by in vitro translation of in vitro transcribed constructions followed by in vitro chloroplast uptake using techniques described by Bartlett et al. In: Edelmann etal. (Eds.) Methods in Chloroplast Molecular Biology, Elsevier pp 1081-1091 (1982) and Wasmann etal. Mol. Gen. Genet. 205: 446-453 (1986). These construction techniques are well known in the art and are equally applicable to mitochondria and peroxisomes.
  • the above-described mechanisms for cellular targeting can be utilized not only in conjunction with their cognate promoters, but also in conjunction with heterologous promoters so as to effect a specific cell-targeting goal under the transcriptional regulation of a promoter that has an expression pattern different to that of the promoter from which the targeting signal derives.
  • transformation vectors available for plant transformation are known to those of ordinary skill in the plant transformation arts, and the genes pertinent to this invention can be used in conjunction with any such vectors.
  • the selection of vector will depend upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra. Gene 19: 259-268 (1982); Bevan et al., Nature 304:184-187 (1983)), the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., Nucl. Acids Res 18: 1062 (1990), Spencer et al.
  • vectors are available for transformation using Agrobacterium tumefaciens. These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, Nucl. Acids Res. (1984)) and pXYZ. Below, the construction of two typical vectors suitable for Agrobacterium transformation is described.
  • pclB200 and pCIB2001 are used for the construction of recombinant vectors for use with Agrobacterium and are constructed in the following manner.
  • pTJS75kan is created by Narl digestion of pTJS75 (Schmidhauser & Helinski, J. Bacteriol.
  • Xhol linkers are ligated to the EcoRV fragment of PCIB7 which contains the left and right T-DNA borders, a plant selectable nos/nptll chimeric gene and the pUC polylinker (Rothstein et al., Gene 53: 153-161 (1987)), and the Xhol- digested fragment are cloned into Sa//-digested pTJS75kan to create pCIB200 (see also EP-332 104, example 19).
  • pCIB200 contains the following unique polylinker restriction sites: EcoRI, Sstl, Kpnl, Bglll, Xbal, and Sail.
  • pCIB2001 is a derivative of pCIB200 created by the insertion into the polylinker of additional restriction sites.
  • Unique restriction sites in the polylinker of pCIB2001 are EcoRI, Sstl, Kpnl, Bglll, Xbal, Sail, Mlul, Bell, Avrll, Apal, Hpal, and Stul.
  • pCIB2001 in addition to containing these unique restriction sites also has plant and bacterial kanamycin selection, left and right T-DNA borders for Agrobacterium- mediated transformation, the RK2-derived trfA function for mobilization between E. coli and other hosts, and the Or/Tand O ⁇ V functions also from RK2.
  • the pCIB2001 polylinker is suitable for the cloning of plant expression cassettes containing their own regulatory signals.
  • the binary vector pCIB10 contains a gene encoding kanamycin resistance for selection in plants and T-DNA right and left border sequences and incorporates sequences from the wide host-range plasmid pRK252 allowing it to replicate in both E. coli and Agrobacterium. Its construction is described by Rothstein etal. (Gene 53: 153-161 (1987)).
  • Various derivatives of pCIBIO are constructed which incorporate the gene for hygromycin B phosphotransferase described by Gritz etal. (Gene 25: 179-188 (1983)). These derivatives enable selection of transgenic plant cells on hygromycin only (pCIB743), or hygromycin and kanamycin (pCIB715, pCIB717).
  • Vectors Suitable for non-Agrobacterium Transformation Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation) and microinjection. The choice of vector depends largely on the preferred selection for the species being transformed. Below, the construction of typical vectors suitable for non-Agrobacterium transformation is described.
  • pCIB3064 is a pUC-derived vector suitable for direct gene transfer techniques in combination with selection by the herbicide basta (or phosphinothricin).
  • the plasmid pCIB246 comprises the CaMV 35S promoter in operational fusion to the E. coli GUS gene and the CaMV 35S transcriptional terminator and is described in the PCT published application WO 93/07278.
  • the 35S promoter of this vector contains two ATG sequences 5' of the start site. These sites are mutated using standard PCR techniques in such a way as to remove the ATGs and generate the restriction sites Sspl and Pvull.
  • the new restriction sites are 96 and 37 bp away from the unique Sail site and 101 and 42 bp away from the actual start site.
  • the resultant derivative of pCIB246 is designated pCIB3025.
  • the GUS gene is then excised from pCIB3025 by digestion with Sail and Sad, the termini rendered blunt and religated to generate plasmid pCIB3060.
  • the plasmid pJIT82 is obtained from the John Innes Centre, Norwich and the a 400 bp Smal fragment containing the bar gene from Streptomyces viridochromogenes is excised and inserted into the Hpal site of pCIB3060 (Thompson etal. EMBO J 6: 2519-2523 (1987)).
  • This generated pCIB3064 which comprises the bar gene under the control of the CaMV 35S promoter and terminator for herbicide selection, a gene for ampicillin resistance (for selection in E. coli) and a polylinker with the unique sites Sphl, P ⁇ tl, Hindlll, and BamHI.
  • This vector is suitable for the cloning of plant expression cassettes containing their own regulatory signals.
  • pSOG35 is a transformation vector that utilizes the E. coli gene dihydrofolate reductase (DFR) as a selectable marker conferring resistance to methotrexate.
  • DFR E. coli gene dihydrofolate reductase
  • PCR is used to amplify the 35S promoter (-800 bp), intron 6 from the maize Adhl gene (-550 bp) and 18 bp of the GUS untranslated leader sequence from pSOG10. A 250-bp fragment encoding the E.
  • coli dihydrofolate reductase type II gene is also amplified by PCR and these two PCR fragments are assembled with a Sacl-Pstl fragment from pB1221 (Clontech) which comprises the pUC19 vector backbone and the nopaline synthase terminator. Assembly of these fragments generates pSOG19 which contains the 35S promoter in fusion with the intron 6 sequence, the GUS leader, the DHFR gene and the nopaline synthase terminator. Replacement of the GUS leader in pSOG19 with the leader sequence from Maize Chlorotic Mottle Virus (MCMV) generates the vector pSOG35. pSOG19 and pSOG35 carry the pUC gene for ampicillin resistance and have Hindlll, Sphl, Pstl and EcoRI sites available for the cloning of foreign substances.
  • MCMV Maize Chlorotic Mottle Virus
  • plastid transformation vector pPH143 (WO 97/32011 , example 36) is used.
  • the nucleotide sequence is inserted into pPH143 thereby replacing the PROTOX coding sequence.
  • This vector is then used for plastid transformation and selection of transformants for spectinomycin resistance.
  • the nucleotide sequence is inserted in pPH143 so that it replaces the aadH gene. In this case, transformants are selected for resistance to PROTOX inhibitors.
  • nucleic acid sequence of the invention Once a nucleic acid sequence of the invention has been cloned into an expression system, it is transformed into a plant cell.
  • Methods for transformation and regeneration of plants are well known in the art.
  • Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake, liposomes, electroporation, micro- injection, and microprojectiles.
  • bacteria from the genus Agrobacterium can be utilized to transform plant cells. Below are descriptions of representative techniques for transforming both dicotyledonous and monocotyledonous plants, as well as a representative plastid transformation technique.
  • Transformation techniques for dicotyledons are well known in the art and include Agrobacterium-based techniques and techniques that do not require Agrobacterium.
  • Non- Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This can be accomplished by PEG or electroporation mediated uptake, particle bombardment-mediated delivery, or microinjection. Examples of these techniques are described by Paszkowski et al., EMBO J 3: 2717-2722 (1984), Potrykus et al., Mol. Gen. Genet. 199: 169-177 (1985), Reich et al., Biotechnology 4: 1001-1004 (1986), and Klein et al., Nature 327: 70-73 (1987). In each case the transformed cells are regenerated to whole plants using standard techniques known in the art.
  • Agrobacterium transformation typically involves the transfer of the binary vector carrying the foreign DNA of interest (e.g. pCIB200 or pCIB2001) to an appropriate Agrobacterium strain which may depend of the complement of vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or chromosomally (e.g. strain CIB542 for pCIB200 and pCIB2001 (Uknes et al. Plant Cell 5: 159-169 (1993)).
  • the binary vector carrying the foreign DNA of interest e.g. pCIB200 or pCIB2001
  • an appropriate Agrobacterium strain which may depend of the complement of vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or chromosomally (e.g. strain CIB542 for pCIB200 and pCIB2001 (Uknes et al. Plant Cell 5: 159-169 (1993)).
  • the transfer of the recombinant binary vector to Agrobacterium is accomplished by a triparental mating procedure using E. coli carrying the recombinant binary vector, a helper E. coli strain which carries a plasmid such as pRK2013 and which is able to mobilize the recombinant binary vector to the target Agrobacterium strain.
  • the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (H ⁇ fgen & Willmitzer, Nucl. Acids Res. 16: 9877 (1988)).
  • Transformation of the target plant species by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant and follows protocols well known in the art. Transformed tissue is regenerated on selectable medium carrying the antibiotic or herbicide resistance marker present between the binary plasmid T- DNA borders.
  • Another approach to transforming plant cells with a gene involves propelling inert or biologically active particles at plant tissues and cells. This technique is disclosed in U.S. Patent Nos. 4,945,050, 5,036,006, and 5,100,792 all to Sanford et al. Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and afford incorporation within the interior thereof.
  • the vector can be introduced into the cell by coating the particles with the vector containing the desired gene.
  • the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle.
  • Biologically active particles e.g., dried yeast cells, dried bacterium or a bacteriophage, each containing DNA sought to be introduced
  • Transformation of most monocotyledon species has now also become routine.
  • Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, and particle bombardment into callus tissue. Transformations can be undertaken with a single DNA species or multiple DNA species (i.e. co- transformation) and both these techniques are suitable for use with this invention.
  • Co- transformation may have the advantage of avoiding complete vector construction and of generating transgenic plants with unlinked loci for the gene of interest and the selectable marker, enabling the removal of the selectable marker in subsequent generations, should this be regarded desirable.
  • a disadvantage of the use of co-transformation is the less than 100% frequency with which separate DNA species are integrated into the genome (Schocher etal. Biotechnology 4: 1093-1096 (1986)).
  • Patent Applications EP-292435, EP-392 225, and WO 93/07278 describe techniques for the preparation of callus and protoplasts from an elite inbred line of maize, transformation of protoplasts using PEG or electroporation, and the regeneration of maize plants from transformed protoplasts.
  • Gordon-Kamm etal. Plant Cell 2: 603-618 (1990)
  • Fromm et al. Biotechnology 8: 833-839 (1990)
  • WO 93/07278 and Koziel etal. describe techniques for the transformation of elite inbred lines of maize by particle bombardment.
  • This technique utilizes immature maize embryos of 1.5-2.5 mm length excised from a maize ear 14-15 days after pollination and a PDS-1000He Biolistics device for bombardment. Transformation of rice can also be undertaken by direct gene transfer techniques utilizing protoplasts or particle bombardment. Protoplast-mediated transformation has been described for Japonica-types and /n ⁇ Vca-types (Zhang ef al. Plant Cell Rep 7: 379-384 (1988); Shimamoto et al. Nature 338: 274-277 (1989); Datta et al. Biotechnology 8: 736-740 (1990)). Both types are also routinely transformable using particle bombardment (Christou et al. Biotechnology 9: 957-962 (1991 )). Furthermore, WO 93/21335 describes techniques for the transformation of rice via electroporation.
  • Patent Application EP-332 581 describes techniques for the generation, transformation and regeneration of Pooideae protoplasts. These techniques allow the transformation of Dactylis and wheat. Furthermore, wheat transformation has been described by Vasil etal. (Biotechnology 10: 667-674 (1992)) using particle bombardment into cells of type C long-term regenerable callus, and also by Vasil ef al. (Biotechnology 11: 1553-1558 (1993)) and Weeks et al. (Plant Physiol. 102: 1077-1084 (1993)) using particle bombardment of immature embryos and immature embryo-derived callus.
  • a preferred technique for wheat transformation involves the transformation of wheat by particle bombardment of immature embryos and includes either a high sucrose or a high maltose step prior to gene delivery.
  • any number of embryos (0.75-1 mm in length) are plated onto MS medium with 3% sucrose (Murashiga & Skoog, Physiologia Plantarum 15: 473-497 (1962)) and 3 mg/l 2,4-D for induction of somatic embryos, which is allowed to proceed in the dark.
  • MS medium with 3% sucrose
  • 3 mg/l 2,4-D for induction of somatic embryos, which is allowed to proceed in the dark.
  • embryos are removed from the induction medium and placed onto the osmoticum (i.e. induction medium with sucrose or maltose added at the desired concentration, typically 15%).
  • the embryos are allowed to plasmolyze for 2-3 h and are then bombarded. Twenty embryos per target plate is typical, although not critical.
  • An appropriate gene-carrying plasmid (such as pCIB3064 or pSG35) is precipitated onto micrometer size gold particles using standard procedures.
  • Each plate of embryos is shot with the DuPont Biolistics® helium device using a burst pressure of -1000 psi using a standard 80 mesh screen. After bombardment, the embryos are placed back into the dark to recover for about 24 h (still on osmoticum). After 24 hrs, the embryos are removed from the osmoticum and placed back onto induction medium where they stay for about a month before regeneration.
  • the embryo explants with developing embryogenic callus are transferred to regeneration medium (MS + 1 mg/liter NAA, 5 mg/liter GA), further containing the appropriate selection agent (10 mg/l basta in the case of pCIB3064 and 2 mg/l methotrexate in the case of pSOG35).
  • regeneration medium MS + 1 mg/liter NAA, 5 mg/liter GA
  • selection agent 10 mg/l basta in the case of pCIB3064 and 2 mg/l methotrexate in the case of pSOG35.
  • GA7s sterile containers which contain half-strength MS, 2% sucrose, and the same concentration of selection agent.
  • Nicotiana tabacum c.v. 'Xanthi nc' are germinated seven per plate in a 1" circular array on T agar medium and bombarded 12-14 days after sowing with 1 ⁇ m tungsten particles (M10, Biorad, Hercules, CA) coated with DNA from plasmids pPH143 and pPH145 essentially as described (Svab, Z. and Maliga, P. (1993) PNAS 90, 913-917).
  • Bombarded seedlings are incubated on T medium for two days after which leaves are excised and placed abaxial side up in bright light (350-500 ⁇ mol photons/m 2 /s) on plates of RMOP medium (Svab, Z., Hajdukiewicz, P. and Maliga, P. (1990) PNAS 87, 8526-8530) containing 500 ⁇ g/ml spectinomycin dihydrochloride (Sigma, St. Louis, MO). Resistant shoots appearing underneath the bleached leaves three to eight weeks after bombardment are subcloned onto the same selective medium, allowed to form callus, and secondary shoots isolated and subcloned.
  • Transgenic maize plants demonstrated to express the peroxidase coding sequence are originally evaluated for insecticidal activity against Ostrinia nubilalis (ECB).
  • This first group of bioassays is performed by applying 10 first instar ECB larvae to a leaf cutting that has been placed into a Gelman petri dish with a moistened filter pad to prevent the leaf cutting from drying out. The larvae are allowed to feed undisturbed for two days. A percent mortality reading is taken after two days.
  • Transgenic maize plants expressing the peroxidase enzyme are also assayed for other insecticidal activity by means of additional insect bioassays known in the art.
  • the procedure is similar for any maize plant transformed with any insecticidal gene but is described here using as an example a peroxidase coding sequence.
  • One to four 4 cm sections are cut from an extended leaf of a transformed maize plant. Each leaf piece is placed on a moistened filter disc in a 50 X 9 mm petri dish. Five neonate larvae of the target insect are placed on each leaf piece. Each plant is sampled multiple times for a total of 5-20 larvae per plant. The petri dishes are incubated at 30°C and leaf feeding damage and mortality data are scored at 24, 48, and 72 hours.
  • Maize plants demonstrated to contain the peroxidase coding sequence are also evaluated for insecticidal activity against, for example: Sesemia nonegrioides, stalk corn borer; Agrotis ipsilon, black cutworm; Helicoverpa zea, corn earworm; Spodoptera frugiperda, fall armyworm; Diatraea grandiosella, southwestern corn borer; Elasmopalpus lignosellus, lesser cornstalk borer; Diatraea saccharalis, sugarcane borer, Diabrotica virgifera virgifera, western corn rootworm, Diabrotica longicornis barberi, northern corn rootworm, Diabrotica undecimpunctata howardi, southern corn rootworm, Melanotus spp., wireworms, Cyclocephala borealis, northern masked chafer (white grub), Cyclocephala immaculata, southern masked chafer (white grub), Popillia japonica, Japanese
  • Sorghum plants demonstrated to contain the peroxidase coding sequence by Southern analysis or PCR are evaluated for insecticidal activity against Chilo pariellus, sorghum borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn earworm; Elasmopalpus lignosellus, lesser cornstalk borer; Feltia subterranean granulate cutworm; Phyllophaga crinita, white grub; Eleodes, Conoderus, and Aeolus spp., wireworms; Oulema melanopus, cereal leaf beetle; Chaetocnema pulicaria, corn flea beetle; Sphenophorus maidis, maize billbug; Rhopatosiphum maidis, corn leaf aph ⁇ d;Anuraphis maidiradicis, corn root aphid; Blissus leucopterus leucopterus, chinch bug; Contari
  • Rice plants demonstrated to express the peroxidase coding sequence are evaluated for insecticidal activity against Diatraea saccharalis, sugarcane borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, com earworm; Colaspis brunnea, grape colaspis; Lissorhoptrus oryzophilus, rice water weevil; Sitophilus oryzae, rice weevil; Nephotettix nigropictus, rice leaf hopper; Blissus leucopterus leucopterus, chinch bug; or Acrosternum hilare, green stink bug, using methods well known in the art. Those transgenic rice plants having insecticidal properties are subjected to field trials.
  • Barley plants transformed via biolistics with the synthetic Nicotiana sylvestris peroxidase gene under control of the MTL promoter are assayed for peroxidase enzyme activity using a Bio-Rad Micro Protein Assay. Results are set forth in the table below.
  • Barley plants demonstrated to express the peroxidase coding sequence are evaluated for insecticidal activity against Ostrinia nubilalis, European corn borer; Agrotis ipsilon, black cutworm; Schizaphis graminum, greenbug; Blissus leucopterus leucopterus, chinch bug; Acrosternum hilare, green stink bug; Euschistus servos, brown stink bug; Hylemya platura, seedcorn maggot; Mayetiola destructor, Hessian fly; Thysanoptera, Thrips; or Petrobia latens, brown wheat mite using methods well known in the art. Those transgenic barley plants having insecticidal properties are subjected to field trials.
  • the plants obtained via tranformation with a nucleic acid sequence of the present invention can be any of a wide variety of plant species, including those of monocots and dicots; however, the plants used in the method of the invention are preferably selected from the list of agronomically important target crops set forth supra.
  • the expression of a gene of the present invention in combination with other characteristics important for production and quality can be incorporated into plant lines through breeding. Breeding approaches and techniques are known in the art. See, for example, Welsh J. R., Fundamentals of Plant Genetics and Breeding, John Wiley & Sons, NY (1981); Crop Breeding, Wood D. R.
  • the genetic properties engineered into the transgenic seeds and plants described above are passed on by sexual reproduction or vegetative growth and can thus be maintained and propagated in progeny plants.
  • said maintenance and propagation make use of known agricultural methods developed to fit specific purposes such as tilling, sowing or harvesting.
  • Specialized processes such as hydroponics or greenhouse technologies can also be applied.
  • measures are undertaken to control weeds, plant diseases, insects, nematodes, and other adverse conditions to improve yield.
  • Use of the advantageous genetic properties of the transgenic plants and seeds according to the invention can further be made in plant breeding, which aims at the development of plants with improved properties such as tolerance of pests, herbicides, or stress, improved nutritional value, increased yield, or improved structure causing less loss from lodging or shattering.
  • the various breeding steps are characterized by well-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or selecting appropriate progeny plants.
  • different breeding measures are taken.
  • the relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc.
  • Hybridization techniques also include the sterilization of plants to yield male or female sterile plants by mechanical, chemical, or biochemical means.
  • Cross pollination of a male sterile plant with pollen of a different line assures that the genome of the male sterile but female fertile plant will uniformly obtain properties of both parental lines.
  • the transgenic seeds and plants according to the invention can be used for the breeding of improved plant lines, that for example, increase the effectiveness of conventional methods such as herbicide or pestidice treatment or allow one to dispense with said methods due to their modified genetic properties.
  • new crops with improved stress tolerance can be obtained, which, due to their optimized genetic "equipment” , yield harvested product of better quality than products that were not able to tolerate comparable adverse developmental conditions.
  • germination quality and uniformity of seeds are essential product characteristics, whereas germination quality and uniformity of seeds harvested and sold by the farmer is not important.
  • seed production In seed production, germination quality and uniformity of seeds are essential product characteristics, whereas germination quality and uniformity of seeds harvested and sold by the farmer is not important.
  • Propagation material to be used as seeds is customarily treated with a protectant coating comprising herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides, or mixtures thereof.
  • Customarily used protectant coatings comprise compounds such as captan, carboxin, thiram (TMTD ® ), methalaxyl (Apron ® ), and pirimiphos-methyl (Actellic ® ). If desired, these compounds are formulated together with further carriers, surfactants or application- promoting adjuvants customarily employed in the art of formulation to provide protection against damage caused by bacterial, fungal or animal pests.
  • the protectant coatings may be applied by impregnating propagation material with a liquid formulation or by coating with a combined wet or dry formulation. Other methods of application are also possible such as treatment directed at the buds or the fruit.
  • the seeds may be provided in a bag, container or vessel comprised of a suitable packaging material, the bag or container capable of being closed to contain seeds.
  • the bag, container or vessel may be designed for either short term or long term storage, or both, of the seed.
  • a suitable packaging material include paper, such as kraft paper, rigid or pliable plastic or other polymeric material, glass or metal.
  • the bag, container, or vessel is comprised of a plurality of layers of packaging materials, of the same or differing type.
  • the bag, container or vessel is provided so as to exclude or limit water and moisture from contacting the seed.
  • the bag, container or vessel is sealed, for example heat sealed, to prevent water or moisture from entering.
  • water absorbent materials are placed between or adjacent to packaging material layers.
  • the bag, container or vessel, or packaging material of which it is comprised is treated to limit, suppress or prevent disease, contamination or other adverse affects of storage or transport of the seed.
  • An example of such treatment is sterilization, for example by chemical means or by exposure to radiation.
  • a commercial bag comprising seed of a transgenic plant comprising a gene of the present invention that is expressed in said transformed plant at higher levels than in a wild type plant, together with a suitable carrier, together with label instructions for the use thereof for conferring broad spectrum disease resistance to plants.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Pest Control & Pesticides (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Insects & Arthropods (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention concerne une nouvelle séquence génétique de la peroxydase anionique isolée à partir de Nicotiana tomentisiformis. De plus, les séquences génétiques de peroxydase Nicotiana tomentisiformis et Nicotiana sylvestris synthétiques sont optimisées pour s'exprimer dans les plantes. La nouvelle séquence génétique de la peroxydase peut s'exprimer dans les plantes transgéniques, afin de réguler la présence des insectes.
PCT/EP2000/007310 1999-07-30 2000-07-28 Sequences genetiques peroxydasiques du tabac WO2001009353A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU68327/00A AU6832700A (en) 1999-07-30 2000-07-28 Peroxidase gene sequences from tobacco

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US09/365,150 US6278041B1 (en) 1999-07-30 1999-07-30 Peroxidase gene sequences
US09/365,150 1999-07-30
US16568399P 1999-11-16 1999-11-16
US60/165,683 1999-11-16

Publications (1)

Publication Number Publication Date
WO2001009353A1 true WO2001009353A1 (fr) 2001-02-08

Family

ID=26861608

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2000/007310 WO2001009353A1 (fr) 1999-07-30 2000-07-28 Sequences genetiques peroxydasiques du tabac

Country Status (2)

Country Link
AU (1) AU6832700A (fr)
WO (1) WO2001009353A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0359472A2 (fr) * 1988-09-09 1990-03-21 Mycogen Plant Science, Inc. Gène synthétique d'une protéine-cristal insecticide
WO1998027218A2 (fr) * 1996-12-19 1998-06-25 Novartis Ag Procedes pour conferer a un monocotyledone une resistance aux insectes par l'utilisation d'une sequence codant pour la peroxydase

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0359472A2 (fr) * 1988-09-09 1990-03-21 Mycogen Plant Science, Inc. Gène synthétique d'une protéine-cristal insecticide
WO1998027218A2 (fr) * 1996-12-19 1998-06-25 Novartis Ag Procedes pour conferer a un monocotyledone une resistance aux insectes par l'utilisation d'une sequence codant pour la peroxydase

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CRIQUI M C ET AL: "Characterization of genes expressed in mesophyll protoplasts of Nicotiana sylvestris before the re-initiation of the DNA replicational activity.", MECHANISMS OF DEVELOPMENT, (1992 AUG) 38 (2) 121-32., XP000942991 *
LAGRIMINI L M ET AL: "MOLECULAR CLONING OF COMPLEMENTARY DNA ENCODING THE LIGNIN-FORMING PEROXIDASE FROM TOBACCO MOLECULAR ANALYSIS AND TISSUE-SPECIFIC EXPRESSION", PROC NATL ACAD SCI U S A, (1987) 84 (21), 7542-7546., XP000941390 *
LAGRIMINI L M ET AL: "PEROXIDASE-INDUCED WILTING IN TRANSGENIC TOBACCO PLANTS.", PLANT CELL, (1990) 2 (1), 7-18., XP002093025 *

Also Published As

Publication number Publication date
AU6832700A (en) 2001-02-19

Similar Documents

Publication Publication Date Title
AU2001285900B2 (en) Novel insecticidal toxins derived from bacillus thuringiensis insecticidal crystal proteins
AU2001285900A1 (en) Novel insecticidal toxins derived from Bacillus thuringiensis insecticidal crystal proteins
AU2010330917B2 (en) Combined use of Cry1Ca and Cry1Fa proteins for insect resistance management
US10934330B2 (en) Methods for modulating the activity of insecticidal proteins
EP2198030B1 (fr) Gènes synthétiques codant pour cry1ac
US6277823B1 (en) Insecticidal toxins and nucleic acid sequences coding therefor
CA3076020A1 (fr) Proteines pesticides genetiquement modifiees et procedes de lutte contre les parasites des plantes
US6281413B1 (en) Insecticidal toxins from Photorhabdus luminescens and nucleic acid sequences coding therefor
CN113179823A (zh) 小地老虎的控制
WO2001014562A1 (fr) Toxines insecticides hybrides et sequences d'acide nucleique codant pour ces toxines
WO1999042589A2 (fr) Toxines insecticides de photorhabdus
WO2019094213A1 (fr) Protéine insecticide active contre les hémiptères
KR100649909B1 (ko) 제노르하브두스 네마토필러스로부터의 신규한 살충 독소, 이를 암호화하는 핵산 서열 및 이의 생산 방법
US6278041B1 (en) Peroxidase gene sequences
US6204057B1 (en) Polynucleotides and the proteins encoded thereby, suitable for controlling lamellicorn beetles
US20020038005A1 (en) Novel delta-endotoxins and nucleic acid sequences coding therefor
WO2001009353A1 (fr) Sequences genetiques peroxydasiques du tabac
RU2240003C2 (ru) Выделенная молекула нуклеиновой кислоты, химерный ген, рекомбинантный вектор, штамм бактерий, токсин, инсектицидная композиция, способ получения токсина, способ получения устойчивого к насекомым растения и способ борьбы с насекомыми
CN114680127A (zh) 夜蛾、草螟和螟蛾有害生物的防治
CN114680126A (zh) 夜蛾、草螟和螟蛾有害生物的防治
CN113179822A (zh) 棉铃虫的控制
CN114747590A (zh) 夜蛾、草螟和螟蛾有害生物的防治
MXPA00010308A (en) Novel insecticidal toxins from xenorhabdus nematophilus
AU3028699A (en) Insecticidal toxins from photorhabdus

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP