WO2001005995A1

WO2001005995A1 - Method of preparing cell cultivation supernatant

Info

Publication number: WO2001005995A1
Application number: PCT/JP2000/004776
Authority: WO
Inventors: Kiyoshi Ito; Satoshi Yoshigai; Hitoshi Takahashi; Tadashi Araki; Junko Tokuda; Daisuke Mochizuki; Takeshi Nakamura
Original assignee: Mitsui Chemicals, Inc.
Priority date: 1999-07-15
Filing date: 2000-07-14
Publication date: 2001-01-25
Also published as: AU6018600A

Abstract

A method of preparing a cell cultivation supernatant free from cells and nucleic acid without causing clogging of a filter. It has a high recovery percentage of a desired useful substance produced by the cells. In this method, the cells and the nucleic acid are removed by passing a cultivation product or its processed product obtained by liquid cultivation through a porous filter having a zeta potential.

Description

SEQUENCE LISTING

<110> MITSUI CHEMICALS, INC.

<120> Method for Producing Cel l Culture Supernatant

<130> 00PF204- PCT

<160> 2

<210> 1

<211> 29

K 212> DNA

213〉 Artificial Sequece

<220>

<223> Ol igonucleotide to act as a PGR primer for amplifying of Phytase gene from Schwann iomyces occidental is

C 400> 1

gttcgggtcc ttacattcaa cgcagtggt 29

<210> 2

K 211> 22

<212> DNA

<213> Artificial Sequece

<220>

<223> Oligonucleotide to act as a PCR primer for amplifying of Phytase gene from Schwann i omyces occidental is

<400> 2

caacaaagtc aacatcccta ag 22 1

Specification

Method for producing cell culture supernatant

Technical field

The present invention relates to a method for producing a cell culture supernatant from which cells and nucleic acids have been removed.

Background art

Microorganisms are widely used as hosts for producing useful substances such as organic acids, amino acids, and proteins. In particular, in recent years, a technology for efficiently producing a useful substance using a transformed microorganism into which a gene for an industrially useful protein has been introduced by utilizing genetic engineering technology has become known. .

When a microorganism is subjected to liquid culture and the microorganism secretes and produces a useful substance such as a protein outside the cell, when the microorganism is recovered (purified) from the culture, the microorganism must be removed from the culture. There is. In addition, depending on the purpose of use of the useful substance, it is important to remove foreign substances such as DNA fragments leaked from cells killed during the culture. In particular, when the intended useful substance is used for adding food or feed, and when a transformed microorganism is used, the transformed microorganism cells should be completely removed. Not only is essential, but also it is required not to mix the recombinant DNA fragment introduced into the transformed microorganism.

In general, centrifugal separation, filtration, treatment with a flocculant, membrane separation, etc. are known as methods for removing microbial cells from a microorganism culture solution. However, other methods than membrane separation completely remove the cells. Can not do it. On the other hand, in the case of membrane separation, microbial cells can be completely removed by using an ultrafiltration membrane such as the commonly used 1 \ 1 "Membrane F" membrane, but DNA fragments However, there was a problem that it was not possible to completely eliminate this.

In addition, microorganisms can be cultured at a high concentration (for example, 5 _g ZL or more in dry cell weight) by fed-batch culture using glucose / methanol or the like as a carbon source, or can be cultured for a long period of one day or more (continuous culture). In this case, there are cases where a large amount of viscous substances such as polysaccharides and high molecular components generated by the cells leaked from the cells killed during the culture and the cells are accumulated in the culture solution. In order to almost completely separate and remove microbial cells from such cultures, MF Two

If an ultrafiltration membrane such as a membrane or a UF membrane is used, polysaccharides and polymer components in the culture solution will cause clogging of the membrane, which will hinder filtration. In such cases, not only is it impossible to maintain a practical filtration rate and low pressure drop, but also the target useful substance is simultaneously captured by the membrane, resulting in a reduction in the recovery rate of the useful substance. There were also points.

Disclosure of the invention

Therefore, an object of the present invention is to remove not only cells but also nucleic acids such as DNA fragments when producing a culture supernatant from a cell culture of a microorganism or the like, and the filter is clogged. An object of the present invention is to provide a method for producing a cell culture supernatant, which allows a target substance produced by a cell to be recovered at a high recovery rate without causing cell bleeding. As a result of intensive studies, the inventors of the present application have found that by using a porous filter having a zeta potential, the recovery rate of the target useful substance is not reduced, and the filter is not clogged. The present inventors have found that cells and nucleic acids can be removed, and have completed the present invention.

That is, the present invention relates to a method for producing a culture supernatant from a cell culture, wherein the culture obtained by liquid culturing the cells or a processed product thereof is passed through a porous filter having a zeta potential. A method for producing a culture supernatant, which comprises the step of removing the cells and the nucleic acids.

Further, the present inventors added a chitosan-based flocculant and a polyacrylic acid-based flocculant to a culture solution before subjecting the cell culture to one treatment with a porous filter having a zeta potential. The cells and nucleic acids are firstly removed, and then the obtained primary supernatant is subjected to a single treatment with a porous filter having a zeta potential, without reducing the recovery rate of the target useful substance, and The present inventors have found that cells and nucleic acids can be removed without clogging of filters, and the present invention has been completed. That is, the present invention relates to a method for producing a culture supernatant from a cell culture, wherein the culture obtained by liquid culture of the cells is 1) a chitosan-based culture medium or a processed product thereof. Alternatively, a first step of adding a polyacrylic acid-based flocculant to aggregate the cells and nucleic acids, 2) separating the aggregated cells and nucleic acids to prepare a primary supernatant, 3) The primary supernatant was used as a reagent having a zeta potential. Pass through L filter Three

The present invention provides a method for producing a culture supernatant, which comprises removing the cells and nucleic acids through the third step.

According to the method of the present invention, it is possible to produce a cell culture supernatant from which cells and nucleic acids have been removed without lowering the recovery of the target useful substance and without clogging the filter. Can be.

BEST MODE FOR CARRYING OUT THE INVENTION

"Cells" in the cell culture used in the method of the present invention may be any of microbial cells, plant cells, and animal cells. Cells that produce the desired useful substance and secrete it into the culture supernatant are preferred, and in particular, microbial cells, particularly microbial cells that are transformed with a gene encoding the useful substance and produce the useful substance, are suitable. A simple example can be mentioned.

Examples of preferred microorganisms include gram-negative bacteria such as Escherichia coli and Pseudomonas spp., Gram-philic fungi such as Bacillus sp. Lactic acid bacteria, yeasts such as Saccharomyces sp. And Actinomycetes such as Streptomyces sp.

In particular, Candida yeast is often used not only as a host for producing useful substances such as proteins and aldehydes, but also in recent years, utilizing genetic engineering technology, it has been possible to obtain genes for industrially useful proteins. Techniques for efficiently producing the useful substance using the introduced transformed Candida yeast have become known. In view of the state of the art, preferred microorganisms used in the present invention include Candida yeast, and Candida yeast transformed separately. Further, among the yeasts of the genus Candida, Candida boidini is a typical example.

That is, the yeast of the genus Candida in the present invention is not particularly limited as long as it is capable of efficiently producing an industrially useful substance. Particularly, the gene of the above-mentioned useful protein is introduced by genetic recombination technology. A preferred example is a transformed Candida yeast capable of efficiently producing the useful substance. Four

In addition, useful substances produced by cells are not limited at all, and examples thereof include enzyme proteins such as phytase, cellulase, xylanase, dalcanase, peroxidase, and oxidase, various amino acids, and various physiologically active peptides. Is not limited to these.

In the method of the present invention, a cell culture or a processed product thereof is passed through a filter described below. Here, the cell culture means a culture in which the above-mentioned cells are cultured in a medium containing ordinary organic and Z or inorganic components. The processed product of the cell culture means a product obtained by subjecting the cell culture to some treatment. For example, the processed product is subjected to centrifugation, filtration, coagulant treatment, etc. Treatment of cell cultures from which cells have been primarily removed, cultures that have been sterilized in advance by chemical treatment or heat treatment, and cultures to which the above-mentioned useful protein substrates and inhibitors have been added in advance Means things. Furthermore, in the bioreactor and the like, a liquid containing a useful substance of interest immobilized in a carrier or in contact with cells cultured on the carrier is also included in the “cell culture or processed product thereof” of the present invention. Is done.

The nucleic acid in the present invention may be any nucleic acid contained in a cell culture or a processed product thereof, and may be any of DNA and RNA. Typical examples are DNA fragments derived from chromosomal DNA molecules of cells, such as chromosomal DNA leaked out of cells and physically and chemically fragmented, and alkaline SDS treatment. Examples include DNA molecules that are not insolubilized even after denaturation treatment of DNA molecules, DNA molecules that have not been insolubilized by a coagulant treatment, and DNA molecules that have not been supplemented by treatment with a resin such as a porous membrane or glass beads. . Further, when the cell is a transformed cell, examples thereof include a recombinant expression vector such as a recombinant plasmid vector or a recombinant virus vector used for the transformation and a fragment thereof. According to the method of the present invention, nucleic acids having a size of 100 Kbp or less, more preferably 100 Kbp or less, and particularly about 100 to 10 Kbp can be removed.

In the method of the present invention, the above-described cell culture or a processed product thereof is passed through a porous filter having a zeta potential (hereinafter, sometimes referred to as “r zeta filter”), Five

The cells and nucleic acids are removed. Here, the term “a porous filter having a zeta potential” refers to not only a mechanical filtration action by a porous filter but also a culture or a cell and a nucleic acid in the processed product which are treated by the zeta potential of the filter. Means a porous filter that is also removed by being electrostatically adsorbed to the filter.

The zeta potential of the filter is not particularly limited, but is preferably +5 mV or more with respect to pure water having a pH of 7.0. Further, the pore size of the porous filter is preferably about 0.05 to 20 im.

Zeta filters usually have a basic structure of a porous matrix in which constituent fibers composed of cellulose, low melting point polyester, polyester, polyethylene, polypropylene or a combination thereof are mechanically entangled and Z or adhesively bonded between the fibers. A modifier having a positive zeta potential in a neutral liquid is attached to the porous matrix. The adhesive bonding between the fibers is performed by a method of adhesively bonding the fibers with an adhesive fiber, a method of adhesively bonding the fibers with an adhesive resin, or the like, but is not limited thereto.

Examples of the modifier for imparting a zeta potential include cationic colloidal silica and a polymer having a positive zeta potential in a neutral liquid. Here, preferred examples of the polymer include polyvinyl pyridine-styrene copolymer quaternary chloride, polycation-acrylic copolymer, polyallylamine, polyethylamine, polyethyleneamine, polyethyleneimine, polyamide-epiclorhydrin, and the like. It can be mentioned. In addition, it is desirable that the water-soluble one is cross-linked with a cross-linking agent such as epoxy, melamine, aldehyde, or the like, and is insoluble in water. As described above, it is preferable that these modifiers can impart a zeta potential of +5 mV or more to neutral water.

Further, as a method for attaching these modifiers, it is preferable to impregnate or apply the above-mentioned cationic colloidal silicic acid or polymer in a solution state such as a solvent solution or emulsion solution and to impregnate or coat the porous matrix. According to such an attachment method, the modifier having a positive zeta potential can be attached relatively uniformly to the surface of the porous matrix. 6

The zeta potential can be measured by an ordinary method, and a device for that is also commercially available (for example, an ultrasonic zeta potential measuring device (model: Acoustophor 8000) manufactured by Penkem, a laser zeta manufactured by Coulter) Potential measuring device (model: DELSA-440), laser zeta potentiometer manufactured by Otsuka Electronics Co., Ltd. (model: ELS-8000, ELS-6000, etc.) Zeta potential can be easily measured using such a commercially available device. .

The principle of measuring the zeta potential by a conventional method is as follows. In other words, when two phases are in contact with each other, when a voltage is applied externally between them, both phases move relative to each other, or conversely, both phases move relatively. The electrokinetic phenomenon, in which an electric field appears in the direction parallel to the interface, was measured, and the zeta potential, which indicates the charge state at both interfaces, was indirectly determined from each calculation formula using the measurement results. For example, when the streaming potential is used, the zeta potential is obtained by the following equation (1).

ξ = {(ν 'λ) / (ε ₀ ■ ε _Γ )}-Ε / Ρ ■ · (1)

Where? Is the viscosity of the liquid, λ is the conductivity of the liquid, is the dielectric constant of vacuum, s _r is the relative dielectric constant of the liquid, E is the streaming potential, and P is the flowing pressure.

In the equation (1), the dielectric constant ε (= ε. _Sr ) is based on the Helmholtz molecular capacity theory used in the derivation process of the equation, and the electric charge of the interface electric double layer is Used to represent. In Equation (1), the conductivity λ is based on Ohm's law used in the process of deriving the equation, and is proportional to the magnitude of the streaming potential generated by the movement of the electric charge at the interface electric double layer. Used as a count. The dielectric constant ε and the conductivity λ must accurately consider the dielectric constant and conductivity of the interfacial electric double layer.However, assuming that they are equal to the dielectric constant and conductivity of the liquid, The values described in the literature for pure liquids are used. Then, when a liquid is caused to flow in one direction to the dispersion layer or the packed bed, the flow potential 間に generated between the electrodes and the flow pressure させ for flowing the liquid are measured and applied to the above equation (1). Calculates the resizer potential ^.

Conventionally, the zeta potential has been measured and calculated as described above. For example, in the flowing potential method, における in equation (1) is measured with a pair of electrodes installed in the measurement system. Since this E depends on the dielectric constant and the electrical conductivity between the electrodes in principle, the value of E slightly varies depending on the measurement system. Since phenomena in the system interact, strictly speaking, the values of the dielectric constant and conductivity should assume both the electric charge of a liquid and a solid, but in general, a pure liquid The zeta potential is determined using the literature value of.

Above many? The pore size of the L-type matrix may be evenly distributed, but should the pore size on the inflow side be larger than on the water outflow side? It is desirable that the L diameter is distributed. With such a structure, relatively large particles that cause contamination are collected on the inflow side, and relatively small particles are collected on the outflow side, so that clogging hardly occurs. Or many with multiple zeta potentials with different average pore sizes? The same can be achieved with an L filter. That is, first, the first porous filter having a zeta potential having a large average diameter (for example, about 5 to 2 Om in average diameter) is processed, and then a first porous filter having a smaller average diameter (for example, By treating with a second porous filter having a zeta potential, clogging hardly occurs and the life of the filter can be extended. Furthermore, it is also preferable to use a porous filter having three or more kinds of zeta potentials having different average pore diameters, and to perform the treatment in order from one having a larger average pore diameter. When a plurality of filters are used, they can be used by arranging them in series in descending order of average pore diameter from the upstream side.

The zeta filter itself is well known and is commercially available. A commercially available porous filter that claims to cause adsorption based on zeta potential satisfies the above-mentioned zeta potential of +7.0 mV with respect to pure water having a pH of 7.0, and the method of the present invention. Can be preferably used. An example of one such commercially available filter is the Zetaplus (registered trademark) series, manufactured by CUNO, IC. Of Connecticut, USA (and Cuno Corporation of Yokohama, Japan, a Japanese corporation), ie, Zetablass® filters S Series, C Series, A, Series, U Series, LA Series and the like. Since these have a lineup of those having various pore sizes, desired filters can be used in combination as appropriate as described above. 8

On the other hand, when cells such as microbial cells are cultured at high density, or as a result of long-term culture such as continuous culture, leakage from cells that have died during culture, and viscosity of polysaccharides and polymer components produced by the cells, etc. If substances are increasing in the culture solution, treating the culture solution directly with a zeta filter makes it difficult to separate the yeast cells from the culture supernatant, and has a practical filter life and filtration. Maintaining speed and low pressure drop can be difficult. In that case, it is more preferable to subject the primary supernatant liquid from which yeast cells have been removed to some extent to a zeta filter treatment by a method such as a flocculant treatment or centrifugation as a pretreatment.

In particular, in the present invention, a preferred example is a method of adding a chitosan-based and / or Z- or polyacrylic-acid-based flocculant to the culture solution or the processed product of the culture solution.

Coagulants are used in industrial wastewater such as papermaking, mining, civil engineering, cement manufacturing, aluminum refining and food processing, as well as in the sedimentation and dehydration of inorganic and organic sludge in the process. Widely used for etc. In other words, if the size of the solid suspended in the liquid is about 1 or less, it becomes difficult to separate the solid by physical methods such as ordinary precipitation and filtration. Have been. Chemicals that aggregate suspended fine particles into large aggregates, thereby facilitating sedimentation and filtration are called flocculants. Organic and inorganic flocculants are used.

In the method of the present invention, a chitosan-based flocculant and a Z or acrylic acid-based flocculant, which are organic polymer-based flocculants, are used.

Chitosan is obtained by heating chitins of crustaceans such as renji and shrimp with a concentrated alkaline solution to at least partially deacetylate the acetylamino group attached to the cyclic portion of the sugar unit of chitin. Things. The acetylation rate of the chitosan used is not particularly limited, but is preferably about 67 to 85 mol%. In the present invention, such chitosan can be preferably used as a flocculant. Also, a chitosan derivative in which an anionic group, for example, a carboxyl group, a sulfone group, or the like is introduced into chitosan can be preferably used. Thus, Chitosa 9

The chitin-based flocculants include chitosan itself and its derivatives. The chitosan used as the coagulant preferably has a large molecular weight, more preferably 20,000 or more, particularly preferably about 50,000 to 400,000.

In addition, such a chitosan-based flocculant itself preferably used in the method of the present invention is well known, is commercially available, and a commercially available product can be preferably used. As an example of a marketed product, there may be mentioned, for example, Crime Bar 101 manufactured by Kurita Kogyo Co., Ltd. of Tokyo, Japan, but is not limited to this.

As the polyacrylic acid-based flocculant, a polymer comprising a repeating unit represented by the following general formula can be preferably used.

(Wherein, X is a substituent selected C00H, G00Na, from C00NH _2. X is polyacrylic acid (anionic For G00H), polyacrylic acid sodium For GOONa (cationic) And polyacrylamide (non-ionic), each of which is used as a polyacrylic acid-based flocculant The molecular weight of the polyacrylic acid-based flocculant is not particularly limited, but is preferably as large as possible. Usually, about 200,000 to 100,000 is preferable.

Such a polyacrylic acid-based flocculant itself preferably used in the method of the present invention is well known, commercially available, and a commercially available product can be preferably used. As an example of a commercially available product, Crimbar 201 manufactured by Kurita Kogyo Co., Ltd. of Tokyo, Japan can be exemplified, but of course, the invention is not limited to this.

At the time of addition, any of a chitosan-based flocculant alone, a polyacrylic acid-based flocculant alone, or a combination of two kinds of chitosan-based and polyacrylic acid-based flocculants may be used.

The amount of the chitosan-based flocculant used is preferably 0.1 to 8% by weight, more preferably 1 to 6% by weight, based on the amount of cells contained in the culture solution (in terms of dry weight). % By weight. On the other hand, the amount of the polyacrylic acid-based flocculant used is preferably 0.05 to 2.0% by weight / o with respect to the amount of cells contained in the culture solution. Ten

More preferably, it is 0.1 to 1.0% by weight.

Further, prior to the addition of the flocculant, the p H of the culture solution, sulfuric acid, propionic acid, formic acid, from p H 2. 0 6. Acidified under 5 with an acid such as acetic acid, preferably, _P H 3 Pre-adjustment under acidic conditions of 5 to 5.0 improves the cell aggregation effect. When the chitosan-based flocculant and the polyacrylic acid-based flocculant are added simultaneously, the order of addition is not particularly limited. However, when adding these, it is easier to agglutinate the cells by stirring as strongly as possible.

The liquid thus treated with the flocculant is separated from the cell culture by centrifugation, filtration, decantation, etc., and is not separated from the primary supernatant by the zeta filter treatment described above. Cells and nucleic acids may be removed.

The cells in the cell culture to be subjected to the method of the present invention are not particularly limited as described above. As a preferred example, a transformed candy producing a useful substance as described above is preferable. Da yeast can be mentioned. As an example of such transformed Candida yeast, Candida boidini i MT-40544 strain (FERM BP-5936) (EPM) into which a phytase gene derived from Schwanniomyces occidental is introduced has been introduced. 0 931 837 A1), but of course, the present invention is not limited to this, and the same form can be applied to microorganisms in general. This strain was established on May 1, 1997 based on the Convention on the International Recognition of the Deposit of Microorganisms in Patent Procedures, 1-3-1 Higashi, Tsukuba City, Ibaraki Prefecture. Deposited at the Industrial Technology Research Institute with the above deposit number.

The composition of the liquid medium for culturing Candida yeast is not particularly limited as long as Candida yeast grows smoothly and useful substances are produced in the culture medium. Examples of the carbon source include methanol, glycerol, ethanol, glucose and the like. As the nitrogen source, various organic or inorganic nitrogen sources such as peptone, corn steep liquor, yeast extract and ammonium sulfate can be used alone or in combination. Also, salts of metals such as magnesium, sodium and potassium (phosphate, sulfate, hydrochloride), trace amounts of gold 1 1

A variety of vitamins, nucleic acid-related substances, pH regulators, etc. can be added to the medium.

There is no particular limitation on the liquid culture method, culture conditions, and culture period for obtaining the culture solution used in the method of the present invention. Specific culture conditions are generally as follows. The cultivation temperature is 15 to 35 ° C, preferably 25 to 30 ° C. The pH of the culture solution during the liquid culture is not particularly limited as long as the pH can grow the present yeast, but is usually in the range of pH 2 to 8, more preferably pH 4 to 7. The culture period is usually about 1 day to 60 days, preferably about 7 days to 40 days. When the yeast cells and the supernatant are separated from the liquid in the continuous culture, the culture period is not particularly limited.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited thereto.

Example 1

80 ml of a liquid medium having the composition shown in Table 1 was added to each of three 500 ml Erlenmeyer flasks with baffles and subjected to high-pressure steam sterilization. Recombinant yeast for phytase production

Candida boidinii MT-40544 (FERM BP-5936) was inoculated and cultured at 27 ° C for 2 days with shaking.

table 1

Medium composition Glucose 20.0 / L

East Nitrogen Base 1.7 g / L

Yeast extract 5. O gZL

Ammonium sulfate 5. O gZL

pH 6.5 Next, 240 ml of the culture solution obtained above (for three flasks) was inoculated into a 1 OL jar armmenter sterilized by adding 5 L of medium having the composition shown in Table 2 and autoclaving with high pressure. Using ammonia water at a temperature of 27 ° C, a ventilation volume of 5 LZ minutes, and a rotation speed of 500 rpm 1 2

Culture was performed for 23 days while maintaining the pH at 6.0 <Methanol was used as an additional carbon source.

Table 2

Medium composition Glyceal 30.0 g / L

Corn steep liquor-30.0 gZL

K 2 H PO 4 1.0 gZ

M g S04 ■ 7 H 2 O 0.5 g / L

N a C I 0.1 gZL

Ammonium sulfate 5.0 gZL

Methanol 15.0m I ZL

After the completion of the culture, the culture was subjected to primary filtration using a Zetaplus filter BioCap 01A (particle size: 5 to 20 m, 24.6 cm ² ) manufactured by Cuno Co., Ltd., which was washed with sterile water. Next, the obtained filtrate was filtered through a zeta plus filter BioCap10S (particle diameter: 0.9 to 2 im). Further, the filtrate obtained here is used as a Zetaplus filter BioCap30S (particle diameter 0.6 to 1.5 m), and the same BioCap60S (particle diameter 0.2 to 0.5). μm). The number of viable yeast in 0.1 ml of the filtrate at each filtration stage was confirmed using a solid medium containing 1.5 <½ agar in a culture solution having the composition shown in Table 1, and Separately, the amount of phytase protein in the filtrate was measured. Table 3 shows the results. At this time, the recovery rate of the phytase protein by the final 4-stage treatment of the zeta filter was 91%. 13

Table 3 Liquid type Number of live yeasts' Itase protein

Recovery rate of (cfu / ml) (%) Culture termination solution Not measured 100%

1 0 S filtrate about 10000

30 S filtrate 250

60S filtrate non-detection 91% Example 2

The culture termination solution obtained in Example 1 was centrifuged (9000 X g, 5 minutes) to remove yeast cells primarily. This centrifuged supernatant was divided into four tubes of 20 OmI each. Each of the supernatants was washed with sterile water, and the ZetaPlus filter BioCap (24.6 cm2) manufactured by Cuno Co., Ltd. was used for 01A (particle size 5 to 2 Oyum) and BIOcap 30S (particle size). 0.6 to 1.5 / im), BioC ap 60 S (particle size 0.2 to 0.55 m), BioC ap 90 S (particle size 0.05 to 0.2 m) ). The number of viable yeast in 0.1 ml of each filtrate was confirmed using an individual medium obtained by adding 1.5% agar to the liquid medium shown in Table 1, and the amount of phytase protein in the filtrate was measured at the same time. . Table 4 shows the results. No live yeast was detected in the 60 S filtrate, and the recovery of phytase protein at this time was 93%. Even when using any filter, supply pressure filtration end plate remained within 0. 5 k gZcm ^2. 14

Table 4

Liquid type Number of live yeasts' Itase protein

(c f u Zm I) recovery rate (%)

Centrifugal supernatant approx. 3 X 10 ⁵ 100%

01 A filtrate Approx. 10000 98%

30 S filtrate 1 30 96%

60S filtrate not detected 93%

90 S filtrate Non-detection 88% The obtained 60 S filtrate 5 ml was subjected to molecular weight fractionation Dialysis against 5 L of sterile water for 24 hours using a membrane with a molecular weight of 12,000 to 14,000 Processing was performed. Thereafter, in order to confirm the presence or absence of the phytase gene fragment in the dialysis solution, amplification of the phytase gene by PCR was attempted. The primers for PCR are the salts shown in the following SEQ ID Nos. 1 and 2 designed based on the phytase base sequence (GenBank accession No. E12200: base number 132-1301) derived from the known Shcwanniomyces occi dental is. Oligonucleotides having a base sequence (synthesized out of Hokkaido System Science Co., Ltd.) were used. In addition, it is possible to amplify a 170 bp phytase gene fragment using this primer.

Sequence number 1: GTTGGGGTCCTTACATTCMCGGAGTGGT (29 bp)

Sequence number 2: CAACAAAGTCAACATCCCTAAG (22 bp)

The Perkin-Elmer Corporation ¾ (0.5 U CD Amp Ii Taq Gold. The company's 3 I reaction buffer for AmpliTaq Go Id (x10 solution), dialysis solution 1 μI, sequence number 1 and Denaturation: 95 ° C, 1 minute, Annealing: 60 ° C, 1 minute, extension reaction: Using a 30 I PCR reaction solution containing 0.5 iM of each primer and 2 mM of each dNTPO. The PCR reaction was performed under the condition that a reaction cycle consisting of 72 ° C. and 1 minute was repeated 25 times. (Galose concentration 0.8%), the presence of the amplified fragment could not be confirmed.

Comparative Example 1

The same centrifugal supernatant 2 OOm I as used in Example 2 was converted to a microza pencil type module PS of Asahi Kasei Kogyo Co., Ltd., which is a cruz flow type ultrafiltration membrane without zeta potential. Filtration was performed with P-013 (MF, 80 cm ² , particle size 0.1 l / ^ m). Since the back pressure at the end of filtration became 1 kgZcm ² or more, which is the maximum working pressure, the filtration operation was stopped when the liquid volume at the start was approximately 6 times concentrated.

The number of viable yeast in 0.1 ml of the filtrate was confirmed using a solid medium containing 1.5% agar in a liquid medium having the composition shown in Table 1. No live yeast was detected. When the amount of phytase protein in the filtrate was measured, the recovery of phytase protein was 45%. Table 5 shows the results. Table 5

Liquid type Number of live yeasts Phytase protein

(c f u / ml) recovery rate (%)

Centrifugal supernatant approx. 3 X 10 ⁵ 100%

PS P-01 3 Not detected 45% As in Example 2, the obtained filtrate of PS P-013 was dialyzed, and then the presence or absence of the phytase gene fragment in the dialyzed solution was determined by PCR. Was examined by amplification. As a result, the presence of an amplified fragment of about 1.2 kbp was confirmed. Example 3

The same centrifugal supernatant, 200 ml, as in Example 2, was adjusted to pH 4.2 with sulfuric acid, and when not adjusted, each was washed with sterile water, and each was washed with sterilized water. (24.6 cm), filtered through 60 LA (particle size 0.2-0.5 urn), the total filtration time at that time was measured, and the filterability was confirmed (supply pressure 1 6 0. 3 k gZcm ² or less). As shown in Table _6, Ρ Η 4 · 2 is faster filtration rate better when adjusted to, it was confirmed filtration is good.

Table 6

Before filtration 時時 During filtration,

Ρ Η 6.0 (before adjustment) 6.6 minutes

Ρ Η 4.2 (After adjustment) 5.4 minutes Example 4

A chitosan diluent was prepared by mixing 98.5 g of pure water with 0.5 g of Crime Bar 101 manufactured by Kurita Water Industries Ltd. and 1 g of acetic acid.

To 200 g of the culture termination solution obtained by culturing in the same manner as in Example 1, the amount of the above-mentioned diluted chitosan solution was changed to 30 _g , 45 g, and 60 g, and the mixture was stirred vigorously for 5 minutes. This treated solution was centrifuged to remove bacteria (about 3000 X g, 10 minutes), and the turbidity (absorbance: 660 nm) of the supernatant was measured to confirm the cohesiveness of the yeast cells. As shown in Table 7, the addition of the chitosan-based flocculant reduced the turbidity of the supernatant, and confirmed the aggregation of yeast cells.

Chitosan diluent addition Absorbance 660 nm

No additive (0 g) 0.58

30 g 0.47

45 g 0.32

60 g 0.26 Example 5

The chitosan diluent was prepared by adding 98 g of pure water to Crime Bar 101 (made by Kurita Water Industries Ltd.) 1 7

Was mixed with 1 g of acetic acid and 1 g of acetic acid. The polyacrylic acid diluent was prepared by dissolving 0.2 g of Crime Bar 201 (manufactured by Kurita Water Industries Ltd.) in 99.8 g of pure water. Propionic acid was used as a pH adjuster.

First, 0.7 g of the chitosan diluent was added to each 1 Og of the culture termination solution obtained by culturing in the same manner as in Example 1 when the pH was not adjusted and when the pH was adjusted to 4.2. The mixture was vigorously stirred for 5 minutes, and then 0.7 g of a diluted polyacrylic acid solution was added. The mixture was stirred until uniform formation of floc and floc was confirmed, and allowed to stand for 30 minutes. This treated solution was subjected to centrifugal eradication treatment (about 2000 X _g , 10 minutes), and the turbidity (absorbance: 660 nm) of the supernatant was measured to confirm the cohesiveness of the yeast cells. As shown in Table 8, when the pH was adjusted to 4.2, the turbidity of the supernatant liquid was reduced, and it was confirmed that the yeast cells were better aggregated.

Table 8 Before aggregation treatment pH Addition of flocculant Absorbance 660 nm

P H 5.9 (before adjustment) None 3.94

pH4. 2 (after adjustment) None 3.50

pH 5.19 (before adjustment) Yes 2.98

p H4.2. (after adjustment) Yes 2. 39 Example 6

Sulfuric acid was added to 1.2 _kg of the culture termination solution obtained in the same manner as in Example 1 to adjust the pH to 4.2. To this, 93 g of the same chitosan diluent as in Example 5 was added, and the mixture was stirred vigorously for 5 minutes.Then, 97 _g of the same polyacrylic acid diluent as in Example 5 was added, and the mixture became uniform and the formation of flocs was confirmed. And left to stand for 30 minutes. This treated solution was centrifuged to remove bacteria (about 10,000 xg, 15 minutes) to produce 1.0 kg of a culture supernatant containing a phytase protein. The culture supernatant was filtered through Zetafilter 60S (Biocap 24.6 cm ^2, manufactured by Kuno).

Claims

The treatment flow rate was 13 mI Zmin, and no live yeast was observed in this filtrate. The recovery of phytase protein before and after the zeta filter treatment was 98%. Example 7 Propionic acid was added to 5.8 kg of the culture broth obtained in the same manner as in Example 1 to adjust the pH to 4.2, and the chitosan diluent (950 g + Crimbar 101 (Kurita Kogyo) 10 g + propionic acid 40 g) 914 g was added with stirring, and the mixture was stirred for 30 minutes. The treated solution was subjected to centrifugal sterilization to obtain 5.2 kg of a primary supernatant containing a phytase protein. 2 kg of the primary supernatant was filtered through Zetafilter 60S (Biocap 24.6 cm2, manufactured by Kuno). The treatment flow rate was 13 mI Zmin, and no live yeast was observed in this filtrate. The recovery of phytase protein before and after the zeta filter treatment was 99%. In the same manner as in Example 2, the obtained filtrate of the zeta filter 60S was dialyzed, and then the presence or absence of the phytase gene fragment in the dialyzed solution was examined by amplification of the phytase gene by PCR. As a result, the presence of the amplified fragment could not be confirmed. COMPARATIVE EXAMPLE 2 1 kg of the primary supernatant of Example 7 was used as a cruz flow type ultrafiltration membrane having no zeta potential similar to that of Comparative Example 1 as a microza pencil type module PS P- from Asahi Kasei Corporation. The solution was filtered through 01 3 (MF, 80 cm2, particle size 0.1 A <m). Since the back pressure at the end of filtration exceeded the maximum operating pressure of 1 kgZcm2, the filtration operation was stopped when the liquid volume at the start was approximately 6 times concentrated. No live yeast was found in this filtrate. The recovery rate of the phytase protein before and after the treatment with PSP-013 was 80 <½. In the same manner as in Example 2, the obtained filtrate of PSP-013 was dialyzed, and then the presence or absence of a phytase gene fragment in the dialyzed liquid was examined by amplification of the phytase gene by PCR. As a result, the presence of an amplified fragment of about 1.2 kbp was confirmed. 1 9 Claims

1. A method for producing a culture supernatant from a cell culture, comprising: passing a culture obtained by liquid-culturing the cells or a processed product thereof through a porous filter having a zeta potential; A method for producing a culture supernatant, comprising a step of removing.

2. A method for producing a culture supernatant from a cell culture, wherein a culture obtained by liquid culture of the cells is: 1) a chitosan-based or polyacrylic acid-based A first step of adding the aggregating agent to aggregate the cells and nucleic acids, 2) a second step of separating the aggregated cells and nucleic acids to prepare a primary supernatant, 3) the primary supernatant A method for producing a culture supernatant, comprising removing the cells and nucleic acids by passing through a third step of passing through a porous filter having a zeta potential.

3. The method according to claim 1, wherein the cell is a microorganism that produces a useful substance.

4. The method according to claim 3, wherein the microorganism is a Candida yeast, and the nucleic acid is a DNA fragment derived from the Candida yeast.

5. The microorganism is a transformed microorganism, and the nucleic acid is an exogenous DNA fragment, a DNA fragment containing the DNA fragment or a part thereof, or a part of the DNA fragment. The method according to claim 3 or 4, wherein:

6. The method according to claim 5, wherein the transformed microorganism is a transformed Candida yeast.

7. The method according to claim 6, wherein the transformed Candida yeast is a transformed Candida boidini.

8. The method according to claim 6, wherein the exogenous DNA fragment introduced into the transformed Candida yeast is a gene of a protein having phytase activity.

9. The method according to any one of claims 3 to 8, wherein the useful substance is a protein having phytase activity.

10. The method according to any one of claims 3 to 9, wherein the pH of the culture is between 4.0 and 7.0. 20

11. The method according to any one of claims 2 to 10, wherein the flocculant treatment is performed at a pH of 2.0 to 6.5.

1 2. A culture supernatant produced by the method according to any one of claims 1 to 11.