WO2001004356A1 - Modulation de egr-1 et de egr-2 dans les cardiopathies - Google Patents

Modulation de egr-1 et de egr-2 dans les cardiopathies Download PDF

Info

Publication number
WO2001004356A1
WO2001004356A1 PCT/US2000/018923 US0018923W WO0104356A1 WO 2001004356 A1 WO2001004356 A1 WO 2001004356A1 US 0018923 W US0018923 W US 0018923W WO 0104356 A1 WO0104356 A1 WO 0104356A1
Authority
WO
WIPO (PCT)
Prior art keywords
egr
cad
induction
agent
heart
Prior art date
Application number
PCT/US2000/018923
Other languages
English (en)
Inventor
Richard Einstein
Original Assignee
Gene Logic, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gene Logic, Inc. filed Critical Gene Logic, Inc.
Priority to AU60883/00A priority Critical patent/AU6088300A/en
Publication of WO2001004356A1 publication Critical patent/WO2001004356A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • This invention relates to methods which monitor the induction of expression of the immediate early genes (IEGs), early growth response gene -1 (Egr-1) and early growth response gene-2 (Egr-2).
  • IEGs immediate early genes
  • Egr-1 early growth response gene -1
  • Egr-2 early growth response gene-2
  • Such monitoring can serve 1) as a predictor of the effects of post ischemic events, such as heart attack and myocardial infarction, 2) as a marker to elucidate pathology of diseases related to coronary artery disease (CAD) such as sudden cardiac death (SCD) or 3) as a means of identifying agents that modulate the induction of these IEGs in cardiac tissues.
  • CAD coronary artery disease
  • SCD sudden cardiac death
  • Cardiovascular disease principally heart disease and stroke, is the National cause of death for both men and women among all racial and ethnic groups. More than 960,000 Americans die of CVD each year, accounting for 42% of all deaths. One in four Americans have CVD. Heart disease and stroke account for almost 6 million hospitalizations each year and cause disability for almost 10 million Americans aged 65 years and older. CVD costs the nation $274 billion each year, including health expenditures and lost productivity.
  • CAD coronary artery disease
  • Egr-1 is induced by a wide range of stimuli in diverse cell types (Decker et al, JBiol Chem (1998) 273(41):26923-26930) and has been associated with myocardial protein synthesis (Neyses et al. , Biochem Biophys Res Comm (1991) 181(1 ) :22- 27) and cardiac remodeling (Sharma et al, Biochem Biophys Res Comm (1994) 205(1):105- 112).
  • mechanical stress such as passive stretch of cardiomyocytes activates protein synthesis and particularly induces the expression of Egr-1 (Yamazaki et al, JMol Cell Cardiol (1995) 27(1):133-140).
  • cardiac cells Unlike skeletal muscle cells in which growth and differentiation appear mutually exclusive, growth stimulation of cardiac cells is characterized by transient expression of immediate early genes (proto-oncogenes) as well as induction of several cardiac specific markers (Macbride et al, Mol Cell Biol (1993) 13(1):600-612).
  • hemodynamic load e.g., blood pressure
  • a proximal event in the regulatory pathway for this increase in cardiac mass is the induction of immediate early genes such as fos, jun and Egr-1 in response to a significant increase in blood pressure (Rozich et al, JMol Cardiol (1995) 27(l):485-499).
  • Egr-2 induction by various stimuli has been demonstrated in a number of diverse tissues (Beckman et al, Neurochem Int (1997) 31 :(4):477-510). While fibroblasts and immune cells dominate much of the scientific literature for in vitro characterization of the general mechanism of Egr-2 induction (Newton et al, EurJ Immunol (1996) 26(4):811-816; Gottschalk et al, J Immunol (1994) 52(5):2115-2122; Miltenberger et al, J Biol Chem (1993) 268(21):15674-15680; and Ueohzono et al, Cell Struct Fund (1994) 19(5):341-348), many of the in vivo studies have focused on the brain (Herdegen et al, Brain Res Brain Res Rev (1998) 28(3):370-490; Beckman et al, Neurochem Int (1997) 31(4):477-510; and Herdegen et al, Neuroscience (1993
  • Egr-1 and Egr-2 have been observed to be induced in nucleic acid samples from ischemic heart tissues. Demonstration of such induction in nucleic acid samples obtained from living patients can serve as a diagnostic aid for detection of coronary artery disease. Also, such a demonstration of induction can serve as a means of elucidating CAD pathology in postmortem tissues. Moreover, cells in which Egr-1 and/or Egr-2 can be induced can be used to screen compounds which modulate the expression of these factors.
  • transcription factors have been observed to be induced in tissues isolated from human heart under conditions of ischemia.
  • Egr-1 or Egr-2 are detected in a method of diagnosing coronary artery disease (CAD) in a patient, wherein nucleic acid samples are used to assay for the induction of Egr-1 or Egr-2.
  • CAD coronary artery disease
  • a screening method is contemplated for identifying modulators of Egr-1 or Egr-2 induction.
  • a method of determining a cause of death where coronary artery disease is suspected is contemplated wherein nucleic acid samples are screened for the induction of Egr-1 or Egr-2.
  • the induction of Egr-1 or Egr-2 is indicative of CAD as the cause of death.
  • Figure 1A, B and C Quantitative PCR (Q-PCR) Results for Egr-1.
  • Figure 1A an image of a READS gel demonstrating up regulation of human Egr-1 between RNA samples obtained from age and sex matched controls (first two lanes) versus heart failure patients (last five lanes). The single headed arrow identifies the band of interest.
  • Figure IB the bar graph demonstrates, graphically, differential expression of Egr-1 in healthy human control samples versus ischemic heart samples (Cluster 1) and samples from patients exhibiting idiopathic heart disease (Cluster 2). The ordinate represents fold difference between the amount of Egr-1 measured verses internal control using quantitative PCR and the abscissa is the sample identifier.
  • the bar graph demonstrates, graphically, differential expression of Egr-1 in healthy human control samples versus heart failure disease panel.
  • the heart failure disease panel consists of samples from human failing hearts that were removed for transplant. Each sample has clinical data and basic physiology that was performed on isolated myocytes. The samples represent a range of failing cells from those that could be barely be considered different from normal cells to those that are severely compromised in their function.
  • Cluster 1 contains samples that are categorized as ischemic heart failure patients. These patients had some episode that allowed the assessment that the patient had undergone some event that reduced blood flow to the heart.
  • Cluster 2 contains samples from patients classified as presenting idiopathic heart failure. These patients have no clear assessment as to the impairment of heart function, but ischemia has been ruled out through laboratory test.
  • the heart failure panel contains a mixture of ischemic, idiopathic, valvular, i.e., patients with damaged valves) and other diagnoses of disease. Again, these samples have a range of function from fairly healthy to extreme disease.
  • the ordinate represents fold difference between the amount of Egr-1 measured verses internal control using quantitative PCR and the abscissa is the sample identifier.
  • Figure 2A and B Quantitative PCR (Q-PCR) Results for Egr-2.
  • the bar graph demonstrates, graphically, differential expression of Egr-2 in healthy human control samples versus ischemic heart samples (Cluster 1) and samples from patients exhibiting idiopathic heart disease (Cluster 2). The ordinate represents fold difference between the amount of Egr-2 measured verses internal control using quantitative PCR and the abscissa is the sample identifier.
  • Figure 2B the bar graph demonstrates, graphically, differential expression of Egr-2 in healthy human control samples versus heart failure disease panel. The ordinate represents fold difference between the amount of Egr-2 measured verses internal control using quantitative PCR and the abscissa is the sample identifier.
  • Figure 3 Graphic representation of the distribution of Egr-1 expression in various human tissues. RT-PCR is performed on nucleic acids isolated from the human tissues listed. After normalizing data to GADPH expression, relative expression is determined by comparing the amount of Egr-1 PCR product in any given tissue to that measured human brain.
  • FIG 4 Graphic representation of the distribution of Egr-2 expression in various human tissues. RT-PCR is performed on nucleic acids isolated from the human tissues listed. After normalizing data to GADPH expression, relative expression is determined by comparing the amount of Egr-2 PCR product in any given tissue to that measured human brain.
  • Figure 5 Agarose gel of the distribution of Egr-1 expression in various human tissues determined by RT-PCR.
  • the present invention is based in part on identifying genes that are differentially regulated or expressed in human ischemic heart tissue compared to normal heart tissue. These genes, as well as the peptides they encode, can serve as targets for agents that can be used to inhibit the expression or modulate the activity of the polypeptides they encode. For example, agents may be identified which modulate biological processes associated with ischemic injury to the heart such as chronic ischemic heart disease and ischemic cardiomyopathy. Agents may also be identified which modulate the biological processes associated with recovery from ischemic injury to the heart.
  • CAD Coronary artery disease
  • myocardial infarction refers to a pathological condition of the heart caused by occlusion of blood vessels, resulting in the interference of the flow of blood to different segments of the myocardium.
  • angina pectoris is a syndrome due to myocardial ischemia characterized by episodes of chest discomfort or pressure.
  • myocardial infarction herein refers to necrosis of myocardium due to ischemia resulting from abrupt reduction in coronary blood flow to segments of the heart.
  • sudden cardiac death SCD is a swift and unexpected death which occurs within moments of the onset of acute symptoms (e.g., chest pain).
  • Chronic diffuse myocardial ischemia herein refers to a disease wherein a patient exhibits persistent and recurrent reduction in blood flow to segments of the myocardium due to blood vessels obstructions which are accompanied by distinctive deviations in wave forms in data from electrocardiograms (ECG).
  • ECG electrocardiograms
  • Myocardium herein refers to the muscle tissue of the heart.
  • Ischemia herein refers to a decrease in blood supply to a body organ, tissue or part caused by constriction or obstruction of blood vessels.
  • Shear stress herein refers to the energy necessary produce an opposite but parallel sliding motion across a body's plane.
  • shear stress refers to substantially the physiological equivalent pressure produced in various tissues or organs such as force present in the vasculature by the actions of cardiac muscle.
  • Modulate refers to the inhibition, induction, agonism and/or antagonism of the regulation of expression or regulation of function of Egr-1 and/or Egr-2 genes or gene products.
  • Nucleic acid includes DNA and RNA molecules and is used synonymously with the terms “nucleic acid sequence” and “polynucleotide”.
  • Transcriptional factors herein refers to a class of proteins that bind to a promoter or to a nearby sequence of DNA to facilitate or prevent transcription initiation.
  • Polypeptide herein refers to an amino acid sequence including, but not limited to, proteins and protein fragments, naturally derived or synthetically produced.
  • Transcriptional profiling herein refers to any assay method or technique which is capable of selectively analyzing, quantitatively and/or qualitatively, one or more mRNA species found in a cell or a nucleic acid sample.
  • assays include but are not limited to RT-PCR, quantitative PCR (Q-PCR), RNase protection assays, and Northern blots.
  • Zinc finger transcription factor or “zinc finger domain” herein refers to a protein having a zinc binding domain comprising a Cys-Xaa 2 -Cys-Xaa_-Cys-Xaa 2 -Cys (or His) or similar sequence that provides the opportunity of Zn(II) binding.
  • Egr-1 and Egr-2 are known inducible transcription factors (ITFs) which, as a consequence of their induction, modulate the expression of their target genes thereby altering a tissues' responses to subsequent stimuli.
  • ITFs inducible transcription factors
  • Two attributes characteristic of these ITFs are (i) their rapid expression, which is controlled by pre-existing transcription factors and (ii) their functioning as transcription factors.
  • Egr-1 usually functions as an activator of target gene transcription such as for rat phenylethanolamine N-methyl transferase, human apolipoprotein Al, and platelet derived growth factor B chain genes.
  • Egr- 1 can also repress expression (e.g., repression of murine adenosine deaminase).
  • Egr-2 has been observed to transactivate HoxB2, the insulin-like growth factor II and HoxA4 genes.
  • Egr-1 and Egr-2 are characterized as zinc finger transcription factors of the Cysa2His2 class (Beckman et al, Neurochem Int (1997) 31(4):477-510). These proteins share extensive homology (90% identity or conserved residues) throughout a zinc finger DNA-binding domain and recognize the same consensus DNA binding motif. As used herein, homology or identity can be determined by BLAST (Basic Local t al).
  • the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), wherein the default values for M and N are 5 and -4, respectively.
  • Egr-1 and Egr-2 recognize the consensus motif GCG(G/T)GGGCG which is commonly referred to as the GSG motif (Herdegen T., Neurochem Int (1997) 31(4): 517-6).
  • the consensus binding motif for SP1 which is related to and often overlaps the Egr-1 or Egr-2 consensus binding site, does not compete for binding to the Egr-1 or Egr-2 protein.
  • Egr-1 DNA comprises the nucleic acid sequence as set forth in SEQ ID NO: 1, wherein said DNA encodes the amino acid sequence as set forth in SEQ ID NO: 2.
  • Egr-2 DNA comprises the nucleic acid sequence as set forth in SEQ ED NO: 3, wherein said DNA encodes the amino acid sequence as set forth in SEQ ID NO: 4.
  • Egr-1 DNA and Egr-2 DNA are not limited to the sequences defined by SEQ ID NOS: 1-4, and include those nucleic acid sequences which are related to SEQ ID Nos: 1 and 3 or which encode these transcription factors in other mammals, for example, those nucleic acids which encode Egr-1 and Egr-2 in rat and murine species.
  • tissues may be assayed under conditions which model physiological cardiac cell stimuli.
  • some model systems simply include substrate depletion and increased intracellular acidity (Ch'en et al, Prog Biophys Mol Biol (1998) 69(2-3):515-38). Others are more complex. For example, Wilders et al.
  • models have been developed to simulate ischemia and reprofusion in quiescent human ventricular cardiomyocytes.
  • Cellular injury and metabolic parameters can be assessed after various interventions, such as: preconditioning cells with anoxia, hypoxia, anoxic supernatants, or hypoxic supernatants (Cohen et al, Circulation (1998) 98(19 Suppl):II 184-94; discussion II194-6).
  • Another model is hypoxia-reoxygenation stress in the rat myoblast cell line, H9c2, which simulates ischemic preconditioning in heart tissue (Sakamoto et al, Biochem Biophys Res Commun (1998) 20;251(2):576-9).
  • assays which incubate cells under conditions that simulate cardiac ischemia and/or heart stress in vitro include, but are not limited to, for example, fluid shear stress in human endothelial cells (Houston et al, Artherioscler Thromb Vacs Biol (1999) 19(2):281-289) and passive stretch of cultured myocytes (Yamazaki et al, JMol Cel Cardiol (1995) 27(1):133-140).
  • assays which simulate ischemia by stressing the heart in vivo include, but are not limited to, for example, occlusion of the heart by ligation of blood vessels in animal models (Soloman et al, J Am Coll Cardiol (1999) 33(3): 854-856 and Kirma et al, Jpn Circ J (1998) 62(4):294-298).
  • One means of diagnosing CAD using the transcriptional factors of the present invention involves obtaining heart tissue from living subjects. Obtaining tissue samples from living sources is problematic for tissues such as heart. However, due to the nature of the treatment paradigms for cardiac patients, biopsy has become routine for certain procedures. For example, such procedures are used to confirm noninvasive findings at cardiac catheterization (e.g., EEG, Salem et al, New Engl JMed (1990) 323:1261-1270). Further, biopsy of cardiac material is routinely performed in order to evaluate lymphocyte infiltration and interstitial edema post-catheterization during IL-2 administration (Beck et al, West J Med (1991) 155(3): 293).
  • cardiac cells are obtained from biopsy specimens of patients where the biopsy procedure is used to confirm noninvasive findings.
  • cardiac cells are obtained from biopsy specimens of patients undergoing catheterization after a post-ischemic event (e.g., myocardial infarction).
  • cardiac cells are obtained from a patient before and after cardiac transplantation. Biopsy can be accomplished by any means, which includes but is not limited to, those described in Giurtino et al (U.S. Patent No. 5,615,690), Vesely et al. (U.S. Patent No. 5.797,849) or Crosby (U.S. Patent No. 4,319,562).
  • nucleic acid probes may be used to determine the expression of Egr-1 and Egr-2 in an assay for CAD in forensic/pathology specimens. Further, nucleic acid assays may be carried out by any means of conducting a transcriptional profiling analysis. In addition to nucleic acid analysis, forensic methods of the invention may target the proteins encoded by Egr-1 or Egr-2 nucleic acids to determine up or down regulation of the genes. Egr-1 and Egr- 2 proteins can be isolated from cardiac tissues and analyzed appropriately (Shiverick et al, Biochim Biophys Acta (1975) 393(l):124-33).
  • methods of the invention may involve treatment of tissues with collagenases or other proteases to make the tissue amenable to cell lysis (Semenov et al, Biull Eksp Biol Med (1987) 104(7): 113-6). Further, it is possible to obtain different regions of the heart for analysis, especially the left ventricle (see McEwen et al, J Cardiovasc Pharmacol (1998) 31 Suppl l:S443-6).
  • Another embodiment of the present invention provides methods for identifying agents that modulate the expression of Egr-1 and/or Egr-2.
  • Such assays may utilize any available means of monitoring for changes in the expression level of Egr-1 and/or Egr-2 mRNA.
  • an agent is said to modulate the expression of Egr-1 and/or Egr-2 mRNA, if it is capable of up- or down-regulating expression of an appropriate nucleic acid in a cell.
  • cell lines that contain reporter gene in-frame fusions between the Egr-1 or Egr-2 promoter (SEQ ID NO: 5 or SEQ ID NO: 6, respectively, see Sakamoto et al, Oncogene (1991) 6(5):867-71 and Joseph et al, Proc Natl Acad Sci U S A (1988) 85(19):7164-8, for promoter sequences in humans) and any assayable fusion partner may be prepared.
  • human promoters as described in Sakamoto et al. (Ibid) and Joseph et al. (Ibid) could be used to make such fusion constructs.
  • Constructs containing downstream transactivation targets for Egr-1 or Egr-2 may be used to identify agents which modulate the expression of the transcription factors.
  • Egr-1 is known to repress murine adenosine deaminase upon induction (Herdegen T., Neurochem Int (1997) 31(4): 517-6), therefore, agents which negatively modulate Egr-1 expression may be screened with murine adenosine deaminase comprising constructs by monitoring the expression of murine adenosine deaminase in appropriately transformed cells.
  • fusion partners Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam et al. (1990) Anal. Biochem. 188:245-254). Cell lines containing the reporter gene fusions are then exposed to the agent to be tested under appropriate conditions and time period. Differential expression of the reporter gene between samples exposed to the agent and control samples identifies agents which modulate the expression of an Egr-1 or Egr-2 nucleic acid.
  • Additional assay formats may be used to monitor the ability of the agent to modulate the expression of a nucleic acid encoding a protein of the invention, for example, the protein having SEQ ID NO: 2 or SEQ ID NO: 4.
  • mRNA expression may be monitored directly by hybridization to the nucleic acids of the invention.
  • Cell lines are exposed to the agent to be tested under appropriate conditions and time periods, after which total RNA or mRNA is isolated by standard procedures such those disclosed in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory Press, 1989), and followed by the appropriate hybridization analysis for example Northern blots (Ibid).
  • Probes to detect differences in RNA expression levels between cells exposed to the agent and control cells may be prepared from Egr-1 and Egr-2 nucleic acids. It is preferable, but not necessary, to design probes which hybridize only with target nucleic acids under conditions of high stringency. Only highly complementary nucleic acid hybrids form under conditions of high stringency. Accordingly, the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference in stability between the probe:target hybrid and the potential probe:non-target hybrids. -13-
  • Probes may be designed from Egr-1 and Egr-2 nucleic acids through methods known in the art. For instance, the G+C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly known, such as those described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, 1989) or Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1995).
  • Hybridization conditions are modified using known methods, such as those described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, 1989) and Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1995) as required for each probe.
  • Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format. For instance, total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the nucleic acids encoding Egr-1 or Egr-2 under conditions in which the probe will specifically hybridize.
  • nucleic acid fragments comprising at least one, or part of one of the nucleic acids encoding Egr-1 or Egr-2 can be affixed to a solid support, such as a silicon wafer or a porous glass wafer.
  • the wafer can then be exposed to total cellular RNA or polyA RNA from a sample under conditions in which the affixed sequences will specifically hybridize.
  • a solid support such as a silicon wafer or a porous glass wafer.
  • Such glass wafers and hybridization methods are widely available, for example, those disclosed by Beattie (WO 95/11755).
  • Such silicon wafers and hybridization methods are widely available, for example, those disclosed by Rava et al. (U.S. Patent No: 5,874,219).
  • probes which hybridize to the hereinabove described Egr-1 and/or Egr-2 nucleic acids if there is at least 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove described polynucleotides.
  • stringent conditions refers to conditions such that hybridization will occur only if there is at least 95%, and preferably 97%, identity between the sequences.
  • Hybridization for qualitative and quantitative analysis of mRNAs may also be carried out by using a RNase Protection Assay (i.e., RPA, see Ma et al, Methods (1996) 10: 273- 238).
  • RPA RNase Protection Assay
  • an expression vehicle comprising cDNA encoding the gene product and a phage specific DNA dependent RNA polymerase promoter (e.g., T7, T3 or SP6 RNA polymerase) is linearized at the 3' end of the cDNA molecule, downstream from the phage promoter, wherein such a linearized molecule is subsequently used as a template for synthesis of a labeled antisense transcript of the cDNA by in vitro transcription.
  • a phage specific DNA dependent RNA polymerase promoter e.g., T7, T3 or SP6 RNA polymerase
  • the labeled transcript is then hybridized to a mixture of isolated RNA (i.e., total or fractionated mRNA) by incubation at 45 °C overnight in a buffer comprising 80% formamide, 40 mM Pipes, pH 6.4, 0.4 M NaCl and 1 mM EDTA.
  • the resulting hybrids are then digested in a buffer comprising 40 ⁇ g/ml ribonuclease A and 2 ⁇ g/ml ribonuclease. After deactivation and extraction of extraneous proteins, the samples are loaded onto urea/polyacrylamide gels for analysis.
  • cells or cell lines In another assay format for identification of agents which effect the expression of the instant gene products, cells or cell lines would first be identified which express said gene products physiologically. Cell and/or cell lines so identified would be expected to comprise the necessary cellular machinery such that the fidelity of modulation of the transcriptional apparatus is maintained with regard to exogenous contact of agents with appropriate surface transduction mechanisms and/or the cytosolic cascades.
  • such cells or cell lines would be transduced or transfected with an expression vehicle (e.g., a plasmid or viral vector) construct comprising an operable non-translated 5 '-promoter containing end of the structural gene encoding the instant gene products fused to one or more antigenic fragments, which are peculiar to the instant gene products, wherein said fragments are under the transcriptional control of said promoter and are expressed as polypeptides whose molecular weight can be distinguished from the naturally occurring polypeptides or may further comprise an immunologically distinct tag.
  • an expression vehicle e.g., a plasmid or viral vector
  • the agent comprises a pharmaceutically acceptable excipient and is contacted with cells comprised in an aqueous physiological buffer such as phosphate buffered saline (PBS) at physiological pH, Eagles balanced salt solution (BSS) at physiological pH, PBS or BSS comprising serum or conditioned media comprising PBS or BSS and/or serum incubated at 37° C .
  • PBS phosphate buffered saline
  • BSS Eagles balanced salt solution
  • serum or conditioned media comprising PBS or BSS and/or serum incubated at 37° C .
  • Said conditions may be modulated as deemed necessary by one of skill in the art.
  • said cells will be disrupted and the polypeptides of the disruptate are fractionated such that a polypeptide fraction is pooled and contacted with an antibody to be further processed by immunological assay (e.g., ELISA, immunoprecipitation or Western blot).
  • immunological assay e.g., ELISA, immunoprecipitation or Western blot.
  • the pool of proteins isolated from the "agent contacted” sample will be compared with a control sample where only the excipient is contacted with the cells and an increase or decrease in the immunologically generated signal from the "agent contacted” sample compared to the control will be used to distinguish the effectiveness of the agent.
  • agents identified by the above methods can be, as examples, peptides, small molecules, vitamin derivatives, as well as carbohydrates. A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents.
  • Candidate peptide agents can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art.
  • the DNA encoding these peptides may be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems (e.g., PCR and cloning). Peptide production using solid phase peptide synthesis is necessitated if non-gene-encoded amino acids are to be included in the candidate peptide product.
  • Another embodiment of the present invention provides methods for identifying agents that modulate at least one activity of the proteins encoded by Egr-1 or Egr-2. Such methods or assays may utilize any means of monitoring or detecting the desired protein(s).
  • the relative amounts of protein between a cell population exposed to an agent to be tested compared to an un-exposed control cell population may be assayed.
  • probes such as specific antibodies are used to monitor the differential expression of the protein(s) in different cell populations.
  • Cell lines or populations are exposed to the agent to be tested under appropriate conditions and time.
  • Cellular lysates may be prepared from the exposed cell line or population and a control, unexposed cell line or population. The cellular lysates are then analyzed with the probe.
  • Antibodies directed against Egr-1 and Egr-2 encoded polypeptides are well known in the art (see Waters et al, Oncogene (1990) 5(5):699-674 and Skerka et al, Immunobiology (1997) 198(1-3):179-191, respectively) and such antibodies may be used as probes. Further, antibodies against Egr-1 and Egr-2 proteins may be prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides, polypeptides or proteins if they are of sufficient length, or, if desired, or if required to enhance immunogenicity, conjugated to suitable carriers. Methods for preparing immunogenic conjugates with carriers such as BSA, KLH, or other carrier proteins are well known in the art.
  • hapten peptides can be extended at either the amino or carboxy terminus with a Cys residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier.
  • Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation.
  • Immortalized cell lines which secrete the desired monoclonal antibodies may be prepared using the standard method of Kohler and Milstein or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known.
  • the immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten, polypeptide or protein.
  • the cells can be cultured either in vitro or by production in ascites fluid.
  • the desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant.
  • Fragments of the monoclonals or the polyclonal antisera which contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies.
  • Use of immunologically reactive fragments, such as the Fab, Fab', of F(ab') 2 fragments is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
  • the antibodies or fragments may also be produced, using current technology, by recombinant means. Regions that bind specifically to the desired regions of the gene products can also be produced in the context of chimeras with multiple species origin.
  • a specific activity of a protein may be assayed, such as the ability of the protein to bind to a substrate such as a GSG consensus comprising nucleic acid or by transactivation of an appropriate gene product (Cibelli et al, Eur J Biochem (1996) 237(l):311-7). Cell lines or populations are exposed under appropriate conditions to the agent to be tested. Agents which modulate the binding activity of the protein are identified by assaying the binding activity of the protein from the exposed cell line or population and a control, unexposed cell line or population, thereby identifying agents which modulate the binding activity of the protein.
  • Binding assays to measure the ability of the agent to modulate the binding activity of an Egr-1 or Egr-2 protein are widely available such as the assays disclosed by Morris et al, Oncogene (1991) 6(12):2339-48 and Cibelli et al, Eur J Biochem (1996) 237(1):311-7.
  • Agents that are assayed in the above method can be randomly selected or rationally selected or designed.
  • an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of the an Egr-1 or Egr-2 protein alone or with its associated substrates, binding partners, etc.
  • An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism.
  • an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis which takes into account the sequence of the target site and/or its conformation in connection with the agent's action.
  • Another class of agents of the present invention are antibodies immunoreactive with critical positions of Egr-1 or Egr-2 proteins.
  • Antibody agents are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions, those portions of the protein intended to be targeted by the antibodies.
  • Antibodies can also be generated by expression of proteins in a variety of culture systems (bacterial, yeast, or mammalian systems) and any portions of the predicted amino acid sequences can be used as an immunogen.
  • Heart tissue was obtained from subjects exhibiting post-ischemic cardiomyopathy and their age- and sex-matched controls. Tissues were obtained from cardioectomized patients or by biopsy. Biopsied materials from heart tissues were obtained by standard procedures associated with heart transplantation and follow-up and during catheterization after heart attack (Gout et al, N Engl J Med (1990) 322:383-388; Beck et al, West J Med (1991) 155(3): 293; Thibault G.E. N Engl JMed (1992) 327:714-717; MacLellan et al, Pediatrics (1995) 96:122-125; and Book et al, Cathet Cardiovasc Diagn (1998) 45(2):167-169).
  • Total cellular RNA was prepared from the heart tissue described above as well as from control, non-ischemic heart tissue using the procedure of Newburger et ⁇ 2/.(1981) J. Biol. Chem. 266(24): 16171-7 and Newburger et al. (1988) Proc. Natl. Acad. Sci. USA 85:5215-5219. Synthesis of cDNA was performed as previously described by Prashar et al. in
  • cDNA was synthesized according to the protocol described in the GIBCO/BRL kit for cDNA synthesis.
  • reaction mixture may include lO ⁇ g of total RNA, and 2 pmol of 1 of the 2-base anchored oligo(dT) primers a heel such as RP5.0 (CTCTCAAGGATCTTACCGCTT 18 AT), or
  • RP6.0 TAATACCGCGCCACATAGCAT , tendencyCG
  • RP9.2 CAGGGTAGACGACGCTACGCT 18 GA
  • This mixture was then layered with mineral oil and incubated at 65°C for 7 min followed by 50°C for another 7 min.
  • 2 ⁇ l of SUPERSCRIPT REVERSE TRANSCRIPTASE® 200 units/ ⁇ l; GIBCO/BRL
  • Second-strand synthesis was performed at 16°C for 2 hr.
  • the adapter oligonucleotide sequences were Al (TAGCGTCCGGCGCAGCGACGGCCAG) and A2 (GATCCTGGCCGTCGGCTGTCTGTCGGCGC).
  • One microgram of oligonucleotide A2 was first phosphorylated at the 5' end using T4 polynucleotide kinase (PNK). After phosphorylation, PNK was heat denatured, and l ⁇ g of the oligonucleotide Al was added along with 10* annealing buffer (1 M NaCl/100 mM Tris-HCl, pH8.0/10 mM EDTA, pH8.0) in a final vol of 20 ⁇ l.
  • This mixture was then heated at 65 °C for 10 min followed by slow cooling to room temperature for 30 min, resulting in formation of the Y adapter at a final concentration of 100 ng/ ⁇ l.
  • About 20 ng of the cDNA was digested with 4 units of Bgl II in a final vol of 10 ⁇ l for 30 min at 37 °C.
  • nl, n2 AA, AC, AG AT CA CC CG CT GA GC GG and GT
  • RP 5.0, RP 6.0, or RP 9.2 used as 3' primers with primer Al.l serving as the 5' primer.
  • 24 pmol of oligonucleotide Al or Al.l was 5' -end-labeled using 15 ⁇ l of [ ⁇ - 32 P]ATP (Amersham; 3000 Ci/mmol) and PNK in a final volume of 20 ⁇ l for 30 min at 37°C. After heat denaturing PNK at 65 °C for 20
  • the labeled oligonucleotide was diluted to a final concentration of 2 ⁇ M in 80 ⁇ l with unlabeled oligonucleotide Al.l.
  • the PCR mixture (20 ⁇ l) consisted of 2 ⁇ l ( ⁇ 100 pg) of the template, 2 ⁇ l of 10x PCR buffer (100 mM Tris-HCl, pH 8.3/500 mM KC1), 2 ⁇ l of 15 mM MgCl 2 to yield 1.5 mM final Mg 2+ concentration optimum in the reaction mixture, 200 ⁇ M dNTPs, 200 nM each 5' and 3' PCR primers, and 1 unit of Amplitaq Gold®. Primers and
  • PCR consisted of 5 cycles of 94 °C for 30 sec, 55 °C for 2 min, and 72 °C for 60 sec followed by 25 cycles of 94 °C for 30 sec,
  • PCR products (2.5 ⁇ l) were analyzed on 6% polyacrylamide sequencing gel.
  • 13.2 ⁇ l of the ligated cDNA sample was digested with a secondary restriction enzyme(s) in a final vol of 20 ⁇ l. From this solution, 3 ⁇ l was used as a template for PCR. This template vol of 3 ⁇ l carried ⁇ 100 pg of
  • Northern blot and PCR Expression Analysis Northern blots are prepared using a probe derived from SEQ ID Nos.l and 3 with hybridization conditions as described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, 1989) PCR expression analysis is also performed using primers derived from EGR-1 or EGR-2 using AmpliTaq Gold PCR® amplification kits (Perkin Elmer).
  • PCR detection is accomplished by the use of the ABI PRISM 7700 Sequence Detection System.
  • the 7700 will measure the fluorescence intensity of the sample each cycle and is able to detect the presence of specific amplicons within the PCR reaction.
  • Each sample is assayed for the level of GAPDH and clones 1084 (Egr-1) and 1084A (Egr-2).
  • GAPDH detection is performed using Perkin Elmer part#402869 according to the manufacturer's directions.
  • Primers are designed for clones 1084 (Egr-1) and 1084A (Egr-2) using Primer Express, a program developed by PE to efficiently find primers and probes for specific sequences. These primers are used in conjunction with SYBR green (Molecular Probes), a nonspecific double stranded DNA dye, to measure the expression level of clones 1084 and/or 1084 A, which is normalized to the GAPDH level in each sample.
  • Shear-Stress Assay Using human epithelial cells, a shear-stress of 1.5 N/m 2 is applied to cells in culture according to the method of Houston et al. (Artherioscler Thromb Vacs Biol (1999) 19(2):281- 289). At specific time points during applied stress, candidate agents and diluent (i.e., carrier minus agent; control) are contacted with human epithelial cells. Cells are removed and lysed in an appropriate buffer for isolation of total and/or messenger RNA in a similar fashion as described in Sambrook et al (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, 1989).
  • Isolated nucleic acids are then assayed by a transcriptional profiling means to determine whether the candidate agent modulates the induction of Egr-1 and or Egr-2.
  • Agents which up- or down-regulate the expression of either one or both transcriptional factors are then designated as modulators of Egr-1 and/or Egr-2.
  • Isolated nucleic acids are then assayed by a transcriptional profiling assay to determine whether the candidate agent modulates the induction of Egr-1 and or Egr-2.
  • Agents which up- or down-regulate the expression of either one or both transcriptional factors will then be designated as modulators of Egr-1 and/or Egr-2.
  • Example 5 Method of Screening for Modulators of Myocardial Egr-1 and or Egr-2 Expression Using an Animal Model for Occlusion and Reprofusion of the Heart Animal models for occlusion of the heart are well documented (Soloman et al, J Am
  • pigs are used wherein regional ischemia is produced in control and candidate agent treated animals by partially occluding (ligating) the left anterior descending coronary artery.
  • agents are administered to the animals (including carrier-only for controls) and at various time points and/or after administration of various concentrations of candidate agents using a single time point, post occlusion, the hearts of the animals are removed for isolation of nucleic acids by standard methods as described in Sambrook et al (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, 1989).
  • Isolated nucleic acids are then assayed by a transcriptional profiling assay to determine whether the candidate agent modulates the induction of Egr-1 and/or Egr-2.
  • Agents which up- or down-regulate of either one or both transcriptional factors will then be designated as modulators of Egr-1 and/or Egr- 2.
  • Example 6 Forensic Method of Determining Cause of Death Due to CAD Samples are obtained from the post mortem heart tissue of expired patients where cause of death is suspected to be from CAD (test sample) and are compared to postmortem tissue isolated from aged and sex matched controls wherein death by heart disease has been excluded. Tissues are prepared for isolation of nucleic acids by standard methods as described in Sambrook et al (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, 1989). Isolated nucleic acids are then assayed by a transcriptional profiling assay to determine whether induction of Egr-1 and/or Egr-2 has occurred. The observation of induced Egr-1 and/or Egr-2 in the test sample is diagnostic of CAD as the cause of death.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Procédés permettant de diagnostiquer une coronaropathie associée à l'ischémie, qui consistent à mesurer l'induction de gènes de facteur de réponse de croissance précoce 1 (Egr-1) et de facteur de réponse de croissance précoce 2 (Egr-2) dans des échantillons d'acide nucléique prélevés chez des patients. Des procédés de criblage de modulateurs de l'induction de Egr-1 et de Egr-2 sont également décrits, ainsi que des méthodes appropriées permettant de déterminer une pathologie associée à l'ischémie. La figure 1A montre une image d'un gel READS illustrant la régulation à la hausse d'Egr-1 humain entre des échantillons d'ARN obtenus auprès de témoins d'âge et de sexe correspondants (deux premières colonnes) par rapport à des patients atteints d'insuffisance cardiaque (cinq dernières colonnes).
PCT/US2000/018923 1999-07-12 2000-07-12 Modulation de egr-1 et de egr-2 dans les cardiopathies WO2001004356A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU60883/00A AU6088300A (en) 1999-07-12 2000-07-12 Modulation of egr-1 and egr-2 in heart disease

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14297399P 1999-07-12 1999-07-12
US60/142,973 1999-07-12

Publications (1)

Publication Number Publication Date
WO2001004356A1 true WO2001004356A1 (fr) 2001-01-18

Family

ID=22502023

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/018923 WO2001004356A1 (fr) 1999-07-12 2000-07-12 Modulation de egr-1 et de egr-2 dans les cardiopathies

Country Status (2)

Country Link
AU (1) AU6088300A (fr)
WO (1) WO2001004356A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003060516A1 (fr) * 2002-01-10 2003-07-24 Takeda Chemical Industries, Ltd. Methode de criblage
WO2003103480A2 (fr) * 2002-06-11 2003-12-18 Mucosal Therapeutics Llc Analyse de famille multigenique pour une maladie des arteres coronaires
WO2004083435A1 (fr) * 2003-03-17 2004-09-30 Julius-Maximilians-Uni Versität Würzburg Proteines nab et leur utilisation dans des applications diagnostiques et therapeutiques de maladie cardiaque
EP1573045A2 (fr) * 2002-11-27 2005-09-14 Artesian Therapeutics, Inc. Detection des genes lies a l'insuffisance cardiaque et dosage therapeutique
EP1642138A1 (fr) * 2003-06-30 2006-04-05 Genova Ltd. Especes polypeptides secretees dont le taux diminue en cas de maladies cardiovasculaires

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5726288A (en) * 1989-11-13 1998-03-10 Massachusetts Institute Of Technology Localization and characterization of the Wilms' tumor gene

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5726288A (en) * 1989-11-13 1998-03-10 Massachusetts Institute Of Technology Localization and characterization of the Wilms' tumor gene

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
AEBERT ET AL.: "Expression of immediate early genes after cardioplegic arrest and reperfusion", ANNALS OF THORACIC SURGERY,, vol. 63, no. 6, June 1997 (1997-06-01), pages 1669 - 1675, XP002931994 *
CHIEN ET AL.: "Effects of mechanical forces on signal transduction and gene expression in endothelial cells", HYPERTENSION,, vol. 31, no. 1, PT. 2, January 1998 (1998-01-01), pages 162 - 169, XP002931996 *
DEINDL ET AL.: "Gene expression after short periods of coronary occlusion", MOLECULAR AND CELLULAR BIOCHEMISTRY,, vol. 186, no. 1-2, September 1998 (1998-09-01), pages 43 - 51, XP002931995 *
GROHE ET AL.: "Effects of moexiprilat on oestrogen-stimulated cardiac fibroblast growth", BRITISH JOURNAL OF PHARMACOLOGY,, vol. 121, no. 7, August 1997 (1997-08-01), pages 1350 - 1354, XP002931998 *
WATSON ET AL.: "Contractile activity and passive stretch regulate tubulin mRNA and protein content in cardia myocytes", AMERICAN JOURNAL OF PHYSIOLOGY,, vol. 271, no. 2, PT. 1, August 1996 (1996-08-01), pages C684 - C689, XP002931997 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003060516A1 (fr) * 2002-01-10 2003-07-24 Takeda Chemical Industries, Ltd. Methode de criblage
EP1467207A1 (fr) * 2002-01-10 2004-10-13 Takeda Chemical Industries, Ltd. Methode de criblage
EP1467207A4 (fr) * 2002-01-10 2006-06-07 Takeda Pharmaceutical Methode de criblage
WO2003103480A2 (fr) * 2002-06-11 2003-12-18 Mucosal Therapeutics Llc Analyse de famille multigenique pour une maladie des arteres coronaires
WO2003103480A3 (fr) * 2002-06-11 2004-01-22 Mucosal Therapeutics Llc Analyse de famille multigenique pour une maladie des arteres coronaires
EP1573045A2 (fr) * 2002-11-27 2005-09-14 Artesian Therapeutics, Inc. Detection des genes lies a l'insuffisance cardiaque et dosage therapeutique
EP1573045A4 (fr) * 2002-11-27 2007-02-21 Artesian Therapeutics Inc Detection des genes lies a l'insuffisance cardiaque et dosage therapeutique
WO2004083435A1 (fr) * 2003-03-17 2004-09-30 Julius-Maximilians-Uni Versität Würzburg Proteines nab et leur utilisation dans des applications diagnostiques et therapeutiques de maladie cardiaque
EP1642138A1 (fr) * 2003-06-30 2006-04-05 Genova Ltd. Especes polypeptides secretees dont le taux diminue en cas de maladies cardiovasculaires

Also Published As

Publication number Publication date
AU6088300A (en) 2001-01-30

Similar Documents

Publication Publication Date Title
US6322976B1 (en) Compositions and methods of disease diagnosis and therapy
JP2003508088A (ja) ５２個のヒト分泌タンパク質
JP2003515313A (ja) 組換え血小板コラーゲン受容体糖タンパク質ｖｉおよびその薬学的使用
US20030166017A1 (en) Compositions and methods for the identification, assessment, prevention and therapy of cardiovascular disease
Goletz et al. Laminin β4 is a constituent of the cutaneous basement membrane zone and additional autoantigen of anti-p200 pemphigoid
WO2001004356A1 (fr) Modulation de egr-1 et de egr-2 dans les cardiopathies
EP0887081B1 (fr) Kinase régulée par les glucocorticoides du sérum humain, une cible pour maladies rénales chroniques et néphropaties diabétiques
US20050037454A1 (en) Gene associated with bone disorders
US6780600B2 (en) Synaptic activation protein compositions and method
US7217692B2 (en) Complex of a human FOXC2 protein and a FOXC2-interacting protein
WO2001057062A1 (fr) Modulation de osf-2 dans des maladies inflammatoires et renales
JP2002508934A (ja) Ｔｎｆレセプターに対して相同性を有する、新規な核酸およびポリペプチド
WO1998040407A9 (fr) Compositions proteiques a activation synaptique et methode afferente
JP2005507651A (ja) ヒト平滑筋ミオシン重鎖
KR102202120B1 (ko) 알츠하이머 질환의 진단 또는 치료를 위한 Ｕｂｅ２ｈ의 용도
JP2001501459A (ja) Ａｐｃタンパク質の異常型の発現の判定方法
WO2000011942A9 (fr) Identification d'un adn complementaire associe a l'ischemie dans le tissu cardiaque humain
NZ526016A (en) Gene encoding syntaxin interacting protein
WO2002038608A9 (fr) Procédé de recherche systématique de modulateurs ltrpc2
WO2001005803A1 (fr) Nouveaux adnc associes a des nephropathies
CA2519562A1 (fr) Methode d'evaluation
US20050147969A1 (en) Genes associated with mast cell activation
EP1383797A2 (fr) Marqueurs de plaques d'atherosclerose instables
Fedeli et al. Alternative pathway of angiotensin II production: role of human chymase in left ventricular remodeling
WO2002012262A1 (fr) Identification des adnc associes a l'hyperplasie benigne de la prostate

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP