WO2000011942A9 - Identification d'un adn complementaire associe a l'ischemie dans le tissu cardiaque humain - Google Patents

Identification d'un adn complementaire associe a l'ischemie dans le tissu cardiaque humain

Info

Publication number
WO2000011942A9
WO2000011942A9 PCT/US1999/020015 US9920015W WO0011942A9 WO 2000011942 A9 WO2000011942 A9 WO 2000011942A9 US 9920015 W US9920015 W US 9920015W WO 0011942 A9 WO0011942 A9 WO 0011942A9
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleic acid
protein
agent
acid molecule
Prior art date
Application number
PCT/US1999/020015
Other languages
English (en)
Other versions
WO2000011942A1 (fr
Inventor
Richard Einstein
Original Assignee
Gene Logic Inc
Richard Einstein
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gene Logic Inc, Richard Einstein filed Critical Gene Logic Inc
Priority to AU57989/99A priority Critical patent/AU5798999A/en
Publication of WO2000011942A1 publication Critical patent/WO2000011942A1/fr
Publication of WO2000011942A9 publication Critical patent/WO2000011942A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the invention relates generally to the changes in gene expression in ischemic heart tissue compared to normal human heart tissue.
  • the invention relates specifically to a novel human gene which is expressed in ischemic human heart tissue.
  • Cardiovascular disease is a general diagnostic category consisting of several separate diseases. Coronary heart disease and cerebrovascular disease are major components of cardiovascular disease with 478,530 dying of coronary heart disease and 144,070 dying of cerebrovascular disease in the U.S. in 1991. See Cecil Textbook of Medicine, Bennet and Plum Eds., W.B. Saunders Co., 1996. Many of the acute forms of coronary heart disease are caused by coronary artery abnormalities such as coronary atherosclerosis. Among the more common causes and contributing factors in sudden cardiac death are chronic ischemic heart disease and ischemic cardiomyopathy.
  • Chronic ischemic heart disease and ischemic cardiomyopathy are caused in part by episodes of insufficient myocardial oxygen supply.
  • Myocardial oxygen supply is governed by coronary blood flow and the ability of the myocardium to extract oxygen from the blood delivered to it.
  • the heart always extracts oxygen with near maximal efficiency from the blood. Even under situations of minimal demand, there is little potential for enhanced oxygen extraction to counter increased oxygen demands.
  • Coronary blood flow can increase several-fold in normal subjects as a result of coronary arterial vasodilation. Coronary arterial vasodilation is regulated by the coronary endothelium which releases vasodilatory substances, most importantly nitric oxide.
  • endothelial dysfunction may diminish production of vasodilatory substances, such as nitric oxide.
  • Myocardial ischemia results when autoregulatory vasodilation is prevented, whether by flow-limiting coronary arterial stenosis or by endothelial dysfunction. In both cases, arterial blood flow can no longer increase proportional to rising oxygen demands.
  • myocardial ischemia may occur when oxygen demands are constant but there is a primary decrease in coronary blood flow mediated via coronary artery spasm, rapid evolution of the underlying atherosclerotic plaque leading to a reduced coronary arterial lumen caliber, and/or intermittent micro vascular plugging by platelet aggregates.
  • ischemia is characterized by the differential expression of numerous genes compared to normal heart tissue.
  • expression of the ⁇ ,- and ⁇ 2 -adrenergic receptors of the adenyl cyclase signal transduction system is impaired by reductions in the expression of mRNA for each receptor (Ihl-Nahl et al., J Mol Cell Cardiol 28:1-10, 1996).
  • Ischemic injury is also known to lead to the differential expression of heat shock and immediate early genes such as hsplQ, c-fos, c-jun,jun-B as well the genes encoding angiotensin receptor subtypes (Plumier et al., J Mol Cell Cardiol 28:1251-1260, 1996; Wharton et al, JPharmoc Experiment Therap 284(1) 323-336, 1998; and Heads et al, JMol Cell Cardiol 27:2133-2148, 1995).
  • the present invention is based on our discovery of a new gene which is expressed in ischemic heart tissue.
  • the invention includes isolated nucleic acid molecules selected from the group consisting of an isolated nucleic acid molecule that encodes the amino acid sequence of SEQ ID No.2 or SEQ ID No.4, an isolated nucleic acid molecule that encodes a fragment of at least 6 amino acids of SEQ ID No.2 or SEQ ID No.4, an isolated nucleic acid molecule which hybridizes to a nucleic acid molecule comprising SEQ ID No.l or SEQ ID No.3 under conditions of sufficient stringency to produce a clear signal and an isolated nucleic acid molecule which hybridizes to the complement of a nucleic acid molecule that encodes the amino acid sequence of SEQ ID No.2 or SEQ ID No.4 under conditions of sufficient stringency to produce a clear signal.
  • the present invention further includes the nucleic acid molecules operably linked to one or more expression control elements, including vectors comprising the isolated nucleic acid molecules.
  • the invention further includes host cells transformed to contain the nucleic acid molecules of the invention and methods for producing a protein comprising the step of culturing a host cell transformed with a nucleic acid molecule of the invention under conditions in which the protein is expressed.
  • the invention further provides an isolated polypeptide selected from the group consisting of an isolated polypeptide comprising the amino acid sequence of SEQ ID No.2 or SEQ ID No.4, an isolated polypeptide comprising a fragment of at least 10 amino acids of SEQ ID No.2 or SEQ ID No.4, an isolated polypeptide comprising conservative amino acid substitutions of SEQ ID No.2 or SEQ ID No.4 and naturally occurring amino acid sequence variants of SEQ ID No.2 or SEQ ID No.4.
  • the invention further provides an isolated antibody that binds to a polypeptide of the invention, including monoclonal and polyclonal antibodies.
  • the invention further provides methods of identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 or SEQ ID No.4, comprising the steps of: exposing cells which express the nucleic acid to the agent; and determining whether the agent modulates expression of said nucleic acid, thereby identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 or SEQ ID No.4.
  • the invention further provides methods of identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID No.2 or SEQ ID No.4, comprising the steps of: exposing cells which express the protein to the agent; and determining whether the agent modulates at least one activity of said protein, thereby identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID No.2 or SEQ ID No.4.
  • assay methods are provided which comprise conditions which simulate physiological cardiac stresses, including simulation of ischemic conditions and occlusion of arteries.
  • the invention further provides methods of identifying binding partners for a protein comprising the sequence of SEQ ID No.
  • the present invention further provides methods of modulating the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 or SEQ ID No.4, comprising the step of: administering an effective amount of an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 or SEQ ID No.4.
  • the invention also provides methods of modulating at least one activity of a protein comprising the sequence of SEQ ID No.2 or SEQ ID No.4, comprising the step of: administering an effective amount of an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID No.2 or SEQ ID No.4.
  • the present invention further provides for non-human transgenic animals comprising the nucleic acids of the present invention.
  • Figure 1 is a Northern blot using a probe derived from SEQ ID NO: 1
  • Figure 2 is a PCR quantification of clone 980 mRNA in normal and ischemic heart tissue compared to the differential display gel.
  • Figure 2A is a section of the differential display gel.
  • Figure 2B represents the normalized PCR results.
  • the present invention is based in part on identifying a new gene that is expressed in human ischemic heart tissue. This gene encodes a protein predicted to consist of 339 amino acids.
  • the protein can serve as a target for agents that can be used to modulate the expression or activity of the protein.
  • agents may be identified which modulate biological processes associated with ischemic injury to the heart such as chronic ischemic heart disease and ischemic cardiomyopathy.
  • Agents may also be identified which modulate the biological processes associated with recovery from ischemic injury to the heart.
  • the present invention is further based on the development of methods for isolating binding partners that bind to the protein.
  • Probes based on the protein are used as capture probes to isolate potential binding partners, such as other proteins.
  • Dominant negative proteins, DNAs encoding these proteins, antibodies to these proteins, peptide fragments of these proteins or mimics of these proteins may be introduced into cells to affect function. Additionally, these proteins provide a novel target for screening of synthetic small molecules and combinatorial or naturally occurring compound libraries to discover novel therapeutics to regulate heart function.
  • the present invention provides isolated protein, allelic variants of the protein, and conservative amino acid substitutions of the protein.
  • the protein or polypeptide refers to a protein that has the human amino acid sequence depicted in SEQ ID No.2 or SEQ ID No.4.
  • the invention includes naturally occurring allelic variants and proteins that have a slightly different amino acid sequence than that specifically recited above. Allelic variants, though possessing a slightly different amino acid sequence than those recited above, will still have the same or similar biological functions associated with the 339 amino acid protein.
  • family of proteins related to the 339 amino acid protein refer to proteins that have been isolated from organisms in addition to humans. The methods used to identify and isolate other members of the family of proteins related to the 339 amino acid protein are described below.
  • the proteins of the present invention are preferably in isolated form.
  • a protein is said to be isolated when physical, mechanical or chemical methods are employed to remove the protein from cellular constituents that are normally associated with the protein. A skilled artisan can readily employ standard purification methods to obtain an isolated protein.
  • the proteins of the present invention further include conservative variants of the proteins herein described.
  • a conservative variant refers to alterations in the amino acid sequence that do not adversely affect the biological functions of the protein.
  • a substitution, insertion or deletion is said to adversely affect the protein when the altered sequence prevents or disrupts a biological function associated with the protein.
  • the overall charge, structure or hydrophobic/hydrophilic properties of the protein can be altered without adversely affecting a biological activity.
  • the amino acid sequence can be altered, for example to render the peptide more hydrophobic or hydrophilic, without adversely affecting the biological activities of the protein.
  • allelic variants, the conservative substitution variants, and the members of the protein family will have an amino acid sequence having at least 75% amino acid sequence identity with the human sequence set forth in SEQ ID No.2 or SEQ ID No.4, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%.
  • Identity or homology with respect to such sequences is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the known peptides, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity.
  • conservative substitution refers to a substitution of one amino acid for another with generally similar properties (size, hydrophobicity, charge, etc). N-terminal, C-terminal or internal extensions, deletions, or insertions into the peptide sequence shall not be construed as affecting homology.
  • the proteins of the present invention include molecules having the amino acid sequence disclosed in SEQ ID No.2 or SEQ ID No.4; fragments thereof having a consecutive sequence of at least about 3, 4, 5, 6, 10, 15, 20, 25, 30, 35 or more amino acid residues of the 339 amino acid protein; amino acid sequence variants of such sequence wherein an amino acid residue has been inserted N- or C-terminal to, or within, the disclosed sequence; and amino acid sequence variants of the disclosed sequence, or their fragments as defined above, that have been substituted by another residue.
  • Contemplated variants further include those containing predetermined mutations by, e.g., homologous recombination, site-directed or PCR mutagenesis, and the corresponding proteins of other animal species, including but not limited to rabbit, rat, murine, porcine, bovine, ovine, equine and non-human primate species, and the alleles or other naturally occurring variants of the family of proteins; and derivatives wherein the protein has been covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (for example a detectable moiety such as an enzyme or radioisotope).
  • a detectable moiety such as an enzyme or radioisotope
  • members of the family of proteins can be used: 1) to identify agents which modulate at least one activity of the protein; 2) in methods of identifying binding partners for the protein, 3) as an antigen to raise polyclonal or monoclonal antibodies, and 4) as a therapeutic agent.
  • nucleic acid molecules that encode the protein having SEQ ID No.2 or SEQ ID No.4 and the related proteins herein described, preferably in isolated form.
  • nucleic acid is defined as RNA or DNA that encodes a protein or peptide as defined above, or is complementary to nucleic acid sequence encoding such peptides, or hybridizes to such nucleic acid and remains stably bound to it under appropriate stringency conditions, or encodes a polypeptide sharing at least 15% sequence identity, preferably at least 80%, and more preferably at least 85%, with the peptide sequences.
  • genomic DNA e.g., genomic DNA, cDNA, mRNA and antisense molecules, as well as nucleic acids based on alternative backbones or including alternative bases whether derived from natural sources or synthesized.
  • hybridizing or complementary nucleic acids are defined further as being novel and unobvious over any prior art nucleic acid including that which encodes, hybridizes under appropriate stringency conditions, or is complementary to nucleic acid encoding a protein according to the present invention.
  • BLAST Basic Local Alignment Search Tool
  • blastp, blastn, blastx, tblastn and tblastx Karlin, et al, Proc Natl Acad Sci USA 87: 2264-2268, 1990 and Altschul, S. F., JMol Evol 36: 290-300, 1993, fully incorporated by reference
  • the approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance.
  • the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), wherein the default values for M and N are 5 and -4, respectively.
  • “Stringent conditions” are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015M NaCl/0.0015M sodium titrate/0.1% SDS at 50°C, or (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C.
  • a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C.
  • Another example is use of 50% formamide, 5 x SSC (0.75M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C. in 0.2 x SSC and 0.1% SDS.
  • a skilled artisan can readily determine and vary the stringency conditions appropriately to obtain a clear and detectable hybridization signal.
  • target e.g., SEQ ID NOs: 1 and 3
  • closely related sequences e.g., nucleic acids encoding SEQ ID NOs: 2 and 4 and variants
  • target e.g., SEQ ID NOs: 1 and 3
  • closely related sequences e.g., nucleic acids encoding SEQ ID NOs: 2 and 4 and variants
  • nucleic acid molecule is said to be "isolated” when the nucleic acid molecule is substantially separated from contaminant nucleic acid encoding other polypeptides from the source of nucleic acid.
  • the present invention further provides fragments of the encoding nucleic acid molecule.
  • a fragment of an encoding nucleic acid molecule refers to a small portion of the entire protein encoding sequence. The size of the fragment will be determined by the intended use. For example, if the fragment is chosen so as to encode an active portion of the protein, the fragment will need to be large enough to encode the functional region(s) of the protein. If the fragment is to be used as a nucleic acid probe or PCR primer, then the fragment length is chosen so as to obtain a relatively small number of false positives during probing/priming.
  • Fragments of the encoding nucleic acid molecules of the present invention i.e., synthetic oligonucleotides
  • PCR poiymerase chain reaction
  • Fragments of the encoding nucleic acid molecules of the present invention can easily be synthesized by chemical techniques, for example, the phosphotriester method of Matteucci, et al, (J. Am. Chem. Soc. 103:3185-3191, 1981) or using automated synthesis methods.
  • larger DNA segments can readily be prepared by well known methods, such as synthesis of a group of oligonucleotides that define various modular segments of the gene, followed by ligation of oligonucleotides to build the complete modified gene.
  • the encoding nucleic acid molecules of the present invention may further be modified so as to contain a detectable label for diagnostic and probe purposes.
  • a detectable label for diagnostic and probe purposes.
  • a variety of such labels are known in the art and can readily be employed with the encoding molecules herein described. Suitable labels include, but are not limited to, biotin, radiolabeled nucleotides and the like. A skilled artisan can employ any of the art known labels to obtain a labeled encoding nucleic acid molecule.
  • the identification of the human nucleic acid molecule having SEQ ID No.l or SEQ ID No 4 allows a skilled artisan to isolate nucleic acid molecules that encode other members of the protein family in addition to the human sequence herein described. Further, the presently disclosed nucleic acid molecules allow a skilled artisan to isolate nucleic acid molecules that encode other members of the family of proteins in addition to the 339 amino acid protein having SEQ ID No.2 or SEQ ID No. 4.
  • SEQ ID No.2 or SEQ ID No.4 can readily use the amino acid sequence of SEQ ID No.2 or SEQ ID No.4 to generate antibody probes to screen expression libraries prepared from appropriate cells.
  • polyclonal antiserum from mammals such as rabbits ii-nmunized with the purified protein (as described below) or monoclonal antibodies can be used to probe a mammalian cDNA or genomic expression library, such as lambda gtll library, to obtain the appropriate coding sequence for other members of the protein family.
  • the cloned cDNA sequence can be expressed as a fusion protein, expressed directly using its own control sequences, or expressed by constructions using control sequences appropriate to the particular host used for expression of the enzyme.
  • a portion of the coding sequence herein described can be synthesized and used as a probe to retrieve DNA encoding a member of the protein family from any mammalian organism.
  • Oligomers containing approximately 18-20 nucleotides (encoding about a 6-7 amino acid stretch) are prepared and used to screen genomic DNA or cDNA libraries to obtain hybridization under stringent conditions or conditions of sufficient stringency to eliminate an undue level of false positives.
  • pairs of oligonucleotide primers can be prepared for use in a poiymerase chain reaction (PCR) to selectively clone an encoding nucleic acid molecule.
  • PCR poiymerase chain reaction
  • a PCR denature/anneal/extend cycle for using such PCR primers is well known in the art and can readily be adapted for use in isolating other encoding nucleic acid molecules.
  • rDNA molecules Containing a Nucleic Acid Molecule
  • the present invention further provides recombinant DNA molecules (rDNAs) that contain a coding sequence.
  • a rDNA molecule is a DNA molecule that has been subjected to molecular manipulation in situ. Methods for generating rDNA molecules are well known in the art, for example, see Sambrook et al, Molecular Cloning (1989).
  • a coding DNA sequence is operably linked to expression control sequences and/or vector sequences.
  • a vector contemplated by the present invention is at least capable of directing the replication or insertion into the host chromosome, and preferably also expression, of the structural gene included in the rDNA molecule.
  • Expression control elements that are used for regulating the expression of an operably linked protein encoding sequence are known in the art and include, but are not limited to, inducible promoters, constitutive promoters, secretion signals, and other regulatory elements.
  • the inducible promoter is readily controlled, such as being responsive to a nutrient in the host cell's medium.
  • the vector containing a coding nucleic acid molecule will include a prokaryotic replicon, i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extrachromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith.
  • a prokaryotic replicon i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extrachromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith.
  • a prokaryotic host cell such as a bacterial host cell, transformed therewith.
  • vectors that include a prokaryotic replicon may also include a gene whose expression confers a detectable marker such as a drug resistance.
  • Typical bacterial drug resistance genes are those that confer resistance to ampicillin or tetracycline.
  • Vectors that include a prokaryotic replicon can further include a prokaryotic or bacteriophage promoter capable of directing the expression (transcription and translation) of the coding gene sequences in a bacterial host cell, such as E. coli.
  • a promoter is an expression control element formed by a DNA sequence that permits binding of RNA poiymerase and transcription to occur. Promoter sequences compatible with bacterial hosts are typically provided in plasmid vectors containing convenient restriction sites for insertion of a DNA segment of the present invention.
  • vector plasmids Typical of such vector plasmids are pUC8, pUC9, pBR322 and ⁇ BR329 available from Biorad Laboratories, (Richmond, CA), pPL and pKK223 available from Pharmacia, Piscataway, N. J.
  • Expression vectors compatible with eukaryotic cells can also be used to form a rDNA molecules that contains a coding sequence.
  • Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired DNA segment.
  • Typical of such vectors are pSVL and pKSV-10 (Pharmacia), pBPV-l/pML2d (International
  • Eukaryotic cell expression vectors used to construct the rDNA molecules of the present invention may further include a selectable marker that is effective in an eukaryotic cell, preferably a drug resistance selection marker.
  • a preferred drug resistance marker is the gene whose expression results in neomycin resistance, i.e., the neomycin phosphotransferase (neo) gene. (Southern et al, J. Mol. Anal.Genet 1:327-341, 1982.)
  • the selectable marker can be present on a separate plasmid, and the two vectors are introduced by co-transfection of the host cell, and selected by culturing in the appropriate drug for the selectable marker.
  • the present invention further provides host cells transformed with a nucleic acid molecule that encodes a protein of the present invention.
  • the host cell can be either prokaryotic or eukaryotic.
  • Eukaryotic cells useful for expression of a protein of the invention are not limited, so long as the cell line is compatible with cell culture methods and compatible with the propagation of the expression vector and expression of the gene product.
  • Preferred eukaryotic host cells include, but are not limited to, yeast, insect and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human cell line.
  • Preferred eukaryotic host cells include Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, NIH Swiss mouse embryo cells NIH/3T3 available from the ATCC as CRL 1658, baby hamster kidney cells (BHK), and the like eukaryotic tissue culture cell lines.
  • CHO Chinese hamster ovary
  • NIH Swiss mouse embryo cells NIH/3T3 available from the ATCC as CRL 1658
  • BHK baby hamster kidney cells
  • Any prokaryotic host can be used to express a rDNA molecule encoding a protein of the invention.
  • the preferred prokaryotic host is E. coli.
  • Transformation of appropriate cell hosts with a rDNA molecule of the present invention is accomplished by well known methods that typically depend on the type of vector used and host system employed. With regard to transformation of prokaryotic host cells, electroporation and salt treatment methods are typically employed, see, for example, Cohen et al. , Proc. Natl. Acad. Sci. USA 69:2110, 1972; and Maniatis et al. , Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982).
  • Successfully transformed cells i.e., cells that contain a rDNA molecule of the present invention
  • cells resulting from the introduction of an rDNA of the present invention can be cloned to produce single colonies. Cells from those colonies can be harvested, lysed and their DNA content examined for the presence of the rDNA using a method such as that described by Southern, JMol Biol 98:503, 1975, or Berent et al, Biotech. 3:208, 1985 or the proteins produced from the cell assayed via an immunological method.
  • the present invention further provides methods for producing a protein of the invention using nucleic acid molecules herein described.
  • the production of a recombinant form of a protein typically involves the following steps:
  • nucleic acid molecule that encodes a protein of the invention, such as the nucleic acid molecule depicted in SEQ ID No.1 or SEQ ID NO.3, nucleotides 184-1200 of SEQ ID No.l or nucleotides 133-1149 of SEQ ID No.3. If the encoding sequence is uninterrupted by introns, it is directly suitable for expression in any host.
  • the nucleic acid molecule is then preferably placed in operable linkage with suitable control sequences, as described above, to form an expression unit containing the protein open reading frame.
  • the expression unit is used to transform a suitable host and the transformed host is cultured under conditions that allow the production of the recombinant protein.
  • the recombinant protein is isolated from the medium or from the cells; recovery and purification of the protein may not be necessary in some instances where some impurities may be tolerated.
  • Each of the foregoing steps can be done in a variety of ways.
  • the desired coding sequences may be obtained from genomic fragments and used directly in appropriate hosts.
  • the construction of expression vectors that are operable in a variety of hosts is accomplished using appropriate replicons and control sequences, as set forth above.
  • control sequences, expression vectors, and transformation methods are dependent on the type of host cell used to express the gene and were discussed in detail earlier. Suitable restriction sites can, if not normally available, be added to the ends of the coding sequence so as to provide an excisable gene to insert into these vectors. A skilled artisan can readily adapt any host/expression system known in the art for use with the nucleic acid molecules of the invention to produce recombinant protein.
  • Another embodiment of the present invention provides methods for use in isolating and identifying binding partners of proteins of the invention
  • a protein of the invention is mixed with a potential binding partner or an extract or fraction of a cell under conditions that allow the association of potential binding partners with the protein of the invention.
  • peptides, polypeptides, proteins or other molecules that have become associated with a protein of the invention are separated from the mixture.
  • the binding partner that bound to the protein of the invention can then be removed and further analyzed.
  • the entire protein for instance the entire 339 amino acid protein of SEQ ID No.2 or SEQ ID No. 4 can be used.
  • a fragment of the protein can be used.
  • a cellular extract refers to a preparation or fraction which is made from a lysed or disrupted cell.
  • the preferred source of cellular extracts will be cells derived from human heart tissue, for instance, ischemic human heart tissue.
  • cellular extracts may be prepared from normal human heart tissue or available cell lines, particularly heart or muscle derived cell lines.
  • a variety of methods can be used to obtain an extract of a cell.
  • Cells can be disrupted using either physical or chemical disruption methods.
  • physical disruption methods include, but are not limited to, sonication and mechanical shearing.
  • chemical lysis methods include, but are not limited to, detergent lysis and enzyme lysis.
  • a skilled artisan can readily adapt methods for preparing cellular extracts in order to obtain extracts for use in the present methods.
  • the extract is mixed with the protein of the invention under conditions in which association of the protein with the binding partner can occur.
  • conditions can be used, the most preferred being conditions that closely resemble conditions found in the cytoplasm of a human cell.
  • Features such as osmolarity, pH, temperature, and the concentration of cellular extract used, can be varied to optimize the association of the protein with the binding partner.
  • the bound complex is separated from the mixture.
  • techniques can be utilized to separate the mixture. For example, antibodies specific to a protein of the invention can be used to immunoprecipitate the binding partner complex. Alternatively, standard chemical separation techniques such as chromatography and density/sediment centrifugation can be used.
  • the binding partner can be dissociated from the complex using conventional methods. For example, dissociation can be accomplished by altering the salt concentration or pH of the mixture.
  • the protein of the invention can be immobilized on a solid support.
  • the protein can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the protein to a solid support aids in separating peptide/binding partner pairs from other constituents found in the extract.
  • the identified binding partners can be either a single protein or a complex made up of two or more proteins.
  • binding partners may be identified using a Far- Western assay according to the procedures of Takayama et al, Methods Mol Biol 69:171-84, 1997 or Sauder et al, J GenVirol 77(5):991-6, 1996 or identified through the use of epitope tagged proteins or GST fusion proteins.
  • the nucleic acid molecules of the invention can be used in a yeast two-hybrid system.
  • the yeast two-hybrid system has been used to identify other protein partner pairs and can readily be adapted to employ the nucleic acid molecules herein described.
  • Another embodiment of the present invention provides methods for identifying agents that modulate the expression of a nucleic acid encoding a protein of the invention such as a protein having the amino acid sequence of SEQ ID No.2 or SEQ ID No.4.
  • Such assays may utilize any available means of monitoring for changes in the expression level of the nucleic acids of the invention.
  • an agent is said to modulate the expression of a nucleic acid of the invention, for instance a nucleic acid encoding the protein having the sequence of SEQ ID No.2 or SEQ ID No.4, if it is capable of up- or down-regulating expression of the nucleic acid in a cell.
  • cell lines that contain reporter gene fusions between the open reading frame defined by nucleotides 184-1200 of SEQ ID No.1 or nucleotides 133-1149 of SEQ ID No.3 and any assayable fusion partner may be prepared.
  • Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam et al. (1990) Anal Biochem 188:245-254).
  • Cell lines containing the reporter gene fusions are then exposed to the agent to be tested under appropriate conditions and time. Differential expression of the reporter gene between samples exposed to the agent and control samples identifies agents which modulate the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 or SEQ ID No.4.
  • Additional assay formats may be used to monitor the ability of the agent to modulate the expression of a nucleic acid encoding a protein of the invention such as the protein having SEQ ID No.2 or SEQ ID No.4.
  • mRNA expression may be monitored directly by hybridization to the nucleic acids of the invention.
  • Cell lines are exposed to the agent to be tested under appropriate conditions and time and total RNA or mRNA is isolated by standard procedures such those disclosed in Sambrook et al. (Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, 1989).
  • tissues may be analyzed under conditions which model physiological cardiac cell stimuli.
  • some model systems simply include substrate depletion and increased intracellular acidity (Ch'en et al, Prog Biophys Mol Biol 69(2-3):515-38, 1998). Others are more complex. For example, Wilders et al.
  • models have been developed to simulate ischemia and reprofusion in quiescent human ventricular cardiomyocytes.
  • Cellular injury and metabolic parameters can be assessed after various interventions, such as: preconditioning cells with anoxia, hypoxia, anoxic supematants, or hypoxic supematants (Cohen et al, Circulation 98(19 Suppl):IIl 84-94; discussion II194-6, 1998).
  • Another model is hypoxia-reoxygenation stress in the rat myoblast cell line, H9c2, which simulates ischemic preconditioning in heart tissue (Sakamoto et al, Biochem Biophys Res Commun 20;251(2):576-9, 1998).
  • assays which incubate cells under conditions that simulate cardiac ischemia and/or heart stress in vitro include, but are not limited to, for example, fluid shear stress in human endothelial cells (Houston et al, Artherioscler Thromb Vacs Biol 19(2):281-289, 1999) and passive stretch of cultured myocytes (Yamazaki et al, JMol Cel Cardiol 27(1):133-140, 1995).
  • Shear stress refers to the energy necessary produce an opposite but parallel sliding motion across a body's plane.
  • shear stress refers to substantially the physiological equivalent pressure produced in various tissues or organs such as force present in the vasculature by the actions of cardiac muscle.
  • assays which simulate ischemia by stressing the heart in vivo include, but are not limited to, for example, occlusion of the heart by ligation of blood vessels in animal models (Soloman et al, J Am Coll Cardiol 33(3): 854-856, 1999 and Kirma et ⁇ /., Jpn Circ J 62(4):294-298, 1998).
  • Probes to detect differences in RNA expression levels between cells exposed to the agent and control cells may be prepared from the nucleic acids of the invention. It is preferable, but not necessary, to design probes which hybridize only with target nucleic acids under conditions of high stringency. Only highly complementary nucleic acid hybrids form under conditions of high stringency.
  • the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference in stability between the probe:target hybrid and potential probe:non-target hybrids.
  • Probes may be designed from the nucleic acids of the invention through methods known in the art. For instance, the G+C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly available in Sambrook et al. ( " Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Press, NY, 1989) or Ausubel et al. (Current Protocols in Molecular Biology. Greene Publishing Co., NY, 1995).
  • Hybridization conditions are modified using known methods, such as those described by Sambrook et al. and Ausubel et al. as required for each probe.
  • Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format.
  • total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the sequences of the invention under conditions in which the probe will specifically hybridize.
  • nucleic acid fragments comprising at least one, or part of one of the sequences of the invention can be affixed to a solid support, such as a porous glass wafer.
  • the glass wafer can then be exposed to total cellular RNA or polyA RNA from a sample under conditions in which the affixed sequences will specifically hybridize.
  • Such glass wafers and hybridization methods are widely available, for example, those disclosed by Beattie (WO 95/11755).
  • Beattie WO 95/11755
  • agents which up or down regulate the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 or SEQ ID No.4 are identified.
  • Hybridization for qualitative and quantitative analysis of mRNAs may also be carried out by using a RNase Protection Assay (i.e., RPA, see Ma et al, Methods 10: 273-238, 1996).
  • RPA RNase Protection Assay
  • an expression vehicle comprising cDNA encoding the gene product and a phage specific DNA dependent RNA poiymerase promoter (e.g., T7, T3 or SP6 RNA poiymerase) is linearized at the 3' end of the cDNA molecule, downstream from the phage promoter, wherein such a linearized molecule is subsequently used as a template for synthesis of a labeled antisense transcript of the cDNA by in vitro transcription.
  • a phage specific DNA dependent RNA poiymerase promoter e.g., T7, T3 or SP6 RNA poiymerase
  • the labeled transcript is then hybridized to a mixture of isolated RNA (i.e., total or fractionated mRNA) by incubation at 45 °C overnight in a buffer comprising 80% formamide, 40 mM Pipes, pH 6.4, 0.4 M NaCl and 1 mM EDTA.
  • the resulting hybrids are then digested in a buffer comprising 40 ⁇ g/ml ribonuclease A and 2 ⁇ g/ml ribonuclease. After deactivation and extraction of extraneous proteins, the samples are loaded onto urea polyacrylamide gels for analysis.
  • agents which effect the expression of the instant gene products cells or cell lines would first be identified which express said gene products physiologically (e.g., see example Figure 1 for tissue distribution via Northern blot, however, RPAs may serve the identical purpose of expression selection).
  • Cell and/or cell lines so identified would be expected to comprise the necessary cellular machinery such that the fidelity of modulation of the transcriptional apparatus is maintained with regard to exogenous contact of agent with appropriate surface transduction mechanisms and/or the cytosolic cascades.
  • such cells or cell lines would be transduced or transfected with an expression vehicle (e.g., a plasmid or viral vector) construct comprising an operable non-translated 5'-promoter containing end of the structural gene encoding the instant gene products fused to one or more antigenic fragments, which are peculiar to the instant gene products, wherein said fragments are under the transcriptional control of said promoter and are expressed as polypeptides whose molecular weight can be distinguished from the naturally occurring polypeptides or may further comprise an immunologically distinct tag.
  • an expression vehicle e.g., a plasmid or viral vector
  • the agent comprises a pharmaceutically acceptable excipient and is contacted with cells comprised in an aqueous physiological buffer such as phosphate buffered saline (PBS) at physiological pH, Eagles balanced salt solution (BSS) at physiological pH, PBS or BSS comprising serum or conditioned media comprising PBS or BSS and/or serum incubated at 37° C .
  • PBS phosphate buffered saline
  • BSS Eagles balanced salt solution
  • serum or conditioned media comprising PBS or BSS and/or serum incubated at 37° C .
  • Said conditions may be modulated as deemed necessary by one of skill in the art.
  • the cells will be dismpted and the polypeptides of the disruptate are fractionated such that a polypeptide fraction is pooled and contacted with an antibody to be further processed by immuno logical assay (e.g., ELISA, immunoprecipitation or Western blot).
  • immuno logical assay e.g., ELISA, immunoprecipitation or Western blot.
  • the pool of proteins isolated from the "agent contacted” sample will be compared with a control sample where only the excipient is contacted with the cells and an increase or decrease in the immunologically generated signal from the "agent contacted” sample compared to the control will be used to distinguish the effectiveness of the agent.
  • Another embodiment of the present invention provides methods for identifying agents that modulate at least one activity of a protein of the invention such as the protein having the amino acid sequence of SEQ ID No.2 or SEQ ID No.4. Such methods or assays may utilize any means of monitoring or detecting the desired activity.
  • the relative amounts of a protein of the invention between a cell population that has been exposed to the agent to be tested compared to an un-exposed control cell population may be assayed.
  • probes such as specific antibodies are used to monitor the differential expression of the protein in the different cell populations.
  • Cell lines or populations are exposed to the agent to be tested under appropriate conditions and time.
  • Cellular lysates may be prepared from the exposed cell line or population and a control, unexposed cell line or population. The cellular lysates are then analyzed with the probe.
  • Antibody probes are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides.
  • polypeptides or proteins of the invention if they are of sufficient length, or, if desired, or if required to enhance immunogenicity, conjugated to suitable carriers.
  • suitable carriers such as BSA, KLH, or other carrier proteins are well known in the art.
  • direct conjugation using, for example, carbodiimide reagents may be effective; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, may be desirable to provide accessibility to the hapten.
  • the hapten peptides can be extended at either the amino or carboxy terminus with a Cys residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier.
  • Immunogens are conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art.
  • titers of antibodies are taken to determine adequacy of antibody formation. While the polyclonal antisera produced in this way may be satisfactory for some applications, for pharmaceutical compositions, use of monoclonal preparations is preferred.
  • Immortalized cell lines which secrete the desired monoclonal antibodies may be prepared using the standard method of Kohler and Milstein (Nature 256(5517):495-7, 1975; EurJ Immunol 6(7):511-9, 1976; and Biotechnology 24:524-6, 1992 )or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known.
  • the immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten. polypeptide or protein.
  • the cells can be cultured either in vitro or by production in ascites fluid.
  • the desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonals or the polyclonal antisera which contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies.
  • Use of immunologically reactive fragments, such as the Fab, Fab', of F(ab') 2 fragments is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
  • the antibodies or fragments may also be produced, using current technology, by recombinant means.
  • Antibody regions that bind specifically to the desired regions of the protein can also be produced in the context of chimeras with multiple species origin, for instance, humanized antibodies.
  • Agents that are assayed in the above method can be randomly selected or rationally selected or designed.
  • an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of the a protein of the invention alone or with its associated substrates, binding partners, etc.
  • An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism.
  • an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis which takes into account the sequence of the target site and or its conformation in connection with the agent's action.
  • agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up these sites.
  • a rationally selected peptide agent can be a peptide whose amino acid sequence is identical to the putative tyrosine kinase phosphorylation site at amino acid 98 of SEQ ID No.l.
  • the agents of the present invention can be, as examples, peptides, small molecules, vitamin derivatives, as well as carbohydrates. A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents of the present invention.
  • the peptide agents of the invention can be prepared using standard solid phase
  • Another class of agents of the present invention are antibodies immunoreactive with critical positions of proteins of the invention. Antibody agents are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions, those portions of the protein intended to be targeted by the antibodies.
  • the proteins and nucleic acids of the invention are expressed in ischemic heart tissue.
  • Agents that modulate or down-regulate the expression of the protein or agents such as agonists or antagonists of at least one activity of the protein may be used to modulate biological and pathologic processes associated with the protein's function and activity.
  • a subject can be any mammal, so long as the mammal is in need of modulation of a pathological or biological process mediated by a protein of the invention.
  • mammal is meant an individual belonging to the class
  • the invention is particularly useful in the treatment of human subjects.
  • Pathological processes refer to a category of biological processes which produce a deleterious effect.
  • expression of a protein of the invention may be associated with chronic ischemic heart disease and ischemic cardiomyopathy.
  • an agent is said to modulate a pathological process when the agent reduces the degree or severity of the process.
  • chronic ischemic heart disease or ischemic cardiomyopathy may be prevented or disease progression modulated after an ischemic event by the administration of agents which reduce or modulate in some way the expression or at least one activity of a protein of the invention.
  • the agents of the present invention can be provided alone, or in combination with other agents that modulate a particular pathological process.
  • an agent of the present invention can be administered in combination with anti-thrombotic agents.
  • two agents are said to be administered in combination when the two agents are administered simultaneously or are administered independently in a fashion such that the agents will act at the same time.
  • the agents of the present invention can be administered via parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or buccal routes.
  • administration may be by the oral route.
  • the dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
  • the present invention further provides compositions containing one or more agents which modulate expression or at least one activity of a protein of the invention.
  • Typical dosages comprise 0.1 to 100 ⁇ g/kg body wt.
  • the preferred dosages comprise 0.1 to 10 ⁇ g/kg body wt.
  • the most preferred dosages comprise 0.1 to 1 ⁇ g/kg body wt.
  • compositions of the present invention may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically for delivery to the site of action.
  • Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts.
  • suspensions of the active compounds as appropriate oily injection suspensions may be administered.
  • Suitable Hpophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran.
  • the suspension may also contain stabilizers. Liposomes can also be used to encapsulate the agent for delivery into the cell.
  • the pharmaceutical formulation for systemic administration according to the invention may be formulated for enteral, parenteral or topical administration. Indeed, all three types of formulations may be used simultaneously to achieve systemic administration of the active ingredient.
  • Suitable formulations for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations and controlled release forms thereof.
  • the compounds of this invention may be used alone or in combination, or in combination with other therapeutic or diagnostic agents.
  • the compounds of this invention may be coadministered along with other compounds typically prescribed for these conditions according to generally accepted medical practice, such as anticoagulant agents, thrombolytic agents, or other antithrombotics, including platelet aggregation inhibitors, tissue plasminogen activators, urokinase, prourokinase, streptokinase, heparin, aspirin, or warfarin.
  • the compounds of this invention can be utilized in vivo, ordinarily in mammals, such as humans, sheep, horses, cattle, pigs, dogs, cats, rats and mice, or in vitro.
  • Transgenic animals containing mutant, knock-out or modified genes corresponding to the cDNA sequence of SEQ ID NO: 1 or SEQ ID NO: 3 are also included in the invention.
  • Transgenic animals are genetically modified animals into which recombinant, exogenous or cloned genetic material has been experimentally transferred. Such genetic material is often referred to as a "transgene".
  • the nucleic acid sequence of the transgene in this case a form of SEQ ID NO: 1 or SEQ ID NO: 3, may be integrated either at a locus of a genome where that particular nucleic acid sequence is not otherwise normally found or at the normal locus for the transgene.
  • the transgene may consist of nucleic acid sequences derived from the genome of the same species or of a different species than the species of the target animal.
  • germ cell line transgenic animal refers to a transgenic animal in which the genetic alteration or genetic information was introduced into a germ line cell, thereby conferring the ability of the transgenic animal to transfer the genetic information to offspring. If such offspring in fact possess some or all of that alteration or genetic information, then they too are transgenic animals.
  • the alteration or genetic information may be foreign to the species of animal to which the recipient belongs, foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently than the native gene.
  • Transgenic animals can be produced by a variety of different methods including transfection, electroporation, microinjection, gene targeting in embryonic stem cells and recombinant viral and retroviral infection (see, e.g., U.S. Patent No. 4,736,866; U.S. Patent No. 5,602,307; Mullins et al, Hypertension 22(4):630-633, 1993; Brenin et al, Surg Oncol 6(2)99-110, 1997; Tuan (ed.), Recombinant Gene Expression Protocols. Methods in Molecular Biology. 1997, No. 62, Humana Press).
  • a number of recombinant or transgenic mice have been produced, including those which express an activated oncogene sequence (U.S. Patent No.
  • mice and rats remain the animals of choice for most transgenic experimentation, in some instances it is preferable or even necessary to use alternative animal species.
  • Transgenic procedures have been successfully utilized in a variety of non-murine animals, including sheep, goats, pigs, dogs, cats, monkeys, chimpanzees, hamsters, rabbits, cows and guinea pigs (see, e.g., Kim et al, Mol ReprodDev 46(4):515-526, 1997; Houdebine, Repr ⁇ /Nwtr .Dev 35(6):609-617, 1995; Petters Reprod Fertil Dev 6(5):643-645, 1994 ; Schnieke et al, Science 278(5346):2130-2133, 1997; and Amoah J Animal Science 75(2):578-585, 1997).
  • the method of introduction of nucleic acid fragments into recombination competent mammalian cells can be by any method which favors co-transformation of multiple nucleic acid molecules.
  • Detailed procedures for producing transgenic animals are readily available to one skilled in the art, including the disclosures in U.S. Patent No. 5,489,743 and U.S. Patent No. 5,602,307.
  • Heart tissue was obtained from five male patients with inotrope-dependent post- ischemic cardiomyopathy exhibiting severe myocyte and or cardiac hypertrophy with at least three years since their first myocardial infarction. Heart tissue was also obtained from 5 female patients with idiopathic dilated cardiomyopathy exhibiting severe myocyte and/or cardiac hypertrophy and CHF duration of at least 2 years.
  • Total cellular RNA was prepared from the heart tissue described above as well as from control, non-ischemic heart tissue using the procedure of Newburger et al. , J. Biol. Chem. 266(24): 16171-7, 1981 and Newburger et al, Proc Natl Acad Sci USA 85:5215-5219, 1988.
  • cDNA was synthesized according to the protocol described in the GIBCO/BRL kit for cDNA synthesis.
  • the reaction mixture may include lO ⁇ g of total RNA, and 2 pmol of 1 of the 2-base anchored oligo(dT) primers a heel such as RP5.0 (CTCTCAAGGATCTTACCGCTT 18 AT) (SEQ ID NO:6), or RP6.0 (TAATACCGCGCCACATAGCAT 18 CG) (SEQ ID NO:7), or RP9.2
  • the adapter oligonucleotide sequences were Al (TAGCGTCCGGCGCAGCGACGGCCAG) (SEQ ID NO:9)and A2 (GATCCTGGCCGTCGGCTGTCTGTCGGCGC) (SEQ ID NO: 10).
  • One microgram of oligonucleotide A2 was first phosphorylated at the 5' end using T4 polynucleotide kinase (PNK). After phosphorylation, PNK was heated denatured, and l ⁇ g of the oligonucleotide Al was added along with 10x annealing buffer (1 M NaCl/100 mM Tris-HCl, pH8.0/10 mM EDTA, pH8.0) in a final vol of 20 ⁇ l.
  • This mixture was then heated at 65 °C for 10 min followed by slow cooling to room temperature for 30 min, resulting in formation of the Y adapter at a final concentration of 100 ng/ ⁇ l.
  • About 20 ng of the cDNA was digested with 4 units of Bgl II in a final vol of 10 ⁇ for 30 min at 37°C.
  • oligonucleotide Al or Al .1 was 5 ' -end-labeled using 15 ⁇ l of [ ⁇ - 32 P] ATP (Amersham; 3000 Ci/mmol) and PNK in a final volume of 20 ⁇ l for 30 min at 37°C.
  • the labeled oligonucleotide was diluted to a final concentration of 2 ⁇ M in 80 ⁇ l with unlabeled oligonucleotide A
  • PCR was done to avoid artefactual amplification arising out of arbitrary annealing of PCR primers at lower temperature during transition from room temperature to 94 °C in the first PCR cycle.
  • PCR consisted of 5 cycles of 94°C for 30 sec, 55°C for 2 min, and 72°C for 60 sec followed by 25 cycles of 94°C for 30 sec, 60°C for 2 min, and 72°C for 60 sec. A higher number of cycles resulted in smeary gel patterns. PCR products (2.5 ⁇ l) were analyzed on 6% polyacrylamide sequencing gel.
  • Fragment 3145 is a band that corresponds to a cDNA derived from a mRNA species that is expressed in at least one ischemic heart tissue sample.
  • the band corresponding to fragment 3145 was sequenced.
  • the sequence of the band is: ccaggagctatgaatgactcagtggtggaaatgcccttctggaaactgaatattaccttctgtaggaaaaggtggaaatagc atctagaaggttgttgtgtgaatgactctgtgctggcaaaaatgcttgaaacctctatatttctttcgttcataagacgtaaaggtcaaat ttttcaagaaaagtctttttaataacaaagcatgttctctgtgtgaatctgtaatagtctgttcaat
  • the full length cDNA corresponding to band 3145 was obtained by the oligo-pulling method. Briefly, a gene-specific oligo was designed based on cDNA fragment 3145. The oligo was labeled with biotin and used to hybridize with 2 ug of single strand plasmid DNA (cDNA recombinants) from a human heart cDNA library following the procedures of Sambrook et al.. The hybridized cDNAs were separated by streptavidin-conjugated beads and eluted by heating. The eluted cDNA was converted to double strand plasmid DNA and used to transform E. coli cells (DH10B) and the longest cDNA was screened. After confirmed by PCR using gene-specific primers, the cDNA clone was subjected to DNA sequencing.
  • cDNA recombinants single strand plasmid DNA
  • DH10B E. coli cells
  • the nucleotide sequence of the full-length cDNA corresponding to the differentially regulated band 3145 band is set forth in SEQ ID No: 1 (PGP-980.1).
  • the cDNA comprises 2008 base pairs with an open reading frame encoding a protein predicted to contain 339 amino acids.
  • the predicted amino acid sequence is presented in SEQ ID Nos. 1 and 2.
  • the nucleotide sequence of a second full length cDNA corresponding to the differentially regulated band 3145 is set forth in SEQ ID NO:3 (PGP980.2).
  • the cDNA comprises 1981 base pairs with an open reading frame encoding a protein predicted to contain 339 amino acids.
  • the predicted amino acid sequence is set forth in SEQ ID Nos: 3 and 4.
  • the 339 amino acid sequence of PGP980.1 and PGP980.2 differ only by the presence of a cysteine residue at amino acid residue 66 in PGP980.1 and an arginine at the same amino acid residue in PGP980.2.
  • the predicted isoelectric point of the 2 proteins is approximately 7.52. Both proteins contain a putative signal sequence comprising amino acids 1-29.
  • RNA encoding the differentially regulated gene encoding the protein of SEQ ID NO:2 was analyzed by Northern blot as well as PCR expression analysis of RNA isolated from various tissues.
  • RNA was isolated from human heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas using standard procedures.
  • Northern blots were prepared using a probe derived from SEQ ID NO:l with hybridization conditions as described by Sambrook et al (1989).
  • PCR expression analysis was also performed using primers derived from SEQ ID NO:l using AmpliTaq Gold PCR® amplification kits (Perkin Elmer).
  • Figure 1 is a Northern blot demonstrating the presence of variable levels of specific RNA in all tissues.
  • Figure 2 is a PCR analysis of expression levels in normal and ischemic heart tissue samples compared to the detected levels in the differential display.
  • Samples 206 and 558 are normal heart tissue samples.
  • Samples 146, 149, 294, 320 and 327 are ischemic heart tissue samples (see Table 1).
  • the first fragment in the top row of Fgure 2 is a differential display band from a normal heart tissue samples. Bands 2-6 correspond to the differential display bands for samples 146, 149, 294, 320 and 327, respectively.
  • Real time PCR detection was accomplished by the use of the ABI PRISM 7700
  • the 7700 measures the fluorescence intensity of the sample each cycle and is able to detect the presence of specific amplicons within the PCR reaction.
  • Each sample was assayed for the level of GAPDH and Clone 980.
  • GAPDH detection was performed using Perkin Elmer part#402869 according to the manufacturer's directions.
  • Primers were designed for clone 980 using Primer Express, a program developed by PE to efficiently find primers and probes for specific sequences. These primers were used in conjunction with SYBR green (Molecular Probes), a nonspecific double stranded DNA dye, to measure the expression level of a clone 980, which was normalized to the GAPDH level in each sample. The normalized values are reported in Figure 2.
  • Samples 206 and 558 are normal samples, the remainder are from ischemic male patients.
  • Example 4 Method of Screening for Modulators of PGP980.1 and PGP980.2 Expression Using Shear-Stress Assay Using human epithelial cells, a shear-stress of 1.5 N/m 2 is applied to cells in culture according to the method of Houston et al. (Artherioscler Thromb Vacs Biol 19(2):281-289, 1999). At specific time points during applied stress, candidate agents and diluent (t.e., carrier minus agent; control) are contacted with human epithelial cells. Cells are removed and lysed in an appropriate buffer for isolation of total and or messenger RNA in a similar fashion as described in Sambrook et al. (1989).
  • candidate agents and diluent t.e., carrier minus agent; control
  • Isolated nucleic acids are then assayed by a transcriptional profiling means to determine whether the candidate agent modulates the induction of PGP980.1 and PGP980.2.
  • Agents which up- or down-regulate the expression of either one or both transcripts are then designated as modulators of PGP980.1 and PGP980.2.
  • Example 6 Method of Screening for Modulators of Myocardial PGP980.1 and PGP980.2 Expression Using an -Animal Model for Occlusion and Reprofusion of the Heart Animal models for occlusion of the heart are well documented (Soloman et al, J Am Coll Cardiol 33(3): 854-856, 1999 and Kirma et al, Jpn Circ J 62(4):294-298, 1998). For example, pigs are used wherein regional ischemia is produced in control and candidate agent treated animals by partially occluding (ligating) the left anterior descending coronary artery.
  • agents are administered to the animals (including carrier-only for controls) and at various time points and/or after administration of various concentrations of candidate agents using a single time point, post occlusion, the hearts of the animals are removed for isolation of nucleic acids by standard methods as described in Sambrook et al (1989). Isolated nucleic acids are then assayed by a transcriptional profiling assay to determine whether the candidate agent modulates the induction of PGP980.1 and PGP980.2. Agents which up- or down- regulate of either one or both transcripts will then be designated as modulators of PGP980.1 and PGP980.2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne, d'une manière générale, les changements survenus dans l'expression génique dans le tissu cardiaque humain ischémique par rapport au tissu cardiaque humain normal. L'invention concerne, d'une manière spécifique, un nouveau gène humain exprimé dans le tissu cardiaque humain ischémique.
PCT/US1999/020015 1998-09-01 1999-09-01 Identification d'un adn complementaire associe a l'ischemie dans le tissu cardiaque humain WO2000011942A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU57989/99A AU5798999A (en) 1998-09-01 1999-09-01 Identification of a cdna associated with ischemia in human heart tissue

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US9868398P 1998-09-01 1998-09-01
US60/098,683 1998-09-01

Publications (2)

Publication Number Publication Date
WO2000011942A1 WO2000011942A1 (fr) 2000-03-09
WO2000011942A9 true WO2000011942A9 (fr) 2000-10-05

Family

ID=22270453

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/020015 WO2000011942A1 (fr) 1998-09-01 1999-09-01 Identification d'un adn complementaire associe a l'ischemie dans le tissu cardiaque humain

Country Status (1)

Country Link
WO (1) WO2000011942A1 (fr)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6800455B2 (en) 2000-03-31 2004-10-05 Scios Inc. Secreted factors
JP4344519B2 (ja) * 2000-12-28 2009-10-14 旭化成ファーマ株式会社 ＮＦ−κＢ活性化遺伝子
WO2003006687A2 (fr) * 2001-07-10 2003-01-23 Medigene Ag Nouveaux genes cibles concernant des maladies cardiaques
JP2005502367A (ja) * 2001-09-11 2005-01-27 ザ リージェンツ オブ ザ ユニバーシティ オブ コロラド， ア ボディー コーポレイト インタクトなヒト心臓における発現プロファイリング

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0977851A2 (fr) * 1997-04-15 2000-02-09 Genetics Institute, Inc. Proteines secretees et polynucleotides codant ces proteines
DE69841994D1 (de) * 1997-05-30 2010-12-23 Human Genome Sciences Inc 32 Humane sekretierte Proteine

Also Published As

Publication number Publication date
WO2000011942A1 (fr) 2000-03-09

Similar Documents

Publication Publication Date Title
US5346991A (en) Tissue factor mutants useful for the treatment of myocardial infarction and coagulopathic disorders
US6762029B2 (en) Methods of identifying agents that modulate P2Y12 receptor activity
US20050037454A1 (en) Gene associated with bone disorders
WO2000011942A9 (fr) Identification d'un adn complementaire associe a l'ischemie dans le tissu cardiaque humain
AU3208999A (en) Identification of a cdna associated with ischemia in human heart tissue
WO2001016354A1 (fr) Modulation de he4 dans des maladies inflammatoires et renales
WO2001057062A1 (fr) Modulation de osf-2 dans des maladies inflammatoires et renales
WO2001062767A1 (fr) IDENTIFICATION D'UN ADNc ASSOCIE A LA FONCTION VENTRICULAIRE DANS DU TISSU MYOCARDIQUE HUMAIN
WO2000060122A1 (fr) IDENTIFICATION D'UN ADNc ASSOCIE A L'ISCHEMIE DANS UN TISSU DE COEUR HUMAIN
WO2001005803A1 (fr) Nouveaux adnc associes a des nephropathies
WO2003025152A2 (fr) Identification d'un adnc associe a l'ischemie dans des tissus cardiaques humains
WO2002012262A1 (fr) Identification des adnc associes a l'hyperplasie benigne de la prostate
WO2000052026A1 (fr) Identification d'un adn complementaire associe a l'hypertrophie compensatoire dans le tissu renal
US20050147969A1 (en) Genes associated with mast cell activation
WO2000078788A1 (fr) Nouvel adn complementaire associe a une pathologie renale
WO2001005804A1 (fr) Nouveaux genes associes a une maladie renale
US20030079239A1 (en) Gene Associated with bone disorders
WO2001098456A2 (fr) Identification d'adnc associes a l'hyperplasie prostatique benigne
WO2002012439A2 (fr) Genes associes a des maladies renales
WO2001041805A1 (fr) Nouvel adnc 22360 associe aux maladies renales et a d'autres etats pathologiques
US20030166881A1 (en) Novel genes associated with allergic hypersensitivity and mast cell activation
WO2002010338A2 (fr) Expression d'une proteine du type gage/page dans l'hypertrophie benigne de la prostate
WO2003008561A2 (fr) Genes associes a l'hyperplasie benigne de la prostate
JP2002291481A (ja) 新規ｇ蛋白質共役型受容体
WO2002077162A2 (fr) Gene (t23490) associe a l'hyperplasie benigne de la prostate

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/2-2/2, DRAWINGS, REPLACED BY NEW PAGES 1/2-2/2; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 09786052

Country of ref document: US

122 Ep: pct application non-entry in european phase