WO2001062767A1 - IDENTIFICATION D'UN ADNc ASSOCIE A LA FONCTION VENTRICULAIRE DANS DU TISSU MYOCARDIQUE HUMAIN - Google Patents

IDENTIFICATION D'UN ADNc ASSOCIE A LA FONCTION VENTRICULAIRE DANS DU TISSU MYOCARDIQUE HUMAIN Download PDF

Info

Publication number
WO2001062767A1
WO2001062767A1 PCT/US2001/005888 US0105888W WO0162767A1 WO 2001062767 A1 WO2001062767 A1 WO 2001062767A1 US 0105888 W US0105888 W US 0105888W WO 0162767 A1 WO0162767 A1 WO 0162767A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
polypeptide
acid molecule
seq
agent
Prior art date
Application number
PCT/US2001/005888
Other languages
English (en)
Inventor
Daniel Bednarik
John Greene
Marga White
Original Assignee
Gene Logic, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gene Logic, Inc. filed Critical Gene Logic, Inc.
Priority to AU2001241707A priority Critical patent/AU2001241707A1/en
Publication of WO2001062767A1 publication Critical patent/WO2001062767A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the invention relates generally to the changes in gene expression in myocardial tissue in patients with end-stage cardiomyopathy before and after surgical implantation of a left ventricle assist device (LVAD).
  • LVAD left ventricle assist device
  • the invention relates specifically to a novel human gene which is down-regulated in myocardial tissue following LVAD implantation in human patients.
  • Dilated cardiomyopathy is characterized by increased left ventricular or bi ventricular dimensions with decreased ventricular ejection.
  • Myocardial contractility is severely impaired in systole along with variable impairment of relaxation and compliance during diastole (Rockney, "Valvular heart disease” in: Bennett & Plum, Textbook of Medicine - 20th edition, Saunders (1996) 319-327).
  • dilated cardiomyopathy was considered an incurable, uniformly fatal chronic disease.
  • Epidemiologic studies however, have demonstrated that at least a quarter of patients with recent onset of symptoms with cardiomyopathy manifest spontaneous improvement and a sustained favorable prognosis (Schocken et al., J. Am. Coll. Cardiol. (1992) 20, 301-
  • the LVAD implant operation is highly risky, in part, because the patients are so urgent ill. But those who survive the initial LVAD implantation surgery go on to do as well as other heart transplant patients. Overall, heart recipients have a four-year survival rate of greater than seventy percent (Kreitt et al, J. Heart Lung Transplant. (1991) 10, 491-498).
  • the LVAD is a mechanical pump that is implanted below the diaphragm while the battery pack which powers the pump is carried outside the body.
  • This device is surgically implanted in the patients' thoracic cavity and bypasses the failing left ventricle of the heart, maintaining the function of the heart to pump that is unable to effectively perform on its own.
  • Patients awaiting a heart transplant often have to wait for extended periods before a suitable heart becomes available. During this wait, the patient's already weakened heart may deteriorate and become unable to pump enough blood to sustain life.
  • the LVAD assists the weakened heart allowing time for a donor heart to be obtained for the patient.
  • this device is an end-stage option for the patient presenting dilated cardiomyopathy and heart failure.
  • the typical LVAD has a tube going into the left ventricle that pulls blood from the ventricle into the pump.
  • LVADs are typically used for several weeks to months but recent studies have examined the use of LVAD as a permanent therapy for end-stage cardiomyopathy (Oz et al, Cardiac Chron. (1993) 7, 1-7).
  • dilated cardiomyopathy The basis for dilated cardiomyopathy has been studied at the molecular level. Phenotypic heterogeneity, different patterns of transmission, and different frequencies of cardiac autoantibodies indicate that multiple genes and pathogenetic mechanisms can lead to dilated cardiomyopathy (Mestroni et al:, J. Am. Coll. Cardiol. (1999) 34, 181-90). For instance, deletion of the entire dystrophin gene has been found to be associated with dilated cardiomyopathy in canines (Schatzberg et al., Neuromuscul. Disord. (1999) 9, 289-95). In humans, terminally differentiated cardiomyocytes have the capacity to synthesize new DNA and exhibit plasticity by a compensatory growth response following ischemic injury.
  • the invention encompasses an isolated nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO: 2; an isolated nucleic acid molecule that encodes a fragment of at least six amino acids of SEQ ID NO: 2; an isolated nucleic acid molecule which hybridizes to a nucleic acid molecule comprising SEQ ID NO: 1 under conditions of sufficient stringency to produce a clear signal; and an isolated nucleic acid molecule which hybridizes to a nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO: 2 under conditions of sufficient stringency to produce a clear signal.
  • Nucleic acid molecules of the invention may have 60% nucleotide sequence identity through the open reading frame of SEQ ID NO:l, preferably about 70-75% sequene identity, more preferably about 80-85% sequence identity, and even more preferably at least about 90% sequence identity through the open reading frame.
  • the isolated nucleic acid molecule may be operably linked to one or more expression control elements, integrated into a vector and used to transform prokaryotic hosts and eukaryotic host cells.
  • the invention also includes a method for producing a polypeptide comprising the step of culturing a host cell transformed with the nucleic acid under conditions in which the protein encoded by said nucleic acid molecule is expressed.
  • the invention further includes an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 2; an isolated polypeptide comprising a fragment of at least six amino acids of SEQ ID NO: 2; an isolated polypeptide comprising conservative amino acid substitutions of SEQ ID NO: 2; and naturally occurring amino acid sequence variants of SEQ ID NO: 2.
  • an antibody that binds to a polypeptide of the invention such antibodies may be monoclonal or polyclonal.
  • the invention encompasses a method of identifying an agent which modulates the expression of the polypeptide of the invention comprising the steps of: exposing cells which express the polypeptide to the agent; and determining whether the agent modulates expression of said polypeptide, thereby identifying an agent which modulates the expression of the polypeptide.
  • the invention further encompasses a method of identifying an agent which modulates the activity of the polypeptide of the invention comprising the steps of: exposing cells which express the poypeptide to the agent; and determining whether the agent modulates the activity of said polypeptide, thereby identifying an agent which modulates the activity of the polypeptide.
  • the invention also encompasses a method of identifying an agent which modulates the transcription of the nucleic acid molecule of the invention comprising the steps of: exposing cells which transcribe the nucleic acid to the agent; and determining whether the agent modulates transcription of said nucleic acid, thereby identifying an agent which modulates the transcription of the nucleic acid.
  • Also embodied in the invention is a method of identifying binding partners for the polypeptide of the invention comprising the steps of: exposing the polypeptide to a potential binding partner; and determining if the potential binding partner binds to the polypeptide, thereby identifying binding ' partners for the polypeptide.
  • Methods for modulating the expression or activity of a nucleic acid or polypeptide of the invention comprising administering an effective amount of an agent which modulates the expression or activity of a nucleic acid or polypeptide are also encompassed in the invention.
  • a non-human transgenic animal modified to contain a nucleic acid molecule of the invention is contemplated.
  • the nucleic acid molecule may also contain a mutation(s) that prevents production of functional protein, constitutively activates the protein or constitutes a dominant negative mutant.
  • the invention encompasses a method of identifying an agent which modulates the amount of gene product expressed from the nucleic acid of the invention comprising the steps of: administering the agent to be tested to, a mammal; and measuring the amount of the gene product expressed in the tissue of said mammal; wherein an increase or decrease in the level of the gene product expressed identifies an agent capable of modulating expression of said gene product.
  • the invention also includes methods for diagnosing cardiomyopathy comprising the step of determining the level of expression of the nucleic acid or polypeptide of the invention.
  • Also included are methods for preventing or treating cardiomyopathy comprising administering a therapeutically effective amount of the nucleic acid or polypeptide of the invention. Such methods may diminish the occurrence of at least one of the following symptoms associated with cardiomyopathy; reduced ejection fraction, increased left ventricular diastolic dimension, decreased ventricular wall thickness, increased atrial size, valvular regurgitation, exertional intolerance and ventricular tachyrhythmia.
  • the invention further includes a method of assessing the effect of LVAD for treatment of cardiomyopathy comprising measuring the amount of the polypeptide of the invention expressed wherein an alteration in the amount of the polypeptide expressed correlates to successful LVAD treatment.
  • Another method encompassed in the invention includes altering the amount of time a patient can remain on LVAD treatment by modulating the amount of the polypeptide of the invention expressed in myocardial tissue.
  • the invention also encompasses a method of identifying patients who require LVAD treatment by measuring the amount of gene product from the nucleic acid of the invention expressed in myocardial tissue wherein an alteration in the amount of said gene product expressed is indicative of a patient requiring LVAD treatment.
  • the invention further encompasses a method of preventing or treating cardiomyopathy comprising modulating the amount of gene product from the nucleic acid of the invention expressed in myocardial tissue by administering a therapeutically effective amount of the agent identified using the methods of the invention.
  • Figure 1 READSTM (Restriction Enzyme Analysis of Differentially expressed Sequences) results displaying regulation of cardiomyopathy associated protein (14431) (SEQ LD NO: 1) expression in myocardial biopsies from normal hearts and myocardial biopsies prior to LVAD therapy and following cardiectomy prior to cardiac transplantation.
  • READSTM Restriction Enzyme Analysis of Differentially expressed Sequences
  • FIG. 1 Quantitative RT-PCR results displaying 14431 (SEQ LD NO: 1) mRNA expression in myocardial biopsies from normal hearts and myocardial biopsies prior to LVAD therapy and following cardiectomy prior to cardiac transplantation.
  • Figure 3 Expanded quantitative RT-PCR results displaying 14431 (SEQ ID NO:
  • FIG. 4 Extended quantitative RT-PCR results displaying 14431 (SEQ ID NO: 1) mRNA expression in myocardial tissue from normal hearts, hearts from patients suffering from ischemic cardiomyopathy (IsCM), idiopathic cardiomyopathy (IDCM), valvular disease (valvular) or other heart disease. (other).
  • IsCM ischemic cardiomyopathy
  • IDCM idiopathic cardiomyopathy
  • valvular valvular disease
  • Figure 5 Quantitative RT-PCR tissue profile panel from kidney, adrenal gland, pancreas, salivary gland, liver, prostate, thyroid, cerebellum, fetal brain, placenta, spinal cord, stomach, small intestine, bone marrow, thymus, spleen, heart, lung, testes, uterus, mammary gland and trachea.
  • Figure 6 Predicted hydrophobicity, hydr ⁇ philicity, antigenic index and structure plots for SEQ ID NO: 2.
  • FIG. 7 Northern blot of various tissues.
  • the present invention is based in part on a new gene that is differentially expressed in human LVAD myocardial biopsy samples.
  • the human gene encodes a protein of 358 amino acids designated as cardiomyopathy associated protein (CAP).
  • CAP cardiomyopathy associated protein
  • the protein can serve as a target for agents that can be used to modulate the expression or activity of the proteins. For example, agents may be identified which modulate biological processes associated with cardiomyopathy, LVAD therapy and cardiac transplantation.
  • the present invention provides isolated protein, allelic variants of the protein, and conservative amino acid substitutions of the protein.
  • protein or polypeptide refers to a protein that has the human amino acid sequence depicted in SEQ ID NO: 2 as well as the related molecules described herein.
  • the invention also includes naturally occurring allelic variants and proteins that have a slightly different amino acid sequence than that specifically recited above. Allelic variants, though possessing a slightly different amino acid sequence than those recited above, will still have the same or similar biological functions associated with the 358 amino acid protein.
  • the family of proteins related to the human amino acid sequence of SEQ ID NO: 2 refers to proteins that have been isolated from organisms in addition to humans. The methods used to identify and isolate other members of the family of proteins related to the 358 amino acid protein are described below.
  • the proteins of the present invention are preferably in isolated form.
  • a protein is said to be isolated when physical, mechanical or chemical methods are employed to remove the protein from cellular constituents that are normally associated with the protein. A skilled artisan can readily employ standard purification methods to obtain an isolated protein.
  • the proteins of the present invention further include conservative amino acid substitution variants (i.e., conservative) of the proteins herein described.
  • a conservative variant refers to at least one alteration in the amino acid sequence that does not adversely affect the biological functions of the protein.
  • a substitution, insertion or deletion is said to adversely affect the protein when the altered sequence prevents or disrupts a biological function associated with the protein.
  • the overall charge, structure or hydrophobic/hydrophilic properties of the protein can be altered without adversely affecting a biological activity.
  • the amino acid sequence can often be altered, for example to render the peptide more hydrophobic or hydrophilic, without adversely affecting the biological activities of the protein.
  • allelic variants, the conservative substitution variants, and the members of the protein family will have an amino acid sequence having at least about 50%, 60%, 70%) or 15% amino acid sequence identity with the sequence set forth in SEQ ID NO: 2 more preferably at least about 80%), even more preferably at least about 90%, and most preferably at least about 95%.
  • Identity or homology with respect to such sequences is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the known peptides, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. N-terminal, C-terminal or internal extensions, deletions, or insertions into the peptide sequence shall not be construed as affecting homology.
  • the proteins of the present invention include molecules having the amino acid sequence disclosed in SEQ ID NO: 2; fragments thereof having a consecutive sequence of at least about 3, 4, 5, 6, 10, 15, 20, 25, 30, 35 or more amino acid residues of the proteins, for instance, antigenic fragments (see Figure 6); amino acid sequence variants wherein an amino acid residue has been inserted N- or C-terminal to, or within, the disclosed sequence; and amino acid sequence variants of the disclosed sequence, or their fragments as defined above, that have been substituted by another residue.
  • Contemplated variants further include those containing predetermined mutations by, e.g.
  • homologous recombination, site-directed or PCR mutagenesis, and the corresponding proteins of other animal species including but not limited to rabbit, mouse, rat, porcine, bovine, ovine, equine and non-human primate species, and the alleles or other naturally occurring variants of the family of proteins; and derivatives wherein the protein has been covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (for example a detectable moiety such as an enzyme or radioisotope).
  • members of the family of proteins can be used: 1) to identify agents which modulate at least one activity of the protein; 2) to identify binding partners for the protein, 3) as an antigen to raise polyclonal or monoclonal antibodies, 4) as a therapeutic agent or target and 5) as a diagnostic marker.
  • nucleic acid includes RNA or DNA molecules that encode a protein or peptide as defined above, is complementary to a nucleic acid sequence encoding such peptides, hybridizes to such a nucleic acid and remains stably bound to it under appropriate stringency conditions, encodes a polypeptide sharing at least about 75 % sequence identity, preferably at least 80%, and more preferably at least about 85%, with the peptide sequences or exhibits at least about 60% nucleotide sequence identity over nucleotides 283-1356 of SEQ ID NO:l, preferably about 70-75% sequence identity, more preferably about 80-85%> sequence identity or more preferably, about 90-95 sequence identity through the open reading frame defined by nucleotide 285- 1356.
  • genomic DNA e.g., genomic DNA, cDNA, mRNA and antisense molecules, as well as nucleic acids based on alternative backbones or including alternative bases whether derived from natural sources or synthesized.
  • hybridizing or complementary nucleic acids are defined further as being novel and non- obvious over any prior art nucleic acid including that which encodes, hybridizes under appropriate stringency conditions, or is complementary to nucleic acid encoding a protein according to the present invention.
  • BLAST Basic Local Alignment Search Tool
  • blastp, blastn, blastx, tblastn and tblastx Karlin et al, Proc. Natl. Acad. Sci. USA (1990) 87, 2264-2268 and Altschul, J. Mol. Evol. (1993) 36, 290-300, fully incorporated by reference
  • the approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance.
  • the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), wherein the default values for M and N are 5 and -4, respectively.
  • “Stringent conditions” are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 MNaCl/0.0015 M sodium citrate/0.1%> SDS at 50°C, or (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1%> Ficoll/0.1%> polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C.
  • a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1%> Ficoll/0.1%> polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C.
  • nucleic acid molecule is said to be "isolated" when the nucleic acid molecule is substantially separated from contaminant nucleic acid encoding other polypeptides from the source of nucleic acid. .
  • the present invention further provides fragments of the encoding nucleic acid molecule.
  • a fragment of an encoding nucleic acid molecule refers to a small portion of the entire protein coding sequence. The size of the fragment will be determined by the intended use. For example, if the fragment is chosen so as to encode an active portion of the protein, the fragment will need to be large enough to encode the functional region(s) of the protein.
  • fragments of the invention encode antigenic fragments of the protein having SEQ ID NO: 2 as set forth in Figure 6. If the fragment is to be used as a nucleic acid probe or PCR primer, then the fragment length is chosen so as to obtain a relatively small number of false positives during probing and priming.
  • Fragments of the encoding nucleic acid molecules of the present invention i.e., synthetic oligonucleotides
  • PCR polymerase chain reaction
  • Fragments of the encoding nucleic acid molecules of the present invention can easily be synthesized by chemical techniques, for example, the phosphotriester method of Matteucci etal, J. Am. Chem. Soc. (1981) 103, 3185-3191) or using automated synthesis methods.
  • larger DNA segments can readily be prepared by well known methods, such as synthesis of a group of oligonucleotides that define various modular segments of the gene, followed by ligation of oligonucleotides to build the complete modified gene.
  • the encoding nucleic acid molecules of the present invention may further be modified so as to contain a detectable label for diagnostic and probe purposes.
  • a detectable label for diagnostic and probe purposes.
  • a variety of such labels are known in the art and can readily be employed with the encoding molecules herein described. Suitable labels include, but are not limited to, biotin, radiolabeled nucleotides and the like. A skilled artisan can employ any of the art known labels to obtain a labeled encoding nucleic acid molecule.
  • nucleic acid molecule having SEQ ID NO: 1 allows a skilled artisan to isolate other members of the protein family in addition to the sequences herein described. Further, the presently disclosed nucleic acid molecules allow a skilled artisan to isolate nucleic acid molecules that encode other members of the family of proteins in addition to the protein having SEQ ID NO: 2.
  • polyclonal antiserum from mammals such as rabbits immunized with the purified protein (as described below) or monoclonal antibodies can be used to probe a mammalian cDNA or genomic expression library, such as lambda gtll library, to obtain the appropriate coding sequence for other members of the protein family.
  • the cloned cDNA sequence can be expressed as a fusion protein, expressed directly using its own control sequences, or expressed by constructions using control sequences appropriate to the particular host used for expression of the enzyme.
  • a portion of the coding sequence herein described can be synthesized and used as a probe to retrieve DNA encoding a member of the protein family from any mammalian organism.
  • Oligomers containing approximately 18-20 nucleotides (encoding about a 6-7 amino acid stretch) are prepared and used to screen genomic DNA or cDNA libraries to obtain hybridization under stringent conditions or conditions of sufficient stringency to eliminate an undue level of false positives.
  • pairs of oligonucleotide primers can be prepared for use in a polymerase chain reaction (PCR) to selectively clone an encoding nucleic acid molecule.
  • PCR polymerase chain reaction
  • a PCR denature/anneal/extend cycle for using such PCR primers is well known in the art and can readily be adapted for use in isolating other encoding nucleic acid molecules.
  • the present invention further provides recombinant DNA molecules (rDNAs) that contain a coding sequence.
  • a rDNA molecule is a DNA molecule that has been subjected to molecular manipulation in situ. Methods for generating rDNA molecules are well known in the art, for example, see Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1985).
  • a coding DNA sequence is operably linked to expression control sequences and/or vector sequences.
  • a vector contemplated by the present invention is at least capable of directing the replication or insertion into the host chromosome, and preferably also expression, of the structural gene included in the rDNA molecule.
  • Expression control elements that are used for regulating the expression of an operably linked protein encoding sequence are known in the art and include, but are not limited to, inducible promoters, constitutive promoters, secretion signals, and other regulatory elements.
  • the inducible promoter is readily controlled, such as being responsive to a nutrient in the host cell's medium.
  • the vector containing a coding nucleic acid molecule will include a prokaryotic replicon, i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extra-chromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith.
  • a prokaryotic replicon i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extra-chromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith.
  • a prokaryotic host cell such as a bacterial host cell, transformed therewith.
  • vectors that include a prokaryotic replicon may also include a gene whose expression confers a detectable marker such as drug resistance. Typical bacterial drug resistance genes are those that confer resistance to ampicillin or tetracycline.
  • Vectors that include a prokaryotic replicon can further include a prokaryotic or bacteriophage promoter capable of directing the expression (transcription and translation) of the coding gene sequences in a bacterial host cell, such as E. coli.
  • a promoter is an expression control element formed by a DNA sequence that permits binding of RNA polymerase and transcription to occur. Promoter sequences compatible with bacterial hosts are typically provided in plasmid vectors containing convenient restriction sites for insertion of a DNA segment of the present invention.
  • Typical of such vector plasmids are pUC8, pUC9, ⁇ BR322 and ⁇ BR329 available from BioRad Laboratories (Richmond, CA), pPL and pKK223 available from Pharmacia (Piscataway, NJ).
  • Expression vectors compatible with eukaryotic cells can also be used to form a rDNA molecules that contains a coding sequence.
  • Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired DNA segment. Typical of such vectors are pSVL and pKSV-10 (Pharmacia), pBPV-l/pML2d (International Biotechnologies, Inc.), pTDTl (ATCC, #31255), the vector pCDM8 described herein, and the like eukaryotic expression vectors. Vectors may be modified to include myocardial cell specific promoters if needed.
  • Eukaryotic cell expression vectors used to construct the rDNA molecules of the present invention may further include a selectable marker that is effective in an eukaryotic cell, preferably a drug resistance selection marker.
  • a preferred drug resistance marker is the gene whose expression results in neomycin resistance, i.e., the neomycin phosphotransferase (neo) gene (Southern et al, J. Mol. Appl. Genet. (1982) 1, 327-341).
  • the selectable marker can be present on a separate plasmid, and the two vectors are introduced by co-transfection of the host cell, and selected by culturing in the appropriate drug for the selectable marker.
  • the present invention further provides host cells transformed with a nucleic acid molecule that encodes a protein of the present invention.
  • the host cell can be either prokaryotic or eukaryotic.
  • Eukaryotic cells useful for expression of a protein of the invention are not limited, so long as the cell line is compatible with cell culture methods and compatible with the propagation of the expression vector and expression of the gene product.
  • Preferred eukaryotic host cells include, but are not limited to, yeast, insect and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human cell line.
  • Preferred eukaryotic host cells include Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, NTH Swiss mouse embryo cells (NTH3T3) available from e ATCC as
  • Any prokaryotic host can be used to express a rDNA molecule encoding a protein of the invention.
  • the preferred prokaryotic host is E. coli.
  • Transformation of appropriate cell hosts with a rDNA molecule of the present invention is accomplished by well known methods that typically depend on the type of vector used and host system employed. With regard to transformation of prokaryotic host cells, electroporation and salt treatment methods are typically employed, see, for example, Cohen et al, Proc. Natl. Acad. Sci. USA (1972) 69, 2110-2114; andManiatis et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1982).
  • electroporation, cationic lipid or salt treatment methods are typically employed, see, for example, Graham et al, Virology (1973) 52, 456-467; and Wigler et al, Proc. Natl. Acad. Sci. USA (1979) 76, 1373- 1376.
  • Successfully transformed cells i.e., cells that contain a rDNA molecule of the present invention
  • cells resulting from the introduction of an rDNA of the present invention can be cloned to produce single colonies. Cells from those colonies can be harvested, lysed and their DNA content examined for the presence of the rDNA using a method such as that described by Southern, J. Moli Biol. (1975) 98, 503-517; or Berent et al, Biotech. Histochem. (1985) 3, 208; or the proteins produced from the cell assayed via an immunological method.
  • the present invention further provides methods for producing a protein of the invention using nucleic acid molecules herein described.
  • the production of a recombinant form of a protein typically involves the following steps: First, a nucleic acid molecule is obtained that encodes a protein of the invention, such as the nucleic acid molecule depicted in SEQ ID NO: 1 or nucleotides 283-1356 of SEQ ID NO: 1. If the encoding sequence is uninterrupted by introns as is SEQ ID NO: 1, it is directly suitable for expression in any host.
  • the nucleic acid molecule is then preferably placed in operable linkage with suitable control sequences, as described above, to form an expression unit containing the protein open reading frame.
  • the expression unit is used to transform a suitable host and the transformed host is cultured under conditions that allow the production of the recombinant protein.
  • the recombinant protein is isolated from the medium or from the cells; recovery and purification of the protein may not be necessary in some instances where some impurities may be tolerated.
  • the desired coding sequences may be obtained from genomic fragments and used directly in appropriate hosts.
  • the construction of expression vectors that are operable in a variety of hosts is accomplished using appropriate replicons and control sequences, as set forth above.
  • the control sequences, expression vectors, and transformation methods are dependent on the type of host cell used to express the gene and were discussed in detail earlier.
  • Suitable restriction sites can, if not normally available, be added to the ends of the coding sequence so as to provide an excisable gene to insert into these vectors.
  • a skilled artisan can readily adapt any host/expression system known in the art for use with the nucleic acid molecules of the invention to produce recombinant protein.
  • Another embodiment of the present invention provides methods for isolating and identifying binding partners of proteins of the invention.
  • a protein of the invention is mixed with a potential binding partner or an extract or fraction of a cell under conditions that allow the association of potential binding partners with the protein of the invention.
  • peptides, polypeptides, proteins or other molecules that have become associated with a protein of the invention are separated from the mixture.
  • the binding partner that bound to the protein of the invention can then be removed and further analyzed.
  • the entire protein for instance a protein comprising the entire amino acid sequence of SEQ ID NO: 2 can be used.
  • a fragment of the protein can be used.
  • a cellular extract refers to a preparation or fraction which is made from a lysed or disrupted cell.
  • the preferred source of cellular extracts will be cells derived from human cardiac tissue, for instance, LVAD biopsy tissue or tissue culture cells.
  • a variety of methods can be used to obtain an extract of a cell.
  • Cells can be disrupted using either physical or chemical disruption methods.
  • physical disruption methods include, but are not limited to, sonicatioh and mechanical shearing.
  • chemical lysis methods include, but are not limited to, detergent lysis and enzyme lysis.
  • a skilled artisan can readily adapt methods for preparing cellular extracts in order to obtain extracts for use in the present methods.
  • the extract is mixed with the protein of the invention under conditions in which association of the protein with the binding partner can occur.
  • conditions can be used, the most preferred being conditions that closely resemble conditions found in the cytoplasm of a human cell.
  • Features such as osmolarity, pH, temperature, and the concentration of cellular extract can be varied to optimize the association of the protein with the binding partner.
  • the bound complex is separated from the mixture.
  • techniques can be utilized to separate the mixture. For example, antibodies specific to a protein of the invention can be used to immunoprecipitate the binding partner complex. Alternatively, standard chemical separation techniques such as chromatography and density/sediment centrifugation can be used.
  • the binding partner can be dissociated from the complex using conventional methods. For example, dissociation can be accomplished by altering the salt concentration or pH of the mixture.
  • the protein of the invention can be immobilized on a solid support.
  • the protein can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the protein to a solid support aids in separating peptide/binding partner pairs from other constituents found in the extract.
  • the identified binding partners can be either a single protein or a complex made up of two or more proteins. Alternatively, binding partners may be identified using a Far- Western assay according to the procedures of Takayama et al, Methods Mol. Biol. (1997) 69, 171 - 184 or identified through the use of epitope tagged proteins or GST fusion proteins.
  • the nucleic acid molecules of the invention can be used in a yeast two- hybrid system.
  • the yeast two-hybrid system has been used to identify other protein partner pairs and can readily be adapted to employ the nucleic acid molecules herein described.
  • Another embodiment of the present invention provides methods for identifying agents that modulate the expression of a nucleic acid encoding a protein of the invention such as a protein having the amino acid sequence of SEQ ID NO: 2. Such assays may utilize any available means of monitoring for changes in the expression level of the nucleic acids of the invention.
  • an agent is said to modulate the expression of a nucleic acid of the invention, for instance a nucleic acid encoding the protein having the sequence of SEQ ID NO: 2, if it is capable of up- or down-regulating expression of the nucleic acid in a cell.
  • cell lines that contain reporter gene fusions between any region of the open reading frame defined by nucleotides 283-1356 of SEQ ID NO: 1 or fragments under control of the gene's promoter and any assayable fusion partner may be prepared.
  • Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alain et al. , Anal. Biochem. (1990) 188, 245-254).
  • Cell lines containing the reporter gene fusions are then exposed to the agent to be tested under appropriate conditions and time. Differential expression of the reporter gene between samples exposed to the agent and control samples identifies agents which modulate the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO: 2.
  • Additional assay formats may be used to monitor the ability of the agent to modulate the expression of a nucleic acid encoding a protein of the invention such as the protein having SEQ ID NO: 2.
  • mRNA expression may be momtored directly by hybridization to the nucleic acids of the invention.
  • Cell lines are exposed to the agent to be tested under appropriate conditions and time and total RNA or mRNA is isolated by standard procedures such those disclosed in Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1985).
  • Probes to detect differences in RNA expression levels between cells exposed to the agent and control cells may be prepared from the nucleic acids of the invention. It is preferable, but not necessary, to design probes which hybridize only with target nucleic acids under conditions of high stringency. Only highly complementary nucleic acid hybrids form under conditions of high stringency. Accordingly, the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference in stability between the probe:target hybrid and potential probe:non-target hybrids.
  • Probes may be designed from the nucleic acids of the invention through methods known in the art. For instance, the G+C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly available in Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1985); or Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Company (1995).
  • Hybridization conditions are modified using known methods, such as those described by Sambrook et al. and Ausubel et al as required for each probe. Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format.
  • total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the sequences of the invention under conditions in which the probe will specifically hybridize.
  • nucleic acid fragments comprising at least one, or part of one of the sequences of the invention can be affixed to a solid support, such as a porous glass wafer.
  • the glass wafer can then be exposed to total cellular RNA or polyA RNA from a sample under conditions in which the affixed sequences will specifically hybridize.
  • Such glass wafers and hybridization methods are widely available, for example, those disclosed by Beattie (WO 95/11755).
  • Beattie WO 95/11755
  • agents which up or down regulate the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO: 2 are identified.
  • Hybridization for qualitative and quantitative analysis of mRNA may also be carried out by using a RNase Protection Assay (i.e., RPA, see Ma et al, Methods (1996) 10, 273- 238).
  • RPA RNase Protection Assay
  • an expression vehicle comprising cDNA encoding the gene product and a phage specific DNA dependent RNA polymerase promoter (e.g., T7, T3 or SP6 RNA polymerase) is linearized at the 3' end of the cDNA molecule, downstream from the phage promoter, wherein such a linearized molecule is subsequently used as a template for synthesis of a labeled antisense transcript of the cDNA by in vitro transcription.
  • a phage specific DNA dependent RNA polymerase promoter e.g., T7, T3 or SP6 RNA polymerase
  • the labeled transcript is then hybridized to a mixture of isolated RNA (i. e. , total or fractionated mRNA) by incubation at 45°C overnight in a buffer comprising 80% formamide, 40 mM Pipes, pH 6.4, 0.4 M NaCl and 1 mM EDTA.
  • the resulting hybrids are then digested in a buffer comprising 40 ⁇ g/ml ribonuclease A and 2 ⁇ g/ml ribonuclease. After deactivation and extraction of extraneous proteins, the samples are loaded onto urea/polyacrylamide gels for analysis.
  • agents which effect the expression of the instant gene products cells or cell lines would first be identified which express said gene products physiologically.
  • Cells and cell lines so identified such as cells derived from the spleen or testes (see Fig. 5), would be expected to comprise the necessary cellular machinery such that the fidelity of modulation of the transcriptional apparatus is maintained with regard to exogenous contact of agent with appropriate surface transduction mechanisms and/or the cytosolic cascades.
  • such cells or cell lines would be transduced or transfected with an expression vehicle (e.g., a plasmid or viral vector) construct comprising an operable non- translated 5 '-promoter upstream of the structural gene encoding the instant gene products fused to one or more antigenic fragments, which are peculiar to the instant gene products, wherein said fragments are under the transcriptional control of said promoter and are expressed as polypeptides whose molecular weight can be distinguished from the naturally occurring polypeptides or may further comprise an immunologically distinct tag.
  • an expression vehicle e.g., a plasmid or viral vector
  • the agent comprises a pharmaceutically acceptable excipient and is contacted with cells comprised in an aqueous physiological buffer such as phosphate buffered saline (PBS) at physiological pH, Eagles balanced salt solution (BSS) at physiological pH, PBS or BSS comprising serum or conditioned media comprising PBS or BSS and or serum incubated at 37°C .
  • PBS phosphate buffered saline
  • BSS Eagles balanced salt solution
  • Said conditions may be modulated as deemed necessary by one of skill in the art.
  • Another embodiment of the present invention provides methods for identifying agents that modulate at least one activity of a protein of the invention such as the protein having the amino acid sequence of SEQ 3D NO: 2. Such methods or assays may utilize any means of monitoring or detecting the desired activity.
  • the relative amounts of a protein of the invention between a cell population that has been exposed to the agent to be tested compared to an un-exposed control cell population may be assayed, hi this format, probes such as specific antibodies are used to monitor the differential expression of the protein in the different cell populations.
  • Cell lines or populations are exposed to the agent to be tested under appropriate conditions and time.
  • Cellular lysates may be prepared from the exposed cell line or population and a control, unexposed cell line or population. The cellular lysates are then analyzed with the probe.
  • Antibody probes are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides, polypeptides or proteins of the invention if they are of sufficient length, or, if desired, or if required to enhance immunogenicity, conjugated to suitable carriers.
  • Methods for preparing immunogenic conjugates with carriers such as BSA, KLH, or other carrier proteins are well known in the art. hi some circumstances, direct conjugation using, for example, carbodiimide reagents may be effective; in other instances linking reagents such as those supplied by Pierce Chemical Co. (Rockford, IL), may be desirable to provide accessibility to the hapten.
  • the hapten peptides can be extended at either the a ino or carboxy terminus with a cysteine residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier.
  • Admimsfration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, liters of antibodies are taken to determine adequacy of antibody formation.
  • Immortalized cell lines which secrete the desired monoclonal antibodies may be prepared using the standard method of Kohler and Milstein (Nature (1975) 256, 495-497) or modifications which effect immortalization of lymphocytes or spleen cells, as is generally . known.
  • the immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten, polypeptide or protein.
  • the cells can be cultured either in vitro or by production in ascites fluid.
  • the desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonal or polyclonal antisera which contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies. Use of immunologically reactive fragments, such as the Fab, Fab', of
  • F(ab') 2 fragments is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
  • the antibodies or fragments may also be produced, using current technology, by recombinant means.
  • Antibody regions that bind specifically to the desired regions of the protein can also be produced in the context of chimeras with multiple species origin, particularly humanized antibodies.
  • Agents that are assayed in the above method can be randomly selected or rationally selected or designed.
  • an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of the a protein of the invention alone or with its associated substrates, binding partners, etc.
  • An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism.
  • agents are said to be rationally selected or designed when the agent is chosen on a non-random basis which takes into account the sequence of the target site and/or its conformation in connection with the agent's action.
  • agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up predicted functional sites. Such sites include a zinc finger motif starting at residue 37 (VVTLP CQHNLCRKCA NDVFQ).
  • the agents of the present invention can be, as examples, peptides, small molecules, vitamin derivatives, as well as carbohydrates.
  • a skilled artisan can readily recognize that there is no limit as to the structural nature of the agents of the present invention.
  • Dominant negative proteins, DNA encoding these proteins, antibodies to these proteins, peptide fragments of these proteins or mimics of these proteins may be introduced into cells to affect function.
  • "Mimic” used herein refers to the modification of a region or several regions of a peptide molecule to provide a structure chemically different from the parent peptide but topographically and functionally similar to the parent peptide (see Grant GA. in: Meyers (ed.) Molecular Biology and Biotechnology, VCH Publishers, (1995) 659-664).
  • the peptide agents of the invention can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art.
  • the DNA encoding these peptides may be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems.
  • the production using solid phase peptide synthesis is necessitated if non-gene-encoded amino acids are to be included.
  • Another class of agents of the present invention are antibodies immunoreactive with critical positions of proteins of the invention. Antibody agents are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions, those portions of the protein intended to be targeted by the antibodies.
  • the proteins and nucleic acids of the invention such as the protein having the amino acid sequence of SEQ ID NO: 2 is expressed in myocardial tissue.
  • Agents that modulate, up-or-down-regulate ' the expression of the protein or agents such as agonists or antagonists of at least one activity of the protein may be used to modulate biological and pathologic processes associated with the protein's function and activity.
  • a subject can be any mammal, so long as the mammal is in need of modulation of a pathological or biological process mediated by a protein of the invention.
  • the term "mammal” is meant an individual belonging to the class Mammalia.
  • the invention is particularly useful in the treatment of human subjects.
  • Pathological processes refer to a category of biological processes which produce a deleterious effect.
  • an agent is said to modulate a pathological process when the agent reduces the degree or severity of the process. For instance, cardiomyopathy may be prevented or disease progression modulated by the aciministration of agents which up-regulate or modulate in some way the expression or at least one activity of a protein of the invention.
  • agents of the present invention can be provided alone, or in combination with other agents that modulate a particular pathological process.
  • an agent of the present invention can be administered in combination with other known drugs such as ACE inl ibitors, digitalis glycosides, diuretics, vasodilators and ⁇ -blockers used in the treatment of cardiomyopathy or anti-rejection drugs used during transplantation.
  • two agents are said to be administered in combination when the two agents are administered simultaneously or are administered independently in a fashion such that the agents will act at the same time.
  • the agents of the present invention can be administered via parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or buccal routes. Alternatively, or concurrently, administration may be by the oral route.
  • the dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
  • the present invention further provides compositions containing one or more agents which modulate expression or at least one activity of a protein of the invention. While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art. Typical dosages comprise 0.1 to 100 ⁇ g/kg body wt. The preferred dosages comprise 0.1 to 10 ⁇ g/kg body weight. The most preferred dosages comprise 0.1 to 1 ⁇ g/kg body weight.
  • the compositions of the present invention may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically for 'delivery to the site of action.
  • Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts.
  • suspensions of the active compounds as appropriate oily injection suspensions may be administered.
  • Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran.
  • the suspension may also contain stabilizers. Liposomes can also be used to encapsulate the agent for delivery into the cell.
  • the pharmaceutical formulation for systemic a ⁇ ninistration according to the invention may be formulated for enteral, parenteral or topical administration. Indeed, all three types of formulations may be used simultaneously to achieve systemic administration of the active ingredient.
  • Suitable formulations for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations and controlled release forms thereof.
  • the compounds of this invention may be used alone or in combination, or in combination with other therapeutic or diagnostic agents.
  • the compounds of this invention may be co-a ⁇ ninistered along with other compounds typically prescribed for these conditions according to generally accepted medical practice.
  • the compounds of this invention can be utilized in vivo, ordinarily in mammals, such as humans, sheep, horses, cattle, pigs, dogs, cats, rats and mice, or in vitro.
  • nucleic acid probes may be used to determine the expression of a nucleic acid molecule comprising all or at least part of the sequence of SEQ ID NO: 1 in forensic or pathology specimens.
  • nucleic acid assays may be carried out by any means of conducting a transcriptional profiling analysis.
  • forensic methods of the invention may target the protein encoded by SEQ ID NO: 1 to assay for the up or down regulation of its gene (Shiverick et al, Biochim. Biophys. Acta (1975) 393, 124-133).
  • Methods of the invention may involve treatment of tissues with collagenases or other proteases to make the tissue amenable to cell lysis (Semenov et al. , Biull. Eksp. Biol. Med. (1987) 104, 113-116). Further, it is possible to obtain biopsy samples from different regions of the heart for analysis.
  • Assays to detect nucleic acid or protein molecules of the invention may be in any available format.
  • Typical assays for nucleic acid molecules include hybridization or PCR based formats.
  • Typical assays for the detection of proteins, polypeptides or peptides of the invention include the use of antibody probes in any available format such as in situ binding assays, etc. See Harlow et al, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1988). hi preferred embodiments, assays are carried-out with appropriate controls.
  • Transgenic animals containing mutant, knock-out, modified genes, or dominant negative mutants corresponding to the cDNA sequence of SEQ ID NO: 1 are also included in the invention.
  • Transgenic animals are genetically modified animals into which recombinant, exogenous or cloned genetic material has been experimentally transferred. Such genetic material is often referred to as a "transgene".
  • the nucleic acid sequence of the transgene in this case a form of SEQ ID NO: 1, may be integrated either at a locus of a genome where that particular nucleic acid sequence is not otherwise normally found or at the normal locus for the transgene.
  • the transgene may consist of nucleic acid sequences derived from the genome of the same species or of a different species than the 'species of the target animal.
  • hybrid cell line transgenic animal refers to a transgenic animal in which the genetic alteration or genetic information was introduced into a genn line cell, thereby conferring the ability of the transgenic animal to transfer the genetic information to offspring. If such offspring in fact possess some or all of that alteration or genetic infonnation, then they too are transgenic animals.
  • the alteration or genetic information may be foreign to the species of animal to which the recipient belongs, foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently than the native gene.
  • Transgenic animals can be produced by a variety of different methods including transfection, electroporation, microinjection, gene targeting in embryonic stem cells and recombinant viral and retroviral infection (see, e.g., U.S. Patents 4,736,866 & 5,602,307; Mullins et al, Hypertension (1993) 22, 630-633; Brenin et al, Surg. Oncol. (1997) 6, 99-110; "Recombinant Gene Expression Protocols” in: Tuan (ed.), Methods in Molecular Biology, Humana Press, 1997)).
  • mice A number of recombinant or transgenic mice have been produced, including those which express an activated oncogene sequence (U.S. Patent 4,736,866); express simian SV40 T-antigen (U.S. Patent 5,728,915); lack the expression of interferon regulatory factor 1 (TRF- 1) (U.S. Patent 5,731,490); exhibit dopaminergic dysfunction (U.S. Patent 5,723,719); express at least one human gene which participates, in blood pressure control (U.S. Patent 5,731,489); display greater similarity to the conditions existing in naturally occurring Alzheimer's disease (U.S. Patent 5,720,936); have a reduced capacity to mediate cellular adhesion (U.S.
  • Patent 5,602,307 possess a bovine growth hormone gene (Clutter et al, Genetics (1996) 143, 1753-1760); or, are capable of generating a fully human antibody response (Bruggemann et al, Curr. Opin. Biotechnol. (1997) 8, 455-458).
  • mice and rats remain the animals of choice for most transgenic experimentation, in some instances it is preferable or even necessary to use alternative animal species.
  • Transgenic procedures have been successfully utilized in a variety of non-murine animals, including sheep, goats, pigs, dogs, cats, monkeys, chimpanzees, hamsters, rabbits, cows and guinea pigs (see, e.g., Kim et al, Mol. Reprod. Dev. (1997) 46, 515-526; Houdebine, Reprod. Nufr. Dev. (1995) 35, 609-617; Petters, Reprod. Fertil. Dev. (1994) 6, 643-645; Schnieke et al, Science (1997) 278, 2130-2133; and Amoah, J. Anim. Sci. (1997) 75, 578-585.
  • the method of introduction of nucleic acid fragments into recombination competent mammalian cells can be by any method which favors co-transformation of multiple nucleic acid molecules.
  • Detailed procedures for producing transgenic animals are readily available to one skilled in the art, including the disclosures in U.S. Patent 5,489,743 and U.S. Patent 5,602,307.
  • Example 1 Identification of Differentially Expressed CAP mRNA
  • Myocardial biopsies were obtained from patients prior to LVAD implantation and following cardiectomy prior to cardiac transplantation.
  • Total cellular RNA was prepared from the biopsies described above as well as from control, non-ischemic donor heart tissue using the procedure of Newburger et al, J. Biol. Chem. (1981) 266, 16171-16177 and Newburger et al, Proc. Natl. Acad. Sci. USA (1988) 85, 5215-5219.
  • cDNA was synthesized according to the protocol described in the Gibco-BRL kit for cDNA synthesis.
  • the reaction mixture may include 10 ⁇ g of total RNA, and two pmol of one of the two base anchored oligo(dT) primers a heel such as RP5.0 (CTCTCAAGGATCTTACCGCTT 18 AT) (SEQ ID NO: 4), or RP6.0 (TAATACCGCGCCACATAGCAT 18 CG) (SEQ D NO: 5), or RP9.2
  • the adapter oligonucleotide sequences were as follows: Al (TAGCGTCCGGCGCAGCGACGGCCAG) (SEQ ID NO: 7) and A2 (GATCCTGGCCGTCGGCTGTCTGTCGGCGC) (SEQ ID NO: 8).
  • Al TAGCGTCCGGCGCAGCGACGGCCAG
  • A2 GATCCTGGCCGTCGGCTGTCTGTCGGCGC
  • PNK T4 polynucleotide kinase
  • PNK was heated denatured, and one ⁇ g of the oHgonucleotide Al was added along with 10x annealing buffer (1 M NaCl/lOO mM Tris-HCl (pH 8), 10 mM EDTA (pH 8) in a final volume of 20 ⁇ l. This mixture was then heated at 65°C for ten minutes followed by slow cooling to room temperature for thirty minutes, resulting in formation of the Y adapter at a final concentration of 100 ng/ ⁇ l. About 20 ng of the cDNA was digested with four units of Bgi ⁇ in a final volume of 10 ⁇ l for thirty minutes at 37°C.
  • oHgonucleotide Al or Al .1 was 5 '-end-labeled using 15 ⁇ l of [ ⁇ 32 P] ATP (Amersham; 3000 Ci mmol) and PNK in a final volume of 20 ⁇ l for thirty minutes at 37°C. After heat denaturing PNK at 65°C for twenty minutes, the labeled oHgonucleotide was diluted to a final concentration of 2 ⁇ M in 80 ⁇ l with unlabeled oHgonucleotide Al.l.
  • the PCR mixture (20 ⁇ l) consisted of 2 ⁇ l (100 pg) of the template, 2 ⁇ l of 10x PCR buffer (100 mM Tris-HCl, pH 8.3, 500 mM KC1), 2 ⁇ l of 15 mM MgCl 2 to yield 1.5 mM final Mg 2+ concentration optimum in the reaction mixture, 200 ⁇ M dNTPs, 200 nM each 5' and 3' PCR primers, and 1 unit of Amphtaq Gold ® . Primers and dNTPs were added after preheating the reaction mixture containing the rest of the components at 85°C.
  • PCR This "hot start" PCR was done to avoid nonspecific ampHfication arising out of arbitrary annealing of PCR primers at lower temperature during transition from room temperature to 94°C in the first PCR cycle.
  • PCR consisted of five cycles of 94°C for thirty seconds, 55°C for two minutes, and 72°C for sixty seconds followed by twenty-five cycles of 94°C for thirty seconds, 60°C for two minutes, and 72°C for sixty seconds. A higher number of cycles resulted in smeary gel patterns.
  • PCR products (2.5 ⁇ l) were analyzed on 6% polyacrylamide sequencing gel.
  • cDNA CAP is a band that corresponds to a cDNA derived from an mRNA species that is expressed in myocardial biopsies obtained from patients prior to LVAD implantation and following cardiectomy prior to cardiac transplantation ( Figure 1). The band corresponding to this cDNA was sequenced.
  • the nucleotide sequence of the full-length cDNA corresponding to the differentially regulated CAP band is set forth in SEQ ID NO: 1.
  • the cDNA comprises 1990 base pairs with an open reading frame from nucleotides 283-1356 encoding a protein of 358 amino acids.
  • the amino acid sequence is presented in SEQ ID NO: 2.
  • the predicted isoelectric point of CAP is approximately 12.2.
  • Example 2 Quantitative RT-PCR Analysis of CAP Expression
  • Real time RT-PCR detection was accompHshed by the use of the ABI PRISM 7700 Sequence Detection System.
  • the 7700 measures the fluorescence intensity of the sample each cycle and is able to detect the presence of specific ampHcons within the PCR reaction.
  • Each sample was assayed for the level of GAPDH and Clone 14431.
  • GAPDH detection was performed using Perkin Elmer part#402869 according to the manufacturer's directions. Primers were designed for clone 14431 using Primer Express, a program developed by Perkin Elmer to efficiently find primers and probes for specific sequences. These primers were used in conjunction with SYBR green (Molecular Probes), a nonspecific double stranded DNA dye, to measure the expression level of a clone 14431 , which was normaHzed to the GAPDH level in each sample.
  • SYBR green Molecular Probes
  • CAP expression was observed in myocardial tissue from patients suffering from ischemic cardiomyopathy (IsCM), idiopathic cardiomyopathy (TDCM) and valvular disease (Valvular) when compared to normal myocardial tissue (Normal (see inset table).
  • IsCM ischemic cardiomyopathy
  • TDCM idiopathic cardiomyopathy
  • Valvular valvular disease
  • RNA was isolated from human kidney, adrenal gland, pancreas, saHvary gland, Hver, prostate, thyroid, cerebellum, fetal brain, placenta, spinal cord, stomach, small intestine, bone marrow, thymus, spleen, heart, lung, testes, uterus, mammary gland and trachea using standard procedures.
  • PCR expression analysis was also performed using primers derived from SEQ ID NO: 1 using AmpHTaq Gold PCR ® ampHfication kits (Perkin Elmer).
  • the presence of variable levels of CAP mRNA was detected in several tissues other than the heart ( Figure 5).
  • CAP mRNA expression was most abundant in the spleen, testis and heart. Lower, but detectable levels, were observed in the small intestine, thyroid, adrenal glands, fetal brain and prostate.
  • Northern blots were also prepared to screen for CAP mRNA expression in various tissues (see Figure 7).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne de manière générale les modifications d'expression génique dans un tissu myocardique provoquées par une thérapie utilisant un système d'assistance ventriculaire gauche (LVAD) pour traiter une cardiomyopathie et des symptômes apparentés. L'invention concerne spécifiquement un nouveau gène humain qui correspond à un ARNm régulé différemment dans des biopsies myocardiques prélevées sur des patients équipés d'implants LVAD. L'invention comprend des méthodes permettant de diagnostiquer et d'évaluer une cardiomyopathie et une thérapie à LVAD, par la mesure de la quantité de produit génétique exprimé chez un patient. L'invention concerne également des méthodes d'identification d'agents qui modifient l'expression du produit génétique de l'invention, et l'utilisation ultérieure de ces agents pour traiter une cardiomyopathie et faciliter une thérapie à LVAD.
PCT/US2001/005888 2000-02-24 2001-02-26 IDENTIFICATION D'UN ADNc ASSOCIE A LA FONCTION VENTRICULAIRE DANS DU TISSU MYOCARDIQUE HUMAIN WO2001062767A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001241707A AU2001241707A1 (en) 2000-02-24 2001-02-26 Identification of a cdna associated with ventricular function in human myocardial tissue

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US18482500P 2000-02-24 2000-02-24
US60/184,825 2000-02-24

Publications (1)

Publication Number Publication Date
WO2001062767A1 true WO2001062767A1 (fr) 2001-08-30

Family

ID=22678505

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/005888 WO2001062767A1 (fr) 2000-02-24 2001-02-26 IDENTIFICATION D'UN ADNc ASSOCIE A LA FONCTION VENTRICULAIRE DANS DU TISSU MYOCARDIQUE HUMAIN

Country Status (2)

Country Link
AU (1) AU2001241707A1 (fr)
WO (1) WO2001062767A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002006318A2 (fr) * 2000-07-18 2002-01-24 Board Of Regents, The University Of Texas System Procedes et compositions permettant de stabiliser des microtubules et des filaments intermediaires dans des cellules de muscle strie
WO2002061046A2 (fr) * 2001-01-30 2002-08-08 Regeneron Pharmaceuticals, Inc. Nouvelles molecules d'acide nucleique et polypeptidiques
WO2003040407A2 (fr) * 2001-11-09 2003-05-15 Max-Planck-Gesellschaft Nouveaux marqueurs pour cardiopathies dilatees

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] SPENCER ET AL.: "Regulation of microtubule dynamics and myogenic differentiation by MURF, a striated muscle RING-finger protein", XP002940182, accession no. Dialog Database accession no. AF294790 *
J. CELL BIOLOGY, vol. 150, no. 4, 21 August 2000 (2000-08-21), pages 771 - 784, XP002940181 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002006318A2 (fr) * 2000-07-18 2002-01-24 Board Of Regents, The University Of Texas System Procedes et compositions permettant de stabiliser des microtubules et des filaments intermediaires dans des cellules de muscle strie
WO2002006318A3 (fr) * 2000-07-18 2002-08-08 Univ Texas Procedes et compositions permettant de stabiliser des microtubules et des filaments intermediaires dans des cellules de muscle strie
US6740751B2 (en) 2000-07-18 2004-05-25 Board Of Regents, The University Of Texas System Methods and compositions for stabilizing microtubules and intermediate filaments in striated muscle cells
US7005512B2 (en) 2000-07-18 2006-02-28 Board Of Regents, The University Of Texas System Methods and compositions for stabilizing microtubules and intermediate filaments in striated muscle cells
US7071318B2 (en) 2000-07-18 2006-07-04 Board Of Regents, The University Of Texas System Methods and compositions for stabilizing microtubules and intermediate filaments in striated muscle cells
WO2002061046A2 (fr) * 2001-01-30 2002-08-08 Regeneron Pharmaceuticals, Inc. Nouvelles molecules d'acide nucleique et polypeptidiques
WO2002061046A3 (fr) * 2001-01-30 2004-02-05 Regeneron Pharma Nouvelles molecules d'acide nucleique et polypeptidiques
WO2003040407A2 (fr) * 2001-11-09 2003-05-15 Max-Planck-Gesellschaft Nouveaux marqueurs pour cardiopathies dilatees
WO2003040407A3 (fr) * 2001-11-09 2004-03-04 Max Planck Gesellschaft Nouveaux marqueurs pour cardiopathies dilatees

Also Published As

Publication number Publication date
AU2001241707A1 (en) 2001-09-03

Similar Documents

Publication Publication Date Title
JP2002501738A (ja) ６７個のヒト分泌タンパク質
US20040010812A1 (en) Human hyaluronan receptor
US20050037454A1 (en) Gene associated with bone disorders
WO2001062767A1 (fr) IDENTIFICATION D'UN ADNc ASSOCIE A LA FONCTION VENTRICULAIRE DANS DU TISSU MYOCARDIQUE HUMAIN
WO2001016354A1 (fr) Modulation de he4 dans des maladies inflammatoires et renales
AU3208999A (en) Identification of a cdna associated with ischemia in human heart tissue
WO2000011942A9 (fr) Identification d'un adn complementaire associe a l'ischemie dans le tissu cardiaque humain
WO2000056756A2 (fr) Proteine de liaison de l'element regulateur de prolactine et son utilisation
WO2001057062A1 (fr) Modulation de osf-2 dans des maladies inflammatoires et renales
WO2001005803A9 (fr) Nouveaux adnc associes a des nephropathies
WO2002012262A1 (fr) Identification des adnc associes a l'hyperplasie benigne de la prostate
WO2001005804A1 (fr) Nouveaux genes associes a une maladie renale
US20050147969A1 (en) Genes associated with mast cell activation
WO2000078788A1 (fr) Nouvel adn complementaire associe a une pathologie renale
US20060121471A1 (en) Gene families associated with stomach cancer
WO2000060122A1 (fr) IDENTIFICATION D'UN ADNc ASSOCIE A L'ISCHEMIE DANS UN TISSU DE COEUR HUMAIN
WO2001098456A2 (fr) Identification d'adnc associes a l'hyperplasie prostatique benigne
WO2000052026A1 (fr) Identification d'un adn complementaire associe a l'hypertrophie compensatoire dans le tissu renal
US20030166881A1 (en) Novel genes associated with allergic hypersensitivity and mast cell activation
WO2003025152A2 (fr) Identification d'un adnc associe a l'ischemie dans des tissus cardiaques humains
JPWO2002064770A1 (ja) 新規スカベンジャー受容体クラスａ蛋白質
WO2002012439A2 (fr) Genes associes a des maladies renales
US20030079239A1 (en) Gene Associated with bone disorders
US20030054385A1 (en) Human ubiquitin-conjugating enzymes
WO2001041805A1 (fr) Nouvel adnc 22360 associe aux maladies renales et a d'autres etats pathologiques

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP