WO2000078937A1 - Procedes d'amelioration du traitement des maladies de la peau du type ichtyoses - Google Patents

Procedes d'amelioration du traitement des maladies de la peau du type ichtyoses Download PDF

Info

Publication number
WO2000078937A1
WO2000078937A1 PCT/US2000/017235 US0017235W WO0078937A1 WO 2000078937 A1 WO2000078937 A1 WO 2000078937A1 US 0017235 W US0017235 W US 0017235W WO 0078937 A1 WO0078937 A1 WO 0078937A1
Authority
WO
WIPO (PCT)
Prior art keywords
involucrin
tgase
slv
lipid
protein
Prior art date
Application number
PCT/US2000/017235
Other languages
English (en)
Inventor
Peter Steinert
Lyuben Marekov
Zoltan Nemes
Original Assignee
The Government Of The United States Of America, Asrepresented By The Secretary, Dept. Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States Of America, Asrepresented By The Secretary, Dept. Of Health And Human Services filed Critical The Government Of The United States Of America, Asrepresented By The Secretary, Dept. Of Health And Human Services
Priority to AU57595/00A priority Critical patent/AU5759500A/en
Publication of WO2000078937A1 publication Critical patent/WO2000078937A1/fr
Priority to US10/023,275 priority patent/US6852686B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/104—Aminoacyltransferases (2.3.2)
    • C12N9/1044—Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to the discovery of a method to provide stabilized transglutaminase 1 enzyme, involucrin, and other molecules to skin cells. Novel biological tools, prophylactics, therapeutics, cosmetics, and methods of use of the foregoing for study, prevention, and treatment of skin disorders are also disclosed.
  • BACKGROUND OF THE INVENTION Terrestrial vertebrates protect themselves from chemical and physical damage and uncontrolled water loss by maintaining a barrier in their epidermis. In mammals this is accomplished by forming a highly insoluble protein and lipid structure on the surface of the corneocytes termed the cornified envelope (CE) and by impeding water diffusion across the stratum corneum by mortaring together the corneocytes by layers of h ⁇ drophobic skin specific lipids. (Downing et al., Dermatology in General Medicine, Fitzpatrick, et al., eds., pp. 210-221 (1993) and Ponec, M strongly The Keratinocyte Handbook, Leigh, et al., eds., pp.
  • lipids differ in composition from other bilayer forming lipids found in all living ceils. Notably they have a diminished phospholipid content and, instead, contain increased amounts of cholesterol, its ac ⁇ i and sulfate esters, fatty acids, and several epidermal specific long chain h ⁇ droxy- and hydroxyacyl (glucosyl)- ceramides. (Elias, P.M. and G.K. Menon. Skin Lipids, Advances in Lipid Research, Vol. 24, pp. 1-26 (1991)).
  • lipids that join the CE are initiated in the spinous layer. These lipids are temporarily stored in lamellar bodies of stratum granulosum, where they are arranged as stacks of tetralaminar sheets. Preceding or paralleling the formation of the protein barrier of the CE, the contents of the lamellar bodies are extruded into the intercellular space.
  • lipids are epidermal specific long chain ⁇ -hydroxyceramides, which become covalently attached onto the outer surface of the CE as a " 5 nm mo ⁇ omolecular layer.
  • One idea is that these protein-linked ceramides interdigitate with the intercellular lipid in a comb-like fashion, presumably to stack them into ordered lamellae. (Wertz, P.W., Experientia Suppl., 78: 227-237 (1997) and Wertz, P.W. and D.T. Downing, Physiology, Biochemistry and Molecular Biology of the Skin, Goldsmith, LA., ed., Vol. 1, pp. 205-236 (1991)).
  • Lamellar Ichthyosis is a clinically heterogeneous autosomal recessive disorder, which causes abnormalities of the CE and persons with the severe LI phenotype often present at birth encased in a translucent colloidion membrane. Soon after birth, this thick membrane dries and cracks and, over time, these persons develop large, brown, plate-like scales in a generalized distribution. (Russell et al., Nat. Genet. 9:279 (1995)).
  • the locus for LI has been mapped to chromosome 14q11 and a complete linkage with the gene encoding transglutaminase 1 (TGase 1) was found. (Russell et al., Nat. Genet. 9:279 (1995)). Further, point mutations in TGase 1 were identified in two of the multiplex LI families used in the linkage study. (Russell et al., Nat. Genet. 9:279 (1995)). These mutations are hypothesized to adversely affect the formation of cross-links essential in the production of the CE. (Russell et al., Nat. Genet. 9:279 (1995)).
  • keratinocyte proteins are expressed and subsequently made insoluble by cross- linking by both disulfide bonds and isopeptide bonds formed by transglutaminases (TGases).
  • TGases transglutaminases
  • involucrin can be characterized as that of a protein scaffold since it is one of the first proteins deposited at or near the membrane surface in the vicinity of desmosomes to initiate CE formation and is subsequently joined to several reinforcement proteins, as well as, ceramide lipids.
  • involucrin becomes cross-linked to several reinforcement CE proteins including other molecules of involucrin, trichoh ⁇ alin, elafin, repetin, periplakin, desmoplakin, envoplakin, keratin intermediate filaments, members of the small proline rich family, cystatin ⁇ , and loricrin.
  • involucrin contains 150 glutamine and 45 lysine residues and it appears that mammalian involucrins have undergone extensive expansion of various glutamine-rich repeating motifs during evolution perhaps to increase the sites suitable or available for TGase mediated cross-linking. (Eckert, R.L. and H. Green, Cell, 46: 583-589 (1988) and (Tseng, H. and H. Green, Cell, 54: 491 -496 (1988)). Indeed, involucrin is an excellent substrate for transglutaminases (TGases) both in vitro ma in vivo. (Simon, M. and H. Green, J Biol.
  • TGase V encodes a 92-kDa protein consisting of 816 amino acid residues located on chromosome 14q1 1.2.
  • TGases are Ca2 + -dependent enzymes, which catalyze the transfer of the ⁇ -carboxyl group from protein-bound glutamine to the ⁇ -amino group of protein bound lysine residues or other primary amines. These enzymes are responsible for the cross-linking of CE proteins into a chemically and mechanically resistant protein polymer.
  • TGases 1, 2, 3 and X are expressed in terminally differentiating epithelia such as the epidermis.
  • the TGase 1 and 3 enzymes are essential for the cooperative cross-linking of such substrates as loricrin, trichohyalin, and small proline rich proteins 1 and 2.
  • substrates as loricrin, trichohyalin, and small proline rich proteins 1 and 2.
  • the TGase 3 enzyme is soluble and requires proteolytic activation before it can function. (Kim, et al., J. Biol. Chem., 265: 21971 -21978 (1990)).
  • the TGase 1 enzyme was first discovered in keratinocytes and is usually anchored to membranes by way of acyl /V-myristoyl and S-myristoyl or ->-palmitoyl adducts near the amino terminus of the protein. (Chakravarty, R. and R.H. Rice, J. Biol.
  • the present invention relates to the discovery of a method to provide stabilized transglutaminase 1 enzyme, involucrin, and other molecules necessary for the assembly of the cell envelope to skin cells.
  • Novel biological tools, prophylactics, therapeutics, cosmetics, and methods of use of the foregoing for study, prevention, and treatment of skin disorders are also disclosed.
  • FIGURE 1 The attachment of involucrin to SLV.
  • SLV synthetic lipid vesicles
  • PS dipalmitoyl phosphatid ⁇ lserine
  • Anionic phospholipids other than PS do not increase involucrin binding to SLV containing 8 % PS: binding of involucrin to SLV containing 8 % PS plus 0-20 % phosphatidic acid [closed circles), phosphatidylglycerol (open circles), or phosphatidylinositol (closed triangles). Points represent the means ⁇ s.d. of three independent measurements.
  • FIGURE 20f several in vivo substrates of the TGAasel enzyme, involucrin binds to SL V.
  • FIGURE ZEffect of free Ca * * concentration on involucrin binding to SL V.
  • Involucrin binding was assayed as in FIGURE 1 in the presence of 0-1000 ⁇ M CaCl Half-maximal binding was calculated at 4.2 ⁇ 0.7 ⁇ M. Binding was reversible in the presence of EDTA. Points represent the means ⁇ s.d. of three independent measurements.
  • FIGURE ⁇ Purified recombinant TGase 1 expressed in baculovirus spontaneously associates to SLV. Binding was assayed as in FIGURE 1 in SLV formulated from 0 or 15 % PS in the presence or absence of free Ca + ⁇ Error bars represent the means ⁇ s.d. of three independent measurements. Binding of TGases 2 or 3 is not statistically significant (p > 0.1).
  • FIGURE ⁇ Effect of PS content of SLV on incorporation of C ⁇ utrescine into involucrin by TGase 1.
  • TGase 1 (0.9 pmol) was bound to SLV formulated with 0-30 % PS, to which were added 1.2 nmol of involucrin,
  • FIGURE SBinding to SLV lowers free Ca * * ion levels required for involucrin cross-linking by TGase I.
  • FIGURE 7 Identification of (-glutamylputrescine by amino acid sequencing.
  • This assay identifies glutamine (Gin) residues that have been modified by putrescine as a result of the TGase reaction.
  • the PTH-derivative of (-glutamylputrescine appears as a novel peak eluting at 13.55 min in the sequencing cycles where only a Gin residue would normally be expected.
  • the relative amounts of this peak and that of PTH-Gln provide an estimate of the extent of modification.
  • FIGURE ⁇ Identification of tryptic peptides of involucrin labeled with Cputrescine by various forms of TGase I.
  • Involucrin was reacted with 20 mM C-putrescine using: (A), solubilized recombinant baculovirus TGase 1 not attached to SLV; and (B), TGase 1 bound to SLV containing 15% PS. Tryptic peptides of involucrin were separated by C18 reverse phase HPLC and were collected and assayed for isotope incorporation. Forty involucrin tryptic peptides were resolved in this system. Labeled peptides are shown by the numbered arrows. Note that in (B), additional minor peptide peaks were contributed by insect proteins, but the same numbering system was retained for clarity.
  • FIGURE ⁇ Model for the alignment of involucrin and TGase I on SLV on the inner surface of the plasma membrane of keratinocytes.
  • Newly expressed TGase 1 (large sphere) attaches to the membranes by way of the lipid adducts on its amino- terminal portion.
  • TGase 1 large sphere
  • involucrin thin rod
  • FIGURE 10 Comparison of a natural co-hydroxyceramide and an artifical o>hydroxyceramide.
  • (A) The structure of a natural ⁇ -hydroxyceramide is shown.
  • (B) The structure of the artificial substrate analog N-[16-(16-h ⁇ droxyhexadecyl)oxypalmito ⁇ l]-sphingosine (lipid Z) is shown; note that the natural and the synthetic lipids have similar chain length and differ only by the presence of an (unreactive) ether bond.
  • FIGURE 11 Separation of lipo-peptide adducts from the tryptic digest of involucrin by HPLC.
  • Involucrin was reacted with SLV containing lipid Z in the presence of TGase 1.
  • Lipid-attached hydrophobic peptides were selectively retained on a C4 column under strongly desorbing solvent conditions (sloping straight line).
  • the numbered peaks refer to the corresponding lipo-peptides in FIGURE 12 and Tables 3 and 4.
  • no lipo-peptides were recovered in the presence of EDTA; and lipo-peptide amounts were significantly reduced by putrescine (see FIGURE 14), or by 20 mM of the generic TGase inhibitor cystamine (smaller peaks shown with A 220 values of approximately Oj.
  • FIGURE 12 Analysis of peak 1 of FIGUBE II by electrospray ionization mass spectrometry before (A) and after (B) saponification.
  • Peaks with corresponding masses marked by arrows denote multiple charge states of the peptides used for mass determination.
  • FIGURE 13 Mass spectrometry of lipid Z following acetonide formation of its peptide-adducts and subsequent alkaline hydrolysis.
  • FIGURE 14 Inhibitory effect of putrescine on glutaminyl ester formation by TGase 1.
  • Amounts of individual lipo-peptides were quantitated by amino acid analysis after isolation by C4 HPLC chromatography. Yields were related to the total of reactive Gin residues.
  • A Ester modification of reactive glutamines without inhibitor.
  • B 1 mM putrescine inhibited the formation of lipid adducts.
  • C 20 mM putrescine significantly (p ⁇ 0.01 ) reduced the amount of ester linkages when added to the reaction at 45 min, showing the availability of ester linkages for TGase mediated aminolysis. Values (mean +. s.e.m.) are from five separate experiments.
  • FIGURE 15 Model for the orientation and reaction of the co-hydroxyl group of epidermal ceramides.
  • TGase 1 enzyme sphere
  • involucrin oval
  • acyl lipid adducts or Ca * + ions, respectively.
  • B During terminal differentiation, in the presence of sufficient Ca + + , they react through a limited selection of glutamine residues.
  • C The ⁇ -hydroxyceramides (or lipid Z) can orient on membranes with the ⁇ -OH group either facing into or out of the cell, however, only the former are esterified onto involucrin by TGase 1.
  • the invention provides: (1) enzyme in a stable active form; (2) synthetic ceramide analogs that can function the same way as normal skin ceramides; and (3) synthetic lipid vesicles that can stably carry both the en ⁇ zme and synthetic ceramide analog to the skin.
  • One effect is the lipid barrier function in normal skin is improved.
  • Another effect is that it might be applied to affected ARI skin in order to provide ameliorative therapy.
  • compositions are provided that allow for the study, treatment, and prevention of skin disorders (e.g., Ichth ⁇ osis-related diseases). It has been discovered that these compositions can be used to deliver proteins (e.g., enzymes), chemicals, or other molecules to skin cells.
  • Embodiments can comprise an enzyme (e.g., TGase 1 ) joined to a synthetic lipid vesicle of composition similar to eukaryotic plasma membranes (SLV) and an adaptor (e.g., involucrin).
  • embodiments of can include an enzyme (e.g., TGase 1) joined to a SLV and an adaptor (e.g., involucrin), wherein the adaptor is also joined to a delivery agent (e.g., extracellular matrix protein, CE assembly protein, enzyme, or other molecule).
  • a delivery agent e.g., extracellular matrix protein, CE assembly protein, enzyme, or other molecule.
  • some embodiments include the compositions described above further comprising a ceramide reactant (e.g., T-hydroxyceramide or lipid Z) joined to the adaptor.
  • compositions including the use of software, hardware, approaches in rational molecule design, molecular biology, and the use of biochemical assays to screen such manufactures are provided in the following disclosure.
  • Methods of using these compositions are also embodied in aspects of the invention including the manufacture of supports having an enzyme, adaptor, and ceramide reactant for the isolation and identification of proteins involved in CE assembly and the preparation of pharmaceuticals and cosmetics for the treatment and/or prevention of skin disorders such as ichthyosis-related diseases.
  • Methods of treatment of skin disorders such as ichthyosis-related diseases using these pharmaceuticals and cosmetics are also provided.
  • the membrane-bound keratinocyte TGase 1 enzyme can perform a novel transesterification reaction between specific glutamin ⁇ l residues of human involucrin and a novel functional analog of epidermal specific ⁇ -hydroxyceramides, N-[16-(16-hydrox ⁇ hexadecyl)oxypalmito ⁇ l] sphingosine (lipid Z).
  • lipid Z N-[16-(16-hydrox ⁇ hexadecyl)oxypalmito ⁇ l] sphingosine
  • ester linkage formation utilized involucrin glutamine residues 107, 118, 122, 133 and 496 by converting the ⁇ -carboxamido groups to lipid esters.
  • residues Several of these residues have been found previously to be attached to ceramides in vivo.
  • Mass-spectrometric analysis after acetonide derivatization also revealed that ester formation involved the ⁇ -hydroxyl group of lipid Z.
  • TGase 1 large sphere attaches to a cellular membrane or lipid bilayer by way of the lipid adducts on its amino-termi ⁇ al portion.
  • involucrin thin rod attaches spontaneously. This binding is fostered through ionic interactions of multiple Glu residues of involucrin, Ca + + , and the anionic PS-rich membrane surface (thick rod).
  • the membrane surface regulates the steric interaction of TGase 1 with involucrin and aligns specific Gin residues of involucrin near the active site of juxtaposed TGase 1 molecules. Cross-linking reactions are then initiated as the Ca + + concentration rises. Further, the activated Gin residues are transferred to other nearby substrates including other involucrin, desmoplakin, e ⁇ voplakin, etc.
  • TGase 1 can be stabilized in an SLV and can cross-link involucrin so as to make a composition comprising TGase 1 and involucrin joined to an SLV.
  • TGase 1 spontaneously associate with SLV.
  • Recombinant TGase 1 enzyme that is expressed in the baculovirus system is constitutively -V-myristoyfated and S- myristoylated or -?-palmitoylated on its amino-terminal 10 kDa portion and can be found mostly in the particulate fraction of the insect cell homogenates. (Candi, et al., J. Biol. Chem., 273: 13693-13702 (1998)).
  • the recombinant TGase 1 can be solubilized from the membranes by extraction with the detergent Triton X-100, and the lipid adducts on the enzyme are retained.
  • the TGase 1 can be solubilized by use of 1 M NH-OH-HCI, which hydrolyses the --"-acyl adducts off the enzyme. (Steinert, et al., J. Biol. Chem., 271 : 26242-26250 (1996), herein expressly incorporated by reference in its entirety).
  • TGase 1 enzyme purified by the NH-OH-HCI method is unable to bind to SLVs, as indicated by amino acid analysis of pelleted SLV mixtures and TGase assays of the resulting supernatants.
  • TGase 1 enzyme purified from Triton X-100 extracts spontaneously associates with SLVs, as indicated by the disappearance of detectable enzyme activity from the supernatants of pelleted SLV mixtures.
  • the saturating amount was found to be approximately 0.9 nmol of TGase 1/ ⁇ mol of lipid. (FIGURE 4).
  • the binding of recombinant TGase 1 protein to SLV was not influenced by Ca + + ions, EGTA, or SLVs prepared with varying formulations of ingredients including anionic
  • Panel B TGase 1 reaction with Sf 9 aniculate fraction:
  • TGase 1 joined to an SLV mediates the cross-linking of involucrin through five specific Gin residues and, thereby forms a composition comprising TGase 1 and involucrin joined to an SLV.
  • the disclosure below decribes an approach to synthesize an a ⁇ olog of T-hydroxyceramide (lipid I), a molecule that can also join to a composition comprising TGase 1 , involucrin, and SLV.
  • Lipid Z is a synthetic ⁇ -hydrox ⁇ ceramide that is similar in size to natural ceramides and has overall solubility and chromatographic properties similar to pig and human epidermal ceramides.
  • Lipid Z 16-(16- hydroxyhexadecyDoxyhexandecanoic acid, is similar to tetratriacontanoyl (C34) fatty acids, and has a terminal ( ⁇ ) primary alcoholic functional group. This product was linked to a sphingosine base in order to create the ceramide analog.
  • Natural ⁇ -hydroxyceramides (FIGURE 10A) have chain lengths of > C30 and are ester-linked to CE structural proteins.
  • Involucrin was joined to the TGase 1 containing SLV in the presence of 1 mM Ca * and cross-linking was allowed to occur. Subsequently, the water-insoluble lipid Z was added to the SLV containing cross-linked TGase 1 and involucrin. After the reaction and removal of unbound lipids, the involucrin was digested with trypsin. Lipo-peptide adducts with uniquely hydrophobic properties were selectively isolated on a C4 HPLC column using highly desorbing conditions and isopropanol gradient elution. (Marekov, L.N. and P.M. Steinert, J. Biol. Chem., 273: 17763-17770 (1998)).
  • Electrospray ionization mass spectrometry was used to assess the molecular weight of the isolated involucrin lipo-peptides prior to and after alkaline saponification. (FIGURE 12). All five peaks displayed masses consistent with the presence of only one major detectable mass ingredient. Following a 2 hour saponification reaction, the masses of each peak decreased by 776.33 to 776.65 atomic mass units (amu), which corresponds exactly to the hydrolysis of a 794.3 Da lipid Z ester (Table 3). Mass spectrometric analysis confirmed that a composition comprising TGase 1 , involucrin, and lipid Z joined to an SLV had been made. The finding that specific Gin residues of involucrin act as substrates for TGase 1- mediated esterificatio ⁇ of involucrin and joining of lipid Z are provided in the next section.
  • Masses were deconvoluted from electrospray ionization mass spectra before and after saponification.
  • the co-Hydroxyl Group of Lipid Z is Preferentially Used in Ester Bond Formation.
  • TGase 1 in order to determine which of the three hydroxyl groups of lipid Z is used by TGase 1 in the este ⁇ fication reaction, isolated lipo-peptides obtained by the approach described above were reacted under acidic conditions with dimethylacetonide and the modified lipid Z was recovered by subsequent alkaline hydrolysis.
  • mass spectrometry the bulk of the lipid was converted to a product of mass of 834 amu, indicating acetonide formation of two closely juxtaposed hydroxyl groups. (FIGURE 13).
  • Such a derivative could only be formed from lipid Z if the two hydroxyls in positions 1 and
  • lipid Z was replaced with palmitoylsphmgosine or 16-hydroxypalm ⁇ toylsph ⁇ ngos ⁇ ne in SLV membranes but no involucrm-adduct formation was observed, indicating that the hydroxyl group on the end of an acyl chain, which is long enough to span the lipid bilayer membrane, is sine qua non for the este ⁇ fication reaction.
  • Kinetic studies on the lip id Z este ⁇ fication of involucrin by TGase 1 were then performed and the results are presented below.
  • TGase 1 enzyme is perhaps the most complex since it exists in multiple forms. (Steinert, et al., J. Biol. Chem., 271: 26242-26250 (1996) and Kim, et al., J. Biol. Chem., 270: 18026-18035 (1995)). This enzyme is of critical importance in skin barrier function in particular since mutations in its gene resulting in loss of activity cause the devastating life-threatening disease lamellar ichthyosis. (Huber, et al..
  • TGases are well known to perform a two-step reaction first activating a protein bound glutamine residue through a thioester intermediate, followed by the transfer of the glutamin ⁇ l moiety to an acceptor amine group, usually the ⁇ -NH2 group of a protein-bound lysine residue (thereby forming an N ⁇ ( ⁇ -glutam ⁇ l)lysine isopeptide bond) or a polyamine (Greenberg et al., FASEB J., 5: 3071-3077 (1991).
  • TGases are responsible for the crosslinking of proteins to form stable, insoluble macromolecular assemblies that are used for many purposes in biology, in some circumstances in the absence of an acceptor amine, the acyl transfer may occur onto water, resulting in deamidation of the protein bound glutamine residue, in addition, early studies have shown using model peptides that TGase 2 may also form an ester linkage by transferring the glutaminyl moiety to a primary alcohol (Gross, M. and J.E. Folk, J. Biol. Chem., 249: 3021 -3025 (1974) and Parameswaran, K.N.
  • a glutamine residue in a protein represents an intrinsically activated high free energy derivative of glutamic acid, and the release of ammonia from its ⁇ -carboxamido group provides sufficient free energy to drive the reaction to form isopeptide or ester bonds.
  • a physiological model system to explore the properties of the TGase 1 enzyme has been developed.
  • the data introduce, for example, a so far unstudied catalytic cofactor, the membrane surface, that regulates the interaction of membrane-bound TGase 1 enzyme and its substrates. It was also found that involucrin also binds to SLV membranes of similar PS content to those of the cytoplasmic surface of plasma membranes of eukaryote cells. (Hauser, H. and G. Poupart, The Structure of Biological Membranes, Yeagle, P., ed., pp. 3-73 (1991)).
  • Optimized involucrin cross-linking by membrane-bound TGase 1 is largely dependent on the ingredients of the membrane and requires Ca ions and PS, an inherent constituent of the cytoplasmic face of membranes in living eukaryote cells.
  • PS is required for a number of other physiological processes, where Ca -dependent binding of proteins to cell membranes is a condition that facilitates enzyme activity, as exemplified in case of protein kinase C activation or blood clotting.
  • involucrin is expressed in mid-late spinous layers in the epidermis (or comparable levels in other stratified squamous epithelia), and is expressed early in cultured keratinocytes as elevated environmental Ca levels initiate terminal differentiation.
  • the TGase 1 enzyme is expressed to a minor extent in basal keratinocytes, but its major expression program approximately coincides with that of involucrin in differentiating keratinocytes. (Pillai, et al., J. Cell Physio/., 143: 294-302 (1990)).
  • involucrin begins to associate onto SLV above at Ca+ + concentrations above 1 ⁇ M.
  • FIGURE 3 These observations favor the view that involucrin binds to the plasma membranes shortly after its expression.
  • the data demonstrate that the cross-linking of involucrin does not begin until the net Ca concentration rises about 10-fold higher than that required for involucrin binding. (See e.g., FIGURE 6).
  • involucrin substrate and TGase 1 enzyme can remain in close juxtaposition on cellular membranes until local Ca concentrations rise above a threshold level.
  • the kinetic data of Table 1 shed light on the high degree of specificity of Gin utilization.
  • the lowered Kcat and KM values of membrane bound TGase 1 using bound involucrin as substrate may be due to the restriction of available Gin residues for the reaction.
  • the maximal reaction velocity can be limited by: (i) the quantity of involucrin molecules attached to a unit of membrane surface; (ii) the lateral diffusion rate of enzyme and substrate along the membrane surface; and (iii) the rate of exchange between soluble and membrane-attached involucrin.
  • association with the SLV membranes can change the conformation and thus specificity of TGase 1.
  • control experiments Table 1
  • no change in substrate specificity to the SPR2 substrate was found.
  • involucrin is cross-linked in vivo to a variety of structural proteins, including in particular desmoplakin at the site of desmosomes, envoplakin and perhaps periplakin located primarily on plasma membranes between desmosomes, as well as to itself. Further, the predominant cross-linking site with desmoplakin is through Gln496 of involucrin. (Steinert, P.M. and L.N. Marekov, J. Biol. Chem., Ill: 2021-2030 (1997)). Thus, some embodiments include compositions comprising TGase 1, involucrin, and lipid Z (or a functional equivalent) joined to an SLV further comprising a protein involved in CE maintenance or assembly or both.
  • models of the three dimensional structures of wild-type and mutant involucrin and TGase 1 proteins can be created and this information can be compared to the results from functional assays (e.g., the "cross-linking and esterification assays", described herein) so as to learn more about the early steps of CE assembly.
  • functional assays e.g., the "cross-linking and esterification assays", described herein.
  • Approaches to conduct such studies are provided in following sections.
  • ceramides contribute to lipid envelope barrier function to the epidermis.
  • Long chain ceramides are insoluble in an aqueous environment but can be dissolved in SLV and presumably cellular membranes. Accordingly, it is plausible that the enzyme(s) required for the esterification reaction that joins involucrin to ⁇ - hydroxyceramides or sphingosine moieties is physically located at the membrane surface so that either the ⁇ -hydroxyl group of the acyl chain or sphingosine hydroxyl groups (or both) are in close proximity to the CE structural proteins including involucrin.
  • lipid Z with an ether derivative of an ⁇ -h ⁇ drox ⁇ ac ⁇ l chain having a net length equivalent approximately to a naturally occurring epidermal C34 ceramide was synthesized.
  • the TGase 1 enzyme catalyzed the formation of an ester link between lipid Z and involucrin.
  • other soluble TGases were not caspable of this transesterification reaction onto involucrin using a variety of experimental conditions. It should be noted that the amine cosubstrate putrescine could reduce the rate of ester formation as expected
  • FIGURE 14B and caused detectable decay of ester products with time (FIGURE 14C).
  • This phenomenon can be attributed to aminolysis of ester bonds by putrescine. This can occur if the conversion of the thioacyl enzyme intermediate into an ester bond is an effectively reversible process, and the amine can deplete the acyi-enzyme intermediate due to its lower free energy.
  • ester bonds formed on involucrin can be susceptible to aminolysis by lysines on proteins, resulting in the formation of the more stable (lower free energy) 'classical' N ⁇ ( ⁇ -glutamyl)lysine isopeptide crosslink.
  • Epidermal specific ceramides have C28-36 acyl chains that are long enough to span a plasma membrane bilayer, so that the ⁇ -hydroxyl group can be located on the side opposite of the more hydrophilic sphingosine moiety.
  • the ⁇ - hydrox ⁇ l group of lipid Z equal in length to the thickness of a lipid bilayer membrane, was specifically utilized for esterification to involucrin, whereas an ⁇ -hydroxyceramide with C16 fat chain was not.
  • the ceramide is attached to a limiting membrane bilayer before it is utilized.
  • An interuption of CE assembly can occur by the inability to correctly synthesize the ceramide lipids as in Refsum's disease [phytanic acid accumulation owing to phyta ⁇ o ⁇ l-CoA hydroxylase deficiency (Janse ⁇ et al., Nature Genet, 17: 190- 193 (1997))] and Sjogren-Larsson's syndrome [pathological lipid metabolism owing to fatty aldehyde dehydrogenase deficiency (De Laurenzi et al., Nature Genet, 12: 52-57 (1996))].
  • Refsum's disease phytanic acid accumulation owing to phyta ⁇ o ⁇ l-CoA hydroxylase deficiency (Janse ⁇ et al., Nature Genet, 17: 190- 193 (1997))
  • Sjogren-Larsson's syndrome pathological lipid metabolism owing to fatty aldehyde dehydrogenase deficiency (De Laurenzi et al
  • compositions that comprise a stabilized form of an enzyme in a synthetic lipid vesicle that can both crosslink glutamine rich molecules, such as involucrin, and mediate the formation of an ester link to hydroxyceramides, such as lipid Z, have been created.
  • Preferred embodiments include TGase 1 (the “enzyme”) joined to an SLV, TGase 1 and involucrin (the “intermediate” or “enzyme and adaptor”) joined to an SLV, and TGase 1, involucrin, and lipid Z (the "product" or
  • enzyme, adaptor, and ceramide reactant joined to an SLV.
  • other enzymes, intermediates, and products joined to an SLV are considered equivalents of the compositions embodied herein in so far as they have been produced by or have the ability to both cross-link glutamine rich molecules (e.g., involucrin) and mediate the formation of an ester link to hydroxyceramides.
  • the "enzymes” can be characterized by their ability to form an isu ⁇ t- ⁇ uut- uunu uy u-msier or an amine on to a glutaminyl residue of a protein and the "adaptor" can be characterized by the ability to join to an enzyme and a ceramide.
  • mutant forms of TGase family members and proteins that share homology to domains of TGase members that can both cross-link glutamine rich molecules and catalyze the formation of an ester bond to hydroxyceramides can be "enzymes" for the purposes of this disclosure.
  • proteins homologous to involucrin, mutant forms of involucrin, wild-type or mutant forms of proteins involved in the assembly of the CE e.g., trichohyalin, elafin, repetin, periplakin, desmoplakin, envoplakin, keratin intermediate filaments, members of the small proline rich family, c ⁇ statin ⁇ , and loricrin
  • proteins or peptidomimetics created to function like involucrin can be "adaptors" for the purposes of this disclosure.
  • lipids similar in structure or function to lipid Z that can be joined to the intermediate by esterification can be "ceramide reactants".
  • the product not only comprises an enzyme, adaptor, and a ceramide reactant joined to an SLV but further comprises another molecule joined to the adaptor.
  • adaptors such as involucrin have several glutamine residues that are not involved in cross-linking to a membrane-bound TGase 1 but can cross-link to solubiized TGase 1. These available glutamines can also be cross-linked to drugs or cosmetics (e.g., chemicals, peptidomimetics, or proteins, such as fatty aldehyde dehydrogenase, cholesterol sulfatse, extracellular matrix proteins, pigments, and proteins involved in CE assembly).
  • adaptor-fusion proteins can be constructed.
  • a fusion protein comprising avidin or streptavidin joined to involucrin can be made using techniques in molecular biology and biotinylated proteins or peptidomimetics can be joined to the fusion protein.
  • Many molecules can be joined to adapters (referred to as "delivery agents") by a number of techniques that will be apparent given this disclosure. Desirably, delivery agents are joined to adaptors prior to the assembly of the adaptor with the enzyme.
  • Preferred delivery agents include, but are not limited to, proteins associated with skin cells (e.g., trichohyalin, elafin, repetin, periplakin, desmoplakin, envoplakin, keratin intermediate filaments, members of the small proline rich family, cystatin ⁇ , loricrin, extracellular matrix proteins, fatty aldehyde dehydrogenase, cholesterol sulfatase, extracellular matrix proteins, and pigments).
  • proteins associated with skin cells e.g., trichohyalin, elafin, repetin, periplakin, desmoplakin, envoplakin, keratin intermediate filaments, members of the small proline rich family, cystatin ⁇ , loricrin, extracellular matrix proteins, fatty aldehyde dehydrogenase, cholesterol sulfatase, extracellular matrix proteins, and pigments.
  • compositions of the invention comprise an enzyme (e.g., TGase 1), an adaptor (e.g., involucrin), a delivery agent (e.g., extracellular matrix protein), and a ceramide reactant (e.g., lipid I).
  • an enzyme e.g., TGase 1
  • an adaptor e.g., involucrin
  • a delivery agent e.g., extracellular matrix protein
  • a ceramide reactant e.g., lipid I
  • synthetic lipid vesicles have been analyzed for their ability to join with enzymes and adaptors.
  • Preferred synthetic lipid vesicles are described throughout this disclosure, however, many other formulations of synthetic lipid vesicles that have the ability to join an enzyme and adaptor and allow for the assembly of a ceramide reactant can be created.
  • synthetic lipid vesicle or "SLV” refers to a lipid vesicle that has these properties.
  • carrier systems can deliver the enzyme (e.g., TGase 1), adaptor (e.g., involucrin), and ceramide reactant (e.g., lipid Z) to the lipid layer of a cell through fusion of the SLV with the cell.
  • “carrier systems” refer to a composition that can deliver the enzyme (e.g., TGase 1), adaptor (e.g., involucrin), delivery agent (e.g., extracellular matrix protein), and ceramide reactant (e.g., lipid Z) to the lipid layer of a cell through fusion of the SLV with the cell.
  • carrier system also refers to the compositions described above, wherein the SLV is replaced by a support, as described below, that can fuse with the lipid layer of a cell.
  • the carrier systems described herein can be used as biotechnological tools to study the assembly of the CE and can be incorporated into pharmaceuticals or cosmetics for the treatment or prevention of ichthyosis-related diseases and other skin disorders.
  • the following section describes, several software and hardware embodiments, as well as, computational methods that can be used to identify enzymes and adaptors for use in the aforementioned compositions.
  • TGase 1 and involucrin nucleic acid sequence and/or the TGase 1 and involucrin protein sequence or fragments thereof can be entered onto a computer readable medium for recording and manipulation. It will be appreciated by those skilled in the art that a computer readable medium having the TGase 1 and/or involucrin nucleic acid sequence and the TGase 1 and involucrin protein sequence or fragments thereof are useful for the determination of homologous sequences, structural and functional domains, and the construction of protein models.
  • a computer readable medium having the TGase 1 and involucrin nucleic acid sequence and/or the TGase 1 and involucrin protein sequence or fragments thereof includes the ability to compare the sequence, using computer programs known in the art, so as to perform homology searches, ascertain structural and functional domains and develop protein models so as to develop mutant forms of TGase 1 and/or involucrin proteins that can more effectively function for their intended purpose in the carrier systems and compositions described above.
  • the TGase 1 and involucrin nucleic acid sequence and/or the TGase 1 and involucrin protein sequence or fragments thereof can be stored, recorded, and manipulated on any medium that can be read and accessed by a computer.
  • the words "recorded” and “stored” refer to a process for storing information on computer readable medium.
  • a skilled artisan can readily adopt any of the presently known methods for recording information on computer readable medium to generate manufactures comprising the nucleotide or polypeptide sequence information of this embodiment.
  • Computer readable media include magnetically readable media, optically readable media, or electronically readable media.
  • the computer readable media can be a hard disc, a floppy disc, a magnetic tape, zip disk, CD-ROM, DVD-ROM, RAM, or ROM as well as other types of other media known to those skilled in the art.
  • the computer readable media on which the sequence information is stored can be in a personal computer, a network, a server or other computer systems known to those skilled in the art.
  • Embodiments include systems, particularly computer-based systems that contain the sequence information described herein.
  • a computer-based system refers to the hardware, software, and any database used to analyze the TGase 1 and involucrin nucleic acid sequence and/or the TGase 1 and involucrin protein sequence or fragments thereof.
  • the computer- based system preferably includes the storage media described above, and a processor for accessing and manipulating the sequence data.
  • the hardware of the computer-based systems of this embodiment comprise a central processing unit (CPU) and a data database.
  • CPU central processing unit
  • data database a data database
  • the computer system includes a processor connected to a bus which is connected to a main memory (preferably implemented as RAM) and a variety of secondary storage devices, such as a hard drive and removable medium storage device.
  • the removable medium storage device may represent, for example, a floppy disk drive, a compact disk drive, a magnetic tape drive, etc.
  • a removable storage medium, such as a floppy disk, a compact disk, a magnetic tape, etc. containing control logic and/or data recorded therein (e.g., TGase 1 and involucrin nucleic acid sequence and/or the TGase 1 and involucrin protein sequence or fragments thereof) can be inserted into the removable storage device.
  • the computer system includes appropriate software for reading the control logic and/or the data from the removable medium storage device once inserted in the removable medium storage device.
  • the TGase 1 and involucrin nucleic acid sequence and/or the TGase 1 and involucrin protein sequence or fragments thereof can be stored in a well known manner in the main memory, any of the secondary storage devices, and/or a removable storage medium.
  • Software for accessing and processing the TGase 1 and involucrin nucleic acid sequence and/or the TGase 1 and involucrin protein sequence or fragments thereof (such as search tools, compare tools, and modeling tools etc.) reside in main memory during execution.
  • a database refers to memory that can store nucleotide or polypeptide sequence information, protein model information, and information on other peptides, chemicals, peptidomimetics, and other agents that interact with enzymes, adaptors, intermediates, ceramide reactants, and products.
  • a “database” refers to a memory access component that can access manufactures having recorded thereon nucleotide or polypeptide sequence information, protein model information, and information obtained from the various assays ("carrier system characterization assays") provided herein including binding information, Ca + + requirements, SLV compositions, cross-linking data, 14 C-putrescine incorporation, appearance of (-glutamylputrescine, HPLC elution profiles, mass spectrometric data, lipo-peptide adduct information, and the effects of molecules that inhibit or enhance (“modulate”) the association of the compositions described herein.
  • carrier system characterization assays including binding information, Ca + + requirements, SLV compositions, cross-linking data, 14 C-putrescine incorporation, appearance of (-glutamylputrescine, HPLC elution profiles, mass spectrometric data, lipo-peptide adduct information, and the effects of molecules that inhibit or enhance (“modulate”) the association of the compositions described herein.
  • a database stores the information described above for numerous different enzymes, adaptors, intermediates, ceramide reactants, and products so that a comparison of the data can be made. That is, databases can store this information as a "profile" for each molecule tested and profiles from different molecules can be compared so as to identify functional and structural characteristics that are needed in a derivative molecule to produce a desired response. Then these derivative molecules can be made by conventional techniques in molecular biology and protein engineering and tested in further rounds of functional assays.
  • sequence data can be stored and manipulated in a variety of data processor programs in a variety of formats.
  • sequence data can be stored as text in a word processing file, such as MicrosoftWORD or WORDPERFECT, an
  • a search program refers to one or more programs that are implemented on the computer-based system to compare a nucleotide or polypeptide sequence with other nucleotide or polypeptide sequences and the molecular profiles created as described above.
  • a search program also refers to one or more programs that compare one or more protein models to several protein models that exist in a database and one or more protein models to several peptides, peptidomimetics, and chemicals which exist in a database.
  • a search program is used, for example, to compare regions of the TGase 1 and involucrin nucleic acid sequence and/or the TGase 1 and involucrin protein sequence or fragments thereof that match sequences in nucleic acid and protein data bases so as to identify homologies and structural or functional motifs.
  • a "retrieval program” refers to one or more programs that are implemented on the computer based system to identify a homologous nucleic acid sequence, a homologous protein sequence, or a homologous protein model.
  • a retrieval program is also used to identify peptides, peptidomimetics and chemicals that interact with a nucleic acid sequence, a protein sequence, or a protein model stored in a database. Further a retrieval program is used to identify a profile from the database that matches a desired property in a molecule.
  • Combinatorial chemistry is the science of synthesizing and testing compounds for bioactivit ⁇ en masse, instead of one by one, the aim being to discover materials more quickly and inexpensively than was formerly possible.
  • search programs are employed to compare regions of TGase 1 and involucrin proteins involved in cross-linking and esterification to other proteins (e.g., mutants and other proteins involved in CE assembly) so that new derivative molecules that perform these functions can be more efficiently designed.
  • search programs are employed to compare regions of adaptors that interact with TGase 1 and, thereby modulate cross-linking or esterification or both, with other molecules such as peptides, peptidomimetics, and chemicals, so that new enzymes, adaptors, intermediates, ceramide reactants, and products can be predicted and manufactured.
  • This process of directed combinatorial chemistry is referred to as "rational molecule design”.
  • one goal of the rational molecule design of the invention is to produce structural analogs of biologically active polypeptides of interest (e.g., TGase 1 or involucrin) or of small molecules with which they interact in order to fashion molecules that are, for example, more or less potent forms of the polypeptide of interest.
  • biologically active polypeptides of interest e.g., TGase 1 or involucrin
  • Rational molecule design has been used to develop HIV protease inhibitors and agonists for five different somatostatin receptor subtypes. (Erickson et al., Science 249:527-533 (1990) and Berk et al., Science 282:737 (1998)).
  • polypeptides having two-dimensional and/or three-dimensional homolog ⁇ can be rapidly identified.
  • a percent sequence identity can be determined by standard methods that are commonly used to compare the similarity and position of the amino acid of two polypeptides.
  • BLAST or FASTA two polypeptides are aligned for optimal matching of their respective amino acids (either along the full length of one or both sequences, or along a predetermined portion of one or both sequences).
  • Such programs provide "default” opening penalty and a “default” gap penalty, and a scoring matrix such as PAM 250 (a standard scoring matrix; see Dayhoff et al., in: Atlas of Protein Sequence and Structure, Vol. 5, Supp. 3 (1978)) can be used in conjunction with the computer program.
  • the percent identity can then be calculated as:
  • the protein sequence corresponding to TGase 1 and involucrin proteins or fragments thereof is compared to known sequences on a protein basis.
  • the candidate polypeptides can have the following degrees of homology to TGase 1 or involucrin proteins or fragments thereof, for example: 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
  • candidate polypeptides having greater than or equal to 50% homology are identified and are subsequently examined using the functional assays described herein.
  • Candidate polypeptides that can be incoporated into carrier systems are, thus, identified and can be analyzed using the assays above so as to generate profiles of the molecules and compositions.
  • a search program is used to compare the three-dimensional structure of TGase 1 and involucrin proteins or fragments thereof with other known three-dimensional structures so as to identify other enzymes and adaptors.
  • the three-dimensional structure of proteins has been determined in a number of ways. Perhaps the best known way of determining protein structure involves the use of x-ray crystallography. A general review of this technique can be found in Van Holde, K.E. Physical Biochemistry, Prentice-Hall, N.J. pp. 221-239 (1971). Using this technique, it is possible to elucidate three-dimensional structure with good precision.
  • protein structure may be determined through the use of techniques of neutron diffraction, or by nuclear magnetic resonance (NMR). (See, e.g., Moore, W.J., Physical Chemistry, 4 th Edition, Prentice-Hall, N.J. (1972)).
  • the protein model embodiments are constructed using computer-based protein modeling techniques.
  • the protein folding problem is solved by finding target sequences that are most compatible with profiles representing the structural environments of the residues in known three-dimensional protein structures.
  • Eisenberg et al. U.S. Patent No. 5,436,850 issued July 25, 1995.
  • the known three-dimensional structures of proteins in a given family are superimposed to define the structurally conserved regions in that family.
  • This protein modeling technique also uses the known three-dimensional structure of a homologous protein to approximate the structure of a polypeptide of interest. (See e.g., Srinivasan, et al., U.S. Patent No. 5,557,535 issued September 17, 1996).
  • fold recognition is performed using Multiple Sequence Threading (MST) and structural equivalences are deduced from the threading output using the distance geometry program DRAGON which constructs a low resolution model.
  • a full-atom representation is then constructed using a molecular modeling package such as QUANTA.
  • MST Multiple Sequence Threading
  • QUANTA molecular modeling package
  • the structural equivalences obtained from the MST output are converted into interresidue distance restraints and fed into the distance geometry program DRAGON, together with auxiliary information obtained from secondary structure predictions.
  • the program combines the restraints in an unbiased manner and rapidly generates a large number of low resolution model confirmations.
  • these low resolution model confirmations are converted into full-atom models and subjected to energy minimization using the molecular modeling package QUANTA. (See e.g., Asz ⁇ di et al., Proteins:Structure, Function, and Genetics, Supplement 1 :38-42 (1997)).
  • a three-dimensional structure of a polypeptide of interest e.g., TGase 1 or involucrin proteins or fragments thereof
  • a polypeptide of interest e.g., TGase 1 or involucrin proteins or fragments thereof
  • Useful protein models of the polypeptide of interest can also be gained by computer modeling alone.
  • Combinatorial chemistry is then employed to design derivatives of the polypeptide of interest based on the three- dimensional models.
  • the candidate proteins are then tested in the functional assays decribed herein.
  • carrier system characterization assays are performed on the newly identified proteins and based on the performance in the carrier system characterization assays, the results are recorded on a computer readable media and a profile is created. Further cycles of modeling and carrier system characterization assays are employed to more narrowly define the parameters needed in an enzyme or adaptor that elicits a desired response.
  • a novel enzyme or adaptor can be identified as follows. First, a molecular model of TGase 1 or involucrin proteins or fragments thereof are created using one of the techniques discussed above or as known in the art. Next, chemical and peptide libraries and protein sequence databases are searched for molecules similar in structure to the polypeptide of interest. Identified candidate molecules are then screened in the carrier system characterization assays, described above, and the agents that produce the desired profiles are used as templates for further library construction.
  • Libraries of related polypeptides are synthesized and these molecules are then used in the carrier system characterization assays.
  • Compounds that produce desirable responses are identified, recorded on a computer readable media, (e.g., a profile is made) and the process is repeated to select for optimal enzymes and adaptors.
  • Each newly identified enzyme and/or adaptor and its performance in the carrier system characterization assay is recorded on a computer readable media and a database or library of profiles are generated. These profiles are used by researchers to identify important property differences between active and inactive molecules so that compound libraries are enriched for molecules that have favorable characteristics.
  • computer modeling and the sequence-to-structure-to-function paradigm is exploited to identify novel enzymes and adaptors.
  • TGase 1 or involucrin proteins or fragments thereof having a known response in a carrier system characterization assay is determined from its sequence using a threading algorithm, which aligns the sequence to the best matching structure in a structural database.
  • the protein's active site i.e., the site important for a desired response in the carrier system characterization assay
  • FFF fuzzy functional form
  • the FFFs are built by itterativel ⁇ superimposing the protein geometries from a series of functionally related proteins with known structures.
  • the FFFs are not overly specific, however, and the degree to which the descriptors can be relaxed is explored.
  • conserved and functionally important residues for a desired response are identified and a set of geometric and conformational constraints for a specific function are defined in the form of a computer algorithm.
  • the program searches experimentally determined protein structures from a protein structural database for sets of residues that satisfy the specified constraints. In this manner, homologous three-dimensional structures can be compared and degrees (e.g., percentages of three-dimensional homology) can be ascertained.
  • genome sequence data bases such as maintained by various organizations including: http://www.tigr.orgftdb; http://www.genetics.wisc.edu; http://genome-www.stanford.edu/ " ball; http://hiv- web.lanl.gov; http://wwwncbi.nlm.nih.gov; http://www.ebi.ac.uk; http://pasteur.fr/other/biology; and http://www- genome.wi.mit.edu, can be rapidly screened for specific protein active sites and for identification of the residues at those active sites which resemble a desired molecule.
  • Several other groups have developed databases of short sequence patterns or motifs designed to identify a given function or activity of a protein. These databases, notably Prosite
  • Mutant TGase 1, mutant involucrin, and mutant forms of other enzymes and adaptors can be used in several embodiments. In some cases, mutations in these proteins have little or no structural or functional effect and are therefore considered equivalents of TGase 1 or involucrin. That is, functionally equivalent amino acid residues can be substituted for residues within the protein's sequence resulting in a silent change. Accordingly, one or more amino acid residues within the TGase 1 and involucrin proteins or fragments thereof can be substituted by another amino acid of a similar polarity that acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the sequence can be selected from other members of the class to which the amino acid belongs.
  • the non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine.
  • the positively charged (basic) amino acids include argi ⁇ ine, lysine, and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • the aromatic amino acids include phenylalanine, tryptophan, and tyrosine.
  • mutations of TGase 1 and involucrin and other enzymes and adaptors can be created so as to effect a structural or functional changes or both.
  • These mutant proteins can be analyzed in the carrier system characterization assays and profiles of the molecules can be generated. These mutant protein profiles can then be compared to wild-type protein profiles so as to determine if the mutation resulted in a gain or loss of function, in this manner, mutations that produce desired functional responses can be selected for and optimal molecules can be created. Mutations that result in a silent change and ones that result in a gain or loss of function can be created by using site-directed mutagenesis and other techniques known to those of skill in the art.
  • TGase 1 involucrin, and other enzymes and adaptors can be created so that the protein is differentially modified during or after translation, e.g., by phosphorylation, glycosylation, cross-linking, acylation, or proteolytic cleavage. (Ferguson et al., Ann. Rev. Biochem. 57:285-320 (1988)).
  • nucleic acids containing the coding sequence for protein are obtained and cloned into a suitable expression vector such that the coding region is operably linked to a heterologous promoter.
  • the nucleic acid encoding the protein or polypeptide to be expressed is operably linked to a promoter in an expression vector using conventional cloning technology.
  • the expression vector can be in any of the mammalian, yeast, amphibian, insect, parasite, or bacterial expression systems known in the art.
  • the following is provided as one exemplary method to express the proteins encoded by the nucleic acids described above.
  • the methionine initiation codon for the gene and the poly A signal of the gene are identified. If the nucleic acid encoding the polypeptide to be expressed lacks a methionine to serve as the initiation site, an initiating methionine can be introduced next to the first codon of the nucleic acid using conventional techniques. Similarly, if the nucleic acid lacks a poly A signal, this sequence can be added to the construct by, for example, splicing out the Poly A signal from pSG5 (Stratagene) using
  • the vector pXT1 contains the LTRs and a portion of the gag gene from Moloney Murine Leukemia Virus. The position of the LTRs in the construct allow efficient stable transfection.
  • the vector includes the Herpes Simplex Thymidine Kinase promoter and the selectable neomycin gene.
  • the nucleic acid encoding the polypeptide to be expressed can be obtained by PCR from the bacterial vector using oligonucleotide primers complementary to the nucleic acid and containing restriction endonuclease sequences for Pst I incorporated into the 5 primer and Bglll at the 5 end of the corresponding cDNA 3 primer, taking care to ensure that the nucleic acid is positioned in frame with the poly A signal.
  • the purified fragment obtained from the resulting PCR reaction is digested with Pstl, blunt ended with an exonuclease, digested with Bgl II, purified and ligated to pXT1, now containing a poly A signal and digested with Bglll.
  • the ligated product is transfected into a suitable cell line, e.g., mouse NIH 3T3 cells, using
  • Lipofectin (Life Technologies, Inc., Grand Island, New York) under conditions outlined in the product specification. Positive transfectants are selected after growing the transfected cells in 600ug/ml G418 (Sigma, St. Louis, Missouri). Preferably the expressed protein is released into the culture medium, thereby facilitating purification.
  • nucleic acids encoding the polypeptide of interest can be cloned into pED6dpc2 and the resulting pED6dpc2 constructs can be transfected into a host cell, such as COS 1 cells. Methotrexate resistant cells are selected and expanded. Preferably, the protein expressed is released into the culture medium thereby facilitating purification.
  • Another embodiment utilizes the "Xpress system for expression and purification" (Invitrogen, San Diego, CA).
  • the Xpress system is designed for high-level production and purification of recombinant proteins from bacterial, mammalian, and insect cells.
  • the Xpress vectors produce recombinant proteins fused to a short N-terminal leader peptide which has a high affinity for divalent cations.
  • a nickel-chelating resin invitrogen
  • the recombinant protein can be purified in one step and the leader can be subsequently removed by cleavage with enterokinase.
  • the pBlueBacHis2 Xpress vector is a Baculovirus expression vector containing a multiple cloning site, an ampicillin resistance gene, and a lac z gene.
  • the nucleic acid encoding the polypeptide of interest is cloned into the pBlueBacHis2 Xpress vector and SF9 cells are infected.
  • the expression protein is then isolated or purified according to the maufacturer's instructions.
  • Proteins in the culture medium can also be separated by gel electrophoresis.
  • the separated proteins are then detected using techniques such as Coomassie or silver staining or by using antibodies against the protein.
  • Coomassie, silver staining, and immunolabeling of proteins are techniques familiar to those skilled in the art.
  • the proteins can also be ammonium sulfate precipitated or separated based on size or charge prior to electrophoresis.
  • the polypeptide of interest can also be purified using standard immunochromatography techniques.
  • a solution containing the protein such as the culture medium or a cell extract, is applied to a column having antibodies against the protein attached to the chromatography matrix.
  • the protein is allowed to bind the immunochromatography column. Thereafter, the column is washed to remove non-specifically bound proteins.
  • the specifically bound protein is then released from the column and recovered using standard techniques.
  • isolated requires that the material be removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally occurring nucleic acid or protein present in a living cell is not isolated, but the same nucleic acid or protein, separated from some or all of the coexisting materials in the natural system, is isolated.
  • polypeptide of interest present in a cell lysate is "isolated”.
  • purified does not require absolute purity; rather it is intended as a relative definition. For example, recombinant nucleic acids and proteins are routinely purified to electrophoretic homogeneity, as detected by ethidum bromide staining or
  • Coomassie staining are suitable in several assays despite having the presence of contaminants.
  • these molecules can be prepared by chemical synthesis methods (such as solid phase peptide synthesis) using methods known in the art such as those set forth by Merrifield et al., J. Am. Chem. Soc. 85:2149 (1964), Houghten et al., Proc. Natl. Acad.
  • polypeptides can be synthesized with or without a methionine on the amino terminus. Chemically synthesized polypeptides can be oxidized using methods set forth in these references to form disulfide bridges.
  • enzymes, adaptors, delivery agents, and ceramide reactants are joined to a support to facilitate the study of CE assembly (e.g., to isolate proteins involved in assembly of the CE), to test the efficacy of therapeutic agents, and to provide a carrier system that can deliver an active ingredient or delivery agent.
  • the next section describes the preparation of several supports for use with some embodiments.
  • a natural onomeric agent that is, an agent that presents a discrete molecule, thus, carrying only one binding epitope or domain
  • a synthetic agent or a multimeric agent that is, an agent that presents multiple molecules, thus, having several binding epitopes or domains
  • multimeric refers to the presence of more than one molecule on an agent, for example, several individual molecules of an antibody joined to a support, as distinguished from the term “multimerized” which refers to an agent that has more than one molecule joined as a single discrete compound molecule on a support, for example several antibody molecules joined to form a single compound molecule that is joined to a support.
  • a multimeric agent (synthetic or natural) can be obtained by joining to a macromolecular support a plurality of enzymes, a plurality of enzymes joined to a plurality of adaptors, and a plurality of enzymes joined to a plurality of adaptors, wherein the adaptors are also joined to a plurality of delivery agents. Additionally, multimeric agents can be obtained by joining the compositions described above to a plurality of ceramide reactants.
  • a "support” is also termed a carrier, a resin or any macromolecular structure used to join or immobilize a molecule.
  • Solid supports include, but are not limited to, the walls of wells of a reaction tray, test tubes, polystyrene beads, magnetic beads, nitrocellulose strips, membranes, microparticles such as latex particles, sheep (or other animal) red blood cells, Duracyte® artificial cells, SLVs and others.
  • the macromolecular support has a hydrophobic surface that interacts with a portion of the protein(s) of interest by a hydrophobic non-covalent interaction.
  • the hydrophobic surface of the support is a polymer such as plastic or any other polymer in which hydrophobic groups have been linked such as polystyrene, polyethylene or polyvinyl.
  • enzymes, adaptors, intermediates, and products can be covalently bound to carriers including proteins and oligo/polysaccarides (e.g. cellulose, starch, glycogen, chitosane or aminated sepharose).
  • reactive groups on the proteins such as a hydrox ⁇ or an amino group, are used to join to a reactive group on the carrier so as to create the covalent bond.
  • Embodiments also comprise a support with a charged surface that interacts with the enzymes, adaptors, intermediates, and products.
  • Additional embodiments comprise a support that has other reactive groups that are chemically activated so as to attach enzymes, adaptors, intermediates, and products. For example, cyanogen bromide activated matrices, epoxy activated matrices, thio and thiopropyl gels, nitrophen ⁇ l chloroformate and N-hydrox ⁇ succinimide chlorformate linkages, or oxirane acrylic supports are used. (Sigma).
  • Inorganic carriers such as silicon oxide material (e.g. silica gel, zeolite, diatomaceous earth or aminated glass) to which the enzymes, adaptors, intermediates, and products are covalently linked through a hydroxy, carboxy or amino group and a reactive group on the carrier are also embodiments.
  • silicon oxide material e.g. silica gel, zeolite, diatomaceous earth or aminated glass
  • linkers such as ⁇ linkers (flexible regions of ⁇ phage), of an appropriate length are inserted between one or more of the molecules that are joined to the support (e.g., linkers are placed between adaptors and delivery agents) so as to encourage greater flexibility and thereby overcome any steric hindrance that is presented by the support or molecules thereon.
  • the determination of an optimal length of linker is made by screening the carrier system having varying linkers in the carrier system characterization assays decribed in the herein.
  • a composite support comprising more than one type of enzyme, adaptor, delivery agent, and ceramide reactant is also an embodiment.
  • a “composite support” is a carrier, a resin, or any macromolecular structure used to join or immobilize two or more different enzymes, adaptors, delivery agents, or ceramide reactants.
  • Linkers such as 8 linkers, can also be found on the composite supports of the invention.
  • the multimeric and composite supports discussed above have attached multimerized proteins.
  • a multimerized protein is obtained by, for example, creating an expression construct having two or more nucleotide sequences encoding the polypeptide of interest joined together. The expressed multimerized protein can then be joined to a support.
  • a support having many such multimerized agents is termed a muitimerized-structureric support.
  • the multimerized form of a protein can be advantageous for many applications because of the ability to obtain an agent with greater functional properties.
  • linkers or spacers, such as flexible ⁇ linkers, between the protein domains that make-up the multimerized agent can also be advantageous for some embodiments.
  • the next section describes several embodiments that have therapeutic and/ or prophylactic and/or cosmetic application.
  • Embodiments are suitable for treatment of subjects either as a preventive measure to avoid skin disorders, such as ichthyosis-related maladies, or as a therapeutic to treat subjects already afflicted with a skin disorder. Although anyone could be treated with these agents as a prophylactic, the most suitable subjects are people at risk for such diseases. Such subjects include, but are not limited to, individuals with a family history of ichthyosis-related diseases.
  • the carrier systems described herein can be processed in accordance with conventional pharmacological and cosmetological methods to produce medicinal agents and cosmetics for administration to patients, e.g., mammals including humans.
  • the carrier systems for example, can be incorporated into a pharmaceutical or cosmetic product with and without modification.
  • the compositions can be employed in admixture with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for topical application that do not deleteriously react with the molecules that assemble the carrier system.
  • Suitable acceptable carriers can be water, salt solutions, alcohols, oils, glycols, gelatine, carbohydrates such as lactose, amylose or starch, fatty acid monogl ⁇ cerides and digl ⁇ cerides, pentaerythritol fatty acid esters, hydroxy methylcellulose, polyvinyl p ⁇ rrolidone, etc.
  • the preparations can be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, aromatic substances and the like that do not deleteriously react with the active compounds. They can also be combined where desired with other active agents.
  • the effective dose and method of administration of a carrier system formulation can vary based on the individual patient and the stage of the disease, as well as other factors known to those of skill in the art.
  • Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical or cosmetological procedures with experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population).
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
  • Pharmaceutical and cosmetological compositions that exhibit large therapeutic indices are preferred.
  • the data obtained from ceil culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • the exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors that may be taken into account include the severity of the disease state, age, weight and gender of the patient; diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy.
  • Short acting compositions are administered daily whereas long acting pharmaceutical compositions are administered every 2, 3 to 4 days, every week, or once every two weeks. Depending on half-life and clearance rate of the particular formulation, the pharmaceutical compositions are administered once, twice, three, four, five, six, seven, eight, nine, ten or more times per day.
  • concentrations of the carrier systems in a specific formulation can be quite high in some embodiments.
  • Desirable concentrations for topical administration range from 10:M to 2M. Preferahle concentrations for these embodiments range from 100:M to 500mM.
  • preferred concentrations for use in topical applications include 1 GO.NI, 110:M, 120:M, 130:M, 140:M, 145:M, 150:M, 160:M, 170:M, 180:M, 190:M, 200:M, 220:M, 240:M, 250:M, 260:M, 280:M, 300:M, 320:M, 340:M, 360:M, 380:M, 400:M, 420:M, 440:M, 460:M, 480:M, 500:M, 550:M, 600:M, 650:M, 700:M, 750:M, 800:M, 850:M, 900:M, 1 mM, 5mM, 10mM, 15mM, 20mM, 25mM, 30mM, 35mM, 35mM, 35
  • the dosage of the therapeutic, prophylactic, and cosmetic is one that provides sufficient carrier system to attain a desirable effect including formation of the CE.
  • Routes of administration of the carrier system are primarily topical, although it is desired to administer some embodiments to cells that reside in deep skin layers.
  • Topical administration is accomplished via a topically applied cream, gel, rinse, etc. containing the carrier system.
  • Compositions of carrier system-containing compounds suitable for topical application include, but not limited to, physiologically acceptable implants, ointments, creams, rinses, and gels. Any liquid, gel, or solid, pharmaceutically acceptable base in which the carrier systems are at least minimally soluble is suitable for topical use.
  • the example below describes an approach that can be used to test embodiments for the ability to treat icth ⁇ osiform-related diseases.
  • mice can be used to evaluate the efficacy of the various compositions.
  • Matzuki et al. Proc. Natl. Acad. Sci. USA 95: 1044-1049 (1998), herein expressly incorporated by reference in its entirety.
  • Mice lacking the TGase 1 gene are obtainable through Matzuki et al., or can be obtained through commercial sources that specialize in manufacturing transgenic and "knock-out" mice to order.
  • mice can be constructed by following the protocol detailed in Matzuki et al., Proc. Natl. Acad. Sci. USA 95: 1044-1049 (1998), herein expressly incorporated by reference in its entirety.
  • TGase 1 knock-out mice are achieved by targeted disruption of the TGase 1 gene, that is replacing exons 1-3 with a Neo cassette by using homologous recombination in R1 ES cells. These exons encode the translation initiation codon and an N-terminal stretch unique to TGase 1 that is required for membrane anchoring.
  • ES cell clones are screened by polymerase chain reaction (PCR) and Southern blot analysis and mutant ES clones carrying the targeted allele are used to generate chimeric animals.
  • Northern blot analysis of heterozygous and homoz ⁇ gous chimeric animals is performed to verify the level of TGase-1 expression.
  • Heterozygous individuals TGase V'
  • homozygous individuals TGase 1 '
  • TGase ' individuals that are left untreated with the carrier systems described herein will die within 4-5 hours after birth.
  • carrier systems to be tested are prepared in advance, and preferred formulations are liquid or gel.
  • preferred formulations are liquid or gel.
  • To screen the carrier systems TGase 1 ' mice are breed and shortly after birth, the mice are dipped into a formulation comprising carrier system.
  • concentrations of product e.g., TGase 1, involucrin, and lipid Z joined to an SLV
  • initial determinations are made with sufficient formulation of product to deliver a concentration of 1 mM of enzyme, adaptor, and ceramide reactant.
  • the time period of survival of treated mice, as compared to untreated mice is determined. A greater period of survival of carrier system-treated TGase 1 ' mice than untreated TGase
  • TEWL transdermal water loss
  • an evaporimeter is used to analyze the dorsal skin of the animals.
  • the Courage and Khazaka Tewameter TM210 an open chamber system with two humidity and temperature sensors, can be used to measure the water evaporation gradient at the surface of the skin. The parameters for calibrating the instrument and use of the instrument is described in Barel and Clarys Skin Pharmacol. 8: 186-195 (1995), herein expressly incorporated by reference in its entirety and the manufacturer's instructions.
  • TEWL will be low in wild-type and heterozygous mice but will be approximately 100 fold greater in untreated homozygous mice.
  • the TEWL reading on homozygous mice that were treated with a carrier system will approach the reading obtained from untreated wild-type or untreated heterozygous mice.
  • the diffusion of the fluorescent dye Lucifer yellow in the skin of carrier system- treated TGase 1 ' mice is compared to that of untreated TGase 1 ' mice, untreated heterozygous mice, and untreated wild- type mice. Accordingly, neonatal mice are restrained in a petri dish with their backs in contact with 1 mM Lucifer yellow in Ringer's solution (pH 7.4) at 37°C. After one hour, the mice are sacrificed, then frozen, and dorsoventraliy sliced at a thickness of 5:m. The sections are counter stained with 5:g/ml propidium iodide and are analyzed by fluoresence microscopy.
  • the dye will be retained in the upper layers of the stratum corneum in the untreated wild-type mice, untreated heterozygous mice, and the carrier-system treated TGase -/- mice but the untreated homozygous mice will be found to have the dye distributed throughout the stratum corneum and the dermal layers.
  • TGase 1 and TGase 3 enzymes were expressed in Sf9 cells by the BaculoGold system using the pVL1392 plasmid vector (Pharmigen, San Diego, CA) as described previously (Candi, et al., J. Biol. Chem., 273: 13693-13702 (1998), herein expressly incorporated by reference in its entirety).
  • TGase 1 was recovered in the particulate fraction after sonication in lysis buffer. In some experiments this crude particulate fraction was used as the
  • Active fractions were brought to 1 M Na2S ⁇ 4 and rechromatographed on a 1 ml Resource Phe hydrophobic interaction column (Amersham Pharmacia Biotech, Piscataway, NY) using a gradient from 1 M Na2S ⁇ 4, 20 mM Tris-CI (pH 8.0) to 20 mM Tris-CI (pH 8.0) in 30 min at a 1 ml/min flow rate.
  • the TGase 1 and 3 enzymes were > 98% pure by SDS-PAGE, and could be stably stored as a suspension in 1.5 M a2S04 for some weeks at 4 C. Amounts were determined by amino acid analysis following acid hydrolysis.
  • TGase 3 was activated with 0.1 U/100 ⁇ g of dispase for 15 min at 23 C and purified from the protease on a MonoQ column as above.
  • cDNA clone of human involucrin was obtained by PCR from human chromosomal DNA. PCR primers used were:
  • (+) GTAGCTTCTCATATGTCCCAGCAAC (SEQ.ID.N0.11); and (-) CCCTTGTATGAGACGATCTGAG (SEQ. ID.NO.12). These were designed to create an Nde ⁇ restriction site to be compatible with the pET expression system
  • the solvent was flushed away under a stream of N2, dried further under high vacuum for 4 h and then resuspended by vortexing in 0.5 ml of a buffer containing 50 mM Tris-CI (pH 8.0), 100 mM NaCI, 3 mM Na 3, 5 mM DTT, and 200 mM sucrose.
  • the mixture was sonicated on ice five times each for 1 mm using a Branson 250 sonifier with micro probe tip, and allowed to stand at 23 °C to facilitate assembly of SLV.
  • the SLV were diluted with 0.5 ml of the above buffer without sucrose, and 200 ⁇ l aliquots were centrifuged at 100,000 x g for 30 mm in a Beckman Airfuge using the A-10 rotor. The top 175 ⁇ l was removed, and the pellet resuspended in another 150 ⁇ l of sucrose-free buffer. The final stock concentration was 11 ⁇ mol/ml.
  • Liver TGase 2 enzyme was obtained from Sigma.
  • the recombinant human CE proteins loricrin (Candi, et al., J. Biol. Chem., 270: 26382-26390 (1995), herein expressly incorporated by reference in its entirety), SPR1 (Candi, et al., J.
  • All binding essays were done at 23 C in a final volume of 200 ⁇ l by mixing SLV with protein amounts empirically found to exceed at least two-fold the binding capacities of the SLV: for TGase 1 , 20 ⁇ g (0.2 nmol) were mixed with 0.1 ⁇ mol of SLV lipids; for involucrin, 1.2 nmol were mixed with 1 ⁇ mol of SLV lipids; for all other proteins, 50 ⁇ g were used with 1 ⁇ mol of SLV lipids.
  • the buffer contained 50 mM T ⁇ s-HCI (pH 8.0), 100 mM NaCI, 1 mM DTT, 3 mM NaN3 ( and other additives where noted.
  • Some mixtures also contained 1 mM CaCl2 or 2 mM EDTA. After mixing, the samples were centrifuged for 45 mm at 100, 000 x g, and the protein content from 50 ⁇ l of supernatant was determined by ammo acid analysis after acid hydrolysis. Data were usually not corrected for loss of SLV lipids, as in control
  • Ca + + /chelator ratios were calculated by the WinMaxC 1.7 computer program (Bers, et al.. Methods in Cell Biology Vol 40- A Practical Guide to the Study of Ca + ⁇ n Living Cells, Nuccitelli, R., ed., pp. 1-327 (1994), herein expressly incorporated by reference in its entirety), and were made by adding the required amounts of 1 M CaCl2 to 0.2 M stock solutions of the following chelators at pH 8.0. Final chelator concentrations in the samples were 10 mM in all cases.
  • Sodium citrate was the chelator for the 20-500 ⁇ M Ca + + range; sodium nit ⁇ lotriacetate for the 1 -20 ⁇ M Ca + + range; and sodium 1,2 b ⁇ s(am ⁇ nophenoxy)ethane-N,N,N',N' tetraacetate for the 0.1-1 ⁇ M Ca + + range.
  • the pellet was redissolved in a buffer of 50 mM Tris-CI (pH 7.5), and digested for 16 h at 37 C with 2 % (by weight) of modified trypsin (Boehringer Mannheim, Indianapolis, IN). Aliquots of 20 ⁇ g were resolved on a 250 x 4.6 mm Beckman Ultrasphere C18 HPLC column. Separated peaks were analyzed for radioactivity and peaks containing activity were attached to a solid support for sequencing as before (Steinert, P.M. and L.N. Marekov, J. Biol. Chem., 270: 17702-1771 1 (1995), herein expressly incorporated by reference in its entirety).
  • Lipid Z N-[16-(16-hydroxyhexadecyl)oxypalmitoyl]-sphingosine
  • reaction mixture was taken up in chloroform, washed with 0.1 M sodium thiosulfate, 0.1 N HCl, water and tried with Na 2 S04. After the evaporation of the solvent, the resulting oil was taken up in 15 ml chioroform-methanol 95.5 and chromatographed on 150g Kieselgel 60 (Merck) by washing with 250 ml and eluting with 300 ml the same solvent. After evaporation of the solvent, 2.1 g of 16-iodo-hexadecanoic acid was obtained (31 %).
  • a mixture of 54 mol% dimyristoyl-phosphatidylcholine, 15 mol% dipalmito ⁇ l-phosphatidylserine, 30 mol% cholesterol (all from Sigma, St. Louis, M0) and 1 mol% lipid Z was made in chloroform: methanol (9:1). This solution was dried down, taken up in aqueous buffer and dispersed by sonication as before (Nemes et al., J. Biol. Chem., 114: in press (1999)). The SLV suspension was equipped with TGase 1 enzyme by incubation at 37 °C for 15 min prior to adding substrates.
  • TGase 1 The amount of TGase 1 used was standardized to an activity level of 0.7 pmol/min using succinylated casein and 14C putrescine as substrates as described (Candi et al, Proc. Natl. Acad. Sci. USA, 95: 2067-2072 (1998), herein expressly incorporated by reference in its entirety). Reactions of TGase 1 with Involucrin and Lipid Z
  • SLV (2 ⁇ mol lipid) were brought to 37 oC and 1 mM CaCl2, and 0.6 nmol (40 ⁇ g) involucrin was added to make a total volume 200 ⁇ l, and incubated for 60 min, if not otherwise stated.
  • the reactions were stopped by the addition of EDTA to 10 mM.
  • Some reaction mixtures contained 1 mM putrescine, or alternatively, putrescine to 20 mM was added after running the reaction for 45 min.
  • Peptides were resolved on a 250 x 2 mm PrimesphereC4 HPLC column (Phenomenex) and separated using a gradient elution from 75% buffer A (0.1 % TFA in water) to 75% buffer B (50% 2-propanol in acetonitrile) in 40 min. Under these conditions, lipo-peptides were retarded but free peptides elute with the solvent front (Marekov, L.N. and P.M. Steinert, J. Biol. Chem., 273: 17763-17770 (1998), herein expressly incorporated by reference in its entirety).
  • Mass Spectrometry Mass analysis was done either using Fast Atom Bombardment (positive ion mode, magic bullet) or electrospray ionization mass spectrometry for peptides. Spectra were acquired on a JEOL SX102 mass spectrometer fitted with an Analytica electrospray source.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dermatology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne la découverte d'une méthode d'apport d'une transglutaminase stabilisée (1), l'involucrine, ainsi que d'autres molécules, nécessaires à l'assemblage de l'enveloppe cellulaire sur les cellules de la peau. L'invention concerne également des nouveaux outils, substances prophylactiques, thérapeutiques et cosmétiques, biologiques, ainsi que des procédés d'utilisation de ceux-ci dans l'étude, la prévention et le traitement de troubles cutanés. L'invention concerne encore un analogue de céramide synthétique, dénommé lipide Z, ainsi que des procédés d'utilisation et de synthèse de cet analogue.
PCT/US2000/017235 1999-06-23 2000-06-22 Procedes d'amelioration du traitement des maladies de la peau du type ichtyoses WO2000078937A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU57595/00A AU5759500A (en) 1999-06-23 2000-06-22 Methods for ameliorating icthyosiform skin diseases
US10/023,275 US6852686B2 (en) 1999-06-23 2001-12-13 Methods for ameliorating icthyosiform skin diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14065699P 1999-06-23 1999-06-23
US60/140,656 1999-06-23

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/023,275 Continuation US6852686B2 (en) 1999-06-23 2001-12-13 Methods for ameliorating icthyosiform skin diseases

Publications (1)

Publication Number Publication Date
WO2000078937A1 true WO2000078937A1 (fr) 2000-12-28

Family

ID=22492231

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/017235 WO2000078937A1 (fr) 1999-06-23 2000-06-22 Procedes d'amelioration du traitement des maladies de la peau du type ichtyoses

Country Status (2)

Country Link
AU (1) AU5759500A (fr)
WO (1) WO2000078937A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6513975B1 (en) 2000-06-19 2003-02-04 The Procter & Gamble Company Bag with extensible handles
WO2019175352A1 (fr) * 2018-03-14 2019-09-19 Universiteit Antwerpen Éthers linéaires alpha-oméga di-fonctionnels longs

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993022281A1 (fr) * 1992-05-07 1993-11-11 Unilever Plc Synthese d'un ingredient cosmetique
WO1994018945A1 (fr) * 1993-02-19 1994-09-01 Howard Green Compositions contenant des proteines corneocytiques

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993022281A1 (fr) * 1992-05-07 1993-11-11 Unilever Plc Synthese d'un ingredient cosmetique
WO1994018945A1 (fr) * 1993-02-19 1994-09-01 Howard Green Compositions contenant des proteines corneocytiques

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CANDI E. ET AL.: "Transglutaminase 1 mutations in lamellar ichthyosis. Loss of activity due to failure of activation by proteolytic processing.", J BIOL CHEM 1998 MAY 29;273(22):13693-702, XP002153851 *
MAREKOV LN. ET AL.: "Ceramides are bound to structural proteins of the human foreskin epidermal cornified cell envelope.", J BIOL CHEM 1998 JUL 10;273(28):17763-70, XP002153849 *
NEMES ZOLTAN ET AL: "A novel function for transglutaminase 1: Attachment of long-chain omega-hydroxyceramides to involucrin by ester bond formation.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 96, no. 15, 20 July 1999 (1999-07-20), pages 8402 - 8407, XP002153852, ISSN: 0027-8424 *
NEMES ZOLTAN ET AL: "Bricks and mortar of the epidermal barrier.", EXPERIMENTAL & MOLECULAR MEDICINE, vol. 31, no. 1, 31 March 1999 (1999-03-31), pages 5 - 19, XP000960915, ISSN: 1226-3613 *
NEMES ZOLTAN ET AL: "Involucrin cross-linking by transglutaminase 1. Binding to membranes directs residue specificity.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 274, no. 16, 16 April 1999 (1999-04-16), pages 11013 - 11021, XP002153848, ISSN: 0021-9258 *
STEINERT PETER M ET AL: "Biochemical evidence that small proline-rich proteins and trichohyalin function in epithelia by modulation of the biomechanical properties of their cornified cell envelopes.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 273, no. 19, 8 May 1998 (1998-05-08), pages 11758 - 11769, XP002153850, ISSN: 0021-9258 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6513975B1 (en) 2000-06-19 2003-02-04 The Procter & Gamble Company Bag with extensible handles
WO2019175352A1 (fr) * 2018-03-14 2019-09-19 Universiteit Antwerpen Éthers linéaires alpha-oméga di-fonctionnels longs
US11634376B2 (en) 2018-03-14 2023-04-25 Universiteit Antwerpen Long alpha-omega di-functional linear ethers

Also Published As

Publication number Publication date
AU5759500A (en) 2001-01-09

Similar Documents

Publication Publication Date Title
Nemes et al. Involucrin cross-linking by transglutaminase 1: binding to membranes directs residue specificity
Toke et al. Isolation and characterization of the Saccharomyces cerevisiae LPP1 gene encoding a Mg2+-independent phosphatidate phosphatase
Leng et al. Site-directed mutagenesis of the 100-kDa subunit (Vph1p) of the yeast vacuolar (H+)-ATPase
Geisbrecht et al. Characterization of PECI, a novel monofunctional Δ3, Δ2-enoyl-CoA isomerase of mammalian peroxisomes
Dupuy et al. Crystal structure of human iron regulatory protein 1 as cytosolic aconitase
Duronio et al. Protein N-myristoylation in Escherichia coli: reconstitution of a eukaryotic protein modification in bacteria.
Yokomizo et al. cDNA cloning, expression, and mutagenesis study of leukotriene B4 12-hydroxydehydrogenase
Zalcman et al. RhoGDI-3 is a new GDP dissociation inhibitor (GDI): identification of a non-cytosolic GDI protein interacting with the small GTP-binding proteins RhoB and RhoG
Takeuchi et al. Distinct specificity in the binding of inositol phosphates by pleckstrin homology domains of pleckstrin, RAC-protein kinase, diacylglycerol kinase and a new 130 kDa protein
AU2006238858B2 (en) Nicotinamide riboside kinase compositions and methods for using the same
Eklund et al. Computer‐graphics interpretations of residue exchanges between the α, β and γ subunits of human‐liver alcohol dehydrogenase class I isozymes
JP2001136987A (ja) ホスホジエステラーゼ酵素
MXPA05008533A (es) Diagnostico y tratamiento de deficiencia de sulfatasa multiple y otras deficiencias de sulfatasa.
AU2005211773A1 (en) Nicotinamide riboside kinase compositions and methods for using the same
LV12814A (en) Cyclic gmp-binding cyclic specific phosphodiesterase materials and methods
KR20020000805A (ko) 스핀고신 키나제 효소
Hijikata et al. Structural and functional analyses of Barth syndrome-causing mutations and alternative splicing in the tafazzin acyltransferase domain
Nes et al. Overexpression, Purification, and Stereochemical Studies of the Recombinant (S)-Adenosyl-l-methionine: Δ24 (25)-to Δ24 (28)-Sterol Methyl Transferase Enzyme fromSaccharomyces cerevisiae
US6001620A (en) Human lysophosphatidic acid acyltransferase
SCHMITZ et al. Molecular cloning of cDNA species for rat and mouse liver α-methylacyl-CoA racemases
US6852686B2 (en) Methods for ameliorating icthyosiform skin diseases
Selengut et al. MDP-1: A novel eukaryotic magnesium-dependent phosphatase
Han et al. Vacuole membrane topography of the DPP1-encoded diacylglycerol pyrophosphate phosphatase catalytic site from Saccharomyces cerevisiae
US20010041356A1 (en) Novel subunits of NADH dehydrogenase
WO2000078937A1 (fr) Procedes d'amelioration du traitement des maladies de la peau du type ichtyoses

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ CZ DE DE DK DK DM DZ EE EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP