WO2000069904A1 - LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES - Google Patents

LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES Download PDF

Info

Publication number
WO2000069904A1
WO2000069904A1 PCT/AU2000/000437 AU0000437W WO0069904A1 WO 2000069904 A1 WO2000069904 A1 WO 2000069904A1 AU 0000437 W AU0000437 W AU 0000437W WO 0069904 A1 WO0069904 A1 WO 0069904A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
isolated
seq
intracellulans
lawsonia
Prior art date
Application number
PCT/AU2000/000437
Other languages
English (en)
French (fr)
Inventor
Michael Panaccio
Everett Lee Rosey
Meri Sinistaj
Detlef Hasse
Jim Parsons
Robert Gerard Ankenbauer
Original Assignee
Pfizer Products Inc
Agriculture Victoria Services Pty Ltd
Australian Pork Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pfizer Products Inc, Agriculture Victoria Services Pty Ltd, Australian Pork Limited filed Critical Pfizer Products Inc
Priority to JP2000618320A priority Critical patent/JP2003516113A/ja
Priority to AU43859/00A priority patent/AU771376B2/en
Priority to MXPA01011669A priority patent/MXPA01011669A/es
Priority to EP00924976A priority patent/EP1181315A4/en
Priority to NZ515331A priority patent/NZ515331A/en
Priority to CA002372098A priority patent/CA2372098A1/en
Priority to BR0011294-1A priority patent/BR0011294A/pt
Publication of WO2000069904A1 publication Critical patent/WO2000069904A1/en
Priority to US11/386,138 priority patent/US20060159707A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/205—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates generally to therapeutic compositions for the treatment and/or prophylaxis of intestinal disease conditions in animals and birds caused or exacerbated by Lawsonia intracellularls or similar or otherwise related microorganism
  • the present invention provides a novel gene derived from Lawsonia intracellularls which encodes an immunogenic peptide, polypeptide or protein
  • polypeptide described herein designated as FlgE, or a peptide homologue, analogue or derivative thereof is particularly useful as an antigen in vaccine preparation for conferring humoral immunity against Lawsonia intracellularls and related pathogens in animal hosts
  • the present invention is also directed to methods for the treatment and/or prophylaxis of such intestinal disease conditions and to diagnostic agents and
  • L intracellularls includes all microorganisms similar to or otherwise related to this microorganism, as 25 described by Stills (1991 ) or Jones et al (1997) or Lawson et al (1993) or McO ⁇ st et al (1995)
  • the word "flgE', or the term “flgE gene” shall be taken to refer to the gene encoding the flagellar hook protein of the present invention It shall also be 30 understood that the term “FlgE polypeptide” refers to the flagellar hook protein of the invention
  • the term “derived from” shall be taken to indicate that a specified product in particular a macromolecule such as a peptide polypeptide, protein gene or nucleic acid molecule, antibody molecule Ig fraction or other macromolecule or a biological sample comprising said macromolecule may be obtained from a particular source, organism, tissue, organ or cell albeit not necessarily directly from that source organism, tissue, organ or cell
  • the meat-producing sector of the agricultural industry is dependant upon the health of its livestock and there is a need to maintain disease-free livestock for human consumption
  • the industry is subject to rapid economic downturn in response to disease conditions adversely affecting livestock and the quality of meat products derived therefrom, including those diseases which may potentially be transmitted to humans It is important therefore to have well defined treatments and prophylactic and diagnostic procedures available to deal with infections or potential infections in livestock animals and humans
  • porcine proliferative enteropathy PPE
  • porcine intestinal adenomatosis PPA
  • necrotic enteritis Rost and Lawson, 1976
  • proliferative haemorrhagic enteropathy Love and Love 1977
  • regional ileitis Jonsson and Martinsson, 1976
  • haemorrhagic bowel syndrome O'Neil, 1970
  • porcine proliferative enteritis and Campylobacter spp - induced enteritis (Straw, 1990)
  • PPE proliferative haemorrhagic enteropathy
  • the causative organism of PPE is a Campy/o-bacter-like organism referred to herein as "Lawsonia intracellulans" (McO ⁇ st et al 1995)
  • the organism has also been previously referred to as Heal symbiont intracellulans (Stills, 1991)
  • PPE-like diseases in pigs may also be caused by other pathogens such as various species of Campylobacter (Gebhart et al, 1983)
  • Lawsonia intracellulans is an intracellular, possibly obligate intracellular, bacterium It can only be cultured in vitro with tissue culture cells (Jones et al , 1997, Lawson et al , 1993, McO ⁇ st et al, 1995, International Patent Application No PCT/US96/09576)
  • L intracellulans is located in the cytoplasm of the villus cells and intestinal crypt cells of infected animals
  • Pigs suffering from PPE are characterised by irregularities in the villus cells and intestinal crypt structure with epithelial cell dysplasia wherein crypt abscesses form as the vil and intestinal crypts become branched and fill with inflammatory cells
  • PPE is a significant cost component associated with the pig industry, especially in terms of stock losses, medication costs, reduced growth rates of pigs and increased feed costs PPE also contributes to downstream indirect costs in, for example additional labour costs and environmental costs in dealing with antibiotic residue contamination, and in control measures to prevent the organism from being passed on or carried to other animals or humans
  • the most effective vaccine preparations are generally comprised of a highly antigenic component, such as a peptide, polypeptide, protein or other macromolecule which is derived from the pathogenic organ' r , against which the vaccine is directed, wherein said antigenic component produces little or no contraindications when administered to a susceptible host animal, and produces little or no antigenic cross-reactivity with desirable organisms, such as non-pathogenic organisms that are a part of the normal flora of the intestinal tract or other tissues of said host animal
  • a highly antigenic component such as a peptide, polypeptide, protein or other macromolecule which is derived from the pathogenic organ' r , against which the vaccine is directed
  • said antigenic component produces little or no contraindications when administered to a susceptible host animal, and produces little or no antigenic cross-reactivity with desirable organisms, such as non-pathogenic organisms that are a part of the normal flora of the intestinal tract or other tissues of said host animal
  • an effective vaccine preparation must be immunogenic, specific and
  • One aspect of the present invention is directed to an isolated or recombinant immunogenic polypeptide which comprises mimics or cross-reacts with a B-cell or T- cell epitope of the FlgE polypeptide derived from Lawsonia spp
  • the isolated or recombinant immunogenic polypeptide is selected from the group consisting of the following
  • a peptide, o gopeptide or polypeptide which comprises an ammo acid sequence which has at least about 60% sequence identity overall to the ammo acid sequence set forth in SEQ ID NO-1 ,
  • a peptide, ohgopeptide or polypeptide which comprises at least about 5 contiguous ammo acids of the am o acid sequence defined by SEQ ID NO 1 , or (in) a homologue analogue or derivative of (i) or (n) which mimics a B-cell or
  • the polypeptide comprises or consists essentially of the ammo acid sequence of SEQ ID NO 1
  • a further aspect of the present invention provides a vaccine composition for the prophylaxis or treatment of infection in an animal, such as a pig or bird, by L intracellulans or a similar or otherwise related microorganism, said vaccine composition comprising an immunologically effective amount of an immunogenic component which comprises an isolated or recombinant polypeptide having at least about 60% overall sequence identity to the ammo acid sequence set forth in SEQ ID NO 1 , or comprising at least 5 contiguous ammo acids derived from SEQ ID NO 1 or an immunogenic homologue, analogue or derivative thereof which is immunologically cross-reactive with Lawsonia intracellulans and one or more carriers, diluents and/or adjuvants suitable for veterinary or pharmaceutical use
  • the polypeptide of the vaccine composition comprises or consists essentially of the ammo acid sequence of SEQ ID NO' 1
  • a further aspect of the invention extends to an immunologically interactive molecule, such as an antibody or antibody fragment, which is capable of binding to the immunogenic polypeptide of the invention
  • a further aspect of the invention provides a method of diagnosing infection of an animal by Lawsonia intracellulans or a related microorganism, said method comprising the steps of contacting a biological sample derived from said animal with an immunologically interactive molecule of the present invention for a time and under conditions sufficient for a complex, such as an antigen.antibody complex, to form, and then detecting said complex formation.
  • a further aspect of the present invention contemplates a method of determining whether or not an animal has suffered from a past infection, or is currently infected, by Lawsonia intracellulans or a related microorganism, said method comprising contacting a tissue or fluid sample, such as blood or serum derived from said animal, with the immunogenic polypeptide of the invention for a time and under conditions sufficient for a complex, such as an antigen.antibody complex, to form, and then detecting said complex formation.
  • a tissue or fluid sample such as blood or serum derived from said animal
  • a further aspect of the present invention provides an isolated nucleic acid molecule which comprises a sequence of nucleotides that encodes, or is complementary to a nucleic acid molecule that encodes, a peptide, ohgopeptide or polypeptide selected from the following:
  • the isolated nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO 2, or a degenerate variant thereof, has at least about 60% sequence identity to all or a part thereof
  • a still further aspect of the invention provides a diagnostic method of detecting Lawsonia intracellulans or related microorganism in a biological sample derived from an animal subject, said method comprising the steps of hybridising one or more polynucleotide or ohgonucleotide probes or primers derived from the nucleotide sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereof or a homologue, analogue or derivative thereof, to said sample, and then detecting said hybridisation using a detection means
  • the detection means according to this aspect of the invention is any nucleic acid-based hybridisation or amplification reaction
  • a further aspect of the invention provides an isolated probe or primer derived from SEQ ID NO 2 or a complementary nucleotide sequence thereto
  • Figure 1 is a schematic representation comparing the ammo acid secjence of Lawsonia intracellulans (L int) flagellar hook protein FlgE to the ammo acid sequences of flagellar hook proteins derived from Treponema phagedenis (T phage), Treponema pallidum (T palli), Salmonella typhimunum (S typhi), Esche ⁇ chia coll (E co ), Aquifex aeolicus (A aeo), Vibrio parahaemolyticus (V parah) and Borrelia burgdorfen (B burgd) Gaps have been introduced to optimise the alignment Positions containing identical ammo acid residues with respect to the FlgE polypeptide of Lawsonia intracellulans (SEQ ID NO 1) are shaded Residues that are identical in all eight sequences appear in boldface DETAILED DESCRIPTION OF THE INVENTION
  • one aspect of the present invention is directed to an isolated or recombinant immunogenic polypeptide which comprises mimics or cross-reacts with a B-cell or T-cell epitope of the FlgE polypeptide derived from Lawsonia spp
  • Epitopes of Lawsonia spp may be B cell epitopes or T-cell epitopes It is well-known that antibody-binding sites (B-cell epitopes) involve linear as well as conformational epitopes (van Regenmortel, 1992) B-cell epitopes are predominantly conformational In contrast, T-cells recognize predominantly linear epitope sequences in combination with MHC class II molecules
  • a precise identification and careful selection of epitopes of Lawsonia spp facilitates the development of diagnostic reagents and vaccine compositions for the effective treatment or prophylaxis of Lawsonia infections
  • Epitope identification and characterization i e , determination of the molecular weight, ammo acid sequence, and structure of epitopes of Lawsonia spp
  • Degrading and denaturing of the epitope molecule must be avoided in order to conserve the three-dimensional structure, because the antigen-antibody reaction will be diminished i.
  • the secondary structure of the epitope is altered significantly In practice, the characterisation and isolation of linear non-conformational epitopes is easier, because any immunoreactive regions are contained within a single peptide fragment or single ammo acid sequence which is capable of being purified under a range of conditions
  • Both non-conformational and conformational epitopes may be identified by virtue of their ability to bind detectable amounts of antibodies (such as IgM or IgG) from sera of animals immunised against or infected with Lawsonia spp and, in particular L intracellula ⁇ s or an isolated polypeptide derived therefrom or alternatively, by virtue of their ability to bind detectable amounts of antibodies in a purified Ig fraction derived from such sera
  • the antibodies may be derived from or contained within pools of polyclonal sera, or may be monoclonal antibodies
  • Antibody fragments or recombinant antibodies, such as those expressed on the surface of a bacte ⁇ ophage or virus particle, such as in a phage display library may also be employed
  • T-cell epitopes are determined by analysing the ability of the epitope peptides to induce the proliferation of peripheral blood lymphocytes or T-cell clones
  • the identification of T-cell epitopes is accomplished using a variety of methods as known in the art, including the use of whole and fragmented native or recombinant antigenic protein, as well as the more commonly employed "overlapping peptide" method In the latter method, overlapping peptides which span the entire sequence of a polypeptide derived from Lawsonia spp are synthesized and tested for their capacity to stimulate T-cell cytotoxic or proliferative responses in vitro
  • Structure determination of both conformational non-linear and non-conformational linear epitopes may be performed by nuclear magnetic resonance spectroscopy (NMR) and X-ray crystallographic analysis
  • NMR nuclear magnetic resonance spectroscopy
  • X-ray crystallographic analysis requires the protein-antibody complex to be crystallized, whereas NMR allows analysis of the complex in a liquid state NMR measures the amount of ammo acids as well as the neighbourhood of protons of different ammo acid residues, wherein the alternating effect of two protons along the carbon backbone is characteristic of a particular epitope
  • the Western blot Peptides may be generated from a complete Lawsonia spp polypeptide by digestion with site-specific proteases, such as trypsm or chymotrypsin, and the peptides generated thereby can be separated using standard electrophoretic or chromatographic procedures
  • site-specific proteases such as trypsm or chymotrypsin
  • the peptides generated thereby can be separated using standard electrophoretic or chromatographic procedures
  • the peptides can be transferred to immobilizing nylon or nitrocellulose membranes and incubated with sera raised against the intact polypeptides Peptides that comprise immunogenic regions
  • B-cell or T-cell epitopes are bound by the antibodies in the sera and the bound antibodies may be detected using secondary antibodies, such as anti-lgG antibodies, that have been labelled radioactively or enzymatically
  • the epitopes may then be characterised by purification based upon their size, charge or ability to bind specifically to antibodies against the intact polypeptide, using one or more techniques, such as size-exclusion chromatography, ion-exchange chromatography, affinity chromatography or ELISA among others After purification of the epitope, only one band or spot should be detectable with gel electrophoresis
  • the N-termmal or total sequencing of the peptide offers the possibility to compare the peptide with known proteins in databases
  • AMPHI The AMPHI algorithm (Margaht et al ,1987), which is based on the periodicity of T cell epitopes, has been widely used for the prediction of T-cell antigenic sites from sequence information alone Essentially, AMPHI describes a common structural pattern of MHC binding motifs, since MHC binding motifs (i e , patterns of ammo acids that appear to be common to most of the peptides that bind to a specific MHC molecule) appear to exhibit the same periodicity as an alpha helix Identification of T- cell epitopes by locating MHC binding motifs in an ammo acid sequence provides an effective means of identifying immunogenic epitopes in diagnostic assays
  • the EpiMer algorithm locates clustered MHC binding motifs in ammo acid sequences of proteins, based upon the correlation between MHC binding motif-dense regions and peptides that may have the capacity to bind to a variety of MHC molecules (promiscuous or multi-determinant binders) and to stimulate an immune response in these various MHC contexts as well (promiscuous or multi-determinant epitopes)
  • the EpiMer algorithm uses a library of MHC binding motifs for multiple class I and class II HLA alleles to predict antigenic sites within a protein that have the potential to induce an immune response in subjects with a variety of genetic backgrounds
  • EpiMer locates matches to each MHC-binding motif within the primary sequence of a given protein antigen The relative density of these motif matches is determined along the length of the antigen, resulting in the generation of a motif-density histogram
  • the algorithm identifies protein regions in this
  • Recombinant methods offer the opportunity to obtain well characterized epitopes of high purity for the production of diagnostic reagents and epitope-specific vaccine formulations (Mohapatra etal , 1995) Based upon the ammo acid sequence of a linear epitope and identification of the corresponding nucleotide sequence encoding same polymerase chain reaction (PCR) may be performed to amplify the epitope-encodmg region from cDNA After cloning and expression in a suitable vector/host system a large amount of epitopes of high purity can be extracted Accordingly the present invention clearly extends to both isolated non-recombmant polypeptides and recombinant polypeptides in an impure or isolated form
  • polypeptide as used herein shall be taken to refer to any polymer consisting of am o acids linked by covalent bonds and includes within its scope full-length proteins and parts or fragments thereof such as for example ohgopeptides and short peptide sequences consisting of at least about 5 ammo acid residues preferably at least about 10 ammo acid residues, more preferably at least about 12 ammo acid residues, and even more preferably at least about 15 ammo acid residues Also included within the scope of the definition of a "polypeptide” are ammo acid sequence variants, containing one or more preferably conservative ammo acid substitutions, deletions, or insertions, which do not alter at least one essential property of said polypeptide such as, for example, its imnnunogenicity, use as a diagnostic reagent, or effectiveness as a peptide vaccine against Lawsonia spp, amongst others Accordingly, a polypeptide may be isolated from a source in nature, or chemically synthesized Furthermore,
  • the present invention is not limited by the source of the subject immunogen and clearly extends to isolated and recombinant polypeptides which are derived from a natural or a non-natural occurring source
  • recombinant polypeptide as used herein shall be taken to refer to a polypeptide which is produced in vitro or in a host cell by the expression of a genetic sequence encoding said polypeptide, which genetic sequence is under the control of a suitable promoter, wherein a genetic manipulation has been performed in order to achieve said expression
  • the term “recombinant polypeptide” clearly encompasses polypeptides produced by the expression of genetic sequences contained in viral vectors, cosmids or plasmids that have been introduced into prokaryotic or eukaryotic cells, tissues or organs Genetic manipulations which may be used in this context will be known to those skilled in the art and include, but are not limited to, nucleic acid isolation, restriction endonuclease digestion, exonuclease digestion, end-filling using the Klenow fragment of E coli DNA polymerase I or T4 DNA polymerase enzymes, blunt-ending of DNA molecules using T4 DNA polymerase or Exolll enzymes, site-directed
  • the present invention extends to a recombinant polypeptide or a derivative, homologue or analogue thereof as present in a virus particle, or as produced in prokaryotic or eukaryotic host cell, or in a virus or cell culture thereof
  • the present invention also extends to a recombinant polypeptide according to any of the foregoing embodiments which is produced in a bacterial cell belonging to the genus Lawsonia, in particular a cell of L intracellulans, or a culture thereof
  • isolated polypeptide refers to a polypeptide of the present invention which has been purified to some extent, preferably to at least about 20% by weight of protein, preferably to at least about 50% by weight of protein, more preferably to at least about 60% by weight of protein, still more preferably to at least about 70% by weight of protein and even more preferably to at least about 80% by weight of protein or greater, from its natural source or, in the case of non-naturally-occur ⁇ ng polypeptides, from the culture medium or cellular environment in which it was produced Such isolation may be performed to improve the immunogenicity of the polypeptide of the present invention, or to improve the specificity of the immune response against that polypeptide, or to remove toxic or undesirable contaminants therefrom
  • the necessary or required degree of purity of an isolated polypeptide will vary depending upon the purpose for which the polypeptide is intended, and for many applications it will be sufficient for the polypeptide preparation to contain no contaminants which would reduce the immunogenicity of the polypeptide when administered to a host animal, in particular a porcine or
  • the purity of an isolated polypeptide of the present invention may be determined by any means known to those skilled in the art, including the degree of homogeneity of a protein preparation as assessed by SDS/polyacrylamide gel electrophoresis, 2- dimensional electrophoresis or ammo acid composition analysis or sequence analysis
  • polypeptide of the present invention will be substantially homogeneous or substantially free of nonspecific proteins, as assessed by SDS/polyacrylamide gel electrophoresis, 2-d ⁇ mens ⁇ onal electrophoresis, or am o acid composition analysis or sequence analysis
  • polypeptide of the present invention can be purified for use as a component of a vaccine composition by any one or a combination of methods known to those of ordinary skill in the art, including, for example, reverse phase chromatography, HPLC, ion-exchange chromatography, and affinity chromatography, among others
  • the isolated or recombinant polypeptide of the invention functions as a flagellar hook protein in a bacterium such as, for example, L intracellulans, or is derived from a flagellar hook protein or, alternatively, is immunologically cross-reactive with the L intracellulans flagellar hook protein, FlgE, of the present invention
  • the isolated or recombinant polypeptide of the invention is derived from Lawsonia spp or other pathogenic agent associated with the onset and/or development of PPE and more preferably, the subject polypeptide is derived from Lawsonia intracellulans
  • a B-cell or T-cell epitope of a FlgE polypeptide or a derivative homologue or analogue thereof may comprise any combination of the following
  • immunogenic polypeptides or derivatives, homologues or analogues thereof comprising the same, or substantially the same primary ammo acid sequence are hereinafter defined as "immunogens which comprise a B-cell or T-cell epitope" or similar term
  • Immunogenic polypeptides or derivatives, homologues, or analogues thereof comprising different primary ammo acid sequences may comprise immunologically identical immunogens, because they possess conformational B-cell or T-cell epitopes ihat are recognised by the immune system of a host species to be dentical
  • immunogenic polypeptides or derivatives, homologues or analogues thereof are hereinafter defined as "immunogens which mimic or cross-react with a B-cell or T-cell epitope", or similar term
  • the present invention extends to an immunogen which comprises, mimics, or cross-reacts with a B-cell or T-cell epitope of an isolated or recombinant polypeptide according to any one of the foregoing embodiments or a derivative, homologue or analogue thereof
  • the present invention provides an immunogen which comprises, mimics or cross-reacts with a B-cell or T- cell epitope of an isolated or recombinant polypeptide which in its native form is obtainable from a species of Lawsonia such as, but not limited to L intracellulans and which polypeptide preferably functions as a flagellar hook protein
  • such immunogenic polypeptides will not comprise a primary ammo acid sequence which is highly-conserved between L intracellulans and another non- pathogenic microorganism which is normally resident in the gut or other organ of an animal in particular a porcine or avian animal
  • a primary ammo acid sequence which is highly-conserved between L intracellulans and another non- pathogenic microorganism which is normally resident in the gut or other organ of an animal in particular a porcine or avian animal
  • the present inventors have shown that the N-termmal ammo acid sequence of the FlgE polypeptide derived from L intracellulans and the 5'-reg ⁇ on of the corresponding flgE gene are less highly conserved among homologous genes and polypeptides derived from other species, compared to the C-termmal region of the L intracellulans FlgE polypeptide and the 3'-reg ⁇ on of the flgE gene Accordingly, the N- termmal region of the FlgE polypeptide is a particularly preferred immunogen for use in vaccination protocols and as diagnostic reagents in respect of L intracellulans Similarly the 5 -end of the flgE gene is particularly preferred for use as a diagnostic reagent for L intracellulans
  • ammo acids not corresponding to the original protein sequence can be added to the ammo or carboxyl terminus of the polypeptide.
  • extra amino acids are useful for coupling the polypeptide to another peptide or polypeptide, to a large carrier protein or to a solid support
  • Ammo acids that are useful for these purposes include but are not limited to tyrosine, lysine, glutamic acid, aspartic acid, cysteine and derivatives thereof
  • Additional protein modification techniques can be used such as, e g , NH 2 -acetylat ⁇ on or COOH-termmal amidation, to provide additional means for coupling the polypeptide to another polypeptide, protein, or peptide molecule, or to a solid support Procedures for coupling polypeptides to each other, or to carrier X -
  • protems or solid supports are well known in the art Polypeptides containing the above-mentioned extra ammo acid residues at either the carboxyl- or ammo-termini and either uncoupled or coupled to a carrier or solid support are consequently within the scope of the present invention
  • polypeptide can be immobilised to a polymeric carrier or support material
  • the immunogenicity of a polypeptide of the present invention may be improved using molecular biology techniques to produce a fusion protein containing one or more polypeptides of the present invention fused to a carrier molecules such as a highly immunogenic protein
  • a fusion protein containing a polypeptide of the present invention fused to the highly immunogenic B subunit of cholera toxin can be used to increase the immune response to the polypeptide
  • the present invention also contemplates fusion proteins comprising a cytokine, such as an interleukin, fused to the subject polypeptide of the present invention, and genes encoding same
  • the polypeptide of the present invention when administered to a mammal, induces an immune response in said mammal.
  • the polypeptide of the present invention when administered to a mammal, in particular a porcine animal (e g , a pig) induces a protective immune response against Lawsonia spp , and preferably against L intracellulans, therein
  • the phrase "induct' ⁇ n of a protecti a immune response" refers to the ability of the administered polypeptide of the present invention to prevent or detectably slow the onset, development, or progression of symptoms associated with Lawsonia infection, and preferably, to prevent or detectably slow the onset, development, or progression of symptoms associated with
  • the immunogenic polypeptide of the invention comprises an am o acid sequence which is substantially the same as the ammo acid sequence set forth in SEQ ID NO 1 or is at least about 60% identical overall to SEQ ID NO 1 or is at least about 75% identical to at least 8 contiguous am o acids of SEQ ID NO 1
  • the immunogenic polypeptide of the present invention consists essentially of the ammo acid sequence of SEQ ID NO 1 or the ammo acid sequence 5 encoded by the FlgE-encodmg nucleotide sequence present in pALK11 (ATCC 207156)
  • ammo acid sequence set forth in SEQ ID NO 1 represents the ammo acid sequence of the FlgE polypeptide encoded by the Lawsonia 10 intracellulans flgE gene
  • the nucleotide sequence of the L intracellulans flgE gene is set forth in SEQ ID NO 2
  • the percentage am o acid sequence identity to SEQ ID NO 1 is at least about 70%, more preferably at least about 80%, even more preferably at least about 15 90%, and still even more preferably at least about 95%
  • the isolated or recombinant immunogenic polypeptide of the invention comprises at least about 10 contiguous ammo acids derived from SEQ ID NO 1 , more preferably at least about 20 contiguous ammo acid residues derived from SEQ ID NO 1 , even more preferably at least about 30 contiguous am o acid residues derived from SEQ ID NO 1 and still even more preferably at least about 40 contiguous ammo acid residues derived from SEQ ID NO 1
  • the present invention further encompasses homologues, analogues and derivatives of a polypeptide comprising the ammo acid sequence set forth in SEQ ID NO.1
  • “Homologues” of a polypeptide are those polypeptides which contain ammo acid substitutions, deletions and/or additions relative to the polypeptide without altering one or more of its properties, such as its immunogenicity, biological activity or catalytic activity
  • am o acids can be replaced by other ammo acids having similar properties such as, for example, hydrophobicity, hydrophihcity, hydrophobic moment, antigenicity, propensity to form or break ⁇ -hehcal structures of ⁇ -sheet structures, and so on
  • Substitutional variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place.
  • Ammo acid substitutions are typically of single residues, but may be clustered depending upon functional constraints placed upon the polypeptide, insertions will usually be of the order of about 1-10 ammo acid residues and deletions will range from about 1-20 residues
  • ammo acid substitutions will comprise conservative ammo acid substitutions, such as those described supra
  • Insertional ammo acid sequence variants are those in which one or more ammo acid residues are introduced into a predetermined site in the protein Insertions can comprise ammo-terminal and/or carboxyl terminal fusions as well as mtra-sequence insertions of single or multiple ammo acids.
  • Insertions within the amino acid sequence will be smaller than ammo or carboxyl terminal fusions, of the order of about 1 to 4 residues.
  • Deletional variants are characterised by the removal of one or more amino acids from the sequence.
  • Ammo acid variants of the polypeptide of the present invention may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulations.
  • the manipulation of DNA sequences to produce variant proteins which manifest as substitutional, insertional or deletional variants are well known in the art.
  • techniques for making substitution mutations at predetermined sites in DNA having known sequence are well known to those skilled in the art, such as by M13 mutagenesis or other site- directed mutagenesis protocol.
  • Analogues are defined as peptides, ohgopeptides and polypeptides which are functionally equivalent to the peptides of the present invention but which contain certain non-naturally occurring or modified ammo acid residues as will be known to those skilled in the art.
  • an "analogue” as defined herein need not comprise an amino acid sequence which is similar to the amino aci sequence set forth herein such as, for example, peptides, ohgopeptides and polypeptides which are derived from computational predictions or empirical data revealing the secondary, tertiary or quaternary structure of the polypeptide of the present invention, and which therefore do not comprise the same primary amino acid sequence of said polypeptide, yet nevertheless mimic or cross-react with B-cell or T-cell epitope of Lawsonia spp. and preferably, mimic or cross-react with B-cell or T-cell epitope of Lawsonia intracellulans.
  • mimotopes polypeptide analogues that cross-react with a B-cell or T-cell epitope of the Lawsonia polypeptide of the invention but however comprise a different am o acid sequence to said epitope
  • the antibodies used to identify such mimotopes may be polyclonal or monoclonal or recombinant antibodies, in crude or purified form
  • Mimotopes of a T-cell epitope may then be assayed further for their ability to stimulate T-cell cytotoxic or proliferative responses in vitro
  • Mimotopes are particularly useful as analogues of non- linear (i e conformational) epitopes of the polypeptide of the present invention because conformational epitopes are generally formed from non-contiguous regions in a polypeptide
  • polypeptide analogues can result in polypeptides with increased immunogenic and/or antigenic activity, that are less sensitive to enzymatic degradation, and which are more selective
  • a suitable prohne analogue is 2- aminocyclopentane carboxylic acid ( ⁇ AC 5 c) which has been shown to increase the immunogenic activity of a native polypeptide more than 20 times (Mierke et al, 1990, Portoghese et al, 1990, Goodman et al, 1987)
  • “Derivatives” of a polypeptide described herein are those peptides, ohgopeptides and polypeptides which comprise at least about five contiguous ammo acid residues of the ammo acid sequence set forth in SEQ ID NO 1
  • a “derivative” may further comprise additional naturally-occurring, altered glycosylated, acylated or non-naturally occurring ammo acid residues compared to the ammo acid sequence set forth in SEQ ID NO 1
  • a derivative may comprise one or more non-ammo acid substituents such as, for example, a reporter molecule or other ligand, covalently or non-covalently bound to the ammo acid sequence such as, for example, a reporter molecule which is bound thereto to facilitate its detection
  • recombinant or synthetic mutants and derivatives of the peptide immunogens of the present invention include those incorporating single or multiple substitutions, deletions and/or additions therein such as carbohydrates hpids and/or proteins or polypeptides Naturally occurring or altered glycosylated or acylated forms of the subject peptides are particularly contemplated by the present invention Additionally, homopolymers or heteropolymers comprising one or more copies of the subject peptide listed in SEQ ID NO 1 , or one or more derivatives, homologues or analogues thereof, are within the scope of the invention
  • homologues, analogues and derivatives of the polypeptide of the invention are "immunogenic", defined hereinafter as the ability of said polypeptide, or a derivative, homologue or analogue thereof, to elicit B cell and/or T cell responses in the host, in response to immunization
  • Preferred homologues, analogues and derivatives of the ammo acid sequence set forth in SEQ ID NO 1 include those ammo acid variants that function as B cell or T cell epitopes of said ammo acid sequence which are capable of mediating an immune response such as, for example, mimotopes of the immunogenic polypeptide described herein which have been produced by synthetic means, such as by Fmoc chemistry
  • the only requirement of such molecules is that they cross-react immunologically with a polypeptide which comprises the ammo acid sequence set forth in SEQ ID NO:1 or a derivative thereof which comprises at least 5 contiguous ammo acids in length of SEQ ID NO 1
  • such homologues, analogues and derivatives of the polypeptide of the invention molecules will be useful to prepare antibodies that cross-react with antibodies against said polypeptide and/or to elicit a protective immune response of similar specificity to that elicited by said polypeptide.
  • Such molecules will also be useful in diagnostic and other applications that are immunological in nature such as, for example, diagnostics which utilise one or more immunoassay formats (eg ELISA, RIA and the like)
  • the immunogen of the present invention or a derivative, homologue or analogue thereof is useful in vaccine compositions that protect an individual against infection by L intracellulans and/or as an antigen to elicit polyclonal or monoclonal antibody production and/or in the detection of antibodies against L intracellulans in infected animals particularly in porcine and avian animals
  • ammo acid sequence set forth in SEQ ID NO 1 is particularly unique as compared to other immunogenic ammo acid sequences, including those of the flagellar hook proteins derived from other bacteria Accordingly, peptides ohgopeptides and polypeptides which comprise unique epitope regions of SEQ ID NO 1 as described in Figure 1 will have improved specificity compared to other regions of the Lawsonia spp FlgE molecule The particular advantages of such peptides will be immediately apparent to those skilled in the production of vaccine compositions, where specificity against a pathogen of interest is an important consideration
  • the unique regions of the L intracellulans FlgE polypeptide are promising antigenic peptides for the formulation of Lawso ⁇ /a-specific vaccines and diagnostics for the specific detection of Lawsonia spp in biological samples
  • a second aspect of the present invention provides a vaccine composition for the prophylaxis or treatment of infection in a mammal or bird by L intracellulans or similar or otherwise related microorganism, said vaccine composition comprising
  • an immunogenic component which comprises an isolated or recombinant polypeptide having at least about 60% overall amino acid sequ°nce identity to the ammo acid sequence set forth in SEQ ID NO 1 and/or comprising at least
  • immunogenic component refers to a peptide, polypeptide 2 -
  • the vaccine ⁇ composition clearly encompasses those vaccine compositions which comprise attenuated, killed or non-pathogenic isolates or forms of L intracellulans or related microorganisms thereto which comprise or express said peptide, polypeptide or protein
  • ' protective immune response is meant that the immunogenic component elicits an immune response in the animal to which the vaccine composition is administered at the humoral and/or cellular level which is sufficient to prevent infection by Lawsonia intracellulans or a related microorganism thereto and/or which is sufficient to detectably reduce one or more symptoms or conditions, or to detectably slow the onset of one or more symptoms or conditions, associated with infection by Lawsonia intracellulans or a related microorganism thereto in an animal host, as compared to a control infected animal
  • effective amount of an immunogenic component present in the vaccine composition refers to that amount of said immunogenic component that is capable of inducing a protective immune response after a single complete dose has been administered, or after several divided doses have been administered
  • the polypeptide component of the subject vaccine composition comprises an ammo acid sequence which is both immunogenic and specific, by virtue of its immunologica- cross-reactivity with the causative agent of PP' 7 , Lawsonia intracellulans
  • polypeptide components may comprise an ammo acid sequence derived from SEQ ID NO 1 or a homologue, analogue or derivative of the ammo acid sequence set forth in SEQ ID NO 1 such as, for example, a mimotope of said sequence
  • immunogenic polypeptide or immunogenic homologue, analogue or derivative may be a naturally-occurring peptide, ohgopeptide or polypeptide in isolated or recombinant form according to any of the embodiments described supra or exemplified herein 2b
  • the immunogenic polypeptide or immunogenic homologue, analogue or derivative is derived from Lawsonia spp in particular L intracellulans or a microorganism that is related thereto
  • the immunogenic component has undergone at least one purification step or at least partial concentration from a cell culture comprising L intracellulans or a related microorganism thereto, or from a lysed preparation of L intracellulans cells or related microorganism, or from another culture in which the immunogenic component is recombinantly expressed
  • the purity of such a component which has the requisite immunogenic properties is preferably at least about 20% by weight of protein in a particular preparation, more preferably at least about 50%, even more preferably at least about 60%, still more preferably at least about 70% and even more preferably at least about 80% or greater
  • the immunogenic component of the vaccine of the present invention can comprise a single peptide, polypeptide or protein, or a range or combination of different peptides, polypeptides or proteins covering different or similar epitopes
  • a single polypeptide can be provided with multiple epitopes
  • the latter type of vaccine is referred to as a polyvalent vaccine
  • a multiple epitope includes two or more epitopes located within a peptide or polypeptide molecule
  • a particularly useful form of the vaccine is a recombinant vaccine produced, for example, in a vaccine vector, such as but not limited to a cell transfected with a vaccinia virus vector or a bacterial cell capable of expressing the immunogenic component
  • the present invention clearly extends to recombinant vaccine compositions in which the immunogenic component at least is contained within killed vaccine vectors 1 1
  • the immunogenic component of the vaccine is generally synthesized in a live vaccine vector which is killed prior to administration to an animal
  • the vaccine vector expressing the immunogenic component may be non- pathogenic or attenuated
  • Attenuated or non-pathogenic host cells include those cells which are not harmful to an animal to which the subject vaccine is administered
  • live vaccines can comprise an attenuated virus vector encoding the immunogenic component or a host cell comprising same, which is capable of replicating in an animal to which it is administered, and using host cell machinery to express the immunogenic componant albeit producing no adverse side-effects therein
  • Such vaccine vectors may colonise the gut or other organ of the vaccinated animal
  • live vaccine vectors are efficacious by virtue of their ability to continually express the immunogenic component in the host animal for a time and at a level sufficient to confer protective immunity against a pathogen which expresses an immunogenic equivalent of said immunogenic component
  • the present invention clearly encompasses the use of such attenuated or non-pathogenic vectors and live vaccine preparations
  • the vaccine vector may be a virus, bacterial cell or a eukaryotic cell such as an avian porcine or other mammalian cell or a yeast cell or a cell line such as COS, VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK) or MDCK cell lines
  • Suitable prokaryotic cells include Mycobactenum spp , Corynebactenum spp , Salmonella spp , Escherichia coli, Bacillus spp and Pseudomonas spp, amongst others Bacterial strains which are suitable for the present purpose are well-known in the relevant art (Ausubel et al, 1987, Sambrook et -8 -
  • Such cells and cell lines are capable of expression of a genetic sequence encoding a FlgE peptide, polypeptide or protein of the present invention from L intracellulans in a manner effective to induce a protective immune response in the animal
  • a non-pathogenic bacterium could be prepared containing a recombinant sequence capable of encoding a peptide, polypeptide or protein from L intracellulans
  • the recombinant sequence would be in the form of an expression vector under the control of a constitutive or mducible promoter
  • the bacterium would then be permitted to colonise suitable locations in a pig's gut and would be permitted to grow and produce the recombinant peptide, polypeptide or protein in amount sufficient to induce a protective immune response against L intracellulans
  • the vaccine can be a DNA or RNA vaccine comprising a DNA or RNA molecule encoding a peptide, polypeptide or protein of the present invention which is injected into muscular tissue or other suitable tissue in a pig under conditions sufficient to permit transient expression of said DNA or RNA to produce an amount of peptide, polypeptide or protein effective to induce a protective immune response
  • the DNA vaccine is in the form of a plasmid, in which the DNA is operably connected with a promoter region capable of expressing the nucleotide sequence encoding the immunogen in cells of the immunized animal
  • the immunogenic component in a suitable vector system
  • the immunogenic component can be expressed by
  • nucleic acid molecule comprising the coding region of the nucleotide sequence set forth in SEQ ID NO 2 or a protein-encoding homologue, analogue or derivative of SEQ ID NO 2 selected from the group consisting of
  • nucleotide sequences that hybridise under at least low stringency hybridisation, preferably under at least moderate stringency conditions, and even more preferably under at least high level stringency conditions to the complement of SEQ ID NO 2, and
  • nucleotide sequences that encode the ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or derivative thereof, including for example, a mimotope of the am o acid set forth in SEQ ID NO 1
  • a low stringency is defined herein as being a hybridisation and/or a wash carried out in 6xSSC buffer, 0 1 % (w/v) SDS at 28°C
  • a moderate stringency is defined herein as being a hybridisation and/or washing carried out in 2xSSC buffer, 0 1 % (w/v) SDS at a temperature in the range 20 45°C to 65°C
  • a high stringency is defined herein as being a hybridisation and/or wash carried out in 0 1xSSC buffer, 0 1% (w/v) SDS at a temperature of at least 65°C
  • the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the tem p erature of the
  • hybridisation and/or wash may vary depending upon the nature of the hybridisation membrane or the type of hybridisation probe used Conditions for hybridisations and washes are well understood by one normally skilled in the art For the purposes of clarification of the parameters affecting hybridisation between nucleic acid molecules,
  • nucleic acid molecule in an expressible format ' is a protein- encoding region of a nucleic acid molecule placed in operable connection with a promoter or other regulatory sequence capable of regulating expression in the vaccine vector system
  • promoter includes the transc ⁇ ptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence and additional regulatory elements (i e upstream activating sequences enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner
  • promoter is also used to describe a recombinant, synthetic or fusion molecule, or derivative which confers, activates or enhances the expression of a nucleic acid molecule to which it is operably connected, and which encodes the immunogenic polypeptide Preferred promoters can contain additional copies of one or more specific regulatory elements to further enhance expression and/or to alter the spatial expression and/or temporal expression of the said nucleic acid molecule
  • a nucleic acid molecule under the regulatory control of i e "in operable connection with” a promoter sequence means positioning the said molecule such that expression is controlled by the promoter sequence Promoters are generally, but not necessarily, positioned 5 (upstream) to the genes that they control In the construction of heterologous promoter/structural gene combinations it is generally preferred to position the p omoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, i e , the gene from which the promoter is derived
  • the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene As is known in the art, some variation in this distance can be accommodated without loss of promoter function Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, i e , the genes from which it is derived Again, as is - J
  • Typical promoters suitable for expression in bacterial cells such as E coli include, but are not limited to, the lacz promoter, temperature-sensitive ⁇ L or ⁇ R promoters, T7 promoter or the IPTG- mducible tac promoter
  • Typical promoters suitable for expression in bacterial cells such as E coli include, but are not limited to, the lacz promoter, temperature-sensitive ⁇ L or ⁇ R promoters, T7 promoter or the IPTG- mducible tac promoter
  • a number of other vector systems for expressing the nucleic acid molecule of the invention in E coli are well-known in the art and are described, for example, in Ausubel et al (1987) or Sambrook et al (1989) Numerous plasmids with suitable promoter sequences for expression in bacteria and efficient ⁇ bosome binding sites have been described, such as for example, pKC30 ( ⁇ L Shimatake and Rosenberg, 1981), pKK173-3 (tac Amann and Brosius 1985
  • Means for introducing the isolated nucleic acid molecule or a genetic construct comprising same into a cell for expression of the immunogenic component of the vaccine composition are well-known to those skilled in the art
  • the technique used for a given organism depends on the known successful techniques
  • Means for introducing recombinant DNA into animal cells include microinjection, transfection mediated by DEAE-dextran, t r ansfect ⁇ on mediated by posomes such as by using hpofectamine (Gibco, MD, USA) and/or cellfectm (Gibco, MD, USA), PEG-mediated DNA uptake, electroporation and microparticle bombardment such as by using DNA-coated tungsten or gold particles (Agracetus Ine , Wl, USA) amongst others
  • the immunogenic component of a vaccine composition as contemplated herein exhibits excellent therapeutic activity, for example, in the treatment and/or prophylaxis of PPE when administered in an amount which depends on the particular case
  • from about 0 5 ⁇ g to about 20 mg may be administered, preferably from about 1 ug to about 10 mg more preferably from about 10 ug to about 5 mg and most preferably from about 50 ⁇ g to about 1 mg equivalent of the immunogenic component in a volume of about 1 ml to about 5ml
  • recombinant peptide molecules from about 0 5 ⁇ g to about 20 mg may be administered, preferably from about 1 ug to about 10 mg more preferably from about 10 ug to about 5 mg and most preferably from about 50 ⁇ g to about 1 mg equivalent of the immunogenic component in a volume of about 1 ml to about 5ml
  • DNA vaccines a preferred amount is from about 0 1 ⁇ g/ml to about 5 mg/ml in a volume of about 1 to about 5 ml
  • the DNA can be present in "naked” form or it can be administered together with an agent facilitating cellular uptake (e g , in posomes or cationic hpids)
  • agent facilitating cellular uptake e g , in posomes or cationic hpids
  • the important feature is to administer sufficient immunogen to induce a protective immune response
  • the above amounts can be administered as stated or calculated per kilogram of body weight Dosage regime can be adjusted to provide the optimum therapeutic response For example, several divided doses can be administered or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation Booster administration may also be required
  • the vaccine of the present invention can further comprise one or more additional immunomodulatory components such as, for example, an adjuvant or cytokine molecule, amongst others, that is capable of increasing the immune response against the immunogenic component
  • additional immunomodulatory components such as, for example, an adjuvant or cytokine molecule, amongst others, that is capable of increasing the immune response against the immunogenic component
  • adjuvants include the RIBI adjuvant system (Ribi Ine , Hamilton, MT, USA), alum, mineral gels such as aluminium hydroxide gel, oil-m-water emulsions, water-m-oil emulsions such as, for example, Block co-polymer (CytRx, Atlanta GA, USA),QS-21 (Cambridge Biotech Ine , Cambridge MA, USA), SAF-M (Chiron, Emeryville CA, USA), AMPHIGEN ® adjuvant, Freund's complete adjuvant, Freund's incomplete adjuvant, and Saponm, QuilA
  • the vaccine composition can be administered in a convenient manner such as by oral, intravenous (where water soluble), intramuscular, subcutaneous, mtranasal, mtradermal or suppository routes or by implantation (eg , using slow release 1 -3
  • the immunogenic component may be required to be coated in a material to protect it from the action of enzymes, acids and other natural conditions which may inactivate it such as those in the digestive tract
  • the vaccine composition may also be administered parenterally or intrape ⁇ toneally Dispersions can also be prepared in glycerol, liquid polyethylene glycois, and mixtures thereof or in oils Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms Alternatively, the vaccine composition can be stored in lyophilised form to be rehydrated with ar appropriate vehicle or carrier prior to use
  • compositions suitable for mjectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile mjectable solutions or dispersion
  • sterile aqueous solutions where water soluble
  • dispersions sterile powders for the extemporaneous preparation of sterile mjectable solutions or dispersion
  • the form must be fluid to the extent that easy sy ⁇ ngabihty exists, unless the pharmaceutical form is a solid or semi-solid such as when slow release technology is employed In any event, it must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms
  • the carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils
  • the proper fluidity can be maintained, fo r example, by the use of a coating such as lecithin, by the mai'.tenance of the required particle size in the case of dispersion and by the use of surfactants
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents such as, for example,, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like
  • it will be preferable to include isotonic agents such as, for example,, sugars or sodium chloride
  • Prolonged absorption of the mjectable compositions can be brought about by the use in the compositions of agents delaying absorption such as, for example, aluminum monostearate and gelatin Sterile mjectable
  • the present invention extends to vaccine compositions which confer protection against infection by one or more isolates or sub-types of L intracellulans including those that belong to the same serovar or serogroup as Lawsonia intracellulans
  • the vaccine composition preferably also confers protection against infection by other species of the genus Lawsonia or other microorganisms related thereto, as determined at the nucleotide, biochemical, structural, physiological and/or immunointeractive level, the only requirement being that said other species or other microorganism expresses a polypeptide which is immunologically cross-reactive to the polypeptide of the invention described herein
  • such related microorganisms may comprise genomic DNA which is at least about 70% identical overall to the genomic DNA of Lawsonia intracellulans as determined using standard genomic DNA hybridisation and analysis techniques
  • serovar refers to a classification of microorganirms which is based upon serological typing data, in particular data obtained using agglutination assays such as the microscopic agglutination test (MAT)
  • agglutination assay such as the microscopic agglutination test (MAT)
  • MAT microscopic agglutination test
  • serovar and serogroup antigens are a mosaic on the cell surface and, as a consequence there will be no strict delineation between bacteria belonging to a serovar and/or serogroup
  • organisms which belong to different species may be classified into the same serovar or serogroup because they are indistinguishable by antigenic determination
  • the term “serovar” means one or more Lawsonia strains which are antigenically-identical with respect to antigenic determinants produced by one or more loci Quantitatively serovars may be differentiated from one another by cross-agglutination absorption techniques
  • serogroup refers
  • the present invention thus clearly extends to vaccine compositions for the treatment and/or prophylaxis of animals in particular vaccine compositions for the treatment and/or prophylaxis of porcine and/or avian species against any bacterium belonging to the same serovar or serogroup as Lawsonia intracellulans
  • vaccine compositions for the treatment and/or prophylaxis of porcine and/or avian species against any bacterium belonging to the same serovar or serogroup as Lawsonia intracellulans Preferably, such organisms will express a polypeptide having an ammo acid sequence identity of at least about 60% overall with respect to SEQ ID NO 1
  • the present invention extends further to vaccine compositions capable of conferring protection against a "genetic variant" of Lawsonia intracellulans, the only requirement being that said variant expresses a polypeptide having an overall ammo acid sequence identity of at least about 60% with respect to SEQ ID NO 1 and/or comprises at least about 5 contiguous ammo acid residues derived from SEQ ID NO 1 or a homologue, analogue or derivative thereof which is immunologically cross-reactive thereto
  • Genetic variants of L intracellulans can be developed by mutation, recombination, conjugation or transformation of L intracellulans or may occur naturally It will be known to a person skilled in the art how to produce such derivatives
  • the vaccine composition of the invention is intended for or suitable for the prophylaxis and/or treatment of infection in a porcine or avian animal and more preferably, for prophylaxis and/or treatment of a porcine animal for infection by L intracellulans
  • the vaccine composition of the invention is intended for or suitable for the prophylaxis and/or treatment of infection in a porcine or avian animal and more preferably for prophylaxis and/or treatment of a porcine animal for infection by L intracellulans
  • the present invention clearly extends to the use of the immunogenic polypeptide of the invention according to any one of the preceding embodiments or as exemplified herein in the preparation of a medicament for the treatment and/or prophylaxis of PPE in animals particularly porcine or avian animals
  • the invention further extends to a method of treatment and/or prophylaxis of PPE in an animal such as an avian or porcine animal said method comprising administering the vaccine composition or the immunogenic polypeptide of the invention as described or exemplified herein to said animal for a time and under conditions sufficient for an immune response to occur thereto
  • the immune response to the immunogen is a protective immune response
  • the present invention further extends to combination vaccines comprising an effective 1 /
  • the second immunogenic component is selected from the group consisting of the L intracellulans autolysm, hemolysin, OmpH, and SodC polypeptides and homologues, analogues or derivatives thereof, in particular immunogenic variants or derivatives thereof, and nucleic acid molecules encoding same
  • the isolated or recombinant FlgE polypeptide of the invention or an immunologically- equivalent homologue, analogue or derivative thereof is also useful for the preparation of immunologically interactive molecules which are useful in the diagnosis of infection of an animal by Lawsonia spp , in particular by L intracellulans or a related organism thereto
  • immunologically interactive molecule includes antibodies and antibody derivatives and functional equivalents, such as a Fab, or a SCAB (single- chain antibody), any of which optionally can be conjugated to an enzyme, radioactive or fluorescent tag, amongst others
  • Fab single-chain antibody
  • SCAB single- chain antibody
  • a further aspect of the mveruon extends to an immunologically interactive molecule which is capable of binding ⁇ o any one or more of the following
  • a peptide, ohgopeptide or polypeptide which comprises an ammo acid sequence which has at least about 60% overall sequence identity to the ammo acid sequence set forth in SEQ ID NO 1 ,
  • the immunologically interactive molecule is an antibody that binds specifically to a polypeptide consisting of the amino acid of SEQ ID NO 1
  • polyclonal antisera or monoclonal antibodies can be made using standard methods
  • a mammal e g , a mouse, hamster, or rabbit
  • an immunogenic form of the polypeptide of the present invention which elicits an antibody response in the mammal
  • Techniques for conferring immunogenicity on a polypeptide include conjugation to carriers, or other techniques well known in the art
  • the polypeptide can be administered in the presence of adjuvant or can be coupled to a carrier molecule, as known in the art, that enhances the immunogenicity of the polypeptide
  • the progress of immunization can be monitored by detection of antibody titres in plasma or serum Standard ELISA or other immunoassay can be used with the immunogen as antigen to assess the levels of antibodies Following immunization, antisera can be obtained and, for example, IgG molecules corresponding to the polyclon
  • antibody producing cells can be harvested from an animal immunised with a peptide of the present invention and fused with myeloma cells by standard somatic cell fusion procedures, thus immortalizing these cells and yielding hyb ⁇ doma cells
  • somatic cell fusion procedures thus immortalizing these cells and yielding hyb ⁇ doma cells
  • Hyb ⁇ doma cells can be isolated and screened immunochemically for production of antibodies that are specifically reactive with the polypeptide and monoclonal antibodies isolated therefrom
  • the immunogenically effective amounts of the peptides of the invention must be determined empirically Factors to be considered include the immunogenicity of the native peptide, whether or not the peptide will be complexed with or covalently attached to an adjuvant or carrier protein or other carrier, the route of administration for the composition, i e , intravenous intramuscular, subcutaneous, etc , and the number of immunizing doses to be administered Such factors are known in the vaccine art and it is well within the skill of immunoiogists to make such determinations without undue experimentation
  • antibody as used herein, is intended to include fragments thereof which are also specifically reactive with a peptide that mimics or cross-reacts with a B-cell or T- cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1
  • Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies For example, F(ab')2 fragments can be generated by treating antibody with pepsin The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments
  • any secondary antibodies (monoclonal, polyclonal or fragments of antibodies), including anti-idiotypic antibodies, directed to the first mentioned antibodies discussed above
  • Both the first and second antibodies can be used in detection assays or a first antibody can be used with a commercially available anti-immunoglobuhn antibody
  • An antibody as contemplated herein includes any antibody specific to any region of a peptide which mimics, or cross-reacts with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1 as here before described
  • the antibodies described herein are useful for determining B-cell or T-cell epitopes of the ammo acid sequence set forth in SEQ ID NO 1 such as, for example, by testing the ability of synthetic peptides to cross-react immunologically with said am o acid sequence or to elicit the production of antibodies which cross-react with said ammo acid sequence Using methods described herein, polyclonal antibodies, monoclonal antibodies or chime ⁇ c monoclonal antibodies can also be raised to peptides which mimic or cross-react with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE - 40 -
  • polyclonal monoclonal or chime ⁇ c monoclonal antibodies can be used to detect the peptides of the invention and/or any homologues, analogues or derivatives thereof, in various biological materials
  • they can be used in an ELISA, radioimmunoassay or histochemical test
  • the antibodies can be used to test for binding to a polypeptide of the invention or to a homologue, analogue or derivative thereof in a biological sample to diagnose the presence of Lawsonia intracellulans therein
  • a further aspect of the invention provides a method of diagnosing infection of an animal by Lawsonia intracellulans or a related microorganism thereto, said method comprising the steps of contacting a biological sample derived from said animal with an immunologically interactive molecule which is capable of binding to a peptide, ohgopeptide or polypeptide comprising the ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or derivative thereof, for a time and under conditions sufficient for an antigen antibody complex to form, and detecting said complex formation
  • the immunologically interactive molecule is preferably an antibody molecule prepared against the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1 or an analogue or derivative thereof
  • the biological sample is one which might contain a polypeptide having an ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or thereof, in particular a biological sample derived from a porcine or avian host of the pathogen Lawsonia intracellulans or a related microorganism thereto, and can include any appropriate tissue or fluid sample from the animal
  • Preferred biological samp'es are derived from the ileum, caecum, small intestine, large intestine, whole serum or lymph nodes of the porcine or avian host animal being tested
  • the biological test sample may comprise faeces or a rectal swab derived from the animal
  • the antibodies should not be prepared against highly-conserved epitopes of FlgE such as those regions of at least 5 am o acids in length which are conserved between L intracellulans and a microorganism which is present in the gut or other organ of an animal in respect of which diagnosis is sought such as, for ⁇ example, E coli
  • the present invention contemplates a method of identifying whether or not an animal has suffered from a past infection, or is currently infected with Lawsonia intracellulans or a related microorganism thereto, said method comprising contacting blood or serum derived from said animal with the immunogenic polypeptide of the invention for a time and under conditions sufficient for an antigen antibody complex to form, and detecting said complex formation
  • This embodiment differs from the embodiment described supra in that it relies upon the detection of emulating antibodies against Lawsonia intracellulans or related organism in the animals blood or serum which are present as a consequence of a past or present infection by this pathogen
  • the principle of the assay format is the same As with other embodiments of the invention referred to supra, conventional immunoassays can be used Persons skilled in the art will readily be capable of varying known immunoassay formats to perform the present embodiment
  • This embodiment of the invention can also utilise derivatives of blood and serum which comprise immunologically interactive molecules such as, for
  • a further aspect of the present invention provides an isolated nucleic acid molecule which comprises a sequence of nucleotides which encodes, or is complementary to a nucleic acid molecule which encodes, a peptide, ohgopeptide or polypeptide selected from the following
  • a peptide, ohgopeptide or polypeptide which comprises an ammo acid sequence having at least about 60% identical overall to the amino acid sequence set forth in SEQ ID NO:1 , (II) a peptide comprising at least 5 contiguous ammo acids derived from
  • the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes, or is complementary to a nucleic acid molecule which encodes, a polypeptide immunogen which comprises, mimics or cross-reacts with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO'1
  • the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding the L. intracellulans FlgE polypeptide having an ammo acid sequence set forth in SEQ ID NO: 1.
  • polymeric forms of the immunogenic polypeptide described herein such as aggregates of the amino acid sequence set forth in SEQ ID NO:1 or a homologue, analogue or derivative thereof or, alternatively, as polypeptides comprising repeats of the amino acid sequence set forth in SEQ ID NO:1 or a homologue, analogue or derivative thereof.
  • the present invention extends further to nucleic acid molecules encoding such polymeric forms. thereof.
  • the isolated nucleic acid molecule of the invention further comprises a sequence of nucleotides which has at least about 60% overall sequence identity to the nucleotide sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereof. More preferably, the percentage sequence identity to SEQ ID NO:2 or to a complementary nucleotide sequence thereto is at least about 80%. Still more preferably, the percentage sequence identity is at least about 90%. Yet still more preferably, the percentage sequence identity is at least about 95%.
  • the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO:2, or the FlgE-encoding nucleotide sequence present in pALK11 (ATCC 207156), or a degenerate variant thereof, and complements thereof.
  • nucleotide sequences In determining whether or not two nucleotide sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences. In such comparisons or alignments, differences may arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment.
  • reference to a percentage identity between two or more nucleotide sequences shall be taken to refer to the number of identical residues between said sequences as determined using any standard algorithm known to those skilled in the art. For example, nucleotide sequences may be aligned and their identity calculated using the BESTFIT programme or other appropriate programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984).
  • the isolated nucleic acid molecule of the invention is capable of hybridising under at least low stringency conditions and to the nucleotide sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereto or to a nucleic acid fragment comprising at least about 20 contiguous nucleotides in length derived from the sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereto
  • nucleic acid molecule is capable of hybridising under at least moderate stringency conditions even more preferably under high stringency conditions • s
  • a low stringency is defined herein as being a hybridisation and/or a wash carried out in 6xSSC buffer 0 1 % (w/v) SDS at 28 C C
  • a moderate stringency is defined herein as being a hybridisation and/or wash carried out in 2xSSC buffer, 0 1 % (w/v) SDS at a temperature in the range 45 n C to 10 65°C
  • a high stringency is defined herein as being a hybridisation and/or wash carried out in 0 1xSSC buffer, 0 1% (w/v) SDS at a temperature of at least 65 °C
  • the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the 5 hybridisation and/or wash
  • the conditions for hybridisation and/or washing may vary depending upon the nature of the hybridisation membrane or the type of hybridisation probe used
  • Conditions for hybridisations and washes are well understood by one normally skilled in the art
  • 0 reference is found in pages 2 10 8 to 2 10 16 of Ausubel ef a/ (1987), which is herein incorporated by reference
  • the present invention clearly encompasses genetic constructs comprising the subject nucleic acid molecule in an expressible format s- -table for the preparation of a 5 recombinant immunogenic polypeptide of the present invention, such as for use in recombinant univalent or polyvalent recombinant vaccines
  • nucleic acid molecule will be operably connected to a promoter sequence which can thereby regulate expression of said nucleic acid molecule in a 0 prokaryotic or eukaryotic cell as described supra
  • the genetic construct optionally further comprises a terminator sequence
  • terminator refers to a DNA sequence at the end of a transc ⁇ ptional unit which signals termination of transcription
  • a ' terminator is a nucleotide sequence, generally located within the 3 -non-translated region of a gene or mRNA comprising a polyadenylation signal to facilitate the post-transc ⁇ ptional addition of a polyadenylate sequence to the 3'-end of a primary mRNA transcript
  • Terminator sequences may be isolated from the genetic sequences of bacteria, fungi, viruses, animals and/or plants Terminators active in animal cells are known and described in the literature
  • the genetic construct can be a cloning or expression vector, as known in the art, such as a plasmid, cosmid, or phage, comprising a nucleic acid molecule of the present invention, and host cells transformed or transfected therewith
  • the vector is plasmid pALK11 (ATCC Accession No. 207156)
  • the genetic constructs of the present invention are particularly useful for producing the immunogenic component of the vaccine composition described herein or for use in a DNA vaccine.
  • a range of genetic diagnostic assays to detect infection of an animal by Lawsonia intracellulans or a related microorganism can be employed using the nucleic acid molecule described herein such as, for example, assays based upon the polymerase chain reaction (PCR) and nucleic acid hybridisation All such assays are contemplated in the present invention
  • a still further aspect of the invention provides a diagnostic method of detecting Lawsonia intracellulans or related microorganism in a biological sample derived from an animal subject, said method comprising the steps of hyb ⁇ dismg one or more probes or primers derived from the nucleotide sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereto or a homologue, analogue or derivative thereof, to a DNA or RNA molecule present in said sample and then detecting said hybridisation using a detection means
  • the term ' probe refers to a nucleic acid molecule which is derived from the nucleotide sequence set forth in SEQ ID NO 2 and which is capable of being used in the detection thereof Probes may comprise DNA (single-stranded or double- stranded) or RNA (i e , ⁇ boprobes) or analogues thereof
  • primer refers to a probe as hereinbefore defined which is further capable of being used to amplify a nucleotide sequence from Lawsonia intracellulans or a related microorganism thereto in a PCR
  • Preferred probes and primers include fragments of the nucleotide sequence set forth in SEQ ID NO 2 and synthetic single-stranded DNA or RNA molecules of at least about 15 nucleotides in length derived from the sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereto
  • probes and primers according to this embodiment will comprise at least about 20 contiguous nucleotides derived from SEQ ID NO 2 or a complementary sequence thereto, even more preferably at least about 25 contiguous nucleotides, still even more preferably at least about 50 contiguous nucleotides and even more preferably at least about 100 nucleotides to about 500 nucleotides derived from the sequence set forth in SEQ ID NO 2 or a complement thereof Probes and primers comprising the full-length of SEQ ID NO 2 or a complementary nucleotide sequence thereto are also encompassed by the present invention
  • homologues of a nucleotide sequence shall be taken to refer to an isolated nucleic acid molecule which encodes a polypeptide that is functionally equivalent to the polypeptide encoded by the nucleic acid molecule of the present invention or to a polypeptide which is a homologue, analogue or derivative of SEQ ID NO 1 , notwithstanding the occurrence within said sequence, of one or more nucleotide substitutions, insertions, deletions, or rearrangements
  • nucleotide sequence set forth herein shall be taken to refer to an isolated nucleic acid molecule which encodes a functionally-equivalent polypeptide to the polypeptide encoded by the nucleic acid molecule of the present invention or a homologue, analogue or derivative of a polypeptide having the amino acid sequence of SEQ ID NON notwithstanding the occurrence of any non-nucleotide constituents not normally present in said isolated nucleic acid molecule such as, for example, carbohydrates, radiochemicals including radio nucleotides, reporter molecules such as, but not limited to biotin, DIG, alkaline phosphatase or horseradish peroxidase, amongst others.
  • Derivatives of a nucleotide sequence set forth herein shall be taken to refer to any isolated nucleic acid molecule which contains at least about 50% nucleotide sequence identity to 15 or more contiguous nucleotides present in the nucleotide sequence set forth in SEQ ID ⁇ O:2 or a complementary nucleotide sequence thereto.
  • the nucleotide sequence of the present invention may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or insertions.
  • Nucleotide insertional derivatives of the nucleotide sequence of the present invention include 5 ' and 3 ' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides or nucleotide analogues.
  • Insertional nucleotide sequence variants are those in which one or more nucleotides or nucleotide analogues are introduced into a predetermined site in the nucleotide sequence of said sequence, although random insertion is also possible with suitable screening of the resulting product being performed.
  • Deletional nucleotide sequence variants are characterised by the removal of one or more nucleotides from the nucleotide sequence.
  • Substitutional nucleotide sequence variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide or nucleotide analogue inserted in its place. In a preferred embodiment, such substitutions are selected based on the degeneracy of the genetic code, as known in the art, with the resulting substitutional variant encoding the amino acid sequence of SEQ ID NO:1.
  • Probes or primers can comprise inosine, adenine, guanine, thymidine, cytidine or uracil residues or functional analogues or derivatives thereof that are capable of being incorporated into a polynucleotide molecule, provided that the resulting probe or primer is capable of hybridising under at least low stringency conditions to SEQ ID NO:2 or to a complementary nucleotide sequence thereof, or is at least about 60% identical to SEQ ID NO 2 or to a complementary nucleotide sequence thereof
  • the biological sample according to this aspect of the invention includes any organ, tissue, cell or exudate which contains or is likely to contain Lawsonia intracellulans or a nucleic acid derived therefrom
  • a biological sample can be prepared in a suitable solution such as, for example, an extraction buffer or suspension buffer
  • suitable solution such as, for example, an extraction buffer or suspension buffer
  • the present invention extends to the testing of biological solutions thus prepared, the only requirement being that said solution at least comprises a biological sample as described herein
  • the diagnostic assay of the present invention is useful for the detection of Lawsonia intracellulans or a microorganism which is related thereto which expresses the flagellar hook protein of the present invention or a flagellar hook protein-like polypeptide
  • the probe or primer, or a homologue, analogue or derivative thereof comprises DNA capable of being used to detect multiple Lawsonia spp
  • the probe or primer or a homologue, analogue or derivative thereof comprises DNA capable of being used to distinguish Lawsonia intracellulans from related microorganisms
  • SEQ ID NO 2 Less-highly consen/ed regions within SEQ ID NO 2 are particularly us ⁇ ful as species-specific probes and/or primers for the detection of L intracellulans and very closely related species
  • the diagnostic assays described herein can be adapted to a genus- specific or species-specific assay by varying the stringency of the hybridisation step Accordingly, a low stringency hybridisation can be used to detect several different species of Lawsonia in one or more biological samples being assayed, while a high stringency hybridisation can be used to distinguish Lawsonia intracellulans from such other species
  • the detection means may be any nucleic acid- based detection means such as for example, nucleic acid hybridisation techniques or paper chromatography hybridisation assay (PACHA), or an amplification reaction such as PCR, or nucleic acid sequence-based amplification (NASBA) system
  • the invention further encompasses the use of different assay formats of said nucleic acid-based detection means, including restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), single-strand chain polymorphism (SSCP), amplification and mismatch detection (AMD) interspersed repetitive sequence polymerase chain reaction (IRS-PCR), inverse polymerase chain reaction (iPCR), in situ polymerase chain reaction and reverse transcription polymerase chain reaction (RT-PCR), amongst others
  • the probe can be labelled with a reporter molecule capable of producing an identifiable signal (e g , a radioisotope such as 32 P or 35 S, or a biot ylated molecule)
  • a reporter molecule capable of producing an identifiable signal
  • the detection of said reporter molecule provides for identification of the probe and that, following the hybridisation reaction, the detection of the corresponding nucleotide sequences in the biological sample is facilitated Additional probes can be used to confirm the assay results obtained using a single probe
  • a variation of '.he nucleic acid hybridisation technique contemplated by the present invention is the paper chromatography hybridisation assay (PACHA) described by Reinhartz ef al (1993) and equivalents thereof, wherein a target nucleic acid molecule is labelled with a reporter molecule such as biotm, applied to one end of a nitrocellulose or nylon membrane filter strip and subjected to chromatography under the action of capillary or other forces (e g , an electric field) for a time and under conditions sufficient to promote migration of said target nucleic acid along the length of said membrane to a zone at which a DNA probe is immobilised thereto such as, for example, in the middle region
  • labelled target nucleic acid comprising the Lawsonia spp nucleotide sequences complementary to the probe will hybridise thereto and become immobilised in that region of the membrane to which the probe is bound
  • Non-complementary sequences to the probe will diffuse past the site at which the probe is bound
  • the target nucleic acid
  • the detection means is a RFLP
  • nucleic acid derived from the biological sample, in particular DNA is digested with one or more restriction endonuclease enzymes and the digested DNA is subjected to electrophoresis, transferred to a solid support such as, for example, a nylon or nitrocellulose membrane, and hybridised to a probe optionally labelled with a reporter molecule as hereinbefore defined
  • a specific pattern of DNA fragments is displayed on the support, wherein said pattern is preferably specific for a particular Lawsonia spp., to enable the user to distinguish between different species of the bacterium.
  • the detection means is an amplification reaction such as, for example, a polymerase chain reaction or a nucleic acid sequence-based amplification (NASBA) system or a variant thereof, one or more nucleic acid primer molecules of at least 15 contiguous nucleotides in length derivable from SEQ ID NO.2 or its complementary nucleotide sequence, or a homologue, analogue or derivative thereof, is hybridised to nucleic acid der /ed from a biological sample, and nucleic acid copies of the FlgE- encoding genetic sequences in said sample, or a part or fragment thereof, are enzymically-amplified
  • NASBA nucleic acid sequence-based amplification
  • the stringency conditions can be selected to promote hybridisation - 3 ;
  • each primer is at least about 95% identical to a region of SEQ ID NO 2 or its complementary nucleotide sequence in the template molecule to which it hybridises
  • PCR provides for the hybridisation of non-complementary primers to different strands of the template molecule such that the hybridised primers are positioned to facilitate the 5 ⁇ 3 synthesis of nucleic acid in the intervening region, under the control of a thermostable DNA polymerase enzyme
  • PCR provides an advantage over other detection means in so far as the nucleotide sequence in the region between the hybridised primers may be unknown and unrelated to any known nucleotide sequence
  • the primers are selected such that, when nucleic acid derived from the biological sample, in particular DNA, is amplified, different length amplification products are produced from different Lawsonia spp
  • the amplification products can be subjected to electrophoresis, transferred to a solid support such as, for example, a nylon or nitrocellulose membrane, and hybridised to a probe optionally labelled with a reporter molecule as hereinbefore described
  • a specific pattern of amplified DNA fragments is displayed on the support, said pattern optionally specific for a particular Lawsonia ssp , to enable the user to distinguish between different species of the bacterium in much the same way as for RFLP analysis
  • the technique of AMD facilitates, not only the detection of Lawsonia spp DNA in a biological sample, out also the determination of nucleotide seque ce variants which differ from the primers and probes used in the assay format
  • the probe is end-labelled with a suitable reporter molecule and mixed with an excess of the amplified template molecule
  • the mixtures are subsequently denatured and allowed to renature to form nucleic acid "probe template hybrid molecules" or "hybrids”, such that any nucleotide sequence variation between the probe and the temple molecule to which it is hybridised will disrupt base-pairing in the hybrids
  • probe template hybrid molecules or "hybrids”
  • the use of a single end-labelled probe allows unequivocal localisation of the sequence variation
  • the distance between the po ⁇ nt(s) of sequence variation and the end-label is represented by the size of the cleavage product
  • the probe is labelled at both ends with a reporter molecule, to facilitate the simultaneous analysis of both DNA strands
  • the nucleic acid sample comprises an RNA molecule which is a transcription product of Lawson/a-de ⁇ ved DNA or a homologue, analogue or derivative thereof
  • this assay format is particularly useful when it is desirable to determine expression of one or more Lawsonia genes
  • the RNA sample is reverse-transcribed to produce the complementary single-stranded DNA which is subsequently amplified using standard procedures
  • the present invention clearly extends to the use of any and all detection means referred to supra for the purposes of diagnosing Lawsonia spp and in particular Lawsonia intracellulans infection in animal
  • the amplification reaction detection means described supra can be further coupled to a classical hybridisation reaction detection means to further enhance sensitivity and -> .
  • hybridisation reaction detection means described supra can be further coupled to a second hybridisation step employing a probe which is different from the probe used in the first hybridisation reaction
  • a further aspect of the invention provides an isolated probe or primer derived from SEQ ID NO 2 or a complementary nucleotide sequence thereto
  • the present invention does not extend to immunogenic polypeptides which comprises exclusively the C-termmal region of the FlgE polypeptide as described in International Patent Application No PCT/AU96/00767 or nucleotide sequences encoding same or vaccine compositions therefor
  • Sections of grossly thickened ilea were taken from pigs naturally or experimentally affected by PPE The presence of L. intracellulans bacteria in the ilea vas confirmed using immunofluorescent staining with specific monoclonal antibodies (McO ⁇ st ef a/., 1987)
  • An example of a suitable antibody is monoclonal antibody IG4 available from the University of Edinburgh, UK.
  • Lawsonia intracellulans bacteria were extracted directly from lesions of PPE in pigs by filtration and further purified over a Percoll (Pharmacia Uppsala Sweden) gradient as follows Infected ilea were collected from pigs and the presence of L intracellulans was confirmed histologically before storage at -80 °C Sections of ileum were thawed and approximately 8g of infected mucosa were scraped from the intestinal wall The mucosa was homogenised with 40 ml sterile phosphate buffered saline (PBS) on half speed for 10 seconds using a Sorvall omnimixer This suspension was centrifuged at 2000 xg for 4 minutes The supernatant was discarded and the ceil pellet was resuspended in 40 ml PBS and re-cent ⁇ fuged This washing step was repeated twice The cell pellet was then resuspended in 20 ml PBS and homogenised at full speed for one minute to release L intra
  • the L intracellulans cells were pelleted by cent ⁇ fugation at 14,000 x g at 4°C for 15 mm
  • the cells were resuspended in 10 ml of TE buffer (1 mM Tris-HCI, 0 1 mM EDTA, pH 8.0) and centrifuged as before The pellet was then resuspended in 4 ml of TE buffer containing 4 mg/ml lysozyme (Sigma Chemical Co.) and incubated at 37 " C for 20 m SDS and protemase K (Promega, Wl, USA) were added to final concentrations of 1 % (w/v) and 200 ⁇ g/ml, respectively, and incubation was continued at 45°C for 4 hours.
  • the lysate was then extracted with an equal volume of phenol, phenol chloroform (1 :1 ) and chloroform, respectively, and the nucleic acids were recovered from the supernatant by ethanol precipitation.
  • the pellet was gently dissolved in TE, treated with RnaseA (Promega, Wl, USA) at 37°C for 30 min and then digested with proteinase K in the presence of 0.5% (w/v) SDS for 1 h at 50°C. After another round of phenokchloroform (1 :1) and ethanol precipitation, the purified DNA was dissolved in TE The DNA was then stored at 4°C
  • Example 3 The genomic DNA from Example 3 was partially digested with the restriction endonuclease SauZA (Promega) and hgated into Lambda ZAP Express (Stratagene, CA, USA). The lambda library was plated on a lawn of E. coli XLI-Blue cells at a density of 1 ,000 phage forming units (pfu) per 150 mm L-broth agar plate.
  • the library was screened using the method described in the Protoblot Technical Manual (Promega, Wl, USA) The filters were blocked in blocking buffer (10 mM Tris-HCI, pH 8.0, 150 mM NaCl, 0.05% Tween 20, 5% Blotto), prior to screening with sera from the pigs Y12 and/or 395.
  • the pigs Y12 and 395 had been immunised with formalin-killed L intracellulans and heat-killed L intracellulans, respectively as described in International Patent Application No PCT/AU96/00767 Positive plaques which were identified in the primary screen were picked re-plated at a lower density and re- screened with either or both sera until an individual plaque was isolated Plasmid DNA from the positive lambda phage clone was isolated by in vivo excision, as recommended by the manufacturer (Stratagene CA USA) A clone containing the partial flgE gene of L intracellulans was identified in this way
  • Phagemid DNA from positive ⁇ ZAP II Express phage clones was isolated by in vivo excision, by the conditions recommended by the manufacturer (Stratagene)
  • Plasmid DNA for restriction analysis was extracted by alkaline-lysis, as described by Sambrook et al (1989), and for automated sequencing, using the High Pure Plasmid Kit, as recommended by the manufacturer (Boeh ⁇ nger Mannheim, Mannheim, Germany)
  • the nucleotide sequence (1005 bp) of the 5' region of the flgE gene of Lawsonia intracellulans was obtained from the clone isolated as described in Example 4 The remaining portion of the flgE gene was amplified using the Vectorette System as described by the manufacturer (Genosys Biotechnologies Ine , TX, USA)
  • the Vectored System enables the amplification of specific DNA fragments where the sequence of only one primer is known There are three basic steps as follows
  • the nucleotide sequence of the amplified product containing the flgE gene was then obtained DNA sequencing of amplified DNA and isolated clone inserts was performed by the Dye-terminator method of automated sequencing (ABI Biosystems CA USA)
  • the nucleotide sequence of the complete coding region of the flgE gene is set out in SEQ ID NO 2
  • the FlgE gene was amplified from L intracellulans chromosomal DNA using the following primers
  • the resulting 1 5 kb PCR fragment was cloned into the pGEMT-TA vector (Promega)
  • the FlgE- containing DNA fragment was isolated from this construct following complete digestion with Xbal and partial digestion with A/del
  • the resulting band was gel-purified and directionally- cloned, as an A/del -Xbal fragment, into a heat-inducible lambda-PL expression vector
  • the recombinant vector was introduced into E. coli cells which were maintained at 30"C. Heat induction of FlgE expression occurred upon shifting the incubation temperature to 42 °C.
  • the solubilized protein was applied to a Q-sepharose FF column using 4 M Urea, 50 mM Tris, pH 7.0 as buffer, and eluted using a salt gradient.
  • the desired protein eluted from this column at 10-15% NaCl concentration.
  • the pooled eluant fractions were step-dialyzed using 10kDa molecular weight cut-off membrane against 2 M Urea, 50 mM Tris (pH 7.2), and then step-dialyzed to 50 mM Tris, pH 7.0.
  • the final product was filtered through a 0.22 ⁇ M membrane.
  • the protein concentration of the filtrered solution was 0.85 mg/ml, with an estimated purity of greater than about 80% as determined using SDS/PAGE.
  • Template DNA was purified from DNA isolated from infected pig intestinal mucosa isolated from the ileum of pigs infected with L. intracellulans. DNA purification from intestinal mucosa was performed according to the method of Nollau ef al. (1996). Due to the presence of contaminating polysaccharides and other material, the DNA content of the samples was not quantitated and samples were used empirically in PCR amplifications
  • the PCR amplifications consisted of 1 u ⁇ pig intestinal mucosa, 1 uM each of the forward (RA170 5' CTATTTTTAGGAGATGTTATC 3 , SEQ ID NO 3) and reverse primers (RA171 5' TACAAAATTAACAATAAAATAC 3', SEQ ID NO 4), 7 5 units KlenTaql polymerase (Ab Peptides, Ine , St Louis Missouri), 0 075 units Pfu polymerase (Stratagene Cloning Systems, La Jolla, California), 1 x PC2 (KlenTaql) buffer and 0 2 mM dNTPs in a 50 u ⁇ volume PCR was carried out in 4 stages (i) 94°C for 5 mm, (n) 94°C for 1 mm, 58°C for 30 seconds, 72X for 2 mm, x 33 cycles, (in) 72°C for 10 m ⁇ n, (iv) hold at 4°C
  • pCR2 1-TOPO Invitrogen Corp , Carlsbad, CA
  • pALK11 ATCC Accession No. 207156
  • the plasmid pALK11 was deposited with the American Type Culture Collection (ATCC) at 10801 University Boulevard, Manassas, VA 20110, USA on 11th March, 1999 and was assigned ATCC Accession No 207156

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Analytical Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/AU2000/000437 1999-05-13 2000-05-11 LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES WO2000069904A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
JP2000618320A JP2003516113A (ja) 1999-05-13 2000-05-11 ローソニア由来の遺伝子及び関連ＦｌｇＥポリペプチド、ぺプチド及びタンパク質並びにそれらの使用
AU43859/00A AU771376B2 (en) 1999-05-13 2000-05-11 Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses
MXPA01011669A MXPA01011669A (es) 1999-05-13 2000-05-11 Gen derivado de lawsonia y polipeptidos, peptidos y proteinas relacionadas con fige y sus usos.
EP00924976A EP1181315A4 (en) 1999-05-13 2000-05-11 LAWSONIA DERIVATIVE GENE, FLGE POLYPEPTIDES, PEPTIDES AND PROTEINS AND USES THEREOF
NZ515331A NZ515331A (en) 1999-05-13 2000-05-11 Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses
CA002372098A CA2372098A1 (en) 1999-05-13 2000-05-11 Lawsonia derived gene and related flge polypeptides, peptides and proteins and their uses
BR0011294-1A BR0011294A (pt) 1999-05-13 2000-05-11 Gene derivado lawsonia e polipeptìdeos, peptìdeos e proteìnas flge relacionados e seus usos
US11/386,138 US20060159707A1 (en) 1999-05-13 2006-03-21 Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13397399P 1999-05-13 1999-05-13
US60/133,973 1999-05-13

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/386,138 Division US20060159707A1 (en) 1999-05-13 2006-03-21 Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses

Publications (1)

Publication Number Publication Date
WO2000069904A1 true WO2000069904A1 (en) 2000-11-23

Family

ID=22461178

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2000/000437 WO2000069904A1 (en) 1999-05-13 2000-05-11 LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES

Country Status (9)

Country Link
EP (1) EP1181315A4 (es)
JP (1) JP2003516113A (es)
AU (1) AU771376B2 (es)
BR (1) BR0011294A (es)
CA (1) CA2372098A1 (es)
MX (1) MXPA01011669A (es)
NZ (1) NZ515331A (es)
PE (1) PE20010316A1 (es)
WO (1) WO2000069904A1 (es)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6605696B1 (en) 1999-10-22 2003-08-12 Pfizer, Inc. Lawsonia intracellularis proteins, and related methods and materials
US6921536B2 (en) 2000-12-20 2005-07-26 Akzo Nobel N.V. Lawsonia intracellularis vaccine
WO2006099561A1 (en) 2005-03-14 2006-09-21 Boehringer Ingelheim Vetmedica, Inc. Immunogenic compositions comprising lawsonia intracellularis
EP2204184A1 (en) 2005-07-15 2010-07-07 BOEHRINGER INGELHEIM VETMEDICA, Inc. Lawsonia vaccine and methods of use thereof
EP2859900A1 (en) 2006-12-11 2015-04-15 Boehringer Ingelheim Vetmedica, Inc. Effective method of treatment of porcine circovirus and lawsonia intracellularis infections
CN114712392A (zh) * 2022-05-16 2022-07-08 西部医美生物科技成都有限公司双流医疗分公司 来自自体血液分离的免疫细胞制剂及其应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2335668T3 (es) * 2003-09-12 2010-03-31 Intervet International Bv Vacuna de sub-unidad de lawsonia intracellularis.

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996039629A1 (en) * 1995-06-05 1996-12-12 Boehringer Ingelheim/Nobl Laboratories, Inc. Lawsonia intracellularis cultivation, anti-lawsonia intracellularis vaccines and diagnostic agents
WO1997020050A1 (en) * 1995-11-30 1997-06-05 Daratech Pty. Ltd. Therapeutic and diagnostic compositions

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996039629A1 (en) * 1995-06-05 1996-12-12 Boehringer Ingelheim/Nobl Laboratories, Inc. Lawsonia intracellularis cultivation, anti-lawsonia intracellularis vaccines and diagnostic agents
WO1997020050A1 (en) * 1995-11-30 1997-06-05 Daratech Pty. Ltd. Therapeutic and diagnostic compositions

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BOYE M. ET AL.: "Specific detection of lawsonia intracellularis in porcine proliferative enteropathy inferred from fluorescent tRNA in situ hybridization", VETERINARY PATHOLOGY, vol. 35, no. 2, March 1998 (1998-03-01), pages 153 - 156, XP000984238 *
See also references of EP1181315A4 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6605696B1 (en) 1999-10-22 2003-08-12 Pfizer, Inc. Lawsonia intracellularis proteins, and related methods and materials
US6921536B2 (en) 2000-12-20 2005-07-26 Akzo Nobel N.V. Lawsonia intracellularis vaccine
US7491401B2 (en) 2000-12-20 2009-02-17 Intervet International B.V. Lawsonia intracellularis vaccine
WO2006099561A1 (en) 2005-03-14 2006-09-21 Boehringer Ingelheim Vetmedica, Inc. Immunogenic compositions comprising lawsonia intracellularis
US8834891B2 (en) 2005-03-14 2014-09-16 Boehringer Ingelheim Vetmedica, Inc. Immunogenic compositions comprising Lawsonia intracellularis
EP2992897A1 (en) 2005-03-14 2016-03-09 Boehringer Ingelheim Vetmedica, Inc. Immunogenic compositions comprising lawsonia intercellularis
EP3354279A2 (en) 2005-03-14 2018-08-01 Boehringer Ingelheim Vetmedica, Inc. Immunogenic compositions comprising lawsonia intracellularis
EP3906941A1 (en) 2005-03-14 2021-11-10 Boehringer Ingelheim Animal Health USA Inc. Immunogenic compositions comprising lawsonia intercellularis
EP2204184A1 (en) 2005-07-15 2010-07-07 BOEHRINGER INGELHEIM VETMEDICA, Inc. Lawsonia vaccine and methods of use thereof
EP2859900A1 (en) 2006-12-11 2015-04-15 Boehringer Ingelheim Vetmedica, Inc. Effective method of treatment of porcine circovirus and lawsonia intracellularis infections
CN114712392A (zh) * 2022-05-16 2022-07-08 西部医美生物科技成都有限公司双流医疗分公司 来自自体血液分离的免疫细胞制剂及其应用
CN114712392B (zh) * 2022-05-16 2022-11-25 西部医美生物科技成都有限公司双流医疗分公司 来自自体血液分离的免疫细胞制剂及其应用

Also Published As

Publication number Publication date
EP1181315A1 (en) 2002-02-27
AU4385900A (en) 2000-12-05
JP2003516113A (ja) 2003-05-13
PE20010316A1 (es) 2001-03-15
CA2372098A1 (en) 2000-11-23
NZ515331A (en) 2003-07-25
BR0011294A (pt) 2002-02-26
AU771376B2 (en) 2004-03-18
MXPA01011669A (es) 2003-09-10
EP1181315A4 (en) 2002-08-14

Similar Documents

Publication Publication Date Title
AU718333B2 (en) Therapeutic and diagnostic compositions
JP2006166919A (ja) 空胞形成毒素欠損Ｈ．ｐｙｌｏｒｉおよび関連する方法
US20060018920A1 (en) Lawsonia derived gene and related OmpH polypeptides, peptides and proteins and their uses
US20060159707A1 (en) Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses
AU771376B2 (en) Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses
AU775323B2 (en) Lawsonia derived gene and related hemolysin polypeptides, peptides and proteins and their uses
EP1177212A1 (en) Lawsonia derived gene and related sodc polypeptides, peptides and proteins and their uses
US7052697B1 (en) Lawsonia derived gene and related OmpH polypeptides, peptides and proteins and their uses
EP1332154A1 (en) Novel therapeutic compositions for treating infection by lawsonia spp
US6846487B2 (en) Therapeutic compositions for treating infection by Lawsonia spp.
US7029683B1 (en) Lawsonia derived gene and related hemolysin polypeptides, peptides and proteins and their uses
AU780980B2 (en) Novel therapeutic compositions for treating infection by lawsonia SPP
US20030049265A1 (en) Heliobacter pylori antigen
MXPA00000028A (es) Compuestos que codifican para la proteina similar a m protectora de streptococcus equi y ensayos para la misma

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 515331

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 2372098

Country of ref document: CA

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2000 618320

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PA/a/2001/011669

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2000924976

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000924976

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 10009823

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 2000924976

Country of ref document: EP