WO2000060067A1 - Element regulateur de cathepsine d - Google Patents

Element regulateur de cathepsine d Download PDF

Info

Publication number
WO2000060067A1
WO2000060067A1 PCT/AU2000/000276 AU0000276W WO0060067A1 WO 2000060067 A1 WO2000060067 A1 WO 2000060067A1 AU 0000276 W AU0000276 W AU 0000276W WO 0060067 A1 WO0060067 A1 WO 0060067A1
Authority
WO
WIPO (PCT)
Prior art keywords
catd
regulatory element
seq
vector
cells
Prior art date
Application number
PCT/AU2000/000276
Other languages
English (en)
Inventor
Piroska Elizabeth Rakoczy
Ian Constable
Original Assignee
The Lions Eye Institute Of Western Australia Incorporated
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Lions Eye Institute Of Western Australia Incorporated filed Critical The Lions Eye Institute Of Western Australia Incorporated
Priority to AU34103/00A priority Critical patent/AU3410300A/en
Publication of WO2000060067A1 publication Critical patent/WO2000060067A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6478—Aspartic endopeptidases (3.4.23)

Definitions

  • the present invention relates to a regulatory element and, more particularly, to a promoter capable of targeting Cathepsin D (CatD)-expressing cells.
  • the invention also relates to a vector including the regulatory element, host cells including the vector and methods of using the regulatory element and the vector.
  • CatD is the major lysosomal aspartic protease with a pH optimum between pH 2.8 and pH 4.0 (Barrett. 1977). Although there are many hints as to the in vivo function of CatD, direct evidence is presently not available. CatD is thought to be involved in intracellular catabolic proteolysis, end-processing, secretion and activation of enzymes and hormones (Opgenorth T.J. et al. 1992), and antigen processing and extracellular proteolysis (Barrett. 1977). Furthermore, it may play a role in leukocyte mobilization (Leto G. et al. 1992), and T-cell cytotoxic activity (Grusby M.J. et al. 1990).
  • CatD stimulates DNA synthesis and cell proliferation in regenerating tissue (Morioka M. et al. 1984), and participates in pathological processes such as inflammation (Barrett. 1977).
  • CatD is induced by estrogens in human breast cancer cell lines (Westley B. et al. 1980) and is produced in excess in cancer cells both in vitro and in vivo, where its concentration in the primary tumour is correlated with increased risk of metastases (Rochefort H. et al. 1990).
  • CatD is expressed in all tissues examined but the level of expression varies. These differences, which are most likely due to different transcription rates, are controlled by a combination of constitutive and proximal promoters.
  • the steroid hormones, vitamin D and estrogen have been shown to induce human CatD expression (Redecker B. et al. 1989).
  • Steroid receptors increase the initiation of transcription of specific genes by interacting with the transcriptional machinery at the promoter level (Beato M.1989).
  • gene expression is controlled by both proximal and distal elements, generally located in the 5'upstream region of the gene.
  • TATA box which binds the transcription factor IID and defines the transcription initiation site; genes with these promoters have been called facultative or regulated genes.
  • promoters of housekeeping genes such as those coding for lysosomal enzymes, lack a recognisable TATA box but contain multiple GC boxes acting as putative binding sites for the transcription factor Spl (Blake M.C. et al. 1990).
  • Estrogens stimulate transcription of the CatD gene by means of estrogen- responsive sequences located in the proximal region of the promoter (Cavailles V. et al. 1991).
  • E 2 17 ⁇ - Estradiol significantly increases CatD gene transcription and intracellular protein formation, and within 24 hrs after hormone treatment, the extracellular levels of the 52- and 34-kDa proteins are also significantly increased.
  • E 2 induces the expression of the CatD gene in ER-responsive breast cancer cells by interacting with the transcriptional machinery at the promoter level.
  • the CatD gene transcription is initiated at multiple transcription start sites l-V; however, E 2 exclusively initiates transcription at the TATA-dependent transcription start site I on the CatD promoter (Cavailles V. et al.
  • the promoter region of CatD does not contain a classical palindromic estrogen- responsive elements (ERE) but contains several GC-rich boxes which can bind to the transcription factor Sp1 (Cavailles V. et al. 1993).
  • Sp-1 -dependent activation of transcription is TATA box-dependent (Smale S . et al. 1990).
  • the mechanism of estrogen activation of the c-myc oncogene also involves similar interactions between the ER half-site and the Sp1 element on the c-myc downstream promoter (Dubik D. et al. 1992).
  • RPE retinal pigment epithelium
  • iris and ciliary body have a high activity of CatD
  • CatD corneal pigment epithelium
  • the highest activity of CatD in ocular tissues has been identified in RPE (Hayasaka S. et al. 1975b; Hayasaka S. et al. 1975b).
  • the RPE is a single multifunctional cell layer of the eye. It is situated beneath the photoreceptor outer segments (POS) and due to its tight junctions, it constitutes part of the blood retinal barrier.
  • the RPE is responsible for the removal of the ever regenerating POS, the lysosomal digestion of phagosomes and the recycling of digestion products. Following the displacement from the proximal to distal end of the outer segments, the intermittently shed POS are phagocytosed by the RPE (Young R.W. et al. 1969; Bosch E. et al. 1993). The phagocytosed POS form phagosomes within the RPE cells which induce a lysosomal response resulting in the digestion of the POS.
  • the RPE layer consists of non-renewable cells and with time the continuous phagocytosis and digestion of POS causes the accumulation of an autofluorescent debris, called lipofuscin, in the aging RPE (Feeney L.1987). It has been proposed by several investigators that abnormal amount of lipofuscin compromises RPE function, and macular photoreceptors die as a secondary response to an aged, incompetent RPE (Bressler N.M. et al. 1994).
  • the visual cycle is the movement of vitamin A (retinol) between the photoreceptors and the RPE cells (Bridges C.D.B. 1976).
  • the visual pigment in the rod and cone outer segments (ROS and COS) is 11-cis retinaldehyde.
  • ROS and COS The visual pigment in the rod and cone outer segments
  • 11 -cis retinaldehyde As a results of photon-triggered isomerisation 11 -cis-retinaldehyde is converted to all- trans retinaldehyde, which is then reduced to all-trans retinol.
  • the all-trans retinol is then transported to the RPE cells to be regenerated into 11 -cis retinaldehyde.
  • RPE In addition to the POS-derived all-trans retinol, RPE also receives all-trans retinol from the blood. All-trans retinol is a lipid soluble molecule therefore to increase solubility and stability the plasma retinol binds to a retinol binding protein (RBP) secreted by the liver (Heller J. et al. 1976). The precise process of the uptake and release of retinol from RBP remains to be elucidated.
  • RBP retinol binding protein
  • the all- trans retinol is initially converted by a retinoid isomerase to 11-cis retinol and by an oxidoreductase (retinol dehydrogenase, RDH) into 11-cis retinaldehyde.
  • the 11- cis retinaldehyde then delivered from the apical membrane of the RPE cells, through the extracellular matrix into the photoreceptors (Saari J.C. et al. 1994).
  • 11-cis retinol can also be converted into 11-cis retinyl ester and stored. During these processes, retinol or its derivatives bind to several transport and binding proteins.
  • the present invention provides an isolated regulatory element capable of targeting CatD-expressing cells, preferably cells expressing a high level of CatD.
  • targeting CatD-expressing cells is meant that the regulatory element preferentially causes expression of a transgene to which it is operationally linked in CatD expressing cells.
  • the regulatory element is preferentially operational in cells expressing a high level of catD.
  • a vector including the regulatory element e.g. a recombinant virus, may be able to enter other cells non-specifically, transgene expression in these cells will be substantially dormant. Only cells which express CatD and preferably a high level of CatD produce factors ncessary to activate the regulatory element.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide present in a living animal is not isolated, but the same polynucleotide separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • cells expressing a high level of CatD activity are meant cells expressing between approximately 0.04 and 10 units CatD enzymatic activity/mg protein, preferably cells expressing between approximately 0.1 and 5 units CatD enzymatic activity/mg protein, more preferably cells expressing between approximately 0.5 and 0.9 units CatD enzymatic activity/mg protein.
  • Cells with less than approximately 0.04 units CatD activity/mg protein are considered to be low CatD producers. While the regulatory element of the present invention is capable of targeting these cells, only the constitutive part of the regulatory element would be active producing low levels of transgenes, as the cells lack the relevant factors necessary for the activation of the estrogen or retinoic acid responsive elements of the CatD regulatory element.
  • the regulatory element may be a nucleic acid molecule, including DNA, cDNA, genomic DNA and RNA eg. mRNA.
  • the regulatory element is a promoter, more preferably a CatD promoter, even more preferably a CatD promoter from retinal pigment epithelium (RPE), preferably human RPE.
  • RPE retinal pigment epithelium
  • the regulatory element includes the nucieotide sequence GGCCGCGCCCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATC CGGCCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACC CTCTCCGACCC (SEQ ID NO: 1)
  • the variant is capable of targeting CatD-expressing cells.
  • Such variants include naturally occurring allelic variants and non-naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are contemplated so long as the modifications do not result in loss of activity of the regulatory element.
  • the variant has at least approximately 80% identity to the relevant part of the above sequence, more preferably at least approximately 90% identity, most preferably at least approximately 95% identity.
  • Such variants include, for example, those having nucleic acid changes which result in conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence.
  • Such variants also include nucleic acid sequences which are antisense to the above sequence.
  • the regulatory element includes a nucieotide sequence selected from the group consisting of:
  • the regulatory element may include other fragments of the sequences shown in Figures 13 (SEQ ID No. 5) and 14 (SEQ ID Nos: 6 and 7), produced by restriction enzyme cuts such as Bs Y, promoter 154-835, Ms ⁇ , promoter 328-835 or SfL, promoter 460-835. These may provide further specificity to RPE cells.
  • RPE cells may be further increased by the elimination of the estrogen responsive elements totally (480-728 bp; see Fig 13) or partially, E1 480-
  • elimination of the initiation site (752-786 bp; see Fig 13) which is responsible for non retinoic acid mediated expression may increase specificity, particularly eliminating the expression of transgenes in a constitutive manner in cells expressing low levels of CatD.
  • the CatD expressing cells are eye cells, more preferably human eye cells.
  • the invention may be applied to target cells outside the eye and in species other than humans.
  • the target cells in the eye include the RPE cells, iris epithelium, ciliary bodies.
  • Another group of cells which are known to express high levels of CatD are cancer cells.
  • a vector capable of targeting CatD expressing cells preferably cells expressing a high level of CatD, said vector including a regulatory element according to the present invention.
  • Said vector may further include a transgene capable of expression in said
  • the invention not only enables the specific targeting of CatD-expressing cells but, in contrast to the widely used viral promoters (RSV, CMV, MLP), it enables the internal CatD regulatory elements to control the expression of the transgene.
  • RSV widely used viral promoters
  • CMV CMV
  • MLP widely used viral promoters
  • the regulatory element may be a nucleic acid molecule, including DNA, cDNA, genomic DNA and RNA eg. mRNA.
  • the regulatory element is a promoter, more preferably a CatD promoter, even more preferably a CatD promoter from retinal pigment epithelium (RPE), preferably human RPE.
  • RPE retinal pigment epithelium
  • the regulatory element includes the nucieotide sequence
  • the regulatory element includes a nucieotide sequence selected from the group consisting of:
  • the regulatory element may include other fragments of the sequences shown in Figures 13 (SEQ ID No. 5) and 14 (SEQ ID Nos: 6 and 7), produced by restriction enzyme cuts such as BsN, promoter 154-835, Msil, promoter 328-835 or SfL, promoter 460-835. These may provide further specificity to RPE cells.
  • RPE cells may be further increased by the elimination of the estrogen responsive elements totally (480-728 bp; see Fig 13) or partially, E1 480-
  • elimination of the initiation site (752-786 bp; see Fig 13) which is responsible for non retinoic acid mediated expression may increase specificity, particularly eliminating the expression of transgenes in a constitutive manner in cells expressing low levels of CatD.
  • the CatD expressing cells are eye cells, more preferably human eye cells.
  • the invention may be applied to target cells outside the eye and in species other than humans.
  • the target cells in the eye include the RPE cells, iris epithelium, ciliary bodies.
  • Another group of cells which are known to express high levels of CatD are cancer cells.
  • the transgene may be DNA and/or RNA and/or a nucieotide sequence which is in antisense orientation to the target sequence.
  • the transgene or the target sequence may be a nucleic acid sequence which is implicated in the causation exarbation of a pathological condition.
  • the transgene may code for a genomic DNA or cDNA sequence.
  • the antisense transgene may be a DNA sequence targeting genomic DNA, cDNA or mRNA.
  • the transgene may code for a protein or RNA sequence depending the target condition and whether down or upregulation of gene expression is required.
  • the target gene is expressed in the RPE, however the invention is not limited to such genes.
  • the target gene is selected from the group consisting of RPE 65, CatD, cathepsin S, CRALBP, vascular endothelial growth factor (VEGF) and Fibroblast growth factor (FGF).
  • the transgenes of non RPE origin may include reporter genes such as lacZ and green fluorescent protein (GFP), and genes specifically expressed in other cell types within the eye such as opsin.
  • the transgene may also include start codons (ATG) and a variety of stop codons and introns.
  • the transgene may be in antisense orientation coding for an RNA capable of inhibiting protein translation from the mRNA sequence.
  • the vector may be of any suitable type and may be viral or non-viral.
  • the vector may be a recombinant virus.
  • the vector may be an expression vector.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; transgenic animal plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the vector may further include a nucleic acid sequence which mediates the delivery and production of the transgene.
  • the vector may include the regulatory element of the present invention, with or without a spacer, the transgene with or without 3' untranslated regions and/or viral polyA signals.
  • the vector or backbone may be a plasmid, for example a mammalian expression vector such as pCDNA2, pGEM etc., a bicistronic expression vector such as pi RES 1 neo, or a recombinant virus such as adenovirus, adenoassociated virus, retrovirus, sendai virus, lentivirus, etc.
  • a mammalian expression vector such as pCDNA2, pGEM etc.
  • a bicistronic expression vector such as pi RES 1 neo
  • a recombinant virus such as adenovirus, adenoassociated virus, retrovirus, sendai virus, lentivirus, etc.
  • the vector backbones in addition to the regulatory element and the transgene or transgenes, may include further elements necessary for transgene expression in different combinations, for example origin of replication (ori), multiple cloning sites, spacer sequences, polyadenilation signals (eg SV40), enhancers, synthetic introns (eg IVS), antibiotic resistance genes (eg Neo) and other marker genes.
  • the vector may also contain a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the regulatory element of the present invention may also be used with other full promoters or partial promoter elements.
  • the vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector backbone, such as a plasmid or viral vector backbone, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises a transgene.
  • a host cell including, eg. genetically engineered with, a vector of the present invention.
  • the host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes.
  • the culture conditions such as temperature, pH and the like, will be apparent to the person skilled in the art.
  • compositions for the prophylaxis or treatment of a pathological condition including a regulatory element and/or a vector according to the present invention and a pharmaceutically acceptable excipient, diluent or carrier therefor.
  • a method for prophylaxis or treatment of a pathological condition in a subject in need thereof including administering to said subject an effective amount of a regulatory element and/or a vector according to the present invention.
  • a regulatory element and/or a vector according to the present invention for preparation of a medicament for the prophylaxis or treatment of a pathological condition.
  • the pathological condition may be a pathological condition of the eye, such as an eye disease, preferably an eye disease in which up or down regulation of gene expression can be beneficial.
  • the pathological condition may be any disease where a genetic failure or acquired abnormality in the RPE cells have clinical consequences such as subretinal neovascularisation, Early Childhood Retinal Degeneration and Age Related Macular Degeneration.
  • prophylaxis or treatment of said pathological condition includes amelioration of said condition.
  • said method of treatment may be a method of gene therapy.
  • an effective amount is meant a therapeutically or prophylactically effective amount. Such amounts can be readily determined by an appropriately skilled person, taking into account the condition to be treated, the route of administration and other relevant factors. Such a person will readily be able to determine a suitable dose, mode and frequency of administration.
  • the subject to be treated is preferably a human, although the methods of the present invention may also be used to treat other mammals such as cats, dogs, horses, sheep, pigs and cattle.
  • the regulatory element and/or vector of the present invention may be administered via any suitable route.
  • it may be administered by routes including the topical, oral, rectal, parenteral (eg. intravenous, subcutaneous or intramuscular), nasal and inhalation routes.
  • parenteral eg. intravenous, subcutaneous or intramuscular
  • the pharmaceutical composition may be in any suitable form, including but not limited to capsules, cachets, tablets, aerosols, powder granules, micronised particles, solutions, emulsions and as a bolus etc.
  • the active ingredient may be incorporated into biodegradable polymers allowing for sustained release, the polymers being implanted in the vicinity of where delivery is desired.
  • biodegradable polymers and their use are described in detail in Brem et al., J Neurosurg.. 74:441-446 (1991 ).
  • Such formulation techniques include the step of bringing into association the active ingredient and the pharmaceutically acceptable carrier(s), diluent(s) or excipient(s).
  • the formulations are prepared uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • Figure 1 Histopathology human sample retinas following picro-Mallory staining.
  • A A typical morphology of an intact retina (sample 12).
  • B Demonstration of a typical hyalinised drusen in sample 10.
  • C Soft granular drusen in sample 11.
  • D Demonstration of the subretinal neovascular membrane (CNV) in sample 13.
  • FIG. 2 (A) Histopathology of a typical human ciliary body and iris following picro-Mallory staining (sample 2).
  • B-D Immunohistochemistry of normal human eyes following CatD staining.
  • B left panel: CatD immunohistochemistry of a normal human retina (sample 6); right panel: control mouse anti-human IgG monoclonal antibody immunoreactivity of the same sample.
  • the neural retina and the RPE layer are partially detached from the choroid. Strong CatD related immunohistochemical signal present in the RPE layer (arrow) and a signal of medium intensity in the ganglion cell layer (small arrow).
  • C CatD immunoreactivity in the pigmented epithelium of the ciliary body (sample 2) and (D) in the anterior dilator epithelium of the iris (sample 6)
  • FIG. 3 CatD immunoreactivity in the retinal pigment epithelial layer of representative samples.
  • A RPE CatD immunoreactivity in normal, Gp1 , young retina (sample 1) and (B) in a normal, Gp1 , old retina (sample 5).
  • C Typical RPE immunoreactivity around a hyalinised drusen in Gp2 samples (sample 9).
  • D RPE CatD immunoreactivity around soft granular drusen in a Gp3 (sample 11).
  • E Immunoreactivity around a drusen in a sample with geographic atrophy (sample 12).
  • F CatD immunoreactivity in a sample with subretinal neovascularisation (sample 13), arrow pointing to RPE cells. Note no staining of fibrovascular tissue.
  • Figure 4 CatD immunoreactivity in the retinal pigment epithelial layer of sample 12 at posterior (A) and at anterior (B) locations.
  • FIG. 5 Tissue distribution of RPE CatD expression.
  • a top An autoradiograph of Northern blot I containing lane 1 : RPE, lane 2: D407, lane 3: MCF7 and lane 4: HepG2 cell total RNA.
  • A, bottom Expression of GAPDH housekeeping gene on the same blot .
  • B. An autoradiograph of Northern blot II, the commercial human MTN, containing mRNA from heart (lane 1 ), brain (lane 2), placenta (lane 3), lung (lane 4), liver (lane 5), skeletal muscle (lane 6), kidney (lane 7) and pancreas (lane 8). Both blots were probed with RPECatD.
  • Figure 6 An autoradiograph of an RNase protection assay demonstrating CatD RNase protected fragments of: lane 1 : transfer RNA, lane 2: MCF7 cells, lane 3: RPE cells. The two major TSS are indicated with arrows.
  • Figure 7 An autoradiograph of an RNase protection assay comparing the intensity of CatD RNase protected fragments of rod outer segment (ROS) challenged and unchallenged RPE cells. Top: Lane 1 RPE cells, lane 2: RPE cells challenged with ROS, and lane 3: tRNA. Bottom: GAPDH RNase protected fragments of the same samples.
  • ROS rod outer segment
  • Figure 8 Northern blot analysis of CatD expression in rod outer segment challenged and unchallenged RPE cells.
  • A Ethidium bromide staining of total RNA loaded.
  • Lane 1 RPE cells, lane 2: rod outer segment (ROS) challenged RPE cells.
  • B Northern blot analysis of panel A.
  • Lane 1 RPE cells, Iane2: ROS challenged RPE cells.
  • Figure 9 Outline of the CatD promoter region showing five TSS.
  • the two major TSS identified in MCF7 and RPE cells are indicated by black lines and the TATA box with an arrow.
  • FIG. 10 Electroretinograms (ERGs) obtained from representative rats at 4 and 10 days post-injection with vehicle and AdRSVnlslacZ.
  • A. Typical ERG traces recorded from the left and right eye of a rat at 4 days after subretinal injection of vehicle into the right eye.
  • B. Typical ERG traces recorded from the left and right eye of a rat at 4 and 10 days after subretinal delivery of AdRSVnlslacZ into the right eye.
  • Figure 11 LacZ activity in non-pigmented (a-d) and pigmented (e-f) rat eyes following subretinal injection of AdRSVnlslacZ (a-d) or AdCMVIacZ (e-f) at 7 days post-injection, (a) Gross morphology of an eye after X-gal staining (X4.5), (b) Wholemount preparation of the eye in panel a, showing that the LacZ-positive cells were confined to a circular area within the bleb created (X10), (c) Re- composed computer image of the whole mount preparation in panel b, captured by a BioRad MRC-1000 confocal microscope for quantification of the cells expressing lacZ (X5).
  • Figure 12 Fluorescent micrographs of RPE cells 48 hours post-transfection with pEGFP-CatDf.
  • Figure 13 Nucieotide sequence of CatD promoter region.
  • the cloning boundaries in pCatD-gfp are indicated by bent arrows.
  • USF and SP1 binding sites are represented by forward and backward arrows, respectively.
  • the estrogen and RA responsive regions are represented by lines above and below the sequence, respectively.
  • Figure 14 Alignment of nucieotide sequence of the human Cathepsin D promoter region between MCF-7 cells and leukocytes and diagram summary of relative regulatory elements.
  • the transcribed sequences are shown in upper case.
  • the transcriptional site and the initiating codon are indicated by "I, II, III, VI, V” and " * " above the sequence, respectively.
  • Sp1 binding sites ( ⁇ «) and Ap-2 binding sites (>») in the direct and reverse orientations, respectively, are labelled under the sequence.
  • Imperfect palindromes containing > 10 nucleotides including TGA or TCA motifs are underlined or uplined.
  • TATA and CCAAC boxes are labelled in blocks.
  • RA-responsive region is indicated in blocks.
  • E1 -4 or ERE represent estrogen-responsive elements.
  • FIG. 15 Structure of Cathepsin D promoter region and EGFP recombinants.
  • E1-3 and ERE indicate estrogen-responsive elements; RA indicates retinoic acid- responsive region; Sp1 , MLPE (the adenovuris major late promoter element) and AP2 are general regulatory elements. Arrowhead shows TATA box; l-V indicate CatD transcription sites and +1 represents the coding region.
  • the Constructs are shown below, with the corresponding Cathepsin D promoter fragments; EGFP (enhancer green fluorescent protein) in pEGFP-1 N is used for a reporter gene in the constructs.
  • Figure 16 Diagram of the construct preparation of the CatD promoter region and pEGFP-1 N.
  • the eyes were obtained on average 3-4 hours after death, except the eye of a 5 year old child which was obtained at autopsy. Before enucleation intravitreal injection of Lillie's buffered formalin through the pars plana was performed. Following enucleation the eyes were fixed in Lillie's buffered formalin for a minimum of 24 hours at room temperature. The eyes were opened in the horizontal plane and examined macroscopically. The position on the sclera corresponding to the macula was localised by observing the tip of a fine probe during transillumination, and the spot marked with concentrated Harris's haematoxylin solution. The inferior section was made using a 10 mm corneal trephine from within the eye.
  • Specimens were sequentially dehydrated up to 70 % alcohol, then placed in 90 %, 95 % and 100 % alcohol under evacuation for a period of 4 hours each.
  • the eyes were double embedded in paraffin wax, and serial sections (6 ⁇ m) cut through the optic disc and macula, using the marked spot on the sclera as a guide. Every tenth section was stained by the picro-Mallory method and adjacent sections from each sample were placed on 3- aminopropyltriethoxysilane (APES) ( Sigma Chemical Co., St Louis, Miss, USA) coated glass slides.
  • APES 3- aminopropyltriethoxysilane
  • the sections were deparaffinised with xylene, and rehydrated through graded alcohol's to distilled water. All subsequent incubation steps were carried out at room temperature. Sections were immersed in Tris buffered saline (TBS) (pH 7.2) for 5 minutes before being bleached to remove melanin. Bleaching was carried out at various stages, prior to and after incubation with normal horse serum, primary antibody, secondary antibody and chromagen to determine the effect of bleaching on CatD immunoreactvity. Procedure which did not result in a signal decrease was applied for the study. The optimal bleaching procedure was performed as follows. Sections were incubated in 0.25 % Potassium Permanganate for 45 minutes followed by 1 % Oxalic Acid for 5 minutes. After three 5-minute washes in TBS, the sections were processed for immunohistochemistry as usual. Monoclonal CatD Antibody staining
  • Sections were blocked with 10 % normal horse serum for 30 minutes and then subjected to a further three 5-minute washes.
  • a monoclonal mouse anti- human CatD (Calbiochem-Novabiochem Corporation, San Diego, California, USA) was applied to the sections at a concentration of 5 ⁇ g/ml for 1 hour.
  • a monoclonal mouse anti-human IgG was used at the same concentration on control sections. After washing, sections were incubated for 1 hour with horse anti-mouse IgG conjugated to alkaline phosphatase, (Vector Laboratories Incorporated, Burlingame, California, USA) at a dilution of 1/250.
  • immunodetection was carried out by incubating the sections in SIGMA FASTTM Fast Red TR/Naphthol AS-MX (Sigma Chemical Company, St Louis, Missouri, USA) for 20 minutes, resulting in a red/pink deposit.
  • a light counterstain was applied by immersing the sections in Meyer's Haemotoxylin for 5 seconds followed by 10 minutes in tap water. Finally, sections were mounted for bright field light microscopy using a glycerol based mounting medium.
  • CNVM choroidal neovascular membrane
  • BLD basal laminar deposit as peer Groups 1 -6 (see materials and methods)
  • Eyes 6 and 7 had up to 20 small hard drusen of the hyalinised variety within the inner macular.
  • BLD was present only occasionally over drusen thus these eyes were considered normal.
  • Eyes 9 and 10 had masses of hard drusen (Fig. 1 B) mostly within the inner macula, the largest drusen were 125 ⁇ m diameter. Small clumps of BLD were found over the surface of the largest drusen in both eyes.
  • Eye 11 from a 94-year-old patient presented soft distinct drusen (Fig. 1C) derived from clusters of small hard drusen outside the macula in the region of the arcades. There was no BLD over the drusen.
  • RPE cells demonstrated a high level, perhaps increased, CatD immunoreactivity around hyalinised drusen (Fig. 4C).
  • the presence of BLD or soft drusen did not affect CatD signal intensity (Fig. 4D).
  • RPE related CatD immunoreactivity remained high around the hyalinised drusen outside the area of atrophy (Fig. 4E) and CNV (data not shown) and in the location of the neovascular membrane (Fig. 4F arrow). There was no CatD immunoreactivity either in drusen or in the neovascular membrane of the CNV sample. There was no CatD immunoreactivity either in drusen or in the neovascular membrane of the CNV sample.
  • RPE CatD immunoreactivity remained strong at all geographical positions. There was no difference in signal intensity between sections derived from the anterior and posterior retina (Fig. 4)
  • a cDNA library prepared from cultured human RPE cells challenged with bovine ROS was constructed in the vector LambdaGEM-4. To obtain full length clones the library was screened with the Hind III fragment of a CatD clone (M13/CatD), corresponding to the first 1571 bp of the human CatD mRNA. The library was screened by plaque lifts on Zeta-Probe GT membrane (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were prehybridized and hybridized in 0.25 M Na 2 HP0 4 pH 7.2, 7 % SDS at 45°C for 5 minutes and 4-24 hours respectively.
  • the membranes were washed twice in 20 mM Na 2 HP ⁇ 4 pH 7.2, 5 % SDS for 30 minutes then twice in 20 mM Na 2 HP0 4 pH 7.2, 1 % SDS also for 30 minutes each. The washes were performed at 50°C and raised to 55°C when higher stringency was required.
  • the resulting clones in LambdaGEM-4 were converted to plasmid form, pGEM-1 , by digestion with Spe I and re-ligation.
  • the plasmid DNA was extracted and purified with Midi Qiagen-100 columns following the manufacturer's instructions (Qiagen, Hilden, Germany) and analyzed by Southern blot hybridization using conditions described above. Plasmids were sequenced in both directions using automated sequencing. The reactions were performed using a PRISMTM Ready Reaction DyeDeoxyTM Terminator Cycle Sequencing Kit and analyzed on an Applied Model 373A Automated Sequencer (Perkin-Elmer Applied Biosystems, Foster City, CA, USA).
  • 5' RACE was performed with the Marathon cDNA Amplification Kit following the manufacturer's protocol (Clontech Laboratories, Palo Alto, CA, USA).
  • a CatD- specific primer spanning part of the coding region +349-+368 was used to prime the reverse transcriptase reaction.
  • the cDNA was synthesized from RNA extracted from the same cells used to construct the cDNA library and amplified using PCR with a kit primer complementary to the 5' adaptor and a CatD-specific primer spanning a part of the coding region +325-+347.
  • Synthetic oligonucleotides (primers) were synthesized by Bresatec Pty. Ltd. (Thebarton, SA, Australia).
  • the 5' RACE product was purified on agarose, and sequenced in both directions as described above.
  • Northern Blot I was prepared using 10 ug of total RNA, which was extracted from different cell lines of human origin namely, low passage human RPE cells, HepG2 cells (a human hepatocellular line), MCF7 cells (a human breast cancer cell line), and D407 cells (an immortal human RPE cell line).
  • the HepG2 and MCF7 cells were obtained from the American Type Culture Collection (ATCC, Rockville, USA) and maintained as recommended. Primary RPE cell cultures from human donor tissue were established as previously described. The total RNA was electrophoresed, transferred to Zeta-probe GT membrane then hybridized.
  • Northern Blot II contained 2 ug of polyA + RNA from human heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas was purchased. Both Northern blots I and II were probed with the CatD cDNA insert isolated from the RPE cDNA library and the purified 5' RACE product labelled with a- 32 P-dCTP (Du Pont, Boston, MA, USA) by nick translation (Promega Corporation, Madison, Wl, USA).
  • Rat GAPDH cDNA is 89 % homologous to human GAPDH cDNA, which is sufficient to hybridize with the transcripts from the human derived cell lines.
  • RNase protection assay A clone containing 5'-prime upstream sequences of CatD was obtained, and the region containing the transcriptional start sites (TSS) was sub-cloned into pGEM-3Zf (Promega Corporation, Madison, Wl, USA). The resulting clone spanned the sequence numbered 702-1002 of genomic CatD sequence, HMCATD1 (GenBankTM #M63134). This 301 bp insert corresponded to the upstream region of CatD spanning from -178 bb relative to the ATG, included exon 1 , to within the first intron.
  • RNA probes were synthesized using the Riboprobe System (Promega Corporation, Madison, Wl, USA) incorporating a- 32 P- CTP (Du Pont, Boston, MA, USA). Rat GAPDH was used as a control to demonstrate equal RNA amounts in all samples.
  • the CatD and GAPDH probes were purified from unincorporated radioactive nucleotides using Chromaspin DEPC-30 and DEPC-400 columns respectively (Clontech Laboratories, Palo Alto, CA, USA).
  • Total RNA was extracted from MCF7 cells, cultured human RPE cells that were either unchallenged or challenged with bovine ROS for 24 hours. An equal amount of yeast tRNA was used as a negative control to identify any self- protected fragments from the probes.
  • the assay was performed with 10 ug total RNA for each sample using a commercial RNase Protection kit (Boehringer Mannheim, Mannheim, Germany).
  • the protected RNA products were analyzed on a 7M urea / 8 % polyacrylamide gel.
  • Radioactive pGEM-3Zf dideoxy reaction products were run in parallel as a size marker (Omnibase DNA cycle sequencing system, Promega Corporation). Single stranded DNA (sequencing products) run approximately 10 % slower than single-stranded RNA (RNA protected products) and this was taken into account when identifying the TSS.
  • RPECatDE was identical to the kidney CatD cDNA sequence, HMCTHD,
  • the extreme 5' end and start codon missing from RPECatDE was subsequently isolated using 5' RACE.
  • the RACE fragment (RPECatDF) that was approximately 400 bp long (data not shown) overlapped with RPECatDE and contained the missing 5' region which includes the start codon.
  • the sequence of RPECatDF contained the adaptor primer sequence and CatD sequence corresponding to the beginning of the start codon at position +1 to the end of the primer used to generate the product which is at position +347. No sequence upstream of the start codon was isolated. There were no differences between the RPECatDF and the relevant kidney CatD cDNA sequence.
  • the full length RPE CatD and the kidney CatD cDNA sequence differ slightly from other CatD sequences previously reported.
  • RPECatD and kidney CatD cDNA sequences differed from MCF7 CatD cDNA sequence by 5 mutations at single base-pair sites, 4 of these are silent mutations and therefore are likely to be polymorphisms.
  • the CatD cDNA sequence from estrogen responsive breast cancer cells, ZR-75 contains 1 silent mutation and 1 bp deletion compared to the kidney(Westley B.R. et al. 1987) and RPECatD sequences.
  • CatD a human CatD cDNA clone from fibroblasts is identical to the kidney cDNA sequence except for a transition (A-G) at position +1306 and an extra 17 bp at the 5' end (Conner G.E. et al. 1989). Considering that several rounds of low stringency screenings with different probes all isolated clones identical to CatD it can be concluded that the main aspartic protease present in RPE cells is CatD
  • CatD the relative levels of CatD expression in cell lines and tissues was investigated.
  • the mRNA expression of CatD transcripts was monitored by the appearance of a signal at 2.2 kb, on Northern blots I and II.
  • CatD expression was detected in RPE cells, D407, MCF7 and HepG2 cell lines at varying intensities.
  • the expression of CatD was the strongest in RPE cells ( Figure 5A, lane 1) followed by an intense signal in MCF7 cells ( Figure 5A, lane 3). MCF7 cells, in agreement with previous reports, demonstrated elevated levels of CatD mRNA expression.
  • CatD was moderately expressed in the HepG2 cells (Figure 5A, lane 4) and very weakly in the D407 cells (Figure 5A, lane 2).
  • the human tissue blot demonstrated the ubiquitous expression of CatD ( Figure 5).
  • the strongest CatD expression was found in heart, lung, liver and skeletal muscle tissue samples ( Figure 5B, lanes 1 ,4,5 and 6, respectively).
  • the TSS utilized by the RPE cells were investigated by a RNase protection assay.
  • the RNase protection patterns of RPE cells (Figure 6, lane 3) showed two TSS which were approximately 90 and 131 nucieotide long and corresponded to -20 and -72 TSS (Cavailles V. et al. 1993) utilized by MCF7 cells ( Figure 6, lane 2).
  • the use of the same two TSS sites was shown in the RPE cell cultures from two different donors (data not shown) suggesting that these TSS sites are exclusively responsible for the expression of CatD in RPE cells.
  • AdRSVIacZ was used to infect 40 160cm 2 tissue flasks of 293 cells. The infected cells were harvested and the resulting adenovirus purified on cesium chloride density gradients, dialysed against phosphate buffered saline (PBS), resuspended to a final concentration of 10% glycerol and stored at -70°C.
  • PBS phosphate buffered saline
  • the virus was titred by limiting dilution and also by spectrophotometry.
  • the replication deficient adenovirus carrying the human cytomegalovirus (CMV) promoter-controlled E.coli lacZ reporter gene (AdCMVIacZ) was a gift from Dr. Karpati and the titre of this virus was 1x10 12 pfu/ml.
  • a 32 gauge needle attached to a 5 ml Hamilton syringe was inserted through the puncture tangentially towards the posterior part of the eye and the advancement of the needle was observed under an operating microscope.
  • Two microlitres of AdRSVnlslacZ, or AdCMVIacZ (each containing 7 x 10 8 pfu of the virus) or vehicle (PBS containing 10% glycerol) were delivered into the subretinal space.
  • the retina was closely observed at the penetrating site under an indirect ophthalmoscope.
  • the conjunctiva was then replaced and an antibiotic solution (gentamicin) was applied on the eye at the site of the wound.
  • Electroretinography ECG
  • the eyes of RCS rdy rats injected subretinally with the AdRSVnlslacZ and vehicle were assessed using ERG. Following anaesthesising the rat and dilation of the pupil as described above, the rat was placed in a stereotaxic frame. The corneas were kept moist with Celluvisc. The animals used for ERG analysis were then allowed to dark adapt for 30 min before recording of scotopic flash electroretinograms. A platinum wire loop was placed on each cornea to act as the recording electrode and a reference electrode was connected to each other. Ground electrodes were attached to the animal's back. A xenon strobe light placed 0.5m in front of the animal presented the flash stimulus at 0.25 Hz.
  • the fixed-eyes were incubated overnight at room temperature in 1 mg/ml 5-bromo-4-chloro-3-indolyl-b-D- galactopyranoside (X-gal) solution containing 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 2 mM MgCI 2 in PBS before being processed for whole mount preparation and paraffin embedding.
  • X-gal 5-bromo-4-chloro-3-indolyl-b-D- galactopyranoside
  • the anterior chamber and lenses were removed. Four to five radial incisions were made at the peripheral part to enable the eye cup to be flattened, sclera side down, onto a silanated glass slide. The neural retina was then gently peeled off and the remaining tissue coverslipped. In krypton laser-treated eyes, the whole mount was prepared in a similar manner but the neural retina was not removed.
  • Quantitation of cells expressing LacZ was performed using image capture and analysis. Images of the cell layer in the wholemount preparation were recorded using the transmission detector of a BioRad MRC-1000 confocal microscope attached to a Nikon Diaphot 300 inverted microscope. The microscope was equipped with an electronic stage programmed to collect images with an overlap of 10 pixels. The image size was 512 x 512 pixels or 312 x 312 mm (pixel size 0.6 mm 2 ). A 20 x OlanApo lens with a numerical aperture of 0.75 (Nikon) was used. The zoom was adjusted to 1.5 and all three lines of the Krypton/Argon laser (488, 568 and 647 nm) were used for illumination. Movement of the stage was controlled using a macro under BioRads macro programming language (MPL) programme. The focus was adjusted manually.
  • MPL BioRads macro programming language
  • electroretinography was used to clinically evaluate any changes in the responsiveness of the retina to light at 4 and 10 days post- injection.
  • the subretinal injection of vehicle alone had no significant effect upon a- or b-wave amplitude of the scotopic flash elecroretinogram recorded at 4 and 10 days post-injection (Table II) demonstrating that the procedure itself did not cause significant retinal damage.
  • Fig. 10a shows typical ERG traces recorded from the left and right eyes of a rat at 4 days after subretinal injection of vehicle into the right eye. TABLE II: Measurement of a- and b-wave amplitude of the scotopic flash electroretinogram at 4 and 10 days after subretinal injection
  • Typical ERG traces, recorded following the subretinal injection of AdRSVnlslacZ, are shown in Fig. 10. It can be seen in Table II that the ERG a- wave amplitude was suppressed on day 4 and day 10 following subretinal injection but these results were not statistically different from the mean a-wave amplitudes obtained from the contralateral control eyes (p>0.05). However, a subretinal injection of AdRSVnlslacZ caused a significant suppression of the scotopic ERG (b-wave). At four days post-injection, the mean b-wave amplitude was 105 ⁇ 16 ⁇ V compared with the contralateral control value of 245 ⁇ 23 ⁇ V (n 4, p ⁇ 0.05).
  • RCS rdy rat eyes were injected with AdRSVnlslacZ.
  • the nuclear localisation of the transgene gave a clear definition of the transduced cells (Fig. 11 inset) and the resultant whole mount retinal images were suitable for quantification.
  • the number of lacZ-positive cells in the eight eyes sampled were 7140, 6338, 4269, 3885, 3698, 3370, 3138, and 2381 , respectively with a mean and standard deviation of 4277+1632.
  • gfp green fluorescent protein
  • RPE retinal pigment epithelial
  • the plasmid pEGFP-N1 (Clontech) contains the gfp gene driven by the CMV promoter. In addition, this plasmid contains a multiple cloning site immediately upstream of the gfp gene and it also contains the neomycin resistance gene (neo r ) for antibiotic selection if required.
  • the CMV promoter was removed from pEGFP-N1 by restriction enzyme digestion with Ase ⁇ and
  • the cut plasmid was then blunt ended and relegated to yield a gfp plasmid containing no promoter, pEGFP-NP.
  • a 773 bp fragment of the human CatD promoter (-770bp to -3bp relative to the ATG start codon) was excised from a plasmid containing the CatD gene with the restriction enzyme Mall I. The resulting fragment was blunt ended with T4 DNA polymerase in order to remove the 3'overhang containing the CatD gene start codon.
  • pEGFP-NP was linearised eg. with the blunt ended restriction enzyme £co/CR1 which cut within the MCS.
  • Each of the CatD promoter fragments was cloned into this site (see Figure 16). Clones were obtained with the CatD promoter fragments in the correct forward orientation (pEGFP-CatDf) and in the backward orientation (pEGFP-CatDb).
  • Cell lines A range of human, rat and murine cell lines were tested for their ability to express gfp when using the CatD promoter. We chose cells that are well characterised in their CatD expression status as well as some less well studied cells. The cells tested are listed below:
  • D407 a human RPE cell line that only expresses immature CatD by Western blot analysis.
  • MDA-MB-231 human breast adenocarcinoma
  • MDA-MB-468 human breast adenocarcinoma
  • MCF7 oestrogen responsive human breast adenocarcinoma cell line that expresses high levels of CatD.
  • GFP could be detected in RPE cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La cathépsine D est une protéase aspartique lysosomiale laquelle est exprimée dans tous les tissus. Un promoteur de cathépsine D et son utilisation sont revendiqués.
PCT/AU2000/000276 1999-03-31 2000-03-31 Element regulateur de cathepsine d WO2000060067A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU34103/00A AU3410300A (en) 1999-03-31 2000-03-31 Cathepsin d regulatory element

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AUPP9520A AUPP952099A0 (en) 1999-03-31 1999-03-31 Regulatory element and uses thereof
AUPP9520 1999-03-31

Publications (1)

Publication Number Publication Date
WO2000060067A1 true WO2000060067A1 (fr) 2000-10-12

Family

ID=3813716

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2000/000276 WO2000060067A1 (fr) 1999-03-31 2000-03-31 Element regulateur de cathepsine d

Country Status (2)

Country Link
AU (1) AUPP952099A0 (fr)
WO (1) WO2000060067A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1662000A2 (fr) 2004-11-25 2006-05-31 SunGene GmbH Cassettes d'expression pour l'expression préférée dans des cellules stomatiques de plantes
EP1669456A2 (fr) 2004-12-11 2006-06-14 SunGene GmbH Cassettes d'expression pour l'expression preférentielle dans les méristèmes de plantes

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL AUGEREAU P. ET AL.: "Characterisation of the proximal estrogen-responsive element of human cathepsin D gene" *
DATABASE EMBL CAVAILLES V. ET AL.: "Cathepsin D gene is controlled by a mixed promoter and estrogens stimulate only TATA-dependent transcription in breast cancer cells" *
DATABASE EMBL MAY F.E.B. ET AL.: "The human cathepsin D-encoding gene is transcribed from an estrogen-regulated and a constitutive start point" *
GENE, vol. 134, 1993, pages 277 - 282 *
MOL. ENDOCRINOL., vol. 8, no. 6, 1994, pages 693 - 703 *
PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 203 - 207 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1662000A2 (fr) 2004-11-25 2006-05-31 SunGene GmbH Cassettes d'expression pour l'expression préférée dans des cellules stomatiques de plantes
EP1669456A2 (fr) 2004-12-11 2006-06-14 SunGene GmbH Cassettes d'expression pour l'expression preférentielle dans les méristèmes de plantes

Also Published As

Publication number Publication date
AUPP952099A0 (en) 1999-04-22

Similar Documents

Publication Publication Date Title
TWI702955B (zh) 使用腺相關病毒（ａａｖ）ｓｆｌｔ-１治療老年性黃斑部退化（ａｍｄ）
Sarra et al. Gene replacement therapy in the retinal degeneration slow (rds) mouse: the effect on retinal degeneration following partial transduction of the retina
US9707304B2 (en) Materials and methods for the treatment of pathological neovascularization in the eye
Tamm Myocilin and glaucoma: facts and ideas
US20220040333A1 (en) Use of neuroglobin agonist for preventing or treating mitochondrial RCCI and/or RCCIII deficiency disease
CN114480502A (zh) 用于将多核苷酸玻璃体内递送到视网膜视锥的组合物和方法
Abe et al. Iris pigment epithelial cell transplantation for degenerative retinal diseases
AU2003297607A1 (en) Materials and methods for treating ocular-related disorders
US11351225B2 (en) Methods for modulating development and function of photoreceptor cells
JP2000507915A (ja) 遺伝子療法のためのｄｎａ担体としてのヒアルロン酸および異常な網膜血管新生を治療するためのｖｅｇｆアンチセンスｄｎａ
Fu et al. Clinical applications of retinal gene therapies
Semkova et al. Overexpression of FasL in retinal pigment epithelial cells reduces choroidal neovascularization
US11096955B2 (en) Synthetic promoters and uses thereof
WO2000060067A1 (fr) Element regulateur de cathepsine d
CN114381465B (zh) 优化的cyp4v2基因及其用途
WO2021174173A1 (fr) Traitement de bestrophinopathies dominantes autosomiques et procédés d'évaluation de celles-ci
JP2023544894A (ja) Ｐｌｖａｐを有効成分として含む網膜又は脈絡膜疾患の予防又は治療用薬学的組成物
Aguirre et al. The use of canine models to develop translational gene therapies for the treatment of six forms of inheritedretinal degenerationsb (Work conducted at the University of Pennsylvania-USA)
Kjellström X-linked retinoschisis electrophysiology, molecular genetics and treatment
RAKÓCZY et al. Eye diseases
JP2013516980A (ja) 核酸の細胞内伝達のための方法

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP