WO2000053781A1 - Generation de mutants de levure conditionnels, techniques et reactifs s'y rapportant - Google Patents

Generation de mutants de levure conditionnels, techniques et reactifs s'y rapportant Download PDF

Info

Publication number
WO2000053781A1
WO2000053781A1 PCT/US2000/006514 US0006514W WO0053781A1 WO 2000053781 A1 WO2000053781 A1 WO 2000053781A1 US 0006514 W US0006514 W US 0006514W WO 0053781 A1 WO0053781 A1 WO 0053781A1
Authority
WO
WIPO (PCT)
Prior art keywords
condition
sensitive
gene
yeast
restrictive
Prior art date
Application number
PCT/US2000/006514
Other languages
English (en)
Inventor
Vivian Berlin
Csilla Csank
Susan E. Smith
Donald Sullivan
Original Assignee
Gpc Biotech, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gpc Biotech, Inc. filed Critical Gpc Biotech, Inc.
Priority to EP00913902A priority Critical patent/EP1161544A1/fr
Priority to CA002366069A priority patent/CA2366069A1/fr
Priority to AU35262/00A priority patent/AU3526200A/en
Publication of WO2000053781A1 publication Critical patent/WO2000053781A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/905Stable introduction of foreign DNA into chromosome using homologous recombination in yeast

Definitions

  • the opportunistic human pathogen Candida albicans is a dimorphic asexual fungus. While this organism is usually found as a commensal of the human gut, it is also an agent of severe infection, especially of immuno-compromised individuals. The molecular mechanisms underlying pathogenicity, such as hyphal differentiation and production of virulence factors are of considerable interest. An understanding of these processes may reveal novel strategies for combating Candida infections. Recently, recombinant technology for genetic analysis of this dimorphic yeast have been developed and applied to investigate diverse biological processes (Scherer and Magee, 1990 Microbiol Rev 54:226). Numerous C. albicans genes have been cloned and the nucleotide sequences determined.
  • Candida spp in general, appear to be obligate diploids.
  • the diploid genome and asexual life cycle of C. albicans have prevented those in the art from advancing a systematic approach for developing conditional mutants of genes which are essential to viability of
  • Candida under all conditions.
  • conditional alleles e.g., temperature sensitive
  • the invention features a method for generating and identifying a strain carrying a lethal condition-sensitive mutation in a gene essential for survival.
  • a method for obtaining a condition-sensitive yeast mutant of an essential gene the yeast being an obligate diploid.
  • the method involves beginning with a diploid yeast strain which is heterozygous for a loss-of-function mutation to the essential gene, wherein the strain is viable under both a permissive condition and a restrictive condition.
  • This strain can be isolated from various sources, or generated by, e.g., homologous recombination.
  • the remaining wild-type allele of the essential gene is replaced with a condition-sensitive homolog thereof, e.g., which is lethal at the restrictive condition but not at the permissive condition, in order to generate a condition- sensitive yeast mutant.
  • at least a portion of the transcriptional regulatory sequence of the remaining wild-type allele of the essential gene is replaced with a conditional transcriptional regulatory sequence, e.g., conditionally inducible or conditionally repressible.
  • a method for obtaining a condition-sensitive yeast mutant of an essential gene the yeast being an obligate haploid.
  • the single wild- type allele of the essential gene can be replaced with a condition-sensitive homolog thereof, e.g., which is lethal at the restrictive condition but not at the permissive condition, in order to generate a condition-sensitive yeast mutant.
  • the essential gene is replaced with a conditional transcriptional regulatory sequence.
  • An exemplary obligate haploid is Candida glabrata.
  • a condition-sensitive homolog of the essential gene replaces the wild-type allele by integrative transformation.
  • integrative transformation can be accomplished with a circular vector including a recombination sequence represented by the general formula -A*-B-C*-D-, wherein A*,B, and C* represent nucleotide sequences that hybridize under physiological conditions with the wild type allele (represented by the general formula -A-B-C-) and D represents a nucleotide sequence heterologous with respect to the wild type allele of the essential gene. Linearizing the vector by cutting within B will direct integration by homologous recombination..
  • Homologous recombination with the wild type allele produces a genomic structure represented by the general formula -A-B-C*-D-A*-B-C-.
  • -A-B-C*- represents a condition-sensitive homolog of the wild type allele with the condition- sensitive mutation contained within C*.
  • -A*-B-C- represents a non-expressed homolog of the wild type allele with A* containing a premature stop codon and in some cases a frameshift mutation.
  • D contains a marker for which there is negative selection. Applying negative selection induces homologous recombination between -AB-C*- and -A*-B-C- such that the repeat is resolved and D is eliminated from the genome.
  • the condition-sensitive homolog is a temperature sensitive homolog.
  • the condition-sensitive homolog is sensitive to one or more of the concentration of an ion, the concentration of a metal, pH or osmolarity, presence or absence of a carbon or nitrogen source.
  • An exemplary condition-sensitive homolog includes an inducible N-degron, such as a heat-inducible N-degron.
  • the expression of the remaining allele can be regulated by replacining all or a portion of the transcriptional regulatory sequences, e.g., promoter(s) and/or enhancer(s), with a conditional transcriptional regulatory sequence(s), such as an inducible promoter or enhancer or a repressible promoter or enhancer.
  • a condition-sensitive transcriptional regualtory sequence of the essential gene replaces the wild- type allele by integrative transformation.
  • the diploid yeast is a Candida strain, such as may be selected from the group consisting of Candida albicans, Candida stellatoidea, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida pseudotropicalis, Candida guilliermondii, Candida utilis and Candida rugosa.
  • the diploid yeast is Candida albicans.
  • the subject method can be used to identify essential genes which are required for cell wall biosynthesis.
  • condition-sensitive homolog causes cell lysis, mitotic catastrophe or growth arrest.
  • Another aspect of the present invention provides a condition-sensitive yeast mutant generated by the subject method.
  • Another aspect of the present invention relates to a method for identifying an essential gene of an obligate diploid yeast.
  • a diploid yeast strain which is heterozygous for a loss-of-function mutation to a gene, e.g., which strain is viable under both a permissive condition and a restrictive condition.
  • the remaining wild-type allele of the gene is replaced with a condition-sensitive homolog thereof which results in a loss-of-function of the gene at the restrictive condition.
  • Whether or not the loss-of-function is cytotoxic to the yeast under the restrictive condition is determined, wherein a cytotoxic phenotype for the loss-of-function is indicative that the gene is an essential gene.
  • the present invention further provides a method for identifying a compound having cytotoxic antifungal activity.
  • the present invention contemplates the use of drug screening assays for detecting inhibitors of the function of an essential gene identified by the method set forth above in order to test compounds for their ability to inhibit the function of the essential gene.
  • Such compounds can be used, e.g., as therapeutic agents to treat animals, as antiseptic agents to treat inanimate objects, as feed supplments for livestock, an in formulations for application to plants.
  • Another aspect of the invention provides a method for obtaining a condition-sensitive yeast mutant of a gene essential to differentiation, the yeast being an obligate diploid.
  • the subject method utilizes a diploid yeast strain which is heterozygous for a loss-of- function mutation to the essential gene, which strain undergoes differentiation under both a permissive condition and a restrictive condition.
  • the wild-type allele of the essential gene is replaced with a condition-sensitive homolog thereof which prevents differentiation under the restrictive condition, but not at the permissive condition, to generate a condition-sensitive yeast mutant.
  • the subject method can be used to identify genes required for hyphal morphogenesis.
  • condition-sensitive yeast mutants of a gene essential to differentiation, where the yeast is an obligate hapolid.
  • genes are potential targets for drug screening assays generated to identify agents having antifungal activity.
  • the subject condition-sensitive yeast mutants can be used identify a gene or gene product which is differentially expressed or whose stability is altered under restrictive conditions relative to permissive conditions.
  • the subject "indexing" method can be used to detect/identify mRNA transcripts (or cDNA) which have altered levels under restrictive conditions relative to permissive conditions.
  • transcripts isolated from the condition-sensitive yeast mutants under restrictive and permissive conditions can be subjected to "differential display" using such protocols as described by, e.g., Liang and Pardee (1992) Science 257:967-971, Chuang et al., (1993) J. Bacteriol. 175, 2026-2036, Lisitsyn et al. (1993) Science 259:946-951, and US Patents 5,837,468 and 5,807,680.
  • the method Chuang et al. identifies those genes which are expressed in an organism by identifying mRNA present using randomly- primed RT-PCR. By comparing pre-infection and post infection profiles, genes up and down regulated during infection can be identified and the RT-PCR product sequenced and matched to library sequences.
  • Another indexing technique which can be used as part of the subject method is the in vivo expression technology (IVET).
  • EERT in vivo expression technology
  • This technique is described by Camilli et al., (1994) PNAS 91 :2634-2638.
  • random chromosomal fragments of target organism are cloned upstream of a promoter-less reporter gene in a plasmid vector.
  • the pool is introduced into a host and at various times after infection bacteria may be recovered and assessed for the presence of reporter gene expression.
  • the chromosomal fragment carried upstream of an expressed reporter gene should carry a promoter or portion of a gene normally upregulated during infection, Sequencing upstream of the reporter gene allows identification of the up regulated gene.
  • Another aspect of the present invention provides a method for identifying a compound having antifungal activity by providing a drug screening assay for detecting compounds which modulate the function of gene or gene product identified by the subject indexing method.
  • FIGURES 1 A and IB Schematic representation of exemplary recombination vectors
  • FIGURE 2 Growth of Candida albicans cells on YPD at 23°C and 42°C.
  • a URA3 gene lies between the two copies of the gene resulting in Uracil prototrophy.
  • Uracil prototrophic strains URA3/URA3 parent (CAF2); URA3/URA3 parent (clinical isolate SC5314); carhol ⁇ /carhol-3-UR ⁇ 3-carhol-STOP (DIY-BL2-41 and 42); carhol ⁇ /carhol-5- URA3-carhol-STOP (DIY-BL2-45 and 48); caram2 A/caram2-l-URA3-caram2-STOP
  • YPD containing 1M sorbitol and uridine in 50ml conical tubes 0.5 x 10 4 cells were added to 100 ⁇ l of YPD in microtiter dishes. Three ten- fold dilutions were made and 5 ⁇ l of each was spotted into YPD plates containing uridine to support growth or uracil prototrophic (URA/URA3) strains. Plates were incubated at either 23°C or 42°C for 2 days.
  • FIGURE 3 Regeneration of Uracil prototrophy in temperature sensitive mutants harboring a single copy of the temperature sensitive (ts) mutant gene of interest. Selected strains (from
  • Fig. 2B were chosen for reinsertion of the CaURA3 gene to obtain prototrophs.
  • the plasmid pSCaURA3.4C7 which contains CaURA3 and one copy of the hisG repeat, was linearized within the hisG sequence with Srfl to target the plasmid to the deleted alleles of either CaRAM2 or CaRHOl which contain a single hisG repeat.
  • FIGURE 4 Growth of C. albicans yeast and mycelial forms at ambient and physiological temperatures.
  • FIGURE 5 RHO1 and RAM2 mutants have hyphal defects separable from growth defects.
  • FIGURE 6A In a CaCAKl heterozygote , the remaining WT allele of CaCAKl is replaced with the CaURA3.PCKl .atgNATG.Ubi.RHCAKl cassette.
  • FIGURE 6B The depletion of CaCAKl is evident in the above western when the promoter is repressed by glucose contianing media. The consequences associated with depletion of CaCAKl on glucose plates at 42°C are illustrated.
  • FIGURE 7 A Shows the effect of depletion of CaRHOl .
  • FIGURE 7B Shows CaRHOl expression is controlled by the PCK1 promoter in glucose media.
  • FIGURE 7C Shows loss of viability when CaRHOl is depleted from cells by repressing the PCK1 promoter in glucose media.
  • the invention features a method for systematically generating mutants of obligate diploids, such as Candida and other yeast strains, having condition-sensitive lethal mutations of a gene which is otherwise essential to cell viability under all conditions of cell growth.
  • Conditional mutants make possible the analysis of physiological changes caused by inactivation of a gene or a gene product and can be used to address the function of any gene.
  • the method of the present invention can be generally characterized as follows: (i) providing a obligate diploid strain which is heterozygous for a loss-of-function mutation of an allele of an essential gene; and (ii) introducing a conditionally sensitive homolog of the gene at the functional allele by integrative transformation.
  • Candida and other obligate diploid yeast the methods of the prior art have provided techniques for generating loss-of-function mutations of non-essential genes which are conditionally essential (e.g. essential under many but not all conditions).
  • the method of the present invention can be used to generate these mutants, and as demonstrated in the appended examples, conditional loss-of-function mutants of truly essential genes.
  • the invention also features a method for systematically generating mutant strains of obligate haploid yeast having condition-sensitive lethal mutations of a gene which is otherwise essential to cell viability under all conditions of cell growth.
  • the loss-of-function phenotype can include essential genes whose activity becomes conditioned on temperature, ion, metal, pH, osmolarity, and the like.
  • the conditionally sensitive homolog can include mutations, or additional sequences (e.g. in the form of a fusion gene) which, under the non-permissive conditions, disrupts the normal bioactivity of the gene product.
  • the mutation(s) can conditionally disrupt protein-protein or protein- DNA interactions, catalytic activity (in the case of the gene encoding an enzyme), stability (folding, degradation), translocation, and the like.
  • Another aspect of the invention provides a strain of obligate diploid or haploid yeast, e.g., a Candida strain, having a condition-sensitive lethal mutation of an essential gene, e.g., which, under the appropriate conditions, is homozygous for loss-of-function of the essential gene.
  • a strain of obligate diploid or haploid yeast e.g., a Candida strain
  • having a condition-sensitive lethal mutation of an essential gene e.g., which, under the appropriate conditions, is homozygous for loss-of-function of the essential gene.
  • Another aspect of the present invention is a method for determining if a gene is (i) an essential gene, and (ii) if it is an essential gene, whether its loss-of-function is cytostatic or cytotoxic to the cell.
  • the agent In the development of antifungal agents, it is desirable that the agent is cytotoxic, not merely cytostatic.
  • essential genes which give rise to cytotoxic loss-of- function phenotypes are candidate targets for drug development assays.
  • Another aspect of the present invention provides a drug screening assay for identifying agents which inhibit the activity of the wild-type form of an essential gene identified by the assay above.
  • the invention also provides pharmaceutical preparations of such compounds, and methods for treating fungal infections using such preparations.
  • essential gene is a gene whose gene product is required for cell viability under all circumstances such that loss-of-function of the gene under any circumstance is lethal to the cell.
  • conditionally essential gene is a gene whose function is required under most, but not all, conditions for cell viability. That is, there are conditions wherein a loss-of-function mutation of the conditionally essential gene are not lethal.
  • loss-of-function refers to mutations to a gene so as to render the gene product thereof to have substantially reduced activity, or preferably no activity relative to one or more functions of the corresponding wild-type gene.
  • a “lethal loss-of-function” mutation is one wherein the activity of the mutant gene product is so impaired, relative to the wild-type gene, that the cell dies as a result of the mutation.
  • homozygous for loss-of-function refers to the loss-of-function of both alleles of a gene, or, more specifically, their gene products, either by the same or different mutations.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • a vector is an genomic integrated vector, or "integrated vector", which can become integrated into the chromsomal DNA of the host cell.
  • an episomal vector i.e., a nucleic acid capable of extra-chromosomal replication.
  • vectors capable of directing the expression of genes to which they are operatively linlced are referred to herein as "expression vectors".
  • expression vectors capable of directing the expression of genes to which they are operatively linlced are referred to herein as "expression vectors".
  • expression vectors In the present specification, "plasmid” and “vector” are used interchangeably unless otherwise clear from the context.
  • nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term should also be understood to include, as applicable to the embodiment being described, single- stranded (such as sense or antisense) and double-stranded polynucleotides.
  • gene or “recombinant gene” refers to a nucleic acid comprising an open reading frame encoding a polypeptide.
  • transfection means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
  • a "protein coding sequence” or a sequence which "encodes” a particular polypeptide is a nucleic acid sequence which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences.
  • a transcription termination sequence will usually be located 3' to the coding sequence.
  • expression refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein.
  • Cells "host cells” or “recombinant host cells” are terms used interchangeably herein.
  • proliferating and “proliferation” refer to cells undergoing mitosis.
  • strains e.g., cells
  • strains with lethal mutations are of greater interest for therapeutic research because a cytotoxic compound, for example, is generally more desirable than a cytostatic compound for use as an antifungal agent.
  • strains carrying lethal mutations must satisfy two criteria. First, when exposed to restrictive conditions for at least two growth cycles, the organism fails to grow. Examples of at least two growth cycles include at least 3, 4, 5, 7, 8, 10 or more growth cycles.
  • Measurements of growth include RNA synthesis, DNA synthesis, protein synthesis, membrane morphology, success of division or reproduction, and levels of ATP. Examples of failure to grow therefore include serious membrane deformity, reduction or absence of DNA (or RNA or protein) synthesis, lysis, ATP depletion, unsuccessful division or reproduction, e.g., culminating in organism death.
  • the second criterion is that shifting such an organism from restrictive (non-permissive) conditions to permissive growth conditions for a period of time will not revive the organism or restore growth. That is, the Candida organism carries at least one lethal mutation, the product of which is irreversibly sensitive to the restrictive conditions. The gene carrying this mutation is essential for growth during the incubation period under the restrictive conditions.
  • a strain carrying a non-lethal or static mutation is expressly avoided, i.e., not selected.
  • a strain with a non-lethal or static mutation may fail to grow and reproduce under restrictive conditions, and yet will resume growth when shifted from restrictive to second permissive growth conditions. This resumption of substantially normal growth is generally apparent after two or more growth cycles under permissive conditions. In some cases, metabolism or growth may be initially slow during a transition period; in addition, growth may be slower than normal for several growth cycles. In either case, a strain with a static mutation does not satisfy the second criterion for lethal mutation as used herein.
  • the period of time will vary with the method of detecting growth or death, but is generally equivalent to a plurality of growth cycles (e.g., at least 2, 4, 6, 8, 10, 15, or 20 cycles). Depending on the strain and the difference between the restrictive and permissive conditions, growth may be delayed, or the rate of growth may increase during a transition period before stabilizing. Growth can be measured by methods known to those in the art, including expansion of colony cell mass, increased turbidity of a liquid cell culture suspension, cell or organism staining, DNA synthesis, and protein synthesis.
  • Candida strains is illustrated in Figures 1A and IB.
  • the initial step requires that one allele of the target gene be deleted by gene replacement.
  • the coding region or open reading frame (ORF) of interest can be replaced by a homologous recombination method, such as through the use of the "Candida URA3 blaster cassette" (described in appended examples) or the like.
  • the resulting strain is heterozygous for loss-of-function of the targeted gene, though still viable. That is, a fully functional allele remains.
  • an integration vector suitable for use in the Candida strain is generated. As described below, this can consist of the plasmid YIplac211 in which the S. cerevisiae URA3 gene has been replaced with the Candida URA3 gene (this plasmid is referred to as pSCaURA3.2).
  • This vector will now receive the Candida gene of interest which has 3 mutations relative to the wild-type gene. These mutations are the conditional mutation itself, a STOP codon (TAA) which can be marked by an Afl II restriction enzyme site, and a frameshift (FS) mutation immediately downstream of the STOP codon in the remote chance that there is read through of the STOP codon.
  • TAA STOP codon
  • FS frameshift
  • the STOP and FS should be sufficient individually to effect the generation of a non-functional protein.
  • Transformation of many species of Candida is achieved using such well-known protocols as the lithium acetate protocol.
  • the transformation mixture is placed onto appropriate selective plates and transformants are recovered at the anticipated permissive temperature of the conditional mutation.
  • the integration event will generate a duplication of the target gene.
  • One copy will be non- functional as it possesses the STOP/FS and the other copy will harbor the conditional mutation and will be functional only at the permissive temperature. Consequently the conditional phenotype should be immediately apparent by screening transformants for growth at the permissive temperature but not at the non-permissive temperature. This fact facilitates the screening effort as such integration events seem to occur with a frequency of around 5%.
  • conditional mutants are screened by Southern blot analysis to ensure that the desired integration event has indeed been achieved.
  • the final stage in the generation of the C. albicans temperature sensitive mutation is to plate the mutant strains onto media containing 5-fluoro-orotic acid (5-FOA). This results in the eviction both of the CaURA3 and the inactive copy of the gene of interest.
  • the desired colonies are caURA3 minus and conditional for growth and should be analyzed by Southern to confirm the eviction of CaURA3 and one copy of the gene of interest. As described in the examples set forth below, this strategy has been used to generate temperature sensitive strains of C.
  • conditional Candida mutants based on analogy to known mutations in other yeast
  • the present invention also contemplates the generation of conditional mutations to essential genes by mutagenic techniques directly involving Candida genes.
  • the target (essential) gene is isolated and subjected to mutagenesis.
  • the target gene can be subcloned from a Candida organism and mutagenized by any suitable method including, but not limited to, cassette mutagenesis, PCR mutagenesis (e.g., the fidelity of PCR replication can be reduced to induce mutation by varying Mg 2+ concentration, increasing the number of amplification cycles, altering temperatures for annealing and elongation, to yield random mutants), or physical or chemical mutagenesis of the entire gene or a portion thereof.
  • Chemical mutagens include ethylmethanesulfonate
  • EMS methylmethanesulfonate
  • NGT methylnitrosoguanidine
  • NQO 4-nitroquinoline-l- oxide
  • 2-aminopurine 5-bromouracil
  • ICR 191 and other acridine derivatives sodium bisulfite, ethidium bromide, nitrous acid, hydroxylamine, N-methyl-N'-nitroso-N- nitroguanidine, and alkylating agents.
  • Physical mutagens include ultraviolet radiation and x- rays.
  • the mutagenesis products can be used to construct a library of integration vectors including the mutant genes.
  • the library of integrative vectors can be used to transfect Candida cells which have are heterozygous for loss-of-function of the target gene. Cell growth at under a desired permissive condition (such as a permissive temperature) allows for selection from the mutagenized gene library of those constructs retaining sufficient activity at that temperature. The viable cells are then shifted to growth under the desired non-permissive conditions. Cells which are unable to grow under those conditions are isolated. Those cells should now include a condition-sensitive allele of the target gene.
  • N-degron is an intracellular degradation signal whose essential determinant is a "destabilizing" N-terminal residue of a protein.
  • a set of N-degrons containing different destabilizing residues is manifested as the N-end rule, which relates the in vivo half-life of a protein to the identity of its N-terminal residue.
  • the N-degron consists of at least two determinants: a destabilizing N-terminal residue and a specific internal Lys residue (or residues) of a substrate.
  • the Lys residue is the site of attachment of a multiubiquitin chain.
  • Ubiquitin is a protein whose covalent conjugation to other proteins plays a role in a number of cellular processes, primarily through routes that involve protein degradation.
  • exemplary heat-inducible N-degron modules which can be adapted for generating conditional mutants in Candida, see US Patents 5,705,387 and 5,538,862, and Dohmen et al. (1994) Science 263:1273-6.
  • the advantage of the heat-inducible N-degron (or "td") method is that it does not require an extensive, often unsuccessful search for a ts mutation in a gene of interest. If the protein of interest can tolerate an N-terminal extension, the corresponding td fusion is likely to be functionally unperturbed at permissive temperature. By contrast, low activity at permissive temperature is a common problem with conventionally derived ts proteins and is also expected to be a complication with proteins expressed from genes whose nonsense mutations are suppressed by a conditional suppressor tRNA.
  • conditional phenotypes A frequent problem with conditional phenotypes is the "phenotypic lag" that may occur between the imposition of nonpermissive conditions and the emergence of a relevant null phenotype.
  • the td method eliminates or reduces this problem, because the heat-induced activation of the conditional N-degron results in rapid disappearance of a td protein.
  • the td method is confined to proteins of the cytosol and the nucleus- compartments where the N-end rule pathway is known to operate.
  • the td concept should also be applicable to degrons in other compartments. Cytosolic degradation signals distinct from N-degrons and residing in either DHFR or other carriers should be feasible as well and may prove superior for certain applications.
  • Varshavsky recently found (US Patent 5,763,212) that the heat induction of the Arg-DHFR ts N-degron is inhibited in the presence of methotrexate, a DHFR-specific, tightly binding substrate analog. The resulting possibility of controlling a degron with agents other than temperature can be used to construct new classes of conditional mutants in Candida.
  • the expression of the remaining allele can be regulated by replacining all or a portion of the transcriptional regulatory sequences, e.g., promoter(s) and/or enhancer(s), with a conditional transcriptional regulatory sequence(s), such as an inducible promoter or enhancer or a repressible promoter or enhancer.
  • exemplary yeast promoters which regulate transcription of a gene by growth conditions, include are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.
  • Other exemplary conditional regulatory element include the glucose-repressible ADH2 promoter, and the repressible promoter of the yeast acid phosphatase gene (PHO5) which is derepressed by low concentrations of inorganic phosphate in the medium.
  • the subject method can be used to create condition-sensitive mutants of a variety of Candida, including Candida albicans, Candida stellatoidea, Candida glabrata, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida pseudotropicalis, Candida guilliermondii, or Candida rugosa.
  • Applicants specifically contemplate that the subject method can be used to generate condition-sensitive mutants of other diploid fungus.
  • the transient disruption of gene function during the period of restrictive growth conditions results in cell death.
  • Organism death can be macroscopically observed in a colony which has the same or reduced size over several growth cycles under the second permissive conditions.
  • Light microscopy and staining can reveal cytological deformations or other morphologies known by those in the art to be indicative of cell death.
  • protein synthesis occurs in a cell which is nominally alive.
  • Dead cells are characterized, in part, by lysis or the absence of DNA, RNA, and protein synthesis.
  • Therapeutic agents can be developed from the identification of essential genes from
  • a gene product e.g., a protein or an RNA molecule identified as being essential by the methods disclosed herein is used in drug screening assays for development of antifungal agents.
  • the disclosed gene selection methods establish that the gene product is essential for survival of the organism.
  • the present invention provides a systematic and practical approach for the identification of candidate agents able to inhibit one or more of the essential gene's functions.
  • the assays of the present invention evaluate the ability of a compound to inhibit the biological activity of the gene product of an essential gene, e.g., by inhibiting, as appropriate, such activities as protein-protein, protein-DNA, secretion, or an enzymatic activity associated with the product of the essential gene.
  • the assay can be generated in many different formats, and include assays based on cell-free systems, e.g. purified proteins or cell lysates, as well as cell-based assays which utilize intact cells.
  • the assays may be formatted to evaluate such activity by adding the compound to a cell-free preparation (e.g., lysate or reconstituted protein mixture) including the product of the essential gene, or by contacting the agent with a cell which recombinantly expresses the essential gene.
  • a cell-free preparation e.g., lysate or reconstituted protein mixture
  • Assays of the present invention which are performed in cell-free systems, such as may be derived with purified or semi-purified proteins or with lysates, are often preferred as "primary" screens in that they can be generated to permit rapid development and relatively easy detection of an alteration in a molecular target which is mediated by a test compound.
  • the effects of cellular toxicity and/or bioavailabihty of the test compound can be generally ignored in the in vitro system, the assay instead being focused primarily on the effect of the drug on the molecular target as may be manifest in an alteration, as appropriate, of binding affinity with other proteins or changes in enzymatic properties of the molecular target.
  • Exemplary compounds which can be screened for activity against an essential gene identified by the subject method include peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries, such as isolated from animals, plants, fungus and/or microbes.
  • the test agent is a small organic molecule having a molecular weight of less than about 2,000 daltons.
  • the assay is preferably repeated for a variegated library of at least 100 different test compounds, though preferably libraries of at least 10 3 , 10 5 , 10 7 , and 10 9 compunds are tested.
  • the test compound can be, for example, small organic molecules, and/or natural product extracts.
  • agents identified in the subject assay can be formulated in pharmaceutical preparations for in vivo administration to an animal, preferably a human.
  • the subject compounds selected in the subject method, or a pharmaceutically acceptable salt thereof may accordingly be formulated for administration with a biologically acceptable medium, such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof.
  • a biologically acceptable medium such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof.
  • a biologically acceptable medium includes any and all solvents, dispersion media, and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation. The use of such media for pharmaceutically active substances is known in the art.
  • Suitable vehicles and their formulation inclusive of other proteins are described, for example, in the book Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences. Mack Publishing Company, Easton, Pa., USA 1985). These vehicles include injectable "deposit formulations". Based on the above, such pharmaceutical formulations include, although not exclusively, solutions or freeze-dried powders of the compound in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered media at a suitable pH and isosmotic with physiological fluids. In preferred embodiment, the compound can be disposed in a sterile preparation for topical and or systemic administration.
  • excipients such as, but not exclusively, mannitol or glycine may be used and appropriate buffered solutions of the desired volume will be provided so as to obtain adequate isotonic buffered solutions of the desired pH.
  • Similar solutions may also be used for the pharmaceutical compositions of compounds in isotonic solutions of the desired volume and include, but not exclusively, the use of buffered saline solutions with phosphate or citrate at suitable concentrations so as to obtain at all times isotonic pharmaceutical preparations of the desired pH, (for example, neutral pH).
  • C. albicans is a diploid and to generate temperature sensitive mutants requires that one allele be knocked out by gene replacement and the remaining allele to be replaced with a mutant version by integrative transformation.
  • the mutations present in the integration vector are the conditional temperature sensitive mutation itself, a STOP codon (TAA) which can be marked by an Afl II restriction enzyme site, and a frameshift (FS) mutation immediately downstream of the STOP codon in the remote chance that there is read through of the STOP codon.
  • TAA STOP codon
  • FS frameshift
  • the integration plasmid is directed to the desired locus by linearizing the plasmid with a unique restriction site located between the STOP/FS and the conditional mutation.
  • the integration event will generate a non-functional allele containing the STOP-FS mutation and a temperature sensitive allele separated by the CaURA3 sequence.
  • the temperature sensitive phenotype should therefore be immediately apparent.
  • the vectors generated for this manipulation and the methods used to check transformed colonies are described.
  • Method 2 In a variation to Method 1, gene replacement of the remaining allele by integrative transformation is accomplished with an integration vector as described above, but which does not include the STOP-FS mutations.
  • the integration plasmid is directed to the desired locus by linearizing the plasmid. The temperature sensitive phenotype will become evident upon treatment of the transformed cells 5-fluoroorotic acid (Boeke, J. D. et al. (1987) Methods Enzvmol. 154: 164-175).
  • the genomic loci for CaRAM2 and CaRHOl (the sequence of which has been supplied previously) were used as templates for PCR to amplify the 5' and 3' non-coding regions thereby exactly deleting the ORF.
  • the PCR fragments were cloned into pBluecript KS-.
  • the CaURA3 blaster cassette on an BamHI/Bglll fragment (received from W. Fonzi) was then inserted into BamHI & Bglll sites of the recipient plasmids to generate the final knockout constructs for CaRAM2 and CaRHOl (designated pSCaRAM2.21 and pSCaRHOl.6 respectively).
  • the CaRAM2 and CaRHOl knockout constructs were excised by Xhol/Notl and Asp718 digests of their respective parent plasmids pSCaRAM2.21 and pSCaRHOl.6.
  • the desired fragments were gel purified prior to being transformed into the C. albicans strain CAF3-1.
  • the method used for CAF3-1 transformation is a lithium acetate protocol (from U. of Minnesota C. ablicans web site: http://alces.med.umn.edu/C ⁇ «Jt_f ⁇ /liac.html).
  • the transformation mixture is then plated onto selective (-Ura glucose) plates and incubated at 30°C for 3days. Individual transformants that appear are restreaked for singles and then preserved as a glycerol stock. To ensure that the correct integrative event has occurred, southern analysis was carried out on several colonies. Those colonies that exhibited the correct genotype were retained.
  • the vector used to integrate each of the temperature sensitive alleles is a modified derivative of YIplac211 (Gietz & Sugino, 1988, Gene, 74, 527-534) and is designated pSCaURA3.2.
  • This vector was generated by replacing the S. cerevisiae URA3 gene with the C. albicans URA3 gene (on an Aatll/Bst 11071 fragment) which had been generated by PCR using the CaURA3 blaster cassette described above as a template.
  • pSCaURA3.2 is the recipient vector for each of the temperature sensitive alleles of CaRAM2 and CaRHOl .
  • the caram2-l temperature sensitive allele possesses the mutation N143K. This mutation was initially reported in C. A. Omer et al, 1993 Biochemistry, 32, 5167-5176.
  • the N143K mutation was introduced into the genomic CaRAM2 clone contained in the plasmid pSCaRAM2.13 by PCR using the Quikchange kit (Stratagene) according to the manufacturers instructions.
  • MutCRl#2 5' ACGACCAAACATGATGTTTCTTGGGGTCTGAAC 3'
  • the mutated allele was confirmed by sequencing and the resultant plasmid designated pSCaRAM2.16.
  • pSCaRAM2.16 To assist in marking the alleles of CaRAM2 a BamHI site was introduced in the 3' untranslated region of the gene.
  • the oligos used for this PCR mutagenesis using the Quikchange kit (Stratagene) are as follows (the alteration is underlined): CRAM2.13:5' CAATTGTTTAACTAGGATCCTCATTGTATACCACCGATATTAC 3'
  • CRAMSTOPFS.2 5' CCAAATCAACAAACTTAAGAACTAAACTCTTCTAATTG 3'
  • This plasmid is the caram2-l integration plasmid and designated pSCaRAM2.30.
  • the carhol-3 temperature sensitive allele possesses the mutation L59P (which is equivalent to L60P mutation found in S. cerevisiae RHO1 gene: Kamada et al. J. Biol. Chem. 1996, 271 , 9193-9196 and additional unpublished information from D. E. Levin's laboratory).
  • L59P mutation was originally introduced into CaRHOl cDNA in the plasmid PID018 generated by V. Damagnez by PCR using the Quikchange kit (Stratagene) according to the manufacturers instructions.
  • the sequence of the oligos used, with the mutation underlined are:
  • CaRHOl.1 5' GGTAGAAAAGTTGAACCAGCATTATGGGATACTGC 3'
  • CaRHOl .2 5' CCCATAATGCTGGTTCAACTTTTCTACCATCAAC 3'
  • the mutated allele was confirmed by sequencing and the resultant plasmid designated pSCaRHOl.l.
  • the mutated CaRHOl ORF was then subcloned into pSCaRHO1.3 cut PacI HincII to generate pSCaRHOl.8 which represents a genomic carhol -3 clone harboring the L59P mutation.
  • the mutated genomic carhol-3 clone was then subcloned into pSCaURA3.2 on an EcoRV/Hindlll fragment to generate the plasmid pSCaRHO1.13.
  • FS FRAMESHIFT
  • CaRHOSTOPFS.l 5' CTGAACTTCGTACTTAAGTTAGTCATTGTCGGTG 3'
  • CaRHOSTOPFS.2 5' CACCGACAATGACTAACTTAAGTACGAAGTTCAG 3'
  • This plasmid is the carhol-3 integration plasmid and designated pSCaRHOl .15.
  • the carhol-5 temperature sensitive allele possesses the mutation G120C (which is equivalent to G121C mutation found in S. cerevisiae RHOl gene: Kamada et al. J. Biol. Chem. 1996, 271, 9193-9196 and additional unpublished information from D. E. Levin's laboratory).
  • the G120C mutation was originally introduced into CaRHOl cDNA in the plasmid PID018 generated by V. Damagnez by PCR using the Quikchange kit (Stratagene) according to the manufacturers instructions.
  • the sequence of the oligos used, with the mutation underlined, are:
  • the mutated allele was confirmed by sequencing and the resultant plasmid designated pSCaRHO1.2.
  • the mutated CaRHOl ORF was then subcloned into pSCaRHOl.3 cut PacI/HincII to generate pSCaRHOl .7 which represents a genomic carhol-5 clone harboring the G120C mutation.
  • the mutated genomic carhol-5 clone was then subcloned into pSCaURA3.2 on an EcoRV/Hindlll fragment to generate the plasmid pSCaRHO1.12.
  • each of the plasmids were linearized with the following enzymes to target their integration to the desired locus: pSCaRAM2.30 (caram2-l) lO ⁇ g was linearized with BstXI pSCaRHO1.14 (carhol-5) lO ⁇ g was linearized with BsmFI
  • Transformation of C albicans is achieved using a lithium acetate protocol (available from the Univ. of Minnesota C. ablicans web site: http://alces.med.umn.edu/CanJtJa/liac.html).
  • the transformation mixture is plated onto appropriate selective plates (-Ura glucose +1M sorbitol) plates that were also supplemented with IM sorbitol which may stabilize the cells if the introduced mutations rendered them osmotically sensitive.
  • the plates were incubated at room temperature (RT) for 5-7 days prior to picking colonies. Each of the integration plasmids gave rise to numerous colonies.
  • Isolated colonies were streaked for singles prior to patching onto a -Ura Glc IM sorbitol plates .
  • the patched plates served as templates for replica plates of -Ura Glc.
  • the replica plates were then placed in a 42°C incubator or left at RT. Patches of cells that either failed to grow at 42°C or appeared yellow were saved and glycerol stocks were made. In each case between 70-150 colonies were screened for inability to grow at 42°C. Temperature sensitive colonies were recovered at a rate of 2-3%.
  • the C. albicans PCKl promoter was cloned by Leuker et al. 1997 Gene 192:235-240. This promoter is repressed by glucose and derepressed by gluceoneogenic carbon sources such as succinate and casamino acids. Heterologous genes placed under the control of the PCKl promoter are similarily regulated by the nature of the carbon source in the medium.
  • C. albicans is a diploid organism for which there is no known sexual phase which makes it difficult to determine whether a gene is essential. The use of a conditional promoter to switch off expression of a gene in a particular medium allows studies to determine whether C. albicans cells can survive in the absence of a particular gene.
  • the effect of including the destabilising residue R at the N-terminus of CaCAKl is shown in Fig 6. Note that for this example the lad sequence, which normally supplies the K residue which receives the ubiquitin moiety was not included. An internal lysine residue in the CaCAKl sequence fulfills this requirement.
  • the PCKl promoter is not repressed fully in glucose containing media. It may be possible to repress the promoter more completely by inco ⁇ orating an additional repression element that functions independently of glucose concentration. Examples of such elements include the haploid specific gene (HSG) element recently also found to function in C. albicans (Hull & Johnson, Science, 1999, 285, 1271). When 3 HSG elements were inco ⁇ orated into the ADH promoter they inactivated this promoter (Hull & Johnson, supra). An HSG element used individually may provide intermediate levels of repression more suitable for regulating the PCKl promoter.
  • HSG haploid specific gene
  • Figure 6A show that in a CaCAKl heterozygote, the remaining WT allele of CaCAKl is replaced with the CaURA3.PCKl.atgNATG.Ubi.RHCAKl cassette.
  • the CaCAKl protein has been made a substrate of the N-end rule by fusing the ubiquitin protein and the amino acids RH N-terminally to the CaCAKl ORF.
  • This cassette is placed under the control of the PCKl promoter. There is also an upstream, out of frame ATG, which reduces production of the desired ORF.
  • the ATG.UbiGG.RHCaCAKl when expressed is immediately processed by a ubiquitin hydrolase which recognises the UbiGG sequence and removes this element exposing CaCAKl with an N-terminal destabilising amino acid arginine (R). RHCaCAKl is then degraded by the ubiquitin system.
  • Figure 6B illustrates that the depletion of CaCAKl is evident in the above western when the promoter is repressed by glucose contianing media. The consequences associated with depletion of CaCAKl on glucose plates at 42°C are illustrated.
  • FIG. 7A shows the effect of depletion of CaRHOl.
  • a short leader sequence has been inserted between the PCKl promoter and the ATG of CaRHOl. This leader sequence is shown below and has the potential to form a hai ⁇ in loop structure as indicated.
  • the PCKl promoter is underlined.
  • the ATG of CaRHOl is also indicated.
  • FIG. 7B shows that CaRHOl expression can be controlled by the PCKl promoter in glucose media.
  • Lane 1 levels of CaRHOl and PGKl in WT CAF2 cells grown in YPD
  • Lane 2 levels of CaRHOl and PGKl in cells dependent on CaRHOl expression from the PCKl promoter in YPCAA (PCKl promoter on).
  • Lane3 Level of CaRHOl in cells dependent on CaRHOl expression from the PCKl promoter after 4hrs in Glc media (PCKl promoter Off), Lane4, after 8hrs in Glc media (PCKl promoter Off), Lane5, after l lhrs in Glc media (PCKl promoter Off), Lane ⁇ , after 14hrs in Glc media (PCKl promoter Off).
  • Figure 7C shows loss of viability when CaRHOl is depleted from cells by repressing the PCKl promoter in glucose media.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne une technique permettant de générer de façon systématique des souches de mutant de levure d'haploïde et de diploïde obligatoires, dont les mutations létales d'un gène sont sensibles aux conditions, gène qui, par ailleurs, est essentiel à la viabilité cellulaire sous toutes les conditions de la croissance cellulaire. Les mutants conditionnels permettent l'analyse des changements physiologiques induits par l'inactivation d'un gène ou d'un produit génique et ils peuvent être utilisés pour solliciter la fonction d'un gène quelconque. Dans un mode de réalisation de l'invention, la technique consiste en général à: (i) prendre une souche de Candida hétérozygote en vue d'une mutation de perte de fonction d'un allèle de gène essentiel; (ii) et introduire un homologue conditionnellement sensible de ce gène, par exemple avec une protéine conditionnellement sensible ou une séquence de régulation de la transcription conditionnellement sensible, au niveau de l'allèle fonctionnel par transformation intégrative.
PCT/US2000/006514 1999-03-11 2000-03-13 Generation de mutants de levure conditionnels, techniques et reactifs s'y rapportant WO2000053781A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP00913902A EP1161544A1 (fr) 1999-03-11 2000-03-13 Generation de mutants de levure conditionnels, techniques et reactifs s'y rapportant
CA002366069A CA2366069A1 (fr) 1999-03-11 2000-03-13 Generation de mutants de levure conditionnels, techniques et reactifs s'y rapportant
AU35262/00A AU3526200A (en) 1999-03-11 2000-03-13 Generation of conditional yeast mutants, methods and reagents related thereto

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12380799P 1999-03-11 1999-03-11
US60/123,807 1999-03-11

Publications (1)

Publication Number Publication Date
WO2000053781A1 true WO2000053781A1 (fr) 2000-09-14

Family

ID=22411011

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/006514 WO2000053781A1 (fr) 1999-03-11 2000-03-13 Generation de mutants de levure conditionnels, techniques et reactifs s'y rapportant

Country Status (4)

Country Link
EP (1) EP1161544A1 (fr)
AU (1) AU3526200A (fr)
CA (1) CA2366069A1 (fr)
WO (1) WO2000053781A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001060975A2 (fr) * 2000-02-18 2001-08-23 Elitra Pharmaceuticals, Inc. Methodologies de disruption genique destinees a la decouverte de medicaments cibles
WO2002053728A2 (fr) * 2000-12-29 2002-07-11 Elitra Pharmaceuticals, Inc. Procedes de disruption de genes pour identification de cible de medicament
US6783985B1 (en) 2000-02-18 2004-08-31 Elitra Pharmaceuticals Inc. Gene disruption methodologies for drug target discovery
EP1932921A1 (fr) * 2006-12-13 2008-06-18 Novartis AG Procédé de criblage différentiel à base mutante simple pour des composés modulant une cible spécifique

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997042210A1 (fr) * 1996-05-06 1997-11-13 Millennium Pharmaceuticals, Inc. Identification de genes essentiels pour la survie

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997042210A1 (fr) * 1996-05-06 1997-11-13 Millennium Pharmaceuticals, Inc. Identification de genes essentiels pour la survie

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DOHMEN R JURGEN ET AL: "Heat-inducible degron: A method for constructing temperature-sensitive mutants.", SCIENCE (WASHINGTON D C), vol. 263, no. 5151, 1994, pages 1273 - 1276, XP002142706, ISSN: 0036-8075 *
OHYA YOSHIKAZU ET AL: "Structure-based systematic isolation of conditional-lethal mutations in the single yeast calmodulin gene.", GENETICS, vol. 138, no. 4, 1994, pages 1041 - 1054, XP000915010, ISSN: 0016-6731 *
PAYTON M A ET AL: "THE ISOLATION OF OSMOTIC-REMEDIAL CONDITIONAL LETHAL MUTANTS OF CANDIDA-ALBICANS", CURRENT GENETICS, vol. 17, no. 4, 1990, pages 293 - 296, XP000914960, ISSN: 0172-8083 *
SANTOS CRUZ ET AL: "Ribosomal protein P0, contrary to phosphoproteins P1 and P2, is required for ribosome activity and Saccharomyces cerevisiae viability.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 269, no. 22, 1994, pages 15689 - 15696, XP002142705, ISSN: 0021-9258 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001060975A2 (fr) * 2000-02-18 2001-08-23 Elitra Pharmaceuticals, Inc. Methodologies de disruption genique destinees a la decouverte de medicaments cibles
WO2001060975A3 (fr) * 2000-02-18 2002-04-25 Elitra Pharmaceuticals Inc Methodologies de disruption genique destinees a la decouverte de medicaments cibles
US6783985B1 (en) 2000-02-18 2004-08-31 Elitra Pharmaceuticals Inc. Gene disruption methodologies for drug target discovery
WO2002053728A2 (fr) * 2000-12-29 2002-07-11 Elitra Pharmaceuticals, Inc. Procedes de disruption de genes pour identification de cible de medicament
WO2002053728A3 (fr) * 2000-12-29 2003-03-20 Elitra Pharmaceuticals Inc Procedes de disruption de genes pour identification de cible de medicament
EP1932921A1 (fr) * 2006-12-13 2008-06-18 Novartis AG Procédé de criblage différentiel à base mutante simple pour des composés modulant une cible spécifique

Also Published As

Publication number Publication date
CA2366069A1 (fr) 2000-09-14
AU3526200A (en) 2000-09-28
EP1161544A1 (fr) 2001-12-12

Similar Documents

Publication Publication Date Title
Smith et al. A transcriptional cascade governs entry into meiosis in Saccharomyces cerevisiae
Bhabhra et al. Disruption of the Aspergillus fumigatus gene encoding nucleolar protein CgrA impairs thermotolerant growth and reduces virulence
Shen et al. Pheromones stimulate mating and differentiation via paracrine and autocrine signaling in Cryptococcus neoformans
Cruz et al. Rapamycin antifungal action is mediated via conserved complexes with FKBP12 and TOR kinase homologs in Cryptococcus neoformans
Kadosh et al. Histone deacetylase activity of Rpd3 is important for transcriptional repression in vivo
Nelson et al. Identification of virulence mutants of the fungal pathogen Cryptococcus neoformans using signature-tagged mutagenesis
Hishida et al. Saccharomyces cerevisiae MGS1 is essential in strains deficient in the RAD6‐dependent DNA damage tolerance pathway
US6046002A (en) Highly parallel and sensitive method for identifying drugs and drug targets
JP2010011851A (ja) 膜蛋白質発現系及び薬剤スクリーニングにおけるその利用
JPH09504176A (ja) 抗真菌剤の選抜法
US6200803B1 (en) Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
Kingsbury et al. Homoserine toxicity in Saccharomyces cerevisiae and Candida albicans homoserine kinase (thr1 Δ) mutants
Hsueh et al. A homolog of Ste6, the a-factor transporter in Saccharomyces cerevisiae, is required for mating but not for monokaryotic fruiting in Cryptococcus neoformans
Soushko et al. An RNA‐binding protein homologue that promotes sporulation‐specific gene expression in Saccharomyces cerevisiae
Parvizi Omran et al. The zinc cluster transcription factor Rha1 is a positive filamentation regulator in Candida albicans
Hoff et al. Schizosaccharomyces pombe retrotransposon Tf2 mobilizes primarily through homologous cDNA recombination
CA2400534C (fr) Marqueur dominant selectionnable pour la transformation de genes et la dissociation dans les levures
EP1161544A1 (fr) Generation de mutants de levure conditionnels, techniques et reactifs s'y rapportant
US7078169B2 (en) Methods for the identification of inhibitors of an isoprenoid metabolic pathway
EP1292668A2 (fr) Methodologies de disruption genique destinees a la decouverte de medicaments cibles
JP2001517946A (ja) 抗真菌活性物質のスクリーニング方法
US20050079619A1 (en) Gene disruption methodologies for drug target discovery
US20100047838A1 (en) Yeast genes that affect viral replication
Lu et al. Loss of RPS41 but not its paralog RPS42 results in altered growth, filamentation and transcriptome changes in Candida albicans
Birštonas et al. Multiplex genetic engineering exploiting pyrimidine salvage pathway-based endogenous counterselectable markers. mBio 11: e00230-20

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2366069

Country of ref document: CA

Ref country code: CA

Ref document number: 2366069

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2000913902

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000913902

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2000913902

Country of ref document: EP