WO2000053747A1 - Sialic acid-binding ig-like lectin (siglec) gene; ob-binding protein like (ob-bpl) - Google Patents

Sialic acid-binding ig-like lectin (siglec) gene; ob-binding protein like (ob-bpl) Download PDF

Info

Publication number
WO2000053747A1
WO2000053747A1 PCT/CA2000/000259 CA0000259W WO0053747A1 WO 2000053747 A1 WO2000053747 A1 WO 2000053747A1 CA 0000259 W CA0000259 W CA 0000259W WO 0053747 A1 WO0053747 A1 WO 0053747A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
nucleic acid
bpl
substance
siglec
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2000/000259
Other languages
English (en)
French (fr)
Inventor
George Foussias
George M. Yousef
Eleftherios P. Diamandis
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mt Sinai Hospital
Original Assignee
Mt Sinai Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mt Sinai Hospital filed Critical Mt Sinai Hospital
Priority to CA002366087A priority Critical patent/CA2366087A1/en
Priority to AU31399/00A priority patent/AU3139900A/en
Publication of WO2000053747A1 publication Critical patent/WO2000053747A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6445Kallikreins (3.4.21.34; 3.4.21.35)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the invention relates to nucleic acid molecules, proteins encoded by such nucleic acid molecules; and use of the proteins and nucleic acid molecules BACKGROUND OF THE INVENTION
  • the immunoglobulinsuperfamily encompassesa large number of cell surface molecules which play a vital role not only in immunity, but also in controlling the behaviour of cells in various tissues, through their ability to mediate cell surface recognition events. These molecules are characterized by the presence of at least one immunoglobulin(Ig) domain, a sandwich of two ⁇ -sheets stabilized by a conserved disulfide bond. The core of this domain is composed of ⁇ -strands A,B,E in one sheet and G,F,C in the other, and arise from the ends of the domain sequence (Williams and Barclay 1988). In between, however, there is a great deal of sequence length variation.
  • Ig domains occur in two types, the V-set and the C-set, and can be distinguished based on patterns of conserved amino acid residues responsible for forming the characteristic ⁇ - sheet sandwich.
  • V-set domains consist of about 65-75 amino acid residues between conserved cysteines, whereas C-set domains have about 55-60 residues (reviewed in (Williams and Barclay 1988)).
  • the C-set domains can be further divided into C 1 - and C2-sets, and are distinguished by the fact that, although showing signs of a C-set domain, the latter half of C2-set domains exhibit sequence patterns more homologous to V-set rather than Cl -set domains (Williams et al, 1989).
  • V-set domains is absent, while a highly conserved cysteine is present in ⁇ -strand E in all siglecs identified so far. This results in the cysteines in ⁇ -strands B and E being next to each other in one ⁇ -sheet, which likely results in an intrasheet disulfide bond (Crocker et al., 1996; Williams et al, 1989). There is also an additional highly conserved cysteine residue in both the V-set and first C2-set domains of all siglecs. In the V-set domain it is located at the beginning of ⁇ -strand B, while in the C2-set domain it is found between ⁇ -strands B and C.
  • the siglec family consists of sialoadhesin (Siglec- 1), CD22 (Siglec-2), CD33 (Siglec-3), myelin-associated glycoprotein (MAG) (Siglec-4a), Schwann cell myelin protein (SMP) (Siglec-4b), OB- binding protein 2 (Siglec-5), OB-binding protein 1 (Siglec-6),and p75/AIRMl (Siglec-7) (Cornish etal, 1998; Crocker et al, 1998; Falco e/ ⁇ /., 1999; Nicoll et al, 1999; Patcl et al, 1999). Each member of the Siglec family is expressed by specific cell types and exhibits a distinct function.
  • Sialoadhesin is a macrophage-restricted adhesion molecule (Crocker et al, 1994), CD22 is B lymphocyte-specific and regulates its activation (Stamenkovic and Seed 1990), CD33 is a myeloid-specific inhibitory receptor (Ulyanova et al, 1999), and MAG functions in the formation and maintenance of axonal myelin structure (Li et al, 1998).
  • Siglec-5 and -6 are expressed in several tissues including placenta and peripheral blood leukocytes, and have shown an in vitro ability to bind leptin (Cornish et al, 1998; Patel et al, 1999), while OB-BPL (p75/AIRMl) is an inhibitory receptor expressed predominantly on human natural killer cells (Falco et al, 1999; Nicoll et al, 1999).
  • OB-BP2 and -BP1 are expressed in several tissues including placenta and peripheral blood leukocytes, and have shown an in vitro ability to bind leptin (Cornish et al, 1998; Patel et al, 1999), while OB-BPL (p75/AIRMl) is an inhibitory receptor expressed predominantly on human natural killer cells (Falco et al, 1999; Nicoll et al, 1999).
  • OB-binding protein like or OB-BPL a novel member of the siglec family
  • the putative protein product displays a high degree of homology with siglec-7, as well as with siglec-5 and siglec-6. Further, it possesses all the structural features found in other siglecs.
  • the gene was localized to 19ql3.4, 43.19 Kb more telomeric than KLK-L6 (a member of the kallikrein gene family) through genomic sequencing data and restriction mapping with EcoRI.
  • the novel siglec is encoded by 7 exons, with six intervening introns. In addition, it is highly expressed in bone marrow, placenta, spleen, and fetal liver, as well as other tissues at lower levels.
  • OB-BPL Protein The gene encoding the protein is referred to as "ob-bpl”.
  • the present invention relates to an isolated nucleic acid molecule which comprises: (i) a nucleic acid sequence encoding a protein having substantial sequence identity with an amino acid sequence of OB-BPL as shown in Table 5 or SEQ.IDNO. 2 or 3; (ii) a nucleic acid sequence encoding a protein comprising an amino acid sequence of OB-
  • BPL as shown in Table 5 or SEQ.IDNO. 2 or 3; (iii) nucleic acid sequences complementary to (i); (iv) a degenerate form of a nucleic acid sequence of (i);
  • nucleic acid sequence capable of hybridizing under stringent conditions to a nucleic acid sequence in (i), (ii) or (iii); (vi) a nucleic acid sequence encoding a truncation, an analog, an allelic or species variation of a protein comprising an amino acid sequence of OB-BPL as shown in Table 5 or SEQ.IDNO. 2 or 3; or
  • a purified and isolated nucleic acid molecule of the invention comprises:
  • nucleic acid sequence comprising the sequence of SEQ.IDNO. 1 wherein T can also be U; (ii) nucleic acid sequences complementary to (i), preferably complementary to the full nucleic acid sequence of SEQ.IDNO. 1; (iii) a nucleic acid capable of hybridizing under stringent conditions to a nucleic acid of (i) or (ii) and preferably having at least 18 nucleotides; or (IV) a nucleic acid molecule differing from any of the nucleic acids of (1) to (in) in codon sequences due to the degeneracy of the genetic code
  • the invention also contemplates a nucleic acid molecule comprising a sequence encoding a truncation of an OB-BPL Protein, an analog, or a homolog of an OB-BPL Protein or a truncation thereof (OB-BPL Protein and truncations, analogs and homologs of OB-BPL Protein are also collectively referred to herein
  • nucleic acid molecules of the invention may be inserted into an approp ⁇ ate expression vector, l e a vector that contains the necessary elements for the transcription and translation of the inserted coding sequence
  • recombinant expression vectors adapted for transformation of a host cell may be constructed which comprise a nucleic acid molecule of the invention and one or more transcription and translation elements linked to the nucleic acid molecule
  • the recombinant expression vector can be used to prepare transformed host cells expressing OB- BPL Related Proteins Therefore, the invention further provides host cells containing a recombinant molecule of the invention
  • the invention also contemplates transgenic non-human mammals whose germ cells and somatic cells contain a recombinant molecule comp ⁇ sing a nucleic acid molecule of the invention, in particular one which encodes an analog of the OB-BPL Protein, or a truncation of the OB-BPL Protein
  • the invention further provides a method for preparing OB-BPL Related Proteins utilizing the purified and isolated nucleic acid molecules of the invention
  • a method for preparing an OB-BPL Related Protein comprising (a) transferring a recombinant expression vector of the invention into a host cell, (b) selecting transformed host cells from untransformed host cells, (c) cultu ⁇ ng a selected transformed host cell under conditions which allow expression of the OB-BPL Related Protein, and (d) is
  • the invention further broadly contemplates an isolated OB-BPL Protein comp ⁇ sing an amino acid sequence as shown m SEQ ID NO 2 or 3
  • the OB-BPL Related Proteins of the invention may be conjugated with other molecules, such as proteins, to prepare fusion proteins This may be accomplished, for example, by the synthesis of N-terminal or C-terminal fusion proteins
  • the invention also permits the construction of nucleotide probes which are unique to the nucleic acid molecules of the invention and/or to proteins of the invention Therefore, the invention also relates to a probe comprising a nucleic acid sequence of the invention, or a nucleic acid sequence encoding a protein of the invention, or a part thereof
  • the probe may be labeled, for example, with a detectable substance and it may be used to select from a mixture of nucleotide sequences a nucleic acid molecule of the invention including nucleic acid molecules coding for a protein which displays one or more of the properties of a protein of the invention
  • the invention still further provides a method for identifying a substance which binds to a protein of the invention comprising reacting the protein with at least one substance which potentially can bind with the protein, under conditions which permit the formation of complexes between the substance and protein and detecting binding. Binding may be detected by assaying for complexes, for free substance, or for non- complexed protein.
  • the invention also contemplates methods for identifying substances that bind to other intracellular proteins that interact with an OB-BPL Related Protein. Methods can also be utilized which identify compounds which bind to OB-BPL gene regulatory sequences (e.g. promoter sequences).
  • the invention provides a method for evaluating a compound for its ability to modulate the biological activity of an OB-BPL Related Protein of the invention. For example a substance which inhibits or enhances the interaction of the protein and a substance which binds to the protein may be evaluated.
  • the method comprises providing a known concentration of an OB-BPL Related Protein, with a substance which binds to the protein and a test compound under conditions which permit the formation of complexes between the substance and protein, and removing and/or detecting complexes.
  • Compounds which modulate the biological activity of a protein of the invention may also be identified using the methods of the invention by comparing the pattern and level of expression of the protein of the invention in tissues and cells, in the presence, and in the absence of the compounds.
  • the proteins of the invention and substances and compounds identified using the methods of the invention, and peptides of the invention may be used to modulate the biological activity of an OB-BPL Related Protein of the invention, and they may be used in the treatment of conditions such a disorders of the hematopoietic system and in particular leukemias. Accordingly, the substances and compounds may be formulated into compositions for administration to individuals suffering from a disorders of the hematopoietic system.
  • the present invention also relates to a composition
  • a composition comprising one or more of a protein of the invention, a peptide of the invention, or a substance or compound identified using the methods of the invention, and a pharmaceutically acceptable carrier, excipient or diluent.
  • a method for treating or preventing cancer or a disorder of the hematopoietic system comprising administering to a patient in need thereof, an OB-BPL Related Protein of the invention, or a composition of the invention.
  • Figure 1 Genomic Structure of a Novel Siglec. Shown are the exon/intron boundaries, as well as the predicted protein sequence. The single underlined region is the 5' untranslated region, and the double underlined region is the 3' untranslated region. In the shaded box is the putative polyadenylation signal.
  • Figure 2 Hydophobicity Plot of the Novel Siglec. This shows the regions of the putative novel siglec protein which contain stretches of hydrophobic amino acid residues. As is evident, there are two such regions, the first corresponding to the signal peptide, and the second, at around residues 350-370, the putative transmembrane region.
  • FIG. 3 Localization of the Novel Siglec Gene.
  • the novel siglec gene resides 43.2 Kb telomeric to the KLK-L6 gene.
  • KLK kallikrein
  • PSA prostate specific antigen
  • KLK-L kallikrein-like
  • NES1 normal epithelial cell-specific 1 gene
  • TLSP trypsin-like serine protease.
  • FIG. 4 Siglec Family Multiple Alignment.
  • the novel siglec was aligned with siglec-5 to -7 and CD33, using ClustalX (Jeanmougin et al, 1998) (SEQ. ID. NOs. 10-13).
  • the signal peptide was determined through computer prediction, and the Ig domain boundaries were assigned based on exon boundaries.
  • the transmembrane domain was also predicted, while taking into consideration exon boundaries as well.
  • the ITIM-Iike and SLAM-like motifs are indicated, as are the conserved cysteines (*) which form the disulfide bonds of the Ig-like domains in siglecs, and the conserved arginine and aromatic residues ( ⁇ ) which are responsible for sialic acid binding and specificity.
  • FIG. 5 Phylogenetic Analysis of the Siglec Family.
  • the phylogenetic tree was created using ClustalX (Jeanmougin et al, 1998) and Tree View (Page 1996).
  • siglec-7 and the novel siglec are very closely related, and they are both related to CD33, in addition to a more distant relation to the other siglecs.
  • FIG. 6 Tissue Expression Profile of the Novel Siglec.
  • RT-PCR was performed on 28 tissue total RNAs, for this novel siglec and actin (control gene).
  • the novel siglec is highly expressed in bone marrow, placenta, spleen, and fetal liver. There is also a lower degree of expression in many of the other tissues, while it is absent in ovary, pancreas, skeletal muscle, and heart.
  • the invention provides an isolated nucleic acid molecule having a sequence encoding an OB-BPL Protein.
  • isolated refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical reactants, or other chemicals when chemically synthesized.
  • An "isolated” nucleic acid may also be free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid molecule) from which the nucleic acid is derived.
  • nucleic acid is intended to include DNA and RNA and can be either double stranded or single stranded.
  • a nucleic acid molecule encodes an OB-BPL Protein comprising an amino acid sequence as shown in SEQ.IDNO. 2 or 3, preferably a nucleic acid molecule comprising a nucleic acid sequence as shown in SEQ.IDNO. 1.
  • the invention includes nucleic acid sequences complementary to a nucleic acid encoding an OB- BPL Protein comprising an amino acid sequence as shown in SEQ.IDNO. 2 or 3, preferably the nucleic acid sequences complementary to a full nucleic acid sequence shown in SEQ.IDNO. 1.
  • the invention includes nucleic acid molecules having substantial sequence identity or homology to nucleic acid sequences of the invention or encoding proteins having substantial identity or similarity to the amino acid sequence shown in in SEQ.IDNO. 2 or 3.
  • the nucleic acids have substantial sequence identity for example at least 65%, 70%, 75%, 80%, or 85% nucleic acid identity; more preferably 90% nucleic acid identity; and most preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity.
  • Identity as known in the art and used herein, is a relationship between two or more amino acid sequences or two or more nucleic acid sequences, as determined by comparing the sequences.
  • BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al. NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al. J. Mol. Biol. 215: 403-410, 1990).
  • nucleic acid molecules encoding an OB-BPL Protein and having a sequence which differs from a nucleic acid sequence of the invention due to degeneracy in the genetic code are also within the scope of the invention.
  • Such nucleic acids encode functionally equivalent proteins (e.g., an OB-BPL Protein) but differ in sequence from the sequence of an OB-BPL Protein due to degeneracy in the genetic code.
  • DNA sequence polymorphisms within the nucleotide sequence of an OB-BPL Protein may result in silent mutations which do not affect the amino acid sequence.
  • Variations in one or more nucleotides may exist among individuals within a population due to natural allelic variation Any and all such nucleic acid variations are within the scope of the invention.
  • DNA sequence polymorphisms may also occur which lead to changes in the ammo acid sequence of an OB-BPL Protein. These amino acid polymorphisms are also within the scope of the present invention
  • Another aspect of the invention provides a nucleic acid molecule which hybridizes under stringent conditions, preferably high stringency conditions to a nucleic acid molecule which comprises a sequence which encodes an OB-BPL Protein having an amino acid sequence shown in SEQ.IDNO. 2 or 3
  • Appropriate stringency conditions which promote D ⁇ A hybridization are known to those skilled m the art, or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, ⁇ .Y.
  • 6.0 x sodium chloride/sodium citrate (SSC) at about 45 C C, followed by a wash of 2 0 x SSC at 50°C may be employed.
  • the stringency may be selected based on the conditions used in the wash step
  • the salt concentration in the wash step can be selected from a high stringency of about 0.2 x SSC at 50°C.
  • the temperature in the wash step can be at high stringency conditions, at about 65°C. It will be appreciated that the invention includes nucleic acid molecules encoding an OB-BPL
  • nucleic acid molecules of the invention which arise by alternative splicing of an mR ⁇ A corresponding to a cD ⁇ A of the invention are encompassed by the invention
  • An isolated nucleic acid molecule of the invention which comprises D ⁇ A can be isolated by prepa ⁇ ng a labelled nucleic acid probe based on all or part of a nucleic acid sequence of the invention
  • the labeled nucleic acid probe is used to screen an appropriate D ⁇ A library (e.g. a cD ⁇ A or genomic D ⁇ A library)
  • a cD ⁇ A library can be used to isolate a cD ⁇ A encoding an OB-BPL Related Protein by screening the library with the labeled probe using standard techniques.
  • a genomic D ⁇ A library can be similarly screened to isolate a genomic clone encompassing a gene encoding an OB-BPL Related Protein.
  • Nucleic acids isolated by screemng of a cDNA or genomic DNA library can be sequenced by standard techniques.
  • An isolated nucleic acid molecule of the invention which is DNA can also be isolated by selectively amplifying a nucleic acid encoding an OB-BPL Related Protein using the polymerase chain reaction (PCR) methods and cDNA or genomic DNA. It is possible to design synthetic oligonucieotide p ⁇ mers from the nucleotide sequence of the invention for use in PCR.
  • a nucleic acid can be amplified from cDNA or genomic DNA using these oligonucieotide p ⁇ mers and standard PCR amplification techniques.
  • cDNA may be prepared from mRNA, by isolating total cellular mRNA by a va ⁇ ety of techniques, for example, by using the guanidimum-thiocyanate extraction procedure of Chirgw et al., Biochemistry, 18, 5294-5299 (1979).
  • cD ⁇ A is then synthesized from the mR ⁇ A using reverse transcnptase (for example, Moloney MLV reverse transcriptase available from Gibco/BRL, Bethesda, MD, or AMV reverse transcriptase available from Seikagaku America, Inc., St. Russia, FL).
  • reverse transcnptase for example, Moloney MLV reverse transcriptase available from Gibco/BRL, Bethesda, MD, or AMV reverse transcriptase available from Seikagaku America, Inc., St. Russia, FL).
  • An isolated nucleic acid molecule of the invention which is RNA can be isolated by cloning a cDNA encoding an OB-BPL Related Protein into an appropriate vector which allows for transcription of the cDNA to produce an RNA molecule which encodes an OB-BPL Related Protein.
  • a cDNA can be cloned downstream of a bacteriophage promoter, (e.g. a T7 promoter) in a vector, cDNA can be transcribed in vitro with T7 polymerase, and the resultant RNA can be isolated by conventional techniques.
  • Nucleic acid molecules of the invention may be chemically synthesized using standard techniques. Methods of chemically synthesizing polydeoxynucleotides are known, including but not limited to solid- phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and Itakura U.S. Patent Nos. 4,401,796 and 4,373,071).
  • Determination of whether a particular nucleic acid molecule encodes an OB-BPL Related Protein can be accomplished by expressing the cDNA in an appropriate host cell by standard techniques, and testing the expressed protein in the methods described herein.
  • a cDNA encoding an OB-BPL Related Protein can be sequenced by standard techniques, such as dideoxynucleotide chain termination or Maxam- Gilbert chemical sequencing, to determine the nucleic acid sequence and the predicted amino acid sequence of the encoded protein.
  • the initiation codon and untranslated sequences of an OB-BPL Related Protein may be determined using computer software designed for the purpose, such as PC/Gene (IntelliGenetics Inc., Calif.).
  • the intron-exon structure and the transcription regulatory sequences of a gene encoding an OB-BPL Related Protein may be confirmed by using a nucleic acid molecule of the invention encoding an OB-BPL Related Protein to probe a genomic DNA clone library. Regulatory elements can be identified using standard techniques. The function of the elements can be confirmed by using these elements to express a reporter gene such as the lacZ gene which is operatively linked to the elements. These constructs may be introduced into cultured cells using conventional procedures or into non-human transgenic animal models. In addition to identifying regulatory elements in DNA, such constructs may also be used to identify nuclear proteins interacting with the elements, using techniques known in the art.
  • the nucleic acid molecules isolated using the methods described herein are mutant OB-BPL gene alleles.
  • the mutant alleles may be isolated from individuals either known or proposed to have a genotype which contributes to the symptoms of a disorder of the hematopoietic system (e.g. leukemias).
  • Mutant alleles and mutant allele products may be used in therapeutic and diagnostic methods described herein.
  • a cDNA of a mutant OB-BPL gene may be isolated using PCR as described herein, and the DNA sequence of the mutant allele may be compared to the normal allele to ascertain the mutation(s) responsible for the loss or alteration of function of the mutant gene product.
  • a genomic library can also be constructed using DNA from an individual suspected of or known to carry a mutant allele, or a cDNA library can be constructed using RNA from tissue known, or suspected to express the mutant allele.
  • a nucleic acid encoding a normal OB-BPL gene or any suitable fragment thereof, may then be labeled and used as a probe to identify the corresponding mutant allele in such libraries.
  • Clones containing mutant sequences can be purified and subjected to sequence analysis.
  • an expression library can be constructed using cDNA from RNA isolated from a tissue of an individual known or suspected to express a mutant OB-BPL allele. Gene products made by the putatively mutant tissue may be expressed and screened, for example using antibodies specific for an OB-BPL Related Protein as described herein. Library clones identified using the antibodies can be purified and subjected to sequence analysis.
  • nucleic acid molecule of the invention may be inverted relative to its normal presentation for transcription to produce an antisense nucleic acid molecule.
  • An antisense nucleic acid molecule may be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • An amino acid sequence of an OB-BPL Protein comprises a sequence as shown in SEQ.IDNO. 2 or 3.
  • the protein is highly expressed in bone marrow, placenta, spleen, and fetal liver.
  • proteins of the present invention include truncations of an OB-BPL Protein, analogs of an OB-BPL Protein, and proteins having sequence identity or similarity to an OB-BPL Protein, and truncations thereof as described herein (i.e. OB-BPL Related Proteins).
  • Truncated proteins may comprise peptides of between 3 and 70 amino acid residues, ranging in size from a tripeptide to a 70 mer polypeptide.
  • the truncated proteins may have an amino group (- ⁇ H2), a hydrophobic group (for example, carbobenzoxyl, dansyl, or T-butyloxycarbonyl), an acetyl group, a 9-fluorenylmethoxy-carbonyl (PMOC) group, or a macromolecule including but not limited to lipid-fatty acid conjugates, polyethylene glycol, or carbohydrates at the amino terminal end.
  • the truncated proteins may have a carboxyl group, an amido group, a T-butyloxycarbonyl group, or a macromolecule including but not limited to lipid-fatty acid conjugates, polyethylene glycol, or carbohydrates at the carboxy terminal end.
  • the proteins of the invention may also include analogs of an OB-BPL Protein, and/or truncations thereof as described herein, which may include, but are not limited to an OB-BPL Protein, containing one or more amino acid substitutions, insertions, and/or deletions.
  • Amino acid substitutions may be of a conserved or non-conserved nature. conserveed amino acid substitutions involve replacing one or more amino acids of an OB-BPL Protein amino acid sequence with amino acids of similar charge, size, and/or hydrophobicity characteristics. When only conserved substitutions are made the resulting analog is preferably functionally equivalent to an OB-BPL Protein.
  • Non-conserved substitutions involve replacing one or more amino acids of the OB-BPL Protein amino acid sequence with one or more amino acids which possess dissimilar charge, size, and/or hydrophobicity characteristics.
  • One or more amino acid insertions may be introduced into an OB-BPL Protein.
  • Amino acid insertions may consist of single amino acid residues or sequential amino acids ranging from 2 to 15 amino acids in length.
  • Deletions may consist of the removal of one or more amino acids, or discrete portions from an OB- BPL Protein sequence.
  • the deleted amino acids may or may not be contiguous.
  • the lower limit length of the resulting analog with a deletion mutation is about 10 amino acids, preferably 20 to 40 amino acids.
  • the proteins of the invention include proteins with sequence identity or similarity to an OB-BPL Protein and/or truncations thereof as described herein.
  • Such OB-BPL Proteins include proteins whose amino acid sequences are comprised of the amino acid sequences of OB-BPL Protein regions from other species that hybridize under selected hybridization conditions (see discussion of stringent hybridization conditions herein) with a probe used to obtain an OB-BPL Protein. These proteins will generally have the same regions which are characteristic of an OB-BPL Protein.
  • a protein will have substantial sequence identity for example, about 65%, 70%, 75%, 80%, or 85% identity, preferably 90% identity, more preferably at least 95%, 96%, 97%, 98%, or 99% identity, and most preferably 98% identity with an amino acid sequence shown in in SEQ.IDNO. 2 or 3.
  • a percent amino acid sequence homology, similarity or identity is calculated as the percentage of aligned amino acids that match the reference sequence using known methods as described herein.
  • the invention also contemplates isoforms of the proteins of the invention.
  • An isoform contains the same number and kinds of amino acids as a protein of the invention, but the isoform has a different molecular structure.
  • Isoforms contemplated by the present invention preferably have the same properties as a protein of the invention as described herein.
  • the present invention also includes OB-BPL Related Proteins conjugated with a selected protein, or a marker protein (see below) to produce fusion proteins. Additionally, immunogenic portions of an OB- BPL Protein and an OB-BPL Protein Related Protein are within the scope of the invention.
  • AN OB-BPL Related Protein of the invention may be prepared using recombinant DNA methods. Accordingly, the nucleic acid molecules of the present invention having a sequence which encodes an OB- BPL Related Protein of the invention may be incorporated in a known manner into an appropriate expression vector which ensures good expression of the protein. Possible expression vectors include but are not limited to cosmids, plasmids, or modified viruses (e.g. replication defective retroviruses, adeno viruses and adeno-associated viruses), so long as the vector is compatible with the host cell used.
  • the invention therefore contemplates a recombinant expression vector of the invention containing a nucleic acid molecule of the invention, and the necessary regulatory sequences for the transcription and translation of the inserted protein-sequence.
  • Suitable regulatory sequences may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes [For example, see the regulatory sequences described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990)]. Selection of appropriate regulatory sequences is dependent on the host cell chosen as discussed below, and may be readily accomplished by one of ordinary skill in the art.
  • the necessary regulatory sequences may be supplied by the native OB-BPL Protein and/or its flanking regions.
  • the invention further provides a recombinant expression vector comprising a DNA nucleic acid molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is linked to a regulatory sequence in a manner which allows for expression, by transcription of - l i ⁇
  • RNA molecules which is antisense to the nucleic acid sequence of a protein of the invention or a fragment thereof.
  • Regulatory sequences linked to the antisense nucleic acid can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance a viral promoter and/or enhancer, or regulatory sequences can be chosen which direct tissue or cell type specific expression of antisense RNA.
  • the recombinant expression vectors of the invention may also contain a marker gene which facilitates the selection of host cells transformed or transfected with a recombinant molecule of the invention.
  • marker genes are genes encoding a protein such as G418 and hygromycin which confer resistance to certain drugs, ⁇ -galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin preferably IgG.
  • the markers can be introduced on a separate vector from the nucleic acid of interest.
  • the recombinant expression vectors may also contain genes which encode a fusion moiety which provides increased expression of the recombinant protein; increased solubility of the recombinant protein; and aid in the purification of the target recombinant protein by acting as a ligand in affinity purification.
  • a proteolytic cleavage site may be added to the target recombinant protein to allow separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
  • Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the recombinant protein.
  • the recombinant expression vectors may be introduced into host cells to produce a transformant host cell.
  • Transformant host cells include host cells which have been transformed or transfected with a recombinant expression vector of the invention.
  • the terms "transformed with”, “transfected with”, “transformation” and “transfection” encompass the introduction of a nucleic acid (e.g.
  • Prokaryotic cells can be transformed with a nucleic acid by, for example, electroporation or calcium-chloride mediated transformation.
  • a nucleic acid can be introduced into mammalian cells via conventional techniques such as calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofectin, electroporation or microinjection. Suitable methods for transforming and transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory textbooks.
  • Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells.
  • the proteins of the invention may be expressed in bacterial cells such as E. coli, insect cells (using baculovirus), yeast cells, or mammalian cells.
  • Other suitable host cells can be found in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1991).
  • a host cell may also be chosen which modulates the expression of an inserted nucleic acid sequence, or modifies (e.g. glycosylation or phosphorylation) and processes (e.g. cleaves) the protein in a desired fashion.
  • Host systems or cell lines may be selected which have specific and characteristic mechanisms for post-translational processing and modification of proteins.
  • eukaryotic host cells including CHO, VERO, BHK, HeLA, COS, MDCK, 293, 3T3, and WI38 may be used.
  • cell lines and host systems which stably express the gene product may be engineered.
  • Host cells and in particular cell lines produced using the methods described herein may be particularly useful in screening and evaluating compounds that modulate the activity of an OB-BPL Related Protein.
  • the proteins of the invention may also be expressed in non-human transgenic animals including but not limited to mice, rats, rabbits, guinea pigs, micro-pigs, goats, sheep, pigs, non-human primates (e.g. baboons, monkeys, and chimpanzees) [see Hammer et al. (Nature 315:680-683, 1985), Palmiter et al. (Science 222:809-814, 1983), Brinster et al. (Proc Natl. Acad. Sci USA 82:44384442, 1985), Palmiter and Brinster (Cell. 41:343-345, 1985) and U.S. Patent No. 4,736,866)].
  • non-human transgenic animals including but not limited to mice, rats, rabbits, guinea pigs, micro-pigs, goats, sheep, pigs, non-human primates (e.g. baboons, monkeys, and chimpanzees) [see Hammer
  • Procedures known in the art may be used to introduce a nucleic acid molecule of the invention encoding an OB-BPL Related Protein into animals to produce the founder lines of transgenic animals.
  • Such procedures include pronuclear microinjection, retrovirus mediated gene transfer into germ lines, gene targeting in embryonic stem cells, electroporation of embryos, and sperm-mediated gene transfer.
  • the present invention contemplates a transgenic animal that carries the OB-BPL gene in all their cells, and animals which carry the transgene in some but not all their cells.
  • the transgene may be integrated as a single transgene or in concatamers.
  • the transgene may be selectively introduced into and activated in specific cell types (See for example, Lasko et al, 1992 Proc. Natl. Acad. Sci. USA 89: 6236).
  • the transgene may be integrated into the chromosomal site of the endogenous gene by gene targeting.
  • the transgene may be selectively introduced into a particular cell type inactivating the endogenous gene in that cell type (See Gu et al Science 265: 103-106).
  • the expression of a recombinant OB-BPL Related Protein in a transgenic animal may be assayed using standard techniques. Initial screening may be conducted by Southern Blot analysis, or PCR methods to analyze whether the transgene has been integrated. The level of mRNA expression in the tissues of transgenic animals may also be assessed using techniques including Northern blot analysis of tissue samples, in situ hybridization, and RT-PCR. Tissue may also be evaluated immunocytochemically using antibodies against OB-BPL Protein.
  • Proteins of the invention may also be prepared by chemical synthesis using techniques well known in the chemistry of proteins such as solid phase synthesis (Merrifield, 1964, J. Am. Chem. Assoc. 85:2149- 2154) or synthesis in homogenous solution (Houbenweyl, 1987, Methods of Organic Chemistry, ed. E. Wansch, Vol. 15 I and II, Thieme, Stuttgart).
  • N-terminal or C-terminal fusion proteins comprising an OB-BPL Related Protein of the invention conjugated with other molecules, such as proteins, may be prepared by fusing, through recombinant techniques, the N-terminal or C-terminal of an OB-BPL Related Protein, and the sequence of a selected protein or marker protein with a desired biological function.
  • the resultant fusion proteins contain OB-BPL Protein fused to the selected protein or marker protein as described herein.
  • proteins which may be used to prepare fusion proteins include immunoglobulins, glutathione-S-transferase (GST), hemagglutinin (HA), and truncated myc.
  • OB-BPL Related Proteins of the invention can be used to prepare antibodies specific for the proteins.
  • Antibodies can be prepared which bind a distinct epitope in an unconserved region of the protein.
  • An unconserved region of the protein is one that does not have substantial sequence homology to other proteins.
  • a region from a conserved region such as a well-characterized domain can also be used to prepare an antibody to a conserved region of an OB-BPL Related Protein.
  • Antibodies having specificity for an OB-BPL Related Protein may also be raised from fusion proteins created by expressing fusion proteins in bacteria as described herein.
  • the invention can employ intact monoclonal or polyclonal antibodies, and immunologically active fragments (e.g.
  • Fab fragments and Fab expression library fragments and epitope-binding fragments thereof
  • an antibody heavy chain and antibody light chain
  • a genetically engineered single chain Fv molecule Ladner et al, U.S. Pat. No. 4,946,778
  • a chimeric antibody for example, an antibody which ⁇ contains the binding specificity of a murine antibody, but in which the remaining portions are of human origin.
  • Antibodies including monoclonal and polyclonal antibodies, fragments and chimeras may be prepared using methods known to those skilled in the art.
  • nucleic acid molecules, OB-BPL Related Proteins, and antibodies of the invention may be used in the prognostic and diagnostic evaluation of cancer or disorders of the hematopoietic system, and the identification of subjects with a predisposition to cancer or hematopoietic disorders (Section 4.1.1 and 4.1.2).
  • Methods for detecting nucleic acid molecules and OB-BPL Related Proteins of the invention can be used to monitor cancer or hematopoietic disorders by detecting OB-BPL Related Proteins and nucleic acid molecules encoding OB-BPL Related Proteins. It would also be apparent to one skilled in the art that the methods described herein may be used to study the developmental expression of OB-BPL Related Proteins.
  • the applications of the present invention also include methods for the identification of compounds that modulate the biological activity of OB-BPL or OB-BPL Related Proteins (Section 4.2).
  • the compounds, antibodies etc. may be used for the treatment of cancer or hematopoietic disorders (Section 4.3).
  • a variety of methods can be employed for the diagnostic and prognostic evaluation of cancer or disorders of the hematopoietic system (e.g. leukemias), and the identification of subjects with a predisposition to cancer or hematopoietic disorders.
  • Such methods may, for example, utilize nucleic acid molecules of the invention, and fragments thereof, and antibodies directed against OB-BPL Related Proteins, including peptide fragments.
  • the nucleic acids and antibodies may be used, for example, for: (1) the detection of the presence of OB-BPL mutations, or the detection of either over- or under-expression of OB-BPL mRNA relative to a non-disorder state or the qualitative or quantitative detection of alternatively spliced forms of OB-BPL transcripts which may correlate with certain conditions or susceptibility toward such conditions; and (2) the detection of either an over- or an under-abundance of OB-BPL Related Proteins relative to a non- disorder state or the presence of a modified (e.g., less than full length) OB-BPL Protein which correlates with a disorder state, or a progression toward a disorder state.
  • a modified (e.g., less than full length) OB-BPL Protein which correlates with a disorder state, or a progression toward a disorder state.
  • the methods described herein may be performed by utilizing pre-packaged diagnostic kits comprising at least one specific OB-BPL nucleic acid or antibody described herein, which may be conveniently used, e.g., in clinical settings, to screen and diagnose patients and to screen and identify those individuals exhibiting a predisposition to developing a disorder.
  • Nucleic acid-based detection techniques are described, below, in Section 4.1.1.
  • Peptide detection techniques are described, below, in Section 4.1.2.
  • the samples that may be analyzed using the methods of the invention include those which are known or suspected to express OB-BPL or contain OB-BPL Related Proteins.
  • the samples may be derived from a patient or a cell culture, and include but are not limited to biological fluids, tissue extracts, freshly harvested cells, and lysates of cells which have been incubated in cell cultures.
  • Oligonucleotides or longer fragments derived from any of the nucleic acid molecules of the invention may be used as targets in a microarray.
  • the microa ⁇ ay can be used to simultaneously monitor the expression levels of large numbers of genes and to identify genetic variants, mutations, and polymorphisms.
  • the information from the microarray may be used to determine gene function, to understand the genetic basis of a disorder, to diagnose a disorder, and to develop and monitor the activities of therapeutic agents.
  • the preparation, use, and analysis of microarrays are well known to a person skilled in the art.
  • nucleic acid molecules of the invention allow those skilled in the art to construct nucleotide probes for use in the detection of nucleic acid sequences of the invention in samples.
  • Suitable probes include nucleic acid molecules based on nucleic acid sequences encoding at least 5 sequential amino acids from regions of the OB-BPL Protein, preferably they comprise 15 to 30 nucleotides.
  • a nucleotide probe may be labeled with a detectable substance such as a radioactive label which provides for an adequate signal and has sufficient half-life such as 32 P, 3 H, 14 C or the like.
  • detectable substances which may be used include antigens that are recognized by a specific labeled antibody, fluorescent compounds, enzymes, antibodies specific for a labeled antigen, and luminescent compounds.
  • An appropriate label may be selected having regard to the rate of hybridization and binding of the probe to the nucleotide to be detected and the amount of nucleotide available for hybridization.
  • Labeled probes may be hybridized to nucleic acids on solid supports such as nitrocellulose filters or nylon membranes as generally described in Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual (2nd ed.).
  • the nucleic acid probes may be used to detect genes, preferably in human cells, that encode OB-BPL Related Proteins.
  • the nucleotide probes may also be useful in the diagnosis of disorders of the hematopoietic system or cancer; in monitoring the progression of such disorders; or monitoring a therapeutic treatment.
  • the probe may be used in hybridization techniques to detect genes that encode OB-BPL Related Proteins.
  • the technique generally involves contacting and incubating nucleic acids (e.g. recombinant DNA molecules, cloned genes) obtained from a sample from a patient or other cellular source with a probe of the present invention under conditions favorable for the specific annealing of the probes to complementary sequences in the nucleic acids. After incubation, the non-annealed nucleic acids are removed, and the presence of nucleic acids that have hybridized to the probe if any are detected.
  • nucleic acids e.g. recombinant DNA molecules, cloned genes
  • the detection of nucleic acid molecules of the invention may involve the amplification of specific gene sequences using an amplification method such as PCR, followed by the analysis of the amplified molecules using techniques known to those skilled in the art. Suitable primers can be routinely designed by one of skill in the art.
  • Genomic DNA may be used in hybridization or amplification assays of biological samples to detect abnormalities involving ob-bpl structure, including point mutations, insertions, deletions, and chromosomal rearrangements.
  • direct sequencing single stranded conformational polymorphism analyses, heteroduplex analysis, denaturing gradient gel electrophoresis, chemical mismatch cleavage, and oligonucieotide hybridization may be utilized.
  • Genotyping techniques known to one skilled in the art can be used to type polymorphisms that are in close proximity to the mutations an OB-BPL gene.
  • the polymorphisms may be used to identify individuals in families that are likely to carry mutations. If a polymorphism exhibits linkage disequalibrium with mutations in an OB-BPL gene, it can also be used to screen for individuals in the general population likely to carry mutations.
  • Polymorphisms which may be used include restriction fragment length polymorphisms (RFLPs), single-base polymorphisms, and simple sequence repeat polymorphisms (SSLPs).
  • a probe of the invention may be used to directly identify RFLPs.
  • a probe or primer of the invention can additionally be used to isolate genomic clones such as YACs, BACs, PACs, cosmids, phage or plasmids. The DNA in the clones can be screened for SSLPs using hybridization or sequencing procedures.
  • Hybridization and amplification techniques described herein may be used to assay qualitative and quantitative aspects of OB-BPL expression.
  • RNA may be isolated from a cell type or tissue known to express OB-BPL and tested utilizing the hybridization (e.g. standard Northern analyses) or PCR techniques referred to herein.
  • the techniques may be used to detect differences in transcript size which may be due to normal or abnormal alternative splicing.
  • the techniques may be used to detect quantitative differences between levels of full length and/or alternatively splice transcripts detected in normal individuals relative to those individuals exhibiting symptoms of a hematopoietic disorder or other disease conditions.
  • the primers and probes may be used in the above described methods in situ i.e directly on tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections.
  • 4.1.2 Methods for Detecting OB-BPL Related Proteins Antibodies specifically reactive with an OB-BPL Related Protein, or derivatives, such as enzyme conjugates or labeled derivatives, may be used to detect OB-BPL Related Proteins in various samples (e.g. biological materials). They may be used as diagnostic or prognostic reagents and they may be used to detect abnormalities in the level of OB-BPL Related Proteins expression, or abnormalities in the structure, and/or temporal, tissue, cellular, or subcellular location of an OB-BPL Related Protein.
  • Antibodies may also be used to screen potentially therapeutic compounds in vitro to determine their effects on disorders of the hematopoietic system, and other conditions. In vitro immunoassays may also be used to assess or monitor the efficacy of particular therapies.
  • the antibodies of the invention may also be used in vitro to determine the level of OB-BPL expression in cells genetically engineered to produce an OB-BPL Related Protein.
  • the antibodies may be used in any known immunoassays which rely on the binding interaction between an antigenic determinant of an OB-BPL Related Protein and the antibodies. Examples of such assays are radioimmunoassays, enzyme immunoassays (e.g.
  • the antibodies may be used to detect and quantify OB-BPL Related Proteins in a sample in order to determine its role in particular cellular events or pathological states, and to diagnose and treat such pathological states.
  • the antibodies of the invention may be used in immuno-histochemical analyses, for example, at the cellular and sub-subcellular level, to detect an OB-BPL Related Protein, to localize it to particular cells and tissues, and to specific subcellular locations, and to quantitate the level of expression.
  • Cytochemical techniques known in the art for localizing antigens using light and electron microscopy may be used to detect an OB-BPL Related Protein.
  • an antibody of the invention may be labeled with a detectable substance and an OB-BPL Related Protein may be localised in tissues and cells based upon the presence of the detectable substance.
  • detectable substances include, but are not limited to, the following: radioisotopes (e.g., 3 H, 14 C, 35 S, 125 1, 131 I), fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors), luminescent labels such as luminol; enzymatic labels (e.g., horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase, acetylcholinesterase), biotinyl groups
  • radioisotopes e.g., 3 H, 14 C, 35 S, 125 1, 131 I
  • fluorescent labels e.g., FITC, rhodamine, lanthanide phosphors
  • luminescent labels such as luminol
  • enzymatic labels e.g., horseradish peroxidase, beta-galactosidase, luciferase, alka
  • labels are attached via spacer arms of various lengths to reduce potential steric hindrance.
  • Antibodies may also be coupled to electron dense substances, such as ferritin or colloidal gold, which are readily visualised by electron microscopy.
  • the antibody or sample may be immobilized on a carrier or solid support which is capable of immobilizing cells, antibodies etc.
  • the carrier or support may be nitrocellulose, or glass, polyacrylamides, gabbros, and magnetite.
  • the support material may have any possible configuration including spherical (e.g. bead), cylindrical (e.g. inside surface of a test tube or well, or the external surface of a rod), or flat (e.g. sheet, test strip).
  • Indirect methods may also be employed in which the primary antigen-antibody reaction is amplified by the introduction of a second antibody, having specificity for the antibody reactive against OB-BPL Related Protein.
  • the second antibody may be goat anti-rabbit gamma-globulin labeled with a detectable substance as described herein.
  • an OB-BPL Related Protein may be localized by radioautography.
  • the results of radioautography may be quantitated by determining the density of particles in the radioautographs by various optical methods, or by counting the grains.
  • the methods described herein are designed to identify substances that modulate the biological activity of an OB-BPL Related Protein including substances that bind to OB-BPL Related Proteins, or bind to other proteins that interact with an OB-BPL Related Protein, to compounds that interfere with, or enhance the interaction of an OB-BPL Related Protein and substances that bind to the OB-BPL Related Protein or other proteins that interact with an OB-BPL Related Protein. Methods are also utilized that identify compounds that bind to OB-BPL regulatory sequences.
  • the substances and compounds identified using the methods of the invention include but are not limited to peptides such as soluble peptides including Ig-tailed fusion peptides, members of random peptide libraries and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids, phosphopeptides (including members of random or partially degenerate, directed phosphopeptide libraries), antibodies [e.g. polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, single chain antibodies, fragments, (e.g. Fab, F(ab) 2 , and Fab expression library fragments, and epitope-binding fragments thereof)], and small organic or inorganic molecules.
  • the substance or compound may be an endogenous physiological compound or it may be a natural or synthetic compound.
  • Substances which modulate an OB-BPL Related Protein can be identified based on their ability to bind to an OB-BPL Related Protein. Therefore, the invention also provides methods for identifying substances which bind to an OB-BPL Related Protein. Substances identified using the methods of the invention may be isolated, cloned and sequenced using conventional techniques. A substance that associates with a polypeptide of the invention may be an agonist or antagonist of the biological or immunological activity of a polypeptide of the invention.
  • agonist refers to a molecule that increases the amount of, or prolongs the duration of, the activity of the polypeptide.
  • antagonist refers to a molecule which decreases the biological or immunological activity of the polypeptide.
  • Agonists and antagonists may include proteins, nucleic acids, carbohydrates, or any other molecules that associate with a polypeptide of the invention.
  • Substances which can bind with an OB-BPL Related Protein may be identified by reacting an OB- BPL Related Protein with a test substance which potentially binds to an OB-BPL Related Protein, under conditions which permit the formation of substance-OB-BPL Related Protein complexes and removing and/or detecting the complexes.
  • the complexes can be detected by assaying for substance-OB-BPL Related Protein complexes, for free substance, or for non-complexed OB-BPL Related Protein.
  • Conditions which permit the formation of substance-OB-BPL Related Protein complexes may be selected having regard to factors such as the nature and amounts of the substance and the protein.
  • the substance-protein complex, free substance or non-complexed proteins may be isolated by conventional isolation techniques, for example, salting out, chromatography, electrophoresis, gel filtration, fractionation, absorption, polyacrylamide gel electrophoresis, agglutination, or combinations thereof.
  • antibody against OB-BPL Related Protein or the substance, or labeled OB-BPL Related Protein, or a labeled substance may be utilized.
  • the antibodies, proteins, or substances may be labeled with a detectable substance as described above.
  • AN OB-BPL Related Protein or the substance used in the method of the invention may be insolubilized.
  • an OB-BPL Related Protein, or substance may be bound to a suitable carrier such as agarose, cellulose, dextran, Sephadex, Sepharose, carboxymethyl cellulose polystyrene, filter paper, ion-exchange resin, plastic film, plastic tube, glass beads, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, silk, etc.
  • the carrier may be in the shape of, for example, a tube, test plate, beads, disc, sphere etc.
  • the insolubilized protein or substance may be prepared by reacting the material with a suitable insoluble carrier using known chemical or physical methods, for example, cyanogen bromide coupling.
  • the invention also contemplates a method for evaluating a compound for its ability to modulate the biological activity of an OB-BPL Related Protein of the invention, by assaying for an agonist or antagonist (i.e. enhancer or inhibitor) of the binding of an OB-BPL Related Protein with a substance which binds with an OB-BPL Related Protein.
  • the basic method for evaluating if a compound is an agonist or antagonist of the binding of an OB-BPL Related Protein and a substance that binds to the protein is to prepare a reaction mixture containing the OB-BPL Related Protein and the substance under conditions which permit the formation of substance-OB-BPL Related Protein complexes, in the presence of a test compound.
  • the test compound may be initially added to the mixture, or may be added subsequent to the addition of the OB-BPL Related Protein and substance.
  • Control reaction mixtures without the test compound or with a placebo are also prepared.
  • the formation of complexes is detected and the formation of complexes in the control reaction but not in the reaction mixture indicates that the test compound interferes with the interaction of the OB-BPL Related Protein and substance.
  • the reactions may be carried out in the liquid phase or the OB-BPL Related Protein, substance, or test compound may be immobilized as described herein.
  • the ability of a compound to modulate the biological activity of an OB-BPL Related Protein of the invention may be tested by determining the biological effects on cells.
  • agonists and antagonists i.e. inhibitors and enhancers that can be assayed using the methods of the invention may act on one or more of the binding sites on the protein or substance including agonist binding sites, competitive antagonist binding sites, non-competitive antagonist binding sites or allosteric sites.
  • the invention also makes it possible to screen for antagonists that inhibit the effects of an agonist of the interaction of OB-BPL Related Protein with a substance which is capable of binding to the OB-BPL Related Protein.
  • the invention may be used to assay for a compound that competes for the same binding site of an OB-BPL Related Protein.
  • the invention also contemplates methods for identifying compounds that bind to proteins that interact with an OB-BPL Related Protein.
  • Protein-protein interactions may be identified using conventional methods such as co-immunoprecipitation, crosslinking and co-purification through gradients or chromatographic columns. Methods may also be employed that result in the simultaneous identification of genes which encode proteins interacting with an OB-BPL Related Protein. These methods include probing expression libraries with labeled OB-BPL Related Protein.
  • Two-hybrid systems may also be used to detect protein interactions in vivo. Generally, plasmids are constructed that encode two hybrid proteins.
  • a first hybrid protein consists of the DNA-binding domain of a transcription activator protein fused to an OB-BPL Related Protein
  • the second hybrid protein consists of the transcription activator protein's activator domain fused to an unknown protein encoded by a cDNA which has been recombined into the plasmid as part of a cDNA library.
  • the plasmids are transformed into a strain of yeast (e.g. S. cerevisiae) that contains a reporter gene (e.g. lacZ, luciferase, alkaline phosphatase, horseradish peroxidase) whose regulatory region contains the transcription activator's binding site.
  • the hybrid proteins alone cannot activate the transcription of the reporter gene.
  • fusion proteins may be used in the above-described methods.
  • OB-BPL Related Proteins fused to a glutathione-S-transferase may be used in the methods.
  • the reagents suitable for applying the methods of the invention to evaluate compounds that modulate an OB-BPL Related Protein may be packaged into convenient kits providing the necessary materials packaged into suitable containers.
  • the kits may also include suitable supports useful in performing the methods of the invention.
  • proteins of the invention substances or compounds identified by the methods described herein, antibodies, and antisense nucleic acid molecules of the invention may be used for modulating the biological activity of an OB-BPL Related Protein, and they may be used in the treatment of conditions such as cancer and disorders of the hematopoietic system, in particular leukemias.
  • Hematopoietic disorders include but are not limited to myeloproliferative or other proliferative disorders of blood forming organs such as thromocythemias, polycythemias, and leukemias (acute myelogenous leukemia, chronic myelogenous leukemia).
  • the proteins, substances, compounds, antibodies, and antisense nucleic acid molecules of the invention may be used in conjunction with bone marrow transplant, or in the treatment of aplasia or myelosuppression caused by radiation, chemical treatment, or chemotherapy. They may also be used to treat hematopoietic disorders associated with viral or bacterial infections.
  • the substances, antibodies, peptides, and compounds may be formulated into pharmaceutical compositions for administration to subjects in a biologically compatible form suitable for administration in vivo.
  • biologically compatible form suitable for administration in vivo is meant a form of the active substance to be administered in which any toxic effects are outweighed by the therapeutic effects.
  • the active substances may be administered to living organisms including humans, and animals.
  • Administration of a therapeutically active amount of a pharmaceutical composition of the present invention is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result.
  • a therapeutically active amount of a substance may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of antibody to elicit a desired response in the individual. Dosage periods may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
  • the active substance may be administered in a convenient manner such as by injection (subcutaneous, intravenous, etc.), oral administration, inhalation, transdermal application, or rectal administration.
  • the active substance may be coated in a material to protect the substance from the action of enzymes, acids and other natural conditions that may inactivate the substance.
  • compositions described herein can be prepared by per se known methods for the preparation of pharmaceutically acceptable compositions which can be administered to subjects, such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle.
  • Suitable vehicles are described, for example, in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA 1985).
  • the compositions include, albeit not exclusively, solutions of the active substances in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and iso-osmotic with the physiological fluids.
  • Vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids may be used to deliver nucleic acid molecules to a targeted organ, tissue, or cell population. Methods well known to those skilled in the art may be used to construct recombinant vectors which will express antisense nucleic acid molecules of the invention. (See, for example, the techniques described in Sambrook et al (supra) and Ausubel et al (supra)).
  • nucleic acid molecules comprising full length cDNA sequences and/or their regulatory elements enable a skilled artisan to use sequences encoding a protein of the invention as an investigative tool in sense (Youssoufian H and H F Lodish 1993 Mol Cell Biol 13:98-104) or antisense (Eguchi et al (1991) Annu Rev Biochem 60:631-652) regulation of gene function.
  • sense or antisense oligomers, or larger fragments can be designed from various locations along the coding or control regions.
  • Genes encoding a protein of the invention can be turned off by transfecting a cell or tissue with vectors which express high levels of a desired OB-BPL-encoding fragment. Such constructs can inundate cells with untranslatable sense or antisense sequences. Even in the absence of integration into the DNA, such vectors may continue to transcribe RNA molecules until all copies are disabled by endogenous nucleases.
  • Modifications of gene expression can be obtained by designing antisense molecules, DNA, RNA or PNA, to the regulatory regions of a gene encoding a protein of the invention, ie, the promoters, enhancers, and introns.
  • oligonucleotides are derived from the transcription initiation site, eg, between -10 and +10 regions of the leader sequence.
  • the antisense molecules may also be designed so that they block translation of mRNA by preventing the transcript from binding to ribosomes. Inhibition may also be achieved using "triple helix" base-pairing methodology. Triple helix pairing compromises the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules. Therapeutic advances using triplex DNA were reviewed by Gee J E et al (In: Huber B E and B I Carr (1994) Molecular and Immunologic Approaches, Futura Publishing Co, Mt Kisco N.Y.).
  • Ribozymes are enzymatic RNA molecules that catalyze the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
  • the invention therefore contemplates engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of sequences encoding a protein of the invention.
  • Specific ribozyme cleavage sites within any potential RNA target may initially be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once the sites are identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the oligonucieotide inoperable. The suitability of candidate targets may also be determined by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
  • vectors may be introduced into stem cells obtained from a patient and clonally propagated for autologous transplant into the same patient (See U.S. Pat. Nos. 5,399,493 and 5,437,994). Delivery by transfection and by liposome are well known in the art.
  • nucleic acid molecules disclosed herein may also be used in molecular biology techniques that have not yet been developed, provided the new techniques rely on properties of nucleotide sequences that are currently known, including but not limited to such properties as the triplet genetic code and specific base pair interactions.
  • the invention also provides methods for studying the function of a polypeptide of the invention.
  • Cells, tissues, and non-human animals lacking in expression or partially lacking in expression of a nucleic acid molecule or gene of the invention may be developed using recombinant expression vectors of the invention having specific deletion or insertion mutations in the gene.
  • a recombinant expression vector may be used to inactivate or alter the endogenous gene by homologous recombination, and thereby create a deficient cell, tissue, or animal.
  • Null alleles may be generated in cells, such as embryonic stem cells by deletion mutation.
  • a recombinant gene may also be engineered to contain an insertion mutation that inactivates the gene.
  • Such a construct may then be introduced into a cell, such as an embryonic stem cell, by a technique such as transfection, electroporation, injection etc.
  • Cells lacking an intact gene may then be identified, for example by Southern blotting, Northern Blotting, or by assaying for expression of the encoded polypeptide using the methods described herein.
  • Such cells may then be fused to embryonic stem cells to generate transgenic non-human animals deficient in a polypeptide of the invention.
  • Germline transmission of the mutation may be achieved, for example, by aggregating the embryonic stem cells with early stage embryos, such as 8 cell embryos, in vitro; transferring the resulting blastocysts into recipient females and; generating germline transmission of the resulting aggregation chimeras.
  • Such a mutant animal may be used to define specific cell populations, developmental patterns and in vivo processes, normally dependent on gene expression.
  • the invention thus provides a transgenic non-human mammal all of whose germ cells and somatic cells contain a recombinant expression vector that inactivates or alters a gene encoding a OB-BPL Related Protein.
  • the invention provides a transgenic non-human mammal all of whose germ cells and somatic cells contain a recombinant expression vector that inactivates or alters a gene encoding an OB- BPL Related Protein resulting in an OB-BPL Related Protein associated pathology. Further the invention provides a transgenic non-human mammal which doe not express an OB-BPL Related Protein of the invention. In an embodiment, the invention provides a transgenic non-human mammal which doe not express an OB-BPL Related Protein of the invention resulting in an OB-BPL Related Protein associated pathology.
  • AN OB-BPL Related Protein pathology refers to a phenotype observed for an OB-BPL Related Protein homozygous mutant.
  • a transgenic non-human animal includes but is not limited to mouse, rat, rabbit, sheep, hamster, dog, cat, goat, and monkey, preferably mouse.
  • the invention also provides a transgenic non-human animal assay system which provides a model system for testing for an agent that reduces or inhibits a pathology associated with an OB-BPL Related Protein, preferably an OB-BPL Related Protein associated pathology, comprising:
  • step (b) determining whether said agent reduces or inhibits the pathology (e.g. OB-BPL Related Protein associated pathology) in the transgenic non-human animal relative to a transgenic non-human animal of step (a) which has not been administered the agent.
  • pathology e.g. OB-BPL Related Protein associated pathology
  • the agent may be useful in the treatment and prophylaxis of conditions such as cancer or hematopoietic disorders as discussed herein.
  • the agents may also be incorporated in a pharmaceutical composition as described herein.
  • the activity of the proteins, substances, compounds, antibodies, nucleic acid molecules, agents, and compositions of the invention may be confirmed in animal experimental model systems.
  • Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or with experimental animals, such as by calculating the ED 50 (the dose therapeutically effective in 50% of the population) or LD 50 (the dose lethal to 50% of the population) statistics.
  • the therapeutic index is the dose ratio of therapeutic to toxic effects and it can be expressed as the ED 50 /LD 50 ratio.
  • Pharmaceutical compositions which exhibit large therapeutic indices are preferred.
  • Nucleotide sequencing data of approximately 130 Kb on chromosome 19ql3.4 was obtained from the Lawrence Livermore National Laboratory (LLNL) web site (http://www- bio.llnl.gov/genome/genome.html), in the form of one contig. This genomic sequence was subjected to a number of computer algorithms (gene prediction programs) designed to predict the presence of putative new genes. All programs used were previously thoroughly evaluated using a large number of known genes (Yousef et al, 1999a).
  • the genomic sequence of the putative new gene was subjected to a homology search against the human EST database using the BLASTN algorithm (http://www.ncbi.nlm.nih.gov/BLAST) (Altschul et al, 1997). Clones showing >95% homology were obtained from the I.M.A.G.E. consortium through Research Genetics Inc. (Hunts ville, AL). The clone obtained was then propagated according to the suppliers instructions, purified, and sequenced from both directions with an automated sequencer, using the insert- flanking vector primers T3 and T7. Molecular Characterization of a Novel Siglec
  • sequence derived from the computer predicted exons of the putative new gene was also used to search the non-redundant protein sequence database, using the BLASTP algorithm (Altschul et al,
  • PCR primers were designed: FI (TCACCGGCTCTCTGTGAATG - SEQ.IDNO. 4 ) and RI (GTCTTCTGCCCAAGGTTCAG - SEQ.IDNO. 5). Using these primers, PCR was performed on bone marrow cD ⁇ A, prepared as discussed below, and chosen based on the tissue expression results.
  • the PCR conditions were as follows: 2.5 units HotStarTaq polymerase (Qiagen, Valencia, CA), IX PCR buffer with 1.5 mM MgCl 2 (Qiagen), 1 ⁇ l cD ⁇ A, 200 uM dNTPs (deoxynucleoside triphosphates), and 250 ng of primers, using the Mastercycler® gradient thermocycler (Eppendorf Scientific, Inc., Westbury, ⁇ Y).
  • the temperature profile was: denaturation at 95°C for 15 min. followed by 94°C for 30 s., annealing at 58°C for 30 s., and extension at 72°C for 1 min. for a total of 35 cycles, followed by a final extension at 72°C for 10 min.
  • PCR product was subjected to electropheresis on a 2% agarose gel and stained with ethidium bromide. Aliquots of the PCR products were subsequently extracted from the gel and the purified D ⁇ A was directly sequenced using an automated sequencer. In order to verify the sequence surrounding the proposed start codon, another set of primers were designed, again derived from regions showing low homology with other known genes: F3 (TCCTCTAAGTCTTGAGCCCG - SEQ.IDNO. 6) and R3 (CAGACGTTGAGATGGACGGT - SEQ.IDNO. 7). PCR was performed using bone marrow cD ⁇ A, prepared as described below. The conditions used for the PCR reaction were identical to those discussed previously, with electrophoresis of the PCR product on a 2% agarose gel, gel extraction, and automated sequencing as before.
  • Sequence analysis tools were also utilized to detect the presence of possible sites of post-translational modification on the putative protein.
  • the analysis programs PROSITE motif search http://www.expasy.ch/prosite/) (Bairoch et al, 1997), and NetOGlyc 2.0 (Hansen et al, 1995; Hansen et al, 1998) were used to detect N- and O-glycosylation, as well as the presence of kinase phosphorylation motifs.
  • the putative protein was assessed for the presence of a possible signal peptide, using SignalP vl.l (http://www.cbs.dtu.uk/) (Nielsen et al, 1997).
  • RNA from 28 normal human tissues was obtained (Clontech, Palo Alto, CA, USA), and reverse transcription was performed using Superscript IITM, according to the manufacturer's instructions (Gibco BRL, Gaithersburg, MD, USA). PCR was then performed using primers F2 (CGTGGGAGATACGGGCATAG - SEQ.ID.NO.8) and R2 (AAAAGGGAGGGCACAGTGTG - SEQ.IDNO. 9), using the same PCR conditions described previously. PCR for actin was also performed as describe elsewhere (Yousef et al, 1999b), as a control for cD ⁇ A quality.
  • RT-PCR was performed on bone marrow cDNA and two additional products were isolated, both encompassing multiple predicted exons. Upon sequencing of these PCR products, the presence of all six predicted exons, as well as the newly identified exon, found from the EST sequence were confirmed. With both cDNA and genomic sequence at hand, the genomic organization of this new gene was determined ( Figure 1).
  • the gene encoding this novel siglec encompasses a genomic area of 5,421 bp. It is composed of seven exons, with six intervening introns. The lengths of the exons are 509, 279, 48, 267, 91, 97, and 417 bp, respectively. All the intron/exon splice sites and their flanking sequences are closely related to the consensus splice sites (- mGTAAGT...CAGm-, where m is any base) (Iida 1990).
  • the proposed protein coding region of the novel siglec gene consists of 1,392 nucleotides, producing a 463 amino acid protein, with a predicted molecular mass of 50.1 kDa, excluding any post- translational modifications.
  • the translation initiation codon (ATG) at position 1171 of the first exon (according to the numbering of SEQ. ID. NO. 1 and GenBank Accession No.
  • AF135027 was chosen because: 1) the flanking region surrounding that codon closely matches the Kozak consensus sequence for translational initiation, particularly at position -3 (a purine), which appears to be the most highly conserved (Kozak 1991); 2) using this initiation codon, the proposed protein contains an N-terminal signal sequence which shows a high degree of homology to other similar proteins (see below).
  • the 3' terminus of the novel siglec gene was verified by the presence of a poly dA tail present in the EST sequence. Further, it is evident from Figure 1 that this gene possesses a 5' untranslated region of at least 88 nucleotides, as well as a 3' untranslated region of 228 nucleotides.
  • This novel siglec contains a total of 3 Ig domains, a V-set and two C2-set domains, based on homology with known Ig domains. As shown in Table 4, the V-set and first C2-set domains are highly similar to Siglec-7 and CD33, with the second C2-set showing highest homologies with Siglec-7 and Siglec-6. The novel siglec exhibits conservation of the cysteine residues in the V-set and first C2-set domains, which form the two characteristic disulfide bridges in other Siglec family members.
  • Cys 41 and Cys 102 form an intrasheet disulfide bond
  • Cys 36 and Cys 170 of the first C2-set domain are likely to form the interdomain disulfide bond, based on findings for other siglecs (Crocker et al, 1996; Williams et al, 1989).
  • the V-set domain also possesses a conserved arginine which has been found to be essential for sialic-acid binding (van der Merwe et al, 1996), as well as two conserved aromatic residues in ⁇ -strands A and G which have been found to make hydrophobic contacts with the N-acetyl and glycerol side groups of N-acetyl neuraminic acid (May et al, 1998).
  • this novel siglec also possesses the critical arginine, at position 120, as well as the aromatic residue in ⁇ -strand G; however it lacks the aromatic residue in the A ⁇ -strand.
  • the domain boundaries were determined based on the one domain: one exon rule (Williams and Barclay 1988), while taking into consideration the domain assignments of others (Cornish et al, 1998; Crocker et al,
  • the second motif, TEYSE(IV) is homologous to a sequence (TxYxx(IV)) recently found in the signaling lymphocyte activation molecule (SLAM) which is responsible for the binding of the SLAM-associated protein (SAP) (Coffey et al, 1998; Sayos et al, 1998).
  • This gene is comprised of 7 exons, with 6 intervening introns.
  • the coding region of this gene is composed of 1,392 nucleotides, producing a 463 amino acid protein, with a predicted molecular mass of 50.1 kDa.
  • This gene is located at 19ql3.4, 43.19 Kb telomeric to the newly identified kallikrein KLK- L6.
  • the high degree of homology between this novel siglec and other siglecs provides strong evidence that this protein also plays a role in sialic acid-dependent protein-glycoprotein or -glycolipid interactions.
  • siglec It possesses the unique pattern of conserved cysteine residues in its Ig-like domains, which are found only in members of the siglec family. Further, this novel siglec possesses the conserved arginine residue, which has been found to be essential for sialic acid binding (van der Merwe et al, 1996). Of note, however, is that it only possesses one of the two conserved aromatic residues in the V-set domain, which may be suggestive of a unique sialic acid specificity, differing from that of previously identified siglecs.
  • the tissue expression profile of the novel siglec was examined and it was found to be highly expressed in bone marrow, placenta, spleen, and fetal liver.
  • the high level of expression of this novel siglec in bone marrow is consistent with findings from groups investigating the other siglec family members. All currently known siglecs have been found to be expressed in some type of bone marrow stem cell-derived cell, ranging from myeloid progenitor cells for CD33 to natural killer cells for Siglec-7 and B lymphocytes for CD22. It is likely that this novel siglec is predominantly expressed on a distinct subset of immune cells, where it plays an intercellular signaling role.
  • ITIM-like and SLAM-like motifs are consensus binding sites for the SH2 (src homology 2) domains of the phosphatases SHP-1 and SHP-2 (Borges et al, 1997; Le Drean et al, 1998). It has been reported that the phosphorylation of the ITIM-like motif in CD22, the phosphatase SHP-1 is recruited, suggesting a possible function of this siglec as a B cell receptor-associated negative co-receptor (Vivier and Daeron 1997).
  • the second cytoplasmic motif has been identified in SLAM and several SLAM-like proteins, a family of immunoregulatory molecules of the IgSF, and is responsible for the binding of a new SH2-containing molecule, SAP (Coffey et al, 1998; Sayos et al, 1998).
  • SAP a new SH2-containing molecule
  • the binding of SAP was shown to inhibit the binding of SHP-2 to its respective binding site on these SLAM proteins.
  • the presence of such a motif in the novel siglec, and other siglecs suggests that there may be a similar regulatory mechanism present in the cytoplasmic domains of siglecs, with SAP inhibiting the binding of SHP-1 and SHP-2 to the ITIM-like motif.
  • siglec family of ITIM and SLAM-bearing receptors probably play a role in controlling the activation of a number of cell types. By extension, it is possible that these siglecs may be involved in the regulation of tumour growth.
  • CD33 has already been identified as an important marker for the diagnosis of acute myelogenous leukemia (AML), particularly for the undifferentiated form, and serves to distinguish AML from lymphoid leukemias (Bernstein et al, 1992; Dinndorf et al, 1986; Griffin et al, 1984). Recently, Kossman et. al. and Sievers et. al. have reported the use of anti-CD33 monoclonal antibodies in phase I studies for the treatment of AML, and have shown selective ablation of malignant hematopoiesis (Kossman et al, 1999; Sievers et al, 1999). The newly identified member of the siglec family may have utility as a target for immunological antineoplastic therapy.
  • AML acute myelogenous leukemia
  • Sievers et. al. have reported the use of anti-CD33 monoclonal antibodies in phase I studies for the treatment of AML, and have shown selective ablation of malignant hematopoies
  • Gapped BLAST and PSI-BLAST a new generation of protein database search programs. Nucleic Acids Res 25: 3389-402.
  • Sialoadhesin a macrophage sialic acid binding receptor for haemopoietic cells with 17 immunoglobulin-like domains. Embo J 13: 4490-503.
  • NetOglyc prediction of mucin type O-glycosylation sites based on sequence context and surface accessibility.
  • OB-BPl/Siglec-6 a leptin- and sialic acid-binding protein of the immunoglobulin superfamily. J Biol Chem 21 A: 22729-38. Pedraza, L., Owens, G. C, Green, L. A. and Salzer, J. L. (1990). The myelin-associated glycoproteins: membrane disposition, evidence of a novel disulfide linkage between immunoglobulin-like domains, and posttranslational palmitylation. J Cell Biol 111: 2651-61.
  • the B-cell antigen CD22 mediates monocyte and erythrocyte adhesion. Nature 345: 74-7.
  • Prostase/KLK-Ll is a new member of the human kallikrein gene family, is expressed in prostate and breast tissues, and is hormonally regulated. Cancer Res 59: 4252-6. Table 1: Genomic organization of a novel siglec.
  • the coding region shown includes the 5' untranslated region in exon 1, and the 3' untranslated region in exon 7. Numbers refer to GenBank accession no. AF135027.
  • the exon prediction programs are as follows: A) GeneBuilder (gene prediciton); B) GeneBuilder (exon prediction); C) Grail 2; D) GENEID-3.
  • Table 2 Putative post-translational modification sites in the novel siglec.
  • MAG Myelin associated glycoprotein
  • GenBank accession numbers for each of the siglec family members is also shown, in brackets. 2. Homology was determined using the BLASTP algorithm (Altschul er at, 1997).
  • Siglec-7 (p75/ATRMl) 3 76 79 Siglec-6 (OB-BPl) 3 52 67 Siglec-5 (OB-BP2) 3 48 62
  • GenBank accession numbers for the listed siglecs are the same as those shown in Table 3.
  • (+) >95% homology with published human EST sequences.
  • (+) denotes the exon containing the stop codon.
  • H histidine
  • D aspartic acid
  • S serine.
  • the aminoacids of the catalytic triad are bold and underlined.
  • A GeneBuilder (gene analysis)
  • B GeneBuilder (exon analysis)
  • C Grail 2
  • D GENEID-3

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/CA2000/000259 1999-03-11 2000-03-09 Sialic acid-binding ig-like lectin (siglec) gene; ob-binding protein like (ob-bpl) Ceased WO2000053747A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA002366087A CA2366087A1 (en) 1999-03-11 2000-03-09 Sialic acid-binding ig-like lectin (siglec) gene; ob-binding protein like (ob-bpl)
AU31399/00A AU3139900A (en) 1999-03-11 2000-03-09 Sialic acid-binding ig-like lectin (siglec) gene; ob-binding protein like (ob-bpl)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US12426099P 1999-03-11 1999-03-11
US60/124,260 1999-03-11
US12738699P 1999-04-01 1999-04-01
US60/127,386 1999-04-01
US14491999P 1999-07-21 1999-07-21
US60/144,919 1999-07-21

Publications (1)

Publication Number Publication Date
WO2000053747A1 true WO2000053747A1 (en) 2000-09-14

Family

ID=27383080

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/CA2000/000259 Ceased WO2000053747A1 (en) 1999-03-11 2000-03-09 Sialic acid-binding ig-like lectin (siglec) gene; ob-binding protein like (ob-bpl)
PCT/CA2000/000258 Ceased WO2000053776A2 (en) 1999-03-11 2000-03-09 Human kallikrein-like genes

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/CA2000/000258 Ceased WO2000053776A2 (en) 1999-03-11 2000-03-09 Human kallikrein-like genes

Country Status (5)

Country Link
EP (1) EP1159431A2 (https=)
JP (1) JP2002538789A (https=)
AU (2) AU3139900A (https=)
CA (2) CA2362885A1 (https=)
WO (2) WO2000053747A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7034132B2 (en) 2001-06-04 2006-04-25 Anderson David W Therapeutic polypeptides, nucleic acids encoding same, and methods of use
WO2017123745A1 (en) * 2016-01-12 2017-07-20 Palleon Pharma Inc. Use of siglec-7 or siglec-9 antibodies for the treatment of cancer
CN112480237A (zh) * 2019-09-12 2021-03-12 上海津曼特生物科技有限公司 一种融合蛋白及其制备方法和应用
CN114414812A (zh) * 2020-12-21 2022-04-29 华中科技大学同济医学院附属同济医院 生物标志物组合在制备暴发性心肌炎诊断试剂及暴发性心肌炎药物方面的应用

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6943236B2 (en) 1997-02-25 2005-09-13 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
EP1734051A3 (en) * 1998-12-01 2007-09-12 Genetech, Inc. Composition and methods for the diagnosis of tumours
EP1151142A2 (en) 1999-01-28 2001-11-07 Gen-Probe Incorporated Nucleic acid sequences for detecting genetic markers for cancer in a biological sample
AU7753700A (en) * 1999-10-07 2001-05-10 Schering Aktiengesellschaft Dna encoding prost 07 polypeptide
CA2426571A1 (en) 2000-11-01 2002-05-10 Eleftherios P. Diamandis Detection of ovarian cancer
EP1661986A1 (en) * 2000-11-17 2006-05-31 Nuvelo, Inc. Nucleic acids and polypeptides enocoded thereby that are member of the kallikrein gene familyNovel nucleic acids and polypeptides
AUPR402201A0 (en) * 2001-03-27 2001-04-26 Queensland University Of Technology Polynucleotides and polypeptides linked to cancer and/or benign tumours
WO2003039475A2 (en) * 2001-11-07 2003-05-15 Millennium Pharmaceuticals, Inc. Methods of identifying and using modulators of fractalkine receptor
WO2004021009A2 (en) * 2002-08-28 2004-03-11 Mount Sinai Hospital Methods for detecting endocrine cancer using kallikrein 13 (klk13) as a biomarker
WO2005021781A2 (en) * 2003-08-30 2005-03-10 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with kallikrein 9 (klk9)
EP1721003A1 (en) * 2004-02-18 2006-11-15 Bayer HealthCare AG Diagnostics and therapeutics for diseases associated with kallikrein 5 (klk5)
US20130315891A1 (en) * 2012-05-25 2013-11-28 Matthew Charles Formulations of human tissue kallikrein-1 for parenteral delivery and related methods
US20130323222A1 (en) 2012-06-04 2013-12-05 Matthew Charles Human tissue kallikrein 1 glycosylation isoforms
AU2018230478B2 (en) 2017-03-09 2025-01-23 Diamedica Inc. Dosage forms of tissue kallikrein 1

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0869178A1 (en) * 1997-04-02 1998-10-07 Smithkline Beecham Corporation SAF-3, Sialoadhesin family member-3
EP0924297A1 (en) * 1997-04-02 1999-06-23 Smithkline Beecham Corporation Sialoadhesin family member-2 (saf-2)
WO2000012708A2 (en) * 1998-09-01 2000-03-09 Genentech, Inc. Further pro polypeptides and sequences thereof
WO2000032221A2 (en) * 1998-12-01 2000-06-08 Genentech, Inc. Promotion or inhibition of angiogenesis and cardiovascularization

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786148A (en) * 1996-11-05 1998-07-28 Incyte Pharmaceuticals, Inc. Polynucleotides encoding a novel prostate-specific kallikrein

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0869178A1 (en) * 1997-04-02 1998-10-07 Smithkline Beecham Corporation SAF-3, Sialoadhesin family member-3
EP0924297A1 (en) * 1997-04-02 1999-06-23 Smithkline Beecham Corporation Sialoadhesin family member-2 (saf-2)
WO2000012708A2 (en) * 1998-09-01 2000-03-09 Genentech, Inc. Further pro polypeptides and sequences thereof
WO2000032221A2 (en) * 1998-12-01 2000-06-08 Genentech, Inc. Promotion or inhibition of angiogenesis and cardiovascularization

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CORNISH A.L. ET AL: "Characterization of siglec -5, a novel glycoprotein expressed on myeloid cells related to CD33.", BLOOD, (15 SEP 1998) 92/6 (2123-2132)., XP000913901 *
CROCKER P R ET AL: "SIALOADHESIN AND RELATED CELLULAR RECOGNITION MOLECULES OF THE IMMUNOGLOBULIN SUPERFAMILY", BIOCHEMICAL SOCIETY TRANSACTIONS,GB,COLCHESTER, ESSEX, vol. 24, 1996, pages 150 - 156, XP000913910, ISSN: 0300-5127 *
CROCKER P R ET AL: "Siglecs: a family of sialic-acid binding lectins [letter].", GLYCOBIOLOGY, (1998 FEB) 8 (2), pages v - vi, XP000913934 *
KELM S. ET AL: "Functional groups of sialic acids involved in binding to siglecs (sialoadhesins) deduced from interactions with synthetic analogues.", EUROPEAN JOURNAL OF BIOCHEMISTRY, (1 AUG 1998) 255/3 (663-672)., XP000913907 *
RAZI N. ET AL: "Masking and unmasking of the sialic acid-binding lectin activity of CD22 Siglec -2) on B lymphocytes.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, (23 JUN 1998) 95/13 (7469-7474)., XP000913900 *
YOUSEF G M ET AL: "IDENTIFICATION OF NOVEL HUMAN KALLIKREIN-LIKE GENES ON CHROMOSOME 19Q13.3 - Q13.4", ANTICANCER RESEARCH,GR,HELENIC ANTICANCER INSTITUTE, ATHENS,, vol. 19, July 1999 (1999-07-01), pages 2843 - 2852, XP000911217, ISSN: 0250-7005 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7034132B2 (en) 2001-06-04 2006-04-25 Anderson David W Therapeutic polypeptides, nucleic acids encoding same, and methods of use
WO2017123745A1 (en) * 2016-01-12 2017-07-20 Palleon Pharma Inc. Use of siglec-7 or siglec-9 antibodies for the treatment of cancer
CN112480237A (zh) * 2019-09-12 2021-03-12 上海津曼特生物科技有限公司 一种融合蛋白及其制备方法和应用
CN112480237B (zh) * 2019-09-12 2023-10-17 上海津曼特生物科技有限公司 一种融合蛋白及其制备方法和应用
CN114414812A (zh) * 2020-12-21 2022-04-29 华中科技大学同济医学院附属同济医院 生物标志物组合在制备暴发性心肌炎诊断试剂及暴发性心肌炎药物方面的应用

Also Published As

Publication number Publication date
WO2000053776A2 (en) 2000-09-14
AU3139900A (en) 2000-09-28
AU3139800A (en) 2000-09-28
WO2000053776A3 (en) 2000-12-14
EP1159431A2 (en) 2001-12-05
JP2002538789A (ja) 2002-11-19
CA2362885A1 (en) 2000-09-14
CA2366087A1 (en) 2000-09-14

Similar Documents

Publication Publication Date Title
WO2000053747A1 (en) Sialic acid-binding ig-like lectin (siglec) gene; ob-binding protein like (ob-bpl)
US6596488B2 (en) Tumor suppressor gene
JP2001509679A (ja) レセプターをコードするポリヌクレオチドとポリペプチド
US7199229B2 (en) Kallikrein gene
JP4642301B2 (ja) UDP−N−アセチルグルコサミン:ガラクトース−β1,3−N−アセチル−ガラクトサミン−α−R/(GlcNAc:GalNAc)β1,6−N−アセチルグルコサミニルトランスフェラーゼ,C2GnT3
AU2001287384A1 (en) Kallikrein gene
US6593119B2 (en) Core 2 β-1,6-N-acetylglycosaminyltransferase gene
US7022497B1 (en) Human kallikrein-like genes
US20040029248A1 (en) CHD5 encoding nucleic acids, polypeptides, antibodies and methods of use thereof
WO1998022584A1 (en) C1q RECEPTOR, ENCODING GENE AND APPLICATION IN HOST DEFENSE ENHANCEMENT
US20020106738A1 (en) Novel Siglec gene
US20020110862A1 (en) Novel Siglec-like gene
US20020098563A1 (en) Novel core 2 beta-1,6-N-acetylglycosaminyltransferase gene
US6455683B1 (en) DNA molecules encoding human CLAX proteins and their soluble fusion proteins
CA2251603A1 (en) Gene family associated with neurosensory defects
WO2002063013A2 (en) Human acid phosphatase gene
US20030049651A1 (en) Tumor associated proteins
US6897052B1 (en) N-acetylglycosaminyl transferase genes
US20070077250A1 (en) Novel core 2 beta-1,6-N-acetylglycosaminyltransferase gene
WO2003062410A2 (en) Torero protein
WO2000008171A1 (en) N-acetylglycosaminyl transferase genes
KR20020013477A (ko) 염색체 17p 연관된 전립선암 감수성 유전자
JPH10201489A (ja) hRAD54
EP1724351A2 (en) Human Kallikrein-like genes
US20020081608A1 (en) Tumor associated proteins

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2366087

Country of ref document: CA

Kind code of ref document: A

Ref document number: 2366087

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 09936278

Country of ref document: US

122 Ep: pct application non-entry in european phase