WO2000043501A2 - Ribozymes directed against the catalytic subunit of the human telomerase (htert) - Google Patents

Ribozymes directed against the catalytic subunit of the human telomerase (htert) Download PDF

Info

Publication number
WO2000043501A2
WO2000043501A2 PCT/DE2000/000227 DE0000227W WO0043501A2 WO 2000043501 A2 WO2000043501 A2 WO 2000043501A2 DE 0000227 W DE0000227 W DE 0000227W WO 0043501 A2 WO0043501 A2 WO 0043501A2
Authority
WO
WIPO (PCT)
Prior art keywords
cugaugaguccgugaggacgaa
telomerase
ribozymes
htert
human telomerase
Prior art date
Application number
PCT/DE2000/000227
Other languages
German (de)
French (fr)
Other versions
WO2000043501A3 (en
Inventor
Thomas Von Zglinicki
Gabriele Saretzki
Antje Ludwig
Original Assignee
Humboldt-Universität Zu Berlin Universitätsklinikum Charite
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Humboldt-Universität Zu Berlin Universitätsklinikum Charite filed Critical Humboldt-Universität Zu Berlin Universitätsklinikum Charite
Priority to JP2000594909A priority Critical patent/JP2002536967A/en
Priority to EP00910502A priority patent/EP1149161A2/en
Publication of WO2000043501A2 publication Critical patent/WO2000043501A2/en
Publication of WO2000043501A3 publication Critical patent/WO2000043501A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the invention relates to anti-telomerase ribozymes and their use.
  • the ribozymes reduce the activity of the catalytic subunit of human telomerase (human telomerase enzyme reverse transcriptase, hTERT). They serve as telomerase inhibitors, limit the proliferative capacity and increase the sensitivity of tumor cells to cytostatics.
  • Telomerase is a unique reverse transcriptase that uses an internal RNA component to attach telomer sequences de novo to the 3 'DNA end of the telomeres. It thus counteracts a progressive mitotic telomere shortening, the result of which leads to proliferative senescence in mortal somatic cells.
  • telomere length especially in experimentally immortalized cells and in other species, their importance for tumor development in humans is apparently rather small.
  • the vast majority of different human tumors have a high telomerase activity, while starting cells and non-invasive tumor precursors usually have only a low activity.
  • the telomerase activity can be reconstituted in vitro solely from the RNA component and the catalytic subunit.
  • telomerase-specific T motif was detected in the catalytic subunit. Mutations in conserved amino acids of the T motif lead to a drastic loss of function in the cell-free system (Weinrich SL, Pruzan, R .. Ma, L., Oulette, M., Tesmer, VM, Holt, SH, Bodnar, A., Lichtsteiner, S., Kim, NW, Trager, JB, Taylor, RD, Carlos, R., Andrews, WH, Wright, W., Shay, JW, Harley, CB, Morin, GB, Nature Genetics, 17, 1997, 498- 502).
  • telomerase incorporation would only lead to telomer-dependent cell cycle blockade after a considerable time delay (Kipling, D., Nature Genet 9, 1995: 104-105).
  • telomere inhibition by hTR antisense vectors which leads to a telom lead shortening and senescence of the corresponding culture has been demonstrated only once in HeLa cells (Feng, J., Funk, W., Wang, SS, Weinrich, SL,. Avilion, AA, Chiu, CP, Adams, RR, Chang , E., Allsopp, RC, Yu, J., Le, S., West, MD, Harley, CB, Andrews, WH, Greider, CW, Villeponteau, B, Science 1995, 269: 1236-1241).
  • RNA component may not be the best target for telomerase introduction because it is also expressed in normal cells.
  • Nucleoside analogs e.g. the known inhibitor of reverse transcriptases azidothymidine, work well in the cell-free system, but show strong non-specific side effects in cells (Ray, C, Blackburn, E., Mol Cell Biol 16, 1996, 53-65; Janta-Lipinski, Matthes, MDC Book, personal communication). Other strategies to inhibit telomerase such as B.
  • Antisense technology with peptide-coupled nucleic acids or the use of non-nucleosides have so far only been tested in the cell-free system.
  • the GUC sequence is one of the most easily cleavable targets. Inhibition of telomerase and subsequent telomere shortening by ribozymes against hTR have been described (Yokoyama, Y., Takahashi, Y., Shinohara, A., Lian, Z., Wan, X., Niwa, K., Tamaya, T., Cancer Res., 58, 1998: 5406-5410). So far, no reliable inhibition of cell growth has been achieved with ribozymes against hTR. Ribozymes with activity against hTERT, the mRNA of the catalytic subunit of telomerase, have not previously been described.
  • telomeres are hypersensitive to oxidative stress (Petersen, S., Saretzki, G., von Zglinicki, T. Exp. Cell Res. 1998, 239: 152-160).
  • telomere shortening leads to the induction of apoptosis (Kondo, Y., Kondo, S., Li, G., Silvermann, RH, Cowell, JK, Oncogene 1998, 16: 3323-3330) or to sensitization to cis- Platinum (Kondo, Y., Kondo. S., Tanaka, Y., Haqqi, T., Barna, BP, Cowell, JK, Oncogene 1998, 16: 2243-2248) within a few days. ie before a significant telomere shortening can occur.
  • telomerase inhibitors are described several times in the patent literature. They are directed primarily against the RNA component of the enzyme (e.g. EP 666313 WO 97/37691 and WO 98/28442). Methods for cancer treatment using telomerase inhibitors are reported in US Patents US 5767278, US 5770613, US 57031 16, US 5760062 and 5656638.
  • the catalytic subunit of human telomerase has the international patent application WO 98/14593 and the resulting European (EP 841396) or German patent application (DE 19743497) to the content.
  • the polynucleotides and plasmids described therein are suitable for the diagnosis, prognosis and treatment of human diseases and for changing the proliferation capacity of cells and organisms.
  • the patent specifications WO 98/14593 and WO 98/14592 relate to plasmids, including those which span the region of the T motif of hTERT, both expression plasmid (s) and antisense plasmids. Antisense plasmids can be used to inhibit telomerase.
  • German patent application DE 19720151 describes a chemically modified oligodeoxynucleotide which on the one hand exerts an antisense effect against hTR and on the other hand reacts at its 5 'end with the protein of the catalytic subunit hTERT.
  • Ribozymes i.e. However, polyribonucleotides which connect antisense flanks with a central RNA-cutting structure are described in the abovementioned. Patents not panned. There are no published results on the specific inhibition of the catalytic subunit of telomerase.
  • the object of the invention was to reduce the activity of the catalytic subunit of human telomerase (human telomerase enzyme reverse transcriptase, hTERT) and thus to make new telomerase inhibitors available.
  • human telomerase human telomerase enzyme reverse transcriptase, hTERT
  • the task was solved by new ribozymes, which are directed against the T motif of human telomerase.
  • the ribozymes according to the invention contain the following sequences: 1. 5 ' -GCUCGAC CUGAuGAGuCcGUGAgGaCGAA ACGUAC AC A-3 ⁇ 2. 5 ' -GCAGCUC CUGAuGAGuCcGUGAgGaCGAA ACGACGUAC-3 '
  • the hammerhead ribozymes according to the invention have catalytic activity in vitro. They cleave the mRNA for human telomerase (hTERT) in the T motif on the sequences planned by the design.
  • hTERT human telomerase
  • the inhibition of telomerase in cells is achieved by stable transfection of an expression vector into which the ribozyme has been cloned. It can also be achieved with other transfection methods (e.g. transient transfection or infection with a recombinant virus).
  • a ribozyme mutated in the catalytic center has no effect. According to the invention, telomere shortening and crisis occur in clones with inhibited telomerase.
  • the clones with inhibited telomerase increase the sensitivity to doxorubicin (measured using the XTT assay - colorimetric assay - as a concentration that kills 50% of the cells - LD50) by a factor of 2-3.
  • the inhibition of telomerase by the ribozymes according to the invention is achieved both in sole use and in combination with cytostatic administration and / or radiation. This accelerates both the "classic" telomere shortening after inhibition of telomerase, which ultimately leads to the crisis and cell death in the course of several cell divisions, and the rate of telomere shortening due to DNA damage, or it eliminates independent repair properties of telomerase, which increases the rate Sensitivity causes.
  • telomere enzyme reverse transcriptase human telomerase enzyme reverse transcriptase
  • the ribozymes according to the invention are suitable for use as telomerase inhibitors and for shortening telomeres, also in combination with cytostatic administration and / or radiation or with topoisomerase inhibition and thereby for accelerating the rate of telomeres shortening due to DNA damage and for switching off the repair properties of telomerase .
  • the ribozymes according to the invention are suitable for the treatment of tumors and for increasing the sensitivity of tumor cells to cytostatics.
  • Ribozymes consist of helices I and III, which hybridize with the target sequences flanking the interface, as well as the catalytic core and the stem loop (Helix II) with the structure CUGAuGAGuCcGUGAgGaCGAA.
  • the ribozymes can be produced, for example, as an oligoribonucleotide.
  • the sequence is synthesized from the ribonucleotides G, C, A and U as described by known methods.
  • stabilization of the 3 'and 5 ' ends by means of modified nucleotides or cap structures is possible; the influence of these modifications on the catalytic activity of the ribozyme must be tested in individual cases.
  • These ribozymes can be used directly.
  • ribozyme Another possibility is the synthesis of the cDNA for the ribozyme from the deoxyribonucleotides G, C, A and T.
  • This form of the ribozymes can be used in connection with suitable promoters and transfection vectors (eg adeno- or retroviral vectors).
  • cDNA sequence of the T motif from hTERT (GenBank AF015950): Nucleotides not belonging to the T motif are shown in italics. The possible interfaces and the sequences of the antisense helices for the possible ribozymes 1-13 result from the sequence. The interface of the first ribozyme (Rl) is shown in bold and the flanking sequences are underlined once or twice.
  • Example 2 Detection of the catalytic activity of the ribozymes 1-4 in vitro
  • a 224 nucleotide (nt) long RNA which includes the sequence of the T motif, was obtained by in vitro transcription from the cDNA of hTERT linked to a T7 promoter produced (target RNA). During the transcription, the radioactive labeling was carried out using P j2 -UTP.
  • Ribozymes were synthesized by standard methods from ribonucleotides with 2'-hydroxyl groups protected by Fpmp (1 l- (2-fluorophenyl) -4-methoxy-piperidin-l-yl) and purified by HPLC. They were deprotected before use.
  • the target RNA was incubated with ribozyme 1, 2, 3 or 4 or without ribozyme (/) for 60 and 180 min and the reaction products were separated electrophoretically in the polyacrylamide gel.
  • the gel was evaluated in the phosphoimager and shows cleavage of the target RNA at the designated sites by the ribozymes 3 and 4 with high efficiency and low effectiveness of the ribozymes 1 and 2 (FIG
  • telomere inhibition by stable transfection and expression of ribozyme 4 in HBL100, an immortal mammary epithelial cell line with high telomerase activity, and in MCF-7, a breast tumor cell line.
  • a ribozyme imitated in the catalytic center has no effect.
  • Both strands of the cDNA coding for the ribozyme R4 (4th ribozyme in the list) and for the ribozyme mutR4 mutated in the catalytic center were synthesized as oligodeoxyribonucleotides by standard methods. They were cloned into the expression vector (plasmid) pCDNA3.1 and stably expressed in MCF-7 (FIG. 2a) or HBL-100 cells (FIG. 2b). The telomerase activity in the numbered clones was measured using a semiquantitative TRAP assay (Telomerase Repeat Amplification Protocol).
  • the intensity of the conductor pattern in the respective track in relation to the intensity of the control band is a measure of the activity of the telomerase.
  • Example 4 Detection of telomere shortening in clones with inhibited telomerase
  • the telomere length in the cell lines MCF-7 (FIG. 3A) and HBL-100 (FIG. 3B) was measured in the Southern blot and quantified as described (Petersen, S., Saretzki, G., by Zglinicki, T. Exp. Cell Res. 1998, 239: 152-160). The number of clones n examined and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated.
  • telomere length in mutR4-transfected clones does not differ significantly from that in parental cells.
  • the telomere length in the clones with clearly inhibited telomerase is, however, significantly shorter.
  • Net proliferation rates were determined by cell counting in each passage. The number of examined clones n and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated. In clones with a telomerase activity below 25% of the starting cells, cell growth is inhibited (FIG. 4A). Evidence of an altered morphology in telomerase-incorporated MCF-7 clones. The morphology of living cells was checked in the phase contrast reversal microscope. Clones stably transfected with mutR4 (left) show normal, rapid growth and the same morphology as parental cells.
  • Clones with telomerase inhibited by R4 show restricted growth and for the most part, especially on the periphery of the resulting, comparatively small colonies, cells with characteristic senescent morphology (same magnification left and right) (FIG. 4B).
  • R4 was cloned into a retroviral expression vector (pBabe) and recombinant viruses were generated according to the standard procedure. 10 MCF-7 cells were infected either with the unmodified vector (left) or with R4-pBabe (right). The mass cultures are shown 2 weeks after infection. Infection with R4-pBabe reduces telomerase activity and blocks growth in the culture. Numerous cells die and detach from the culture dish. The few over- living cells show a senescent phenotype (same magnification left and right) ( Figure 4C).
  • Example 6 Detection of a sensitivity of clones with inhibited telomerase to doxorubicin increased by a factor of 2-3
  • HBL-100 cells were transfected with R4 or mutR4. Telomerase activity was measured using a TRAP assay. The clones were treated with doxorubicin in concentrations between 10 and 1000 ng / ml for three days and then cell survival was measured with an XTT assay. The doxorubicin concentration resulting in a 50% reduced XTT signal (colorimetric signal) (LD50) was calculated. The number of clones n examined and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated. Clones with a telomerase activity ⁇ 25% of the starting cells have an LD50 reduced by a factor of 2 (FIG. 5A). Determination of the LD50 for doxorubicin in MCF-7 clones (see above). Clones with a telomerase activity below 25% are three to four times more sensitive to doxorubicin ( Figure 5B).
  • the sensitivity to the specified cytostatics was measured as LD50 using the XTT assay.
  • the ratio of the LD50 of the telomerase-positive to the telomerase-negative clones is given.
  • MutR4-transfected vs. R4-transfected HBL-100 and MCF-7 clones and hTERT-expressing vs parental BJ fibroblasts Bodnar, AG, Oulette, M., Frolkis, M., Holt, SE, Chiu, CP Morin, GB, Harley, CB, Shay, JW, Lichtsteiner, S., Wright, W. Science 1998, 279: 349-352).
  • telomeres with reduced telomerase activity are more sensitive than the isogenic clones with active telomerase to all investigated topoisomerase inhibitors (mitoxantrone, etoposide and doxorubicin - Römpp Chemie Lexikon 1995), but not to the cytostatic agents cis-platinum and bleomycin or the alkylating agent N-methyl -N'-nitro-N-nitrosoguanidine (MN G) or oxidative exposure using hydrogen peroxide (H 2 O9) ( Figure 6).

Abstract

The invention relates to anti-telomerase ribozymes and to the use thereof. The ribozymes diminish the activity of the catalytic subunit of the human telomerase (human Telomerase Enzyme Reverse Transcriptase, hTERT). They serve as telomerase inhibitors, limit the proliferative capacity and increase the sensitivity of tumor cells with regard to cytostatic agents.

Description

Gegen die katalytische Untereinheit der humanen Telomerase (hTERT) gerichtete RibozymeRibozymes directed against the catalytic subunit of human telomerase (hTERT)
Beschreibungdescription
Die Erfindung betrifft Anti-Telomerase-Ribozyme und ihre Verwendung. Die Ribozyme vermindern die Aktivität der katalytischen Untereinheit der humanen Telomerase (human Telomerase Enzyme Reverse Transcriptase, hTERT). Sie dienen als Telomerase-Inhibitoren, begrenzen die proliferative Kapazität und erhöhen die Sensitivität von Tumorzellen gegenüber Zytostatika.The invention relates to anti-telomerase ribozymes and their use. The ribozymes reduce the activity of the catalytic subunit of human telomerase (human telomerase enzyme reverse transcriptase, hTERT). They serve as telomerase inhibitors, limit the proliferative capacity and increase the sensitivity of tumor cells to cytostatics.
Die Telomerase ist eine unikale reverse Transkriptase, die mit Hilfe einer internen RNA- Komponente Telomerensequenzen de novo an das 3 'DNA -Ende der Telomeren anhängt. Damit wirkt sie einer progressiven mitotischen Telomerenverkürzung entgegen, deren Ergebnis in mortalen somatischen Zellen zur proliferativen Seneszenz führt. Obwohl es, insbeson- dere bei experimentell immortalisierten Zellen sowie bei anderen Spezies, alternative Möglichkeiten zum Telomerenlängenerhalt gibt, ist deren Bedeutung für die Tumorentstehung beim Menschen offenbar eher gering. Die weit überwiegende Mehrheit unterschiedlicher humaner Tumoren besitzt eine hohe Telomeraseaktivität, während Ausgangszellen und nichtin- vasive Tumorvorstufen meist nur geringe Aktivität aufweisen. Die Telomeraseaktivität kann in vitro allein aus der RNA-Komponente und der katalytischen Untereinheit rekonstituiert werden. In der katalytischen Untereinheit konnte außer 7 konservierten Sequenzmotiven für Reverse Transkriptasen ein telomerasespezifϊsches T-Motiv nachgewiesen werden. Mutationen in konservierten Aminosäuren des T-Motivs führen zu einem drastischen Funktionsverlust im zellfreien System (Weinrich S.L., Pruzan, R.. Ma, L., Oulette, M., Tesmer, V. M., Holt, S.H., Bodnar, A., Lichtsteiner, S., Kim, N.W., Trager, J.B., Taylor, R.D., Carlos, R., Andrews, W. H., Wright, W., Shay, J.W., Harley, C.B., Morin, G.B., Nature Genetics, 17, 1997, 498-502).Telomerase is a unique reverse transcriptase that uses an internal RNA component to attach telomer sequences de novo to the 3 'DNA end of the telomeres. It thus counteracts a progressive mitotic telomere shortening, the result of which leads to proliferative senescence in mortal somatic cells. Although there are alternative options for maintaining telomere length, especially in experimentally immortalized cells and in other species, their importance for tumor development in humans is apparently rather small. The vast majority of different human tumors have a high telomerase activity, while starting cells and non-invasive tumor precursors usually have only a low activity. The telomerase activity can be reconstituted in vitro solely from the RNA component and the catalytic subunit. In addition to 7 conserved sequence motifs for reverse transcriptases, a telomerase-specific T motif was detected in the catalytic subunit. Mutations in conserved amino acids of the T motif lead to a drastic loss of function in the cell-free system (Weinrich SL, Pruzan, R .. Ma, L., Oulette, M., Tesmer, VM, Holt, SH, Bodnar, A., Lichtsteiner, S., Kim, NW, Trager, JB, Taylor, RD, Carlos, R., Andrews, WH, Wright, W., Shay, JW, Harley, CB, Morin, GB, Nature Genetics, 17, 1997, 498- 502).
Hemmung der Telomerase wurde schon sehr früh als eine potentiell hochspezifische Möglichkeit zur "Remortalisierung" und therapeutischen Kontrolle von Tumorzellen vorgeschla- gen. Es war jedoch klar, daß Telomerase-Inliibition erst nach erheblicher Zeitverzögerung zur telomerenabhängigen Zellzyklusblockade führen würde (Kipling, D., Nature Genet 9, 1995: 104-105).Inhibition of telomerase was proposed very early on as a potentially highly specific possibility for "remortalization" and therapeutic control of tumor cells. However, it was clear that telomerase incorporation would only lead to telomer-dependent cell cycle blockade after a considerable time delay (Kipling, D., Nature Genet 9, 1995: 104-105).
Die bisherigen Bemühungen, die Aktivität der Telomerase auszuschalten, richteten sich in erster Linie gegen die RNA-Komponente des Enzyms, da diese bereits seit 1995 bekannt ist. Eine erfolgreiche Telomeraseinhibition durch hTR-Antisensevektoren, die zu einer Telome- renverkürzung und Seneszenz der entsprechenden Kultur führt, ist bisher nur einmal in HeLa Zellen demonstriert worden (Feng, J., Funk, W., Wang, S.S., Weinrich, S.L.,. Avilion, A.A., Chiu, C.P., Adams, R.R., Chang, E., Allsopp, R.C., Yu, J., Le, S., West, M.D., Harley, C.B., Andrews, W.H., Greider, C.W., Villeponteau, B, Science 1995, 269: 1236-1241). Erst in letzter Zeit sind Arbeiten einer Gruppe erschienen, die Telomerase-Inhibition in Gliomzellen mit nachfolgender Induktion von Apoptose oder Differenzierung durch Einsatz modifizierter Antisense-RNA berichten (Kondo, Y., Kondo, S., Li, G., Silvermann, R.H., Cowell, J.K., On- cogene 1998, 16: 3323-3330; Kondo, Y., Kondo, S., Tanaka, Y., Haqqi, T., Barna, B.P., Cowell, J.K., Oncogene 1998, 16:2243-2248). Die Spezifität dieser Effekte ist jedoch unklar, Telomerenerosion wurde nicht nachgewiesen und ist hier wahrscheinlich nicht die Ursache der Apoptoseinduktion. Die RNA-Komponente ist möglicherweise nicht das beste Target für Telomerase-Inliibition, da sie auch in normalen Zellen exprimiert wird.The previous efforts to switch off the activity of telomerase have primarily been directed against the RNA component of the enzyme, since this has been known since 1995. A successful telomerase inhibition by hTR antisense vectors, which leads to a telom lead shortening and senescence of the corresponding culture has been demonstrated only once in HeLa cells (Feng, J., Funk, W., Wang, SS, Weinrich, SL,. Avilion, AA, Chiu, CP, Adams, RR, Chang , E., Allsopp, RC, Yu, J., Le, S., West, MD, Harley, CB, Andrews, WH, Greider, CW, Villeponteau, B, Science 1995, 269: 1236-1241). Only recently have a group of works published that report telomerase inhibition in glioma cells with subsequent induction of apoptosis or differentiation by using modified antisense RNA (Kondo, Y., Kondo, S., Li, G., Silvermann, RH, Cowell, JK, Oncogene 1998, 16: 3323-3330; Kondo, Y., Kondo, S., Tanaka, Y., Haqqi, T., Barna, BP, Cowell, JK, Oncogene 1998, 16: 2243- 2248). However, the specificity of these effects is unclear, telomeric erosion has not been demonstrated and is probably not the cause of apoptosis induction here. The RNA component may not be the best target for telomerase introduction because it is also expressed in normal cells.
Nukleosidanaloga, wie z.B. der bekannte Hemmer reverser Transkriptasen Azidothymidin, funktionieren gut im zellfreien System, zeigen in Zellen aber starke unspezifische Nebenwir- kungen (Strahl, C, Blackburn, E., Mol Cell Biol 16, 1996, 53-65; Janta-Lipinski, Matthes, MDC Buch, pers. Mitteilung). Andere Strategien zur Hemmung der Telomerase wie z. B. An- tisense-Technik mit peptidgekoppelten Nukleinsäuren oder Einsatz von Nicht-Nukleosiden sind bislang nur im zellfreien System erprobt. Hammerhead-Ribozyme sind katalytische RNAs mit einer wohldefinierten Struktur, die RNA- Targets mit der Sequenz XUN (N = A, C oder U) spezifisch spalten. Die Sequenz GUC gehört zu den besonders gut spaltbaren Targets. Hemmung der Telomerase und folgende Telomeren- verkürzung durch Ribozyme gegen hTR wurde beschrieben (Yokoyama, Y., Takahashi, Y., Shinohara, A., Lian, Z., Wan, X., Niwa, K., Tamaya, T., Cancer Res., 58, 1998: 5406-5410). Eine verläßliche Inhibition des Zellwachstums wurde bisher mit Ribozymen gegen hTR nicht erreicht. Ribozyme mit Aktivität gegen hTERT, die mRNA der katalytischen Untereinheit der Telomerase, wurden bisher nicht beschrieben.Nucleoside analogs, e.g. the known inhibitor of reverse transcriptases azidothymidine, work well in the cell-free system, but show strong non-specific side effects in cells (Ray, C, Blackburn, E., Mol Cell Biol 16, 1996, 53-65; Janta-Lipinski, Matthes, MDC Book, personal communication). Other strategies to inhibit telomerase such as B. Antisense technology with peptide-coupled nucleic acids or the use of non-nucleosides have so far only been tested in the cell-free system. Hammerhead ribozymes are catalytic RNAs with a well-defined structure that specifically cleave RNA targets with the sequence XUN (N = A, C or U). The GUC sequence is one of the most easily cleavable targets. Inhibition of telomerase and subsequent telomere shortening by ribozymes against hTR have been described (Yokoyama, Y., Takahashi, Y., Shinohara, A., Lian, Z., Wan, X., Niwa, K., Tamaya, T., Cancer Res., 58, 1998: 5406-5410). So far, no reliable inhibition of cell growth has been achieved with ribozymes against hTR. Ribozymes with activity against hTERT, the mRNA of the catalytic subunit of telomerase, have not previously been described.
In letzter Zeit gibt es erste Hinweise auf spezifische Wechselbeziehungen zwischen Telome- ren und Telomerase einerseits und DNA-schädigenden Prozessen andererseits. Das bedeutet, daß Telomerase nicht nur durch Kompensation der "normalen" Telomerenerosion zur unlimi- tierten Proliferation von Tumorzellen beitragen könnte. Telomeren sind hypersensitiv gegenüber oxidativem Streß (Petersen, S., Saretzki, G., von Zglinicki, T. Exp. Cell Res. 1998, 239: 152-160). Inhibition der Telomerase in humanen Glioblastomzellen führt zur Induktion von Apoptose (Kondo, Y., Kondo, S., Li, G., Silvermann, R.H., Cowell, J.K., Oncogene 1998, 16: 3323-3330) oder zur Sensibilisierung gegen cis-Platin (Kondo, Y., Kondo. S., Tanaka, Y., Haqqi, T., Barna, B.P., Cowell, J.K., Oncogene 1998, 16:2243-2248) innerhalb weniger Tage. d.h. bevor eine signifikante Telomerenverkürzung auftreten kann.Recently there have been first indications of specific interrelations between telomeres and telomerase on the one hand and DNA damaging processes on the other. This means that telomerase could not only contribute to the unlimited proliferation of tumor cells by compensating for "normal" telomer erosion. Telomeres are hypersensitive to oxidative stress (Petersen, S., Saretzki, G., von Zglinicki, T. Exp. Cell Res. 1998, 239: 152-160). Inhibition of telomerase in human glioblastoma cells leads to the induction of apoptosis (Kondo, Y., Kondo, S., Li, G., Silvermann, RH, Cowell, JK, Oncogene 1998, 16: 3323-3330) or to sensitization to cis- Platinum (Kondo, Y., Kondo. S., Tanaka, Y., Haqqi, T., Barna, BP, Cowell, JK, Oncogene 1998, 16: 2243-2248) within a few days. ie before a significant telomere shortening can occur.
In der Patentliteratur werden Telomerase-Inhibitoren mehrfach beschrieben. Sie richten sich vorwiegend gegen die RNA-Komponente des Enzyms (z.B. EP 666313 WO 97/37691 und WO 98/28442). Über Methoden zur Krebsbehandlung unter Verwendung von Telomerase- Inhibitoren wird in den US-Patenten US 5767278, US 5770613, US 57031 16, US 5760062 und 5656638 berichtet. Die katalytische Untereinheit der menschlichen Telomerase (hTERT) hat die internationale Patentanmeldung WO 98/14593 und die daraus hervorgegangene europäische (EP 841396) bzw. deutsche Patentanmeldung (DE 19743497) zum Inhalt. Die darin beschriebenen Polynucleotide und Plasmide eignen sich zur Diagnose, Prognose und Behandlung von menschlichen Krankheiten und zur Veränderung der Proliferationskapazität von Zellen und Organismen. Die Patentschriften WO 98/14593 und WO 98/14592 beziehen sich auf Plasmide, darunter auch solche, die den Bereich des T-Motivs von hTERT überspannen, und zwar sowohl Expressionplasmid(e) als auch antisense-Plasmide. Antisense-Plasmide können zur Inhibition der Telomerase eingesetzt werden. Die deutsche Patentanmeldung DE 19720151 beschreibt ein chemisch modifiziertes Oligodesoxynukleotid, das einerseits einen Antisense-Effekt gegen hTR ausübt, andererseits an seinem 5 '-Ende mit dem Protein der katalytischen Untereinheit hTERT reagiert. Ribozyme, d.h. Polyribonukleotide, die antisense-Flanken mit einer zentralen RNA- schneidenden Struktur verbinden, sind jedoch in den o.g. Patenten nicht erwälmt. Zur spezifischen Hemmung der katalytischen Untereinheit der Telomerase existieren bislang keine publizierten Ergebnisse.Telomerase inhibitors are described several times in the patent literature. They are directed primarily against the RNA component of the enzyme (e.g. EP 666313 WO 97/37691 and WO 98/28442). Methods for cancer treatment using telomerase inhibitors are reported in US Patents US 5767278, US 5770613, US 57031 16, US 5760062 and 5656638. The catalytic subunit of human telomerase (hTERT) has the international patent application WO 98/14593 and the resulting European (EP 841396) or German patent application (DE 19743497) to the content. The polynucleotides and plasmids described therein are suitable for the diagnosis, prognosis and treatment of human diseases and for changing the proliferation capacity of cells and organisms. The patent specifications WO 98/14593 and WO 98/14592 relate to plasmids, including those which span the region of the T motif of hTERT, both expression plasmid (s) and antisense plasmids. Antisense plasmids can be used to inhibit telomerase. German patent application DE 19720151 describes a chemically modified oligodeoxynucleotide which on the one hand exerts an antisense effect against hTR and on the other hand reacts at its 5 'end with the protein of the catalytic subunit hTERT. Ribozymes, i.e. However, polyribonucleotides which connect antisense flanks with a central RNA-cutting structure are described in the abovementioned. Patents not panned. There are no published results on the specific inhibition of the catalytic subunit of telomerase.
Der Erfindung lag die Aufgabe zugrunde, die Aktivität der katalytischen Untereinheit der hu- manen Telomerase (human Telomerase Enzyme Reverse Transcriptase, hTERT) zu vermindern und damit neue Telomerase-Inhibitoren zur Verfügung zu stellen.The object of the invention was to reduce the activity of the catalytic subunit of human telomerase (human telomerase enzyme reverse transcriptase, hTERT) and thus to make new telomerase inhibitors available.
Die Aufgabe wurde durch neue Ribozyme, die gegen das T-Motiv der humanen Telomerase gerichtet sind, gelöst. Die erfindungsgemäßen Ribozyme enthalten folgende Sequenzen: 1. 5 '-GCUCGAC CUGAuGAGuCcGUGAgGaCGAA ACGUAC AC A-3 Λ 2. 5 '-GCAGCUC CUGAuGAGuCcGUGAgGaCGAA ACGACGUAC-3'The task was solved by new ribozymes, which are directed against the T motif of human telomerase. The ribozymes according to the invention contain the following sequences: 1. 5 ' -GCUCGAC CUGAuGAGuCcGUGAgGaCGAA ACGUAC AC A-3 Λ 2. 5 ' -GCAGCUC CUGAuGAGuCcGUGAgGaCGAA ACGACGUAC-3 '
3. 5 '-AAAGAAA CUGAuGAGuCcGUGAgGaCGAA ACCUGAGCA-3 '3.5 ' -AAAGAAA CUGAuGAGuCcGUGAgGaCGAA ACCUGAGCA-3'
4. 5 '-UCUCCGU CUGAuGAGuCcGUGAgGaCGAA ACAUAAAAG-3 '4.5 ' -UCUCCGU CUGAuGAGuCcGUGAgGaCGAA ACAUAAAAG-3'
5. S'-UGCUCCA CUGAuGAGuCcGUGAgGaCGAA ACACUCUUC-3 ' 5. S ' -UGCUCCA CUGAuGAGuCcGUGAgGaCGAA ACACUCUUC-3 '
6. 5 '-GACGACG CUGAuGAGuCcGUGAgGaCGAA ACACACUCA-3 ' 7. 5 '-CUUUUGA CUGAuGAGuCcGUGAgGaCGAA ACGUGGUCU-3 '6.5 ' -GACGACG CUGAuGAGuCcGUGAgGaCGAA ACACACUCA-3 ' 7.5 '-CUUUUGA CUGAuGAGuCcGUGAgGaCGAA ACGUGGUCU-3'
8. 5 '-GCUUUGC CUGAuGAGuCcGUGAgGaCGAA ACUUGCUCC-3 ' 8. 5 '-GCUUUGC CUGAuGAGuCcGUGAgGaCGAA ACUUGCUCC-3 '
9. 5 '-AAGACCU CUGAuGAGuCcGUGAgGaCGAA AGCAGCUCG-3 '9.5 'AAGACCU CUGAuGAGuCcGUGAgGaCGAA AGCAGCUCG-3'
10. 5'-UGUUUUU CUGAuGAGuCcGUGAgGaCGAA AGCCUGUUC-3 ' 11. 5 '-CAUAAAA CUGAuGAGuCcGUGAgGaCGAA AAAGACCUG-3 ' 10. 5'-UGUUUUU CUGAuGAGuCcGUGAgGaCGAA AGCCUGUUC-3 '11. 5' -CAUAAAA CUGAuGAGuCcGUGAgGaCGAA AAAGACCUG-3 '
12. 5'-UUCUUUU CUGAuGAGuCcGUGAgGaCGAA AAACGUGGU-3 ' 12. 5'-UUCUUUU CUGAuGAGuCcGUGAgGaCGAA AAACGUGGU-3 '
13. 5'-UCCGGUA CUGAuGAGuCcGUGAgGaCGAA AAAAAGAGC-3 ' (kleine Buchstaben bezeichnen im Rahmen der Komplementarität der Nukleotide im Stemloop frei wählbare Nukleotide). Es hat sich herausgestellt, daß die erfindungsgemäßen Ribozyme das T-Motiv der humanen Telomerase (hTERT) wie designt an einer der Sequenzen GUC, GUA, GUU, CUC oder UUC spalten.13. 5'-UCCGGUA CUGAuGAGuCcGUGAgGaCGAA AAAAAGAGC-3 '(small letters denote freely selectable nucleotides in the context of the complementarity of the nucleotides in the stem loop). It has been found that the ribozymes according to the invention cleave the T motif of human telomerase (hTERT) as designed on one of the sequences GUC, GUA, GUU, CUC or UUC.
Die erfindungsgemäßen Hammerhead-Ribozyme besitzen katalytische Aktivität in vitro. Sie spalten die mRNA für die humane Telomerase (hTERT) im T-Motiv an den vom Design ge- planten Sequenzen. Die Hemmung der Telomerase in Zellen gelingt durch stabile Transfekti- on eines Expressionsvektors, in den das Ribozym kloniert wurde. Sie gelingt ebenfalls mit anderen Transfektionsverfahren (z.B. transiente Transfektion oder Infektion mit einem re- kombinanten Virus). Ein im katalytischen Zentrum mutiertes Ribozym hat keinen Effekt. Erfindungsgemäß tritt Telomerenverkürzung und Krise in Klonen mit gehemmter Telomerase ein.The hammerhead ribozymes according to the invention have catalytic activity in vitro. They cleave the mRNA for human telomerase (hTERT) in the T motif on the sequences planned by the design. The inhibition of telomerase in cells is achieved by stable transfection of an expression vector into which the ribozyme has been cloned. It can also be achieved with other transfection methods (e.g. transient transfection or infection with a recombinant virus). A ribozyme mutated in the catalytic center has no effect. According to the invention, telomere shortening and crisis occur in clones with inhibited telomerase.
Die Klone mit gehemmter Telomerase steigern die Sensitivität gegenüber Doxorubicin (gemessen mit XTT-Assay - kolorimetrischer Assay - als Konzentration, die 50% der Zellen abtötet - LD50) um einen Faktor 2-3. Die Hemmung der Telomerase durch die erfindungsgemäßen Ribozyme wird sowohl in allei- niger Anwendung als auch in Kombination mit Zytostatikagabe und/oder Bestrahlung erreicht. Dadurch wird sowohl die "klassische" Telomerenverkürzung nach Hemmung der Telomerase, die im Verlauf mehrerer Zellteilungen schließlich zur Krise und zum Absterben der Zellen führt, als auch die Telomerenverkürzungsrate durch DNA-Schädigung beschleunigt, oder es werden unabhängige Reparatureigenschaften der Telomerase ausgeschaltet, was eine erhöhte Sensitivität bewirkt.The clones with inhibited telomerase increase the sensitivity to doxorubicin (measured using the XTT assay - colorimetric assay - as a concentration that kills 50% of the cells - LD50) by a factor of 2-3. The inhibition of telomerase by the ribozymes according to the invention is achieved both in sole use and in combination with cytostatic administration and / or radiation. This accelerates both the "classic" telomere shortening after inhibition of telomerase, which ultimately leads to the crisis and cell death in the course of several cell divisions, and the rate of telomere shortening due to DNA damage, or it eliminates independent repair properties of telomerase, which increases the rate Sensitivity causes.
Das Wesen der Erfindung liegt in einer Kombination bekannter Elemente und neuer Lösungswege, die sich gegenseitig beeinflussen und in ihrer neuen Gesamtwirkung einen Gebrauchsvorteil und den erstrebten Erfolg ergeben, der darin liegt, daß nunmehr Inhibitoren der katalytischen Untereinheit der humanen Telomerase (human Telomerase Enzyme Reverse Transcriptase, hTERT) zur Verfügung stehen.The essence of the invention lies in a combination of known elements and new approaches that mutually influence each other and in their new overall effect give a benefit in use and the desired success, which lies in the fact that now inhibitors of catalytic subunit of human telomerase (human telomerase enzyme reverse transcriptase, hTERT) are available.
Die erfindungsgemäßen Ribozyme eignen sich zur Verwendung als Telomerase-Inhibitoren und zur Telomerenverkürzung, auch in Kombination mit Zytostatikagabe und/oder Bestrah- lung oder mit Topoisomerase-Inhibition und dadurch zur Beschleunigung der Telomerenver- kürzungsrate durch DNA-Schädigung sowie zur Ausschaltung der Reparatureigenschaften der Telomerase. Die erfindungsgemäßen Ribozyme eignen sich zur Behandlung von Tumoren und zur Erhöhung der Sensitivität von Tumorzellen gegenüber Zytostatika.The ribozymes according to the invention are suitable for use as telomerase inhibitors and for shortening telomeres, also in combination with cytostatic administration and / or radiation or with topoisomerase inhibition and thereby for accelerating the rate of telomeres shortening due to DNA damage and for switching off the repair properties of telomerase . The ribozymes according to the invention are suitable for the treatment of tumors and for increasing the sensitivity of tumor cells to cytostatics.
Die folgenden Beispiele dienen der Verdeutlichung der Erfindung, ohne sie auf diese Beispiele zu beschränken.The following examples serve to illustrate the invention without restricting it to these examples.
Ausführungsbeispieleembodiments
Beispiel 1 : Design der RibozymeExample 1: Design of the Ribozymes
Ribozyme bestehen aus den Helizes I und III, die mit den die Schnittstelle flankierenden Sequenzen des Targets hybridisieren, sowie dem katalytischen Kern und dem Stemloop (Helix II) mit der Struktur CUGAuGAGuCcGUGAgGaCGAA. Die Herstellung der Ribozyme kann z.B. als Oligoribonukleotid erfolgen. Dazu wird die Sequenz wie angegeben aus den Ribonu- kleotiden G, C, A und U nach bekannten Verfahren synthetisiert. Stabilisierung des 3 '- und des 5 '-Endes mittels modifizierter Nukleotide oder cap- Strukturen ist prinzipiell möglich, der Einfluß dieser Modifikationen auf die katalytische Aktivität des Ribozyms muß im Einzelfall getestet werden. Diese Ribozyme können direkt eingesetzt werden. Eine andere Möglichkeit ist die Synthese der cDNA für das Ribozym aus den Desoxyribonukleotiden G, C, A und T. Diese Form der Ribozyme kann in Verbindung mit geeigneten Promotor(en) und Transfekti- onsvektoren (z.B. adeno- oder retrovirale Vektoren) eingesetzt werden.Ribozymes consist of helices I and III, which hybridize with the target sequences flanking the interface, as well as the catalytic core and the stem loop (Helix II) with the structure CUGAuGAGuCcGUGAgGaCGAA. The ribozymes can be produced, for example, as an oligoribonucleotide. For this purpose, the sequence is synthesized from the ribonucleotides G, C, A and U as described by known methods. In principle, stabilization of the 3 'and 5 ' ends by means of modified nucleotides or cap structures is possible; the influence of these modifications on the catalytic activity of the ribozyme must be tested in individual cases. These ribozymes can be used directly. Another possibility is the synthesis of the cDNA for the ribozyme from the deoxyribonucleotides G, C, A and T. This form of the ribozymes can be used in connection with suitable promoters and transfection vectors (eg adeno- or retroviral vectors).
cDNA-Sequenz des T-Motivs von hTERT (GenBank AF015950): Nicht zum T-Motiv gehörende Nukleotide sind kursiv dargestellt. Aus der Sequenz ergeben sich die möglichen Schnittstellen und die Sequenzen der Antisense-Helizes für die möglichen Ribozyme 1-13. Die Schnittstelle des ersten Ribozyms (Rl) ist fett dargestellt, und die flankierenden Sequenzen sind einmal bzw. zweimal unterstrichen. Darunter befindet sich das zugehörige Ribozym mit entsprechender Darstellung: 1681 caagttcctg cαetggctga tgagtgtgta cgtcgtcgag ctgctcaggt ctttctttta 1741 tgtcacggag accacgtttc aaaagaacag gctctttttc taccggaaga gtgtctggag 1801 caagttgcaa agcattggaa tcagacagca cttgaagαgg gtgcagctgc gggagctgtccDNA sequence of the T motif from hTERT (GenBank AF015950): Nucleotides not belonging to the T motif are shown in italics. The possible interfaces and the sequences of the antisense helices for the possible ribozymes 1-13 result from the sequence. The interface of the first ribozyme (Rl) is shown in bold and the flanking sequences are underlined once or twice. Below is the associated ribozyme with the corresponding representation: 1681 caagttcctg cαetggctga tgagtgtgta cgtcgtcgag ctgctcaggt ctttctttta 1741 tgtcacggag accacgtttc aaaagaacag gctctttttc taccggaaga gtgtctggag 1801 caagttgcaa agcattcggggcgcgggggggcgcgggggggggggggggggggggggggcggggg
5 -GCUCGAC CUGAuGAGuCcGUGAgGaCGAA ACGUACACA-3' 5 -GCUCGAC CUGAuGAGuCcGUGAgGaCGAA ACGUACACA-3 '
Beispiel 2: Nachweis der katalytischen Aktivität der Ribozyme 1 - 4 in vitro Eine 224 Nukleotide (nt) lange RNA, die die Sequenz des T-Motivs einschließt, wurde durch in-vitro-Transkription aus der mit einem T7-Promoter verlinkten cDNA von hTERT hergestellt (Target-RNA). Während der Transkription erfolgte die radioaktive Markierung mittels Pj2-UTP. Ribozyme wurden nach Standardverfahren aus Ribonukleotiden mit durch Fpmp (1 l-(2-Fluorophenyl)-4-methoxy-piperidin-l-yl) geschützten 2 '-Hydroxylgruppen synthetisiert und HPLC-gereinigt. Sie wurden vor Gebrauch entschützt. Die Target-RNA wurde mit Ribozym 1, 2, 3 oder 4 bzw. ohne Ribozym (/) für 60 und 180 min inkubiert und die Reaktionsprodukte elektrophoretisch im Polyacrylamid-Gel getrennt. Das Gel wurde im Phosphoi- mager ausgewertet und zeigt Spaltung der Target-RNA an den designierten Stellen durch die Ribozyme 3 und 4 mit hoher Effizienz und geringe Wirksamkeit der Ribozyme 1 und 2 (FigurExample 2: Detection of the catalytic activity of the ribozymes 1-4 in vitro A 224 nucleotide (nt) long RNA, which includes the sequence of the T motif, was obtained by in vitro transcription from the cDNA of hTERT linked to a T7 promoter produced (target RNA). During the transcription, the radioactive labeling was carried out using P j2 -UTP. Ribozymes were synthesized by standard methods from ribonucleotides with 2'-hydroxyl groups protected by Fpmp (1 l- (2-fluorophenyl) -4-methoxy-piperidin-l-yl) and purified by HPLC. They were deprotected before use. The target RNA was incubated with ribozyme 1, 2, 3 or 4 or without ribozyme (/) for 60 and 180 min and the reaction products were separated electrophoretically in the polyacrylamide gel. The gel was evaluated in the phosphoimager and shows cleavage of the target RNA at the designated sites by the ribozymes 3 and 4 with high efficiency and low effectiveness of the ribozymes 1 and 2 (FIG
1).1).
Beispiel 3:Example 3:
Nachweis der Hemmung der Telomerase durch stabile Transfektion und Expression des Ribozyms 4 in HBL100, einer immortalen Mammaepithelzelllinie mit hoher Telomeraseaktivität, und in MCF-7, einer Mammatumorzelllinie. Ein im katalytischen Zentrum imitiertes Ribozym hat keinen Effekt.Detection of inhibition of telomerase by stable transfection and expression of ribozyme 4 in HBL100, an immortal mammary epithelial cell line with high telomerase activity, and in MCF-7, a breast tumor cell line. A ribozyme imitated in the catalytic center has no effect.
Beide Stränge der für das Ribozym R4 (4. Ribozym in der Liste) bzw. der für das im katalytischen Zentrum mutierte Ribozym mutR4 kodierenden cDNA wurden als Oligodesoxyribonu- kleotide nach Standardverfahren synthetisiert. Sie wurden in den Expressionvektor (Plasmid) pCDNA3.1 Moniert und stabil in MCF-7 - (Figur 2a) bzw. HBL-100-Zellen (Figur 2b) - ex- primiert. Die Telomeraseaktivität in den numerierten Klonen wurde mittels semiquantitativen TRAP-Assay (Telomerase Repeat Amplification Protocol) gemessen. Die Intensität des Leitermusters in der jeweiligen Spur im Verhältnis zur Intensität der Kontrollbande (Dreieck) ist ein Maß für die Aktivität der Telomerase. Die HBL-100- bzw. MCF-7-Klone, die mit einem im katalytischen Zentrum mutierten Ribozym transfiziert wurden (mut R4), zeigen etwa die gleiche Telomeraseaktivität wie die parentalen Zellen (p = Parentale Zellen, R8 = Positivkon- trolle, NC = Negativkontrolle). Expression von R4 reduziert die Telomeraseaktivität auf Werte zwischen <1 und etwa 30%.Both strands of the cDNA coding for the ribozyme R4 (4th ribozyme in the list) and for the ribozyme mutR4 mutated in the catalytic center were synthesized as oligodeoxyribonucleotides by standard methods. They were cloned into the expression vector (plasmid) pCDNA3.1 and stably expressed in MCF-7 (FIG. 2a) or HBL-100 cells (FIG. 2b). The telomerase activity in the numbered clones was measured using a semiquantitative TRAP assay (Telomerase Repeat Amplification Protocol). The intensity of the conductor pattern in the respective track in relation to the intensity of the control band (triangle) is a measure of the activity of the telomerase. The HBL-100 and MCF-7 clones that were transfected with a ribozyme mutated in the catalytic center (mut R4) show approximately the same telomerase activity as the parental cells (p = parental cells, R8 = positive con trolls, NC = negative control). Expression of R4 reduces telomerase activity to values between <1 and about 30%.
Beispiel 4: Nachweis von Telomerenverkürzung in Klonen mit gehemmter Telomerase Die Telomerenlänge in den Zellinien MCF-7 (Figur 3A) und HBL-100 (Figur 3B) wurde im Southernblot gemessen und quantifiziert wie beschrieben (Petersen, S., Saretzki, G., von Zglinicki, T. Exp. Cell Res. 1998, 239: 152-160). Die Anzahl der untersuchten Klone n und die jeweilige Telomeraseaktivität (in % der Aktivität in parentalen/mutR4-transfizierten Zellen, X-Achse) ist angegeben. Die Telomerenlänge in mit mutR4 transfizierten Klonen (mutR4) oder in den R4-transfizierten Klonen, die nur geringfügige Verminderung der Telomeraseaktivität aufweisen, weicht nicht signifikant von der in parentalen Zellen ab. Die Telomerenlänge in den Klonen mit deutlich gehemmter Telomerase ist jedoch signifikant geringer.Example 4: Detection of telomere shortening in clones with inhibited telomerase The telomere length in the cell lines MCF-7 (FIG. 3A) and HBL-100 (FIG. 3B) was measured in the Southern blot and quantified as described (Petersen, S., Saretzki, G., by Zglinicki, T. Exp. Cell Res. 1998, 239: 152-160). The number of clones n examined and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated. The telomeric length in mutR4-transfected clones (mutR4) or in the R4-transfected clones, which show only a slight reduction in telomerase activity, does not differ significantly from that in parental cells. The telomere length in the clones with clearly inhibited telomerase is, however, significantly shorter.
Beispiel 5: Nachweis der Inhibition des Zellwachstums in MCF-7-Klonen mit inhibierter TelomeraseExample 5: Detection of inhibition of cell growth in MCF-7 clones with inhibited telomerase
Netto-Proliferationsraten wurden durch Zellzählung in jeder Passage ermittelt. Die Anzahl der untersuchten Klone n und die jeweilige Telomeraseaktivität (in % der Aktivität in parenta- len/mutR4-transfizierten Zellen, X-Achse) ist angegeben. In Klonen mit einer Telomerase- Aktivität unter 25% der Ausgangszellen ist das Zellwachstum inhibiert (Figur 4A). Nachweis einer geänderten Morphologie in telomerase-inliibierten MCF-7-Klonen. Die Morphologie lebender Zellen wurde im Phasenkontrast-UmkehrmikiOskop kontrolliert. Mit mutR4 stabil transfizierte Klone (links) zeigen normales, schnelles Wachstum und die gleiche Morphologie wie parentale Zellen. Klone mit durch R4 inhibierter Telomerase (rechts) zeigen eingeschränktes Wachstum und zum überwiegenden Teil, insbesondere an der Peripherie der entstehenden, vergleichsweise kleinen Kolonien, Zellen mit charakteristisch seneszenter Morphologie (gleiche Vergrößerung links und rechts) (Figur 4B).Net proliferation rates were determined by cell counting in each passage. The number of examined clones n and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated. In clones with a telomerase activity below 25% of the starting cells, cell growth is inhibited (FIG. 4A). Evidence of an altered morphology in telomerase-incorporated MCF-7 clones. The morphology of living cells was checked in the phase contrast reversal microscope. Clones stably transfected with mutR4 (left) show normal, rapid growth and the same morphology as parental cells. Clones with telomerase inhibited by R4 (right) show restricted growth and for the most part, especially on the periphery of the resulting, comparatively small colonies, cells with characteristic senescent morphology (same magnification left and right) (FIG. 4B).
Nachweis der Erzeugung eines seneszenten Phänotyps durch retrovirale Infektion mit dem Ribozym R4 in einer Massenkultur von MCF-7. R4 wurde in einen retroviralen Expressionsvektor (pBabe) kloniert und rekombinante Viren nach Standard-Prozedur generiert. Jeweils 10 MCF-7-Zellen wurden entweder mit dem unmodifizierten Vektor (links) oder mit R4- pBabe (rechts) infiziert. Dargestellt sind die Massenkulturen 2 Wochen nach Infektion. Infektion mit R4-pBabe vermindert die Telomeraseaktivität und blockiert das Wachstum in der Kultur. Zahlreiche Zellen sterben ab und lösen sich von der Kulturschale. Die wenigen über- lebenden Zellen zeigen einen seneszenten Phänotyp (gleiche Vergrößerung links und rechts) (Figur 4C).Evidence of the generation of a senescent phenotype by retroviral infection with the ribozyme R4 in a mass culture of MCF-7. R4 was cloned into a retroviral expression vector (pBabe) and recombinant viruses were generated according to the standard procedure. 10 MCF-7 cells were infected either with the unmodified vector (left) or with R4-pBabe (right). The mass cultures are shown 2 weeks after infection. Infection with R4-pBabe reduces telomerase activity and blocks growth in the culture. Numerous cells die and detach from the culture dish. The few over- living cells show a senescent phenotype (same magnification left and right) (Figure 4C).
Beispiel 6: Nachweis einer um einen Faktor 2-3 gesteigerten Sensitivität der Klone mit gehemmter Telomerase gegenüber DoxorubicinExample 6: Detection of a sensitivity of clones with inhibited telomerase to doxorubicin increased by a factor of 2-3
HBL-100-Zellen wurden mit R4 bzw. mutR4 transfiziert. Die Telomeraseaktivität wurde mit TRAP-Assay gemessen. Die Klone wurden mit Doxorubicin in Konzentrationen zwischen 10 und 1000 ng/ml für drei Tage behandelt und dann das Zellüberleben mit XTT-Assay gemes- sen. Die Doxorubicin-Konzentration, die in einem um 50% reduzierten XTT-Signal (kolorimetrisches Signal) resultiert (LD50), wurde berechnet. Die Anzahl der untersuchten Klone n und die jeweilige Telomeraseaktivität (in % der Aktivität in parentalen/mutR4- transfizierten Zellen, X-Achse) ist angegeben. Klone mit einer Telomeraseaktivität <25% der Ausgangszellen weisen eine etwa um den Faktor 2 verminderte LD50 auf (Figur 5A). Bestimmung der LD50 für Doxorubicin in MCF-7-Klonen (s. oben). Klone mit einer Telomeraseaktivität unter 25% sind drei- bis viermal sensitiver gegenüber Doxorubicin (Figur 5B).HBL-100 cells were transfected with R4 or mutR4. Telomerase activity was measured using a TRAP assay. The clones were treated with doxorubicin in concentrations between 10 and 1000 ng / ml for three days and then cell survival was measured with an XTT assay. The doxorubicin concentration resulting in a 50% reduced XTT signal (colorimetric signal) (LD50) was calculated. The number of clones n examined and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated. Clones with a telomerase activity <25% of the starting cells have an LD50 reduced by a factor of 2 (FIG. 5A). Determination of the LD50 for doxorubicin in MCF-7 clones (see above). Clones with a telomerase activity below 25% are three to four times more sensitive to doxorubicin (Figure 5B).
Beispiel 7:Example 7:
Nachweis der erhöhten Sensitivität von telomerase-negativen Zellen gegenüber topoisomera- se-inhibierenden ZytostatikaEvidence of the increased sensitivity of telomerase-negative cells to topoisomerase-inhibiting cytostatics
Die Sensitivität gegenüber den angegebenen Zytostatika wurde als LD50 mittels XTT-Assay pßabe gemessen. Angegeben ist das Verhältnis der LD50 der telomerase-positiven zu den telomerase-negativen Klonen. Untersucht wurden mutR4-transfizierte vs. R4-transfizierte HBL- 100- und MCF-7-Klone und hTERT-exprimierende vs parentale BJ-Fibroblasten (Bodnar, A.G., Oulette, M., Frolkis, M., Holt, S.E., Chiu, C.P. Morin, G.B., Harley, C.B., Shay, J.W., Lichtsteiner, S., Wright, W. Science 1998, 279: 349-352). Zellen mit verringerter Telomeraseaktivität sind sensitiver als die isogenen Klone mit aktiver Telomerase gegenüber allen untersuchten Topoisomerase-Lnhibitoren (Mitoxantron, Etoposid und Doxorubicin - Römpp Chemie Lexikon 1995), nicht aber gegenüber den anderswirkenden Zytostatika cis-Platin und Bleomycin oder dem alkylierenden Wirkstoff N-Methyl-N'-Nitro-N-Nitrosoguanidin (MN G) oder oxidativer Belastung mittels Wasserstoffperoxid (H2O9) (Figur 6). The sensitivity to the specified cytostatics was measured as LD50 using the XTT assay. The ratio of the LD50 of the telomerase-positive to the telomerase-negative clones is given. MutR4-transfected vs. R4-transfected HBL-100 and MCF-7 clones and hTERT-expressing vs parental BJ fibroblasts (Bodnar, AG, Oulette, M., Frolkis, M., Holt, SE, Chiu, CP Morin, GB, Harley, CB, Shay, JW, Lichtsteiner, S., Wright, W. Science 1998, 279: 349-352). Cells with reduced telomerase activity are more sensitive than the isogenic clones with active telomerase to all investigated topoisomerase inhibitors (mitoxantrone, etoposide and doxorubicin - Römpp Chemie Lexikon 1995), but not to the cytostatic agents cis-platinum and bleomycin or the alkylating agent N-methyl -N'-nitro-N-nitrosoguanidine (MN G) or oxidative exposure using hydrogen peroxide (H 2 O9) (Figure 6).

Claims

Patentansprüche claims
1. Ribozyme, die die Aktivität der katalytischen Untereinheit der humanen Telomerase hTERT (human Telomerase Enzyme Reverse Transcriptase) vermindern.1. Ribozymes which reduce the activity of the catalytic subunit of human telomerase hTERT (human telomerase enzyme reverse transcriptase).
2. Ribozyme nach Anspruch 1 , dadurch gekemizeiclmet. daß sie gegen das T-Motiv der humanen Telomerase gerichtet sind.2. Ribozymes according to claim 1, characterized gekemizeiclmet. that they are directed against the T motif of human telomerase.
3. Ribozyme nach Anspruch 1 und 2, dadurch gekeimzeichnet, daß sie das T-Motiv der humanen Telomerase (hTERT) an den Sequenzen GUC, GUA, GUU, CUC oder UUC schneiden.3. Ribozymes according to claims 1 and 2, characterized in that they cut the T motif of human telomerase (hTERT) on the sequences GUC, GUA, GUU, CUC or UUC.
4. Ribozyme nach Anspruch 1 bis 3, dadurch gekennzeichnet, daß es sich um Hammerhead- Ribozyme mit folgenden Sequenzen handelt: a) 5'-GCUCGAC CUGAuGAGuCcGUGAgGaCGAA ACGUACACA-3 b) 5'-GCAGCUC CUGAuGAGuCcGUGAgGaCGAA ACGACGUAC-3 c) 5'-AAAGAAA CUGAuGAGuCcGUGAgGaCGAA ACCUGAGCA-3 d) 5'-UCUCCGU CUGAuGAGuCcGUGAgGaCGAA ACAUAAAAG-3 e) 5'-UGCUCCA CUGAuGAGuCcGUGAgGaCGAA ACACUCUUC-3 f) 5-GACGACG CUGAuGAGuCcGUGAgGaCGAA ACACACUCA-3 g) 5'-CUUUUGA CUGAuGAGuCcGUGAgGaCGAA ACGUGGUCU-3 h) 5'-GCUUUGC CUGAuGAGuCcGUGAgGaCGAA ACUUGCUCC-3 i) 5'-AAGACCU CUGAuGAGuCcGUGAgGaCGAA AGCAGCUCG-3 j) 5'-UGUUUUU CUGAuGAGuCcGUGAgGaCGAA AGCCUGUUC-3 k) 5'-CAUAAAA CUGAuGAGuCcGUGAgGaCGAA AAAGACCUG-34. Ribozymes according to claim 1 to 3, characterized in that it is hammerhead ribozymes with the following sequences: a) 5'-GCUCGAC CUGAuGAGuCcGUGAgGaCGAA ACGUACACA-3 b) 5'-GCAGCUC CUGAuGAGuCcGUGAgGaCGAA 3CGAAAUACA) CUGAuGAGuCcGUGAgGaCGAA ACCUGAGCA-3 d) 5'-UCUCCGU CUGAuGAGuCcGUGAgGaCGAA ACAUAAAAG-3 e) 5'-UGCUCCA CUGAuGAGuCcGUGAgGaCGAA ACACUCUUC-3 f) 5-GACGACG CUGAuGAGuCcGUGAgGaCGAA ACACACUCA-3 g) of 5'-CUUUUGA CUGAuGAGuCcGUGAgGaCGAA ACGUGGUCU-3 h) 5'-GCUUUGC CUGAuGAGuCcGUGAgGaCGAA ACUUGCUCC-3 i) 5'-AAGACCU CUGAuGAGuCcGUGAgGaCGAA AGCAGCUCG-3 j) 5'-UGUUUUU CUGAuGAGuCcGUGAgGaCGAA AGCCUGUUC-3 k) 5'-CAUAAAA CUGAGGAGCCCGAAAGAGC
1) 5'-UUCUUUU CUGAuGAGuCcGUGAgGaCGAA AAACGUGGU-3 m) 5'-UCCGGUA CUGAuGAGuCcGUGAgGaCGAA AAAAAGAGC-31) 5'-UUCUUUU CUGAuGAGuCcGUGAgGaCGAA AAACGUGGU-3 m) 5'-UCCGGUA CUGAuGAGuCcGUGAgGaCGAA AAAAAGAGC-3
5. Verwendung von Ribozymen nach Anspruch 1 bis 4 als Telomerase-hihibitoren.5. Use of ribozymes according to claims 1 to 4 as telomerase inhibitors.
6. Verwendung von Ribozymen nach Anspruch 1 bis 4 zur Telomerenverkürzung.6. Use of ribozymes according to claim 1 to 4 for telomere shortening.
7. Verwendung von Ribozymen nach Anspruch 1 bis 4 in Kombination mit Zytostatikagabe und/oder Bestrahlung zur Telomerenverkürzung. 7. Use of ribozymes according to claim 1 to 4 in combination with cytostatic administration and / or radiation to shorten telomeres.
8. Verwendung von Ribozymen nach Anspruch 1 bis 4 in Kombination mit Topoisomerase- Lnhibition zur Telomerenverkürzung.8. Use of ribozymes according to claim 1 to 4 in combination with topoisomerase inhibition for telomere shortening.
9. Verwendung nach Anspruch 7 oder 8 zur Beschleunigung der Telomerenverkürzungsrate durch DNA-Schädigung sowie zur Ausschaltung der Reparatureigenschaften der Telomerase.9. Use according to claim 7 or 8 for accelerating the rate of telomere shortening by DNA damage and for eliminating the repair properties of the telomerase.
10. Verwendung von Ribozymen nach Anspruch 1 bis 9 zur Behandlung von Tumoren.10. Use of ribozymes according to claim 1 to 9 for the treatment of tumors.
11. Verwendung nach Anspruch 1 bis 4 zur Erhöhung der Sensitivität von Tumorzellen gegenüber Zytostatika. 11. Use according to claim 1 to 4 for increasing the sensitivity of tumor cells to cytostatics.
PCT/DE2000/000227 1999-01-22 2000-01-21 Ribozymes directed against the catalytic subunit of the human telomerase (htert) WO2000043501A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2000594909A JP2002536967A (en) 1999-01-22 2000-01-21 Ribozymes targeting the catalytic subunit of human telomerase (hTERT)
EP00910502A EP1149161A2 (en) 1999-01-22 2000-01-21 Ribozymes directed against the catalytic subunit of the human telomerase (htert)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19903961 1999-01-22
DE19903961.5 1999-01-22

Publications (2)

Publication Number Publication Date
WO2000043501A2 true WO2000043501A2 (en) 2000-07-27
WO2000043501A3 WO2000043501A3 (en) 2000-11-16

Family

ID=7896056

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2000/000227 WO2000043501A2 (en) 1999-01-22 2000-01-21 Ribozymes directed against the catalytic subunit of the human telomerase (htert)

Country Status (4)

Country Link
EP (1) EP1149161A2 (en)
JP (1) JP2002536967A (en)
DE (1) DE10003356A1 (en)
WO (1) WO2000043501A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1330759C (en) * 2004-08-24 2007-08-08 四川大学 Nucleusase gene hTERT-5'R2 cDNA of inhibiting endgranulase activity and its recombined carrier and nucleusase
WO2010018731A2 (en) * 2008-08-12 2010-02-18 Japan Health Sciences Foundation A mammalian rna dependent rna polymerase

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5656638A (en) * 1995-04-18 1997-08-12 Geron Corporation Telomerase inhibitors
EP0841396A1 (en) * 1996-10-01 1998-05-13 Geron Corporation Human telomerase catalytic subunit

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5656638A (en) * 1995-04-18 1997-08-12 Geron Corporation Telomerase inhibitors
EP0841396A1 (en) * 1996-10-01 1998-05-13 Geron Corporation Human telomerase catalytic subunit

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KONDO YASUKO ET AL: "Inhibition of telomerase increases the susceptibility of human malignant glioblastoma cells to cisplatin-induced apoptosis." ONCOGENE, Bd. 16, Nr. 17, 30. April 1998 (1998-04-30), Seiten 2243-2248, XP000864718 ISSN: 0950-9232 *
WAN MARGARET S K ET AL: "Synthetic 2'-O-methyl-modified hammerhead ribozymes targeted to RNA component of telomerase as sequence-specific inhibitors of telomerase activity." ANTISENSE & NUCLEIC ACID DRUG DEVELOPMENT, Bd. 8, Nr. 4, August 1998 (1998-08), Seiten 309-317, XP000907692 ISSN: 1087-2906 *
YOKOYAMA Y ET AL: "Application of hammerhead ribozyme targeting telomerase molecule for cancer therapy." NIPPON RINSHO. JAPANESE JOURNAL OF CLINICAL MEDICINE, (1998 MAY) 56 (5) 1126-30. REF: 19 , XP000864684 *
YOKOYAMA YASUHIRO ET AL: "Attenuation of telomerase activity by a hammerhead ribozyme targeting the template region of telomerase RNA in endometrial carcinoma cells." CANCER RESEARCH, Bd. 58, Nr. 23, 1. Dezember 1998 (1998-12-01), Seiten 5406-5410, XP000915164 ISSN: 0008-5472 in der Anmeldung erw{hnt *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1330759C (en) * 2004-08-24 2007-08-08 四川大学 Nucleusase gene hTERT-5'R2 cDNA of inhibiting endgranulase activity and its recombined carrier and nucleusase
WO2010018731A2 (en) * 2008-08-12 2010-02-18 Japan Health Sciences Foundation A mammalian rna dependent rna polymerase
WO2010018731A3 (en) * 2008-08-12 2010-07-15 Japan Health Sciences Foundation A mammalian rna dependent rna polymerase

Also Published As

Publication number Publication date
DE10003356A1 (en) 2000-07-27
JP2002536967A (en) 2002-11-05
EP1149161A2 (en) 2001-10-31
WO2000043501A3 (en) 2000-11-16

Similar Documents

Publication Publication Date Title
DE3852539T3 (en) Ribozymes.
EP1798285B1 (en) Methods and medicament for inhibition the expression of a defined gene
US5589580A (en) Ribozymes
US5543508A (en) Ribozymes
DE69933653T2 (en) To inhibit the expression of the CCR5 receptor capable of ribozymes
US6001989A (en) Nucleotide based endonucleases
EP0918853A2 (en) Antisense rna with a secondary structure
EP0711835A1 (en) Selection and expression of heterologous proteins using a selection-amplification-system
WO2003062432A1 (en) Method for increasing the efficiency of an inhibitor of tyrosine kinase activity
DE69921609T2 (en) RIBOZYMALE NUCLEIC ACID CUT THE CCR5 OR CXCR4
DE10230996A1 (en) Method for inhibiting viral replication, useful particularly for treating hepatitis C infection, by altering the 3&#39;-untranslated region of the virus
WO2000043501A2 (en) Ribozymes directed against the catalytic subunit of the human telomerase (htert)
DE69432444T2 (en) Promoter sequence of the p55 receptor for tumor necrosis factor
DE69930862T2 (en) EXPRESSION SYSTEMS FOR THE FUNCTIONAL EXPRESSION OF NUCLEIC ACIDS
DE69933382T2 (en) PREPARATION OF SSDNA INSIDE THE CELL
DE19731609C2 (en) Cholesteryl ester transfer protein (CETP) mRNA as a target molecule in the therapy of atherosclerosis
DE60023921T2 (en) GAS1 POLYPEPTIDES

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 594909

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09890024

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2000910502

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000910502

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2000910502

Country of ref document: EP