WO2000043501A2 - Ribozymes directed against the catalytic subunit of the human telomerase (htert) - Google Patents
Ribozymes directed against the catalytic subunit of the human telomerase (htert) Download PDFInfo
- Publication number
- WO2000043501A2 WO2000043501A2 PCT/DE2000/000227 DE0000227W WO0043501A2 WO 2000043501 A2 WO2000043501 A2 WO 2000043501A2 DE 0000227 W DE0000227 W DE 0000227W WO 0043501 A2 WO0043501 A2 WO 0043501A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cugaugaguccgugaggacgaa
- telomerase
- ribozymes
- htert
- human telomerase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
Definitions
- the invention relates to anti-telomerase ribozymes and their use.
- the ribozymes reduce the activity of the catalytic subunit of human telomerase (human telomerase enzyme reverse transcriptase, hTERT). They serve as telomerase inhibitors, limit the proliferative capacity and increase the sensitivity of tumor cells to cytostatics.
- Telomerase is a unique reverse transcriptase that uses an internal RNA component to attach telomer sequences de novo to the 3 'DNA end of the telomeres. It thus counteracts a progressive mitotic telomere shortening, the result of which leads to proliferative senescence in mortal somatic cells.
- telomere length especially in experimentally immortalized cells and in other species, their importance for tumor development in humans is apparently rather small.
- the vast majority of different human tumors have a high telomerase activity, while starting cells and non-invasive tumor precursors usually have only a low activity.
- the telomerase activity can be reconstituted in vitro solely from the RNA component and the catalytic subunit.
- telomerase-specific T motif was detected in the catalytic subunit. Mutations in conserved amino acids of the T motif lead to a drastic loss of function in the cell-free system (Weinrich SL, Pruzan, R .. Ma, L., Oulette, M., Tesmer, VM, Holt, SH, Bodnar, A., Lichtsteiner, S., Kim, NW, Trager, JB, Taylor, RD, Carlos, R., Andrews, WH, Wright, W., Shay, JW, Harley, CB, Morin, GB, Nature Genetics, 17, 1997, 498- 502).
- telomerase incorporation would only lead to telomer-dependent cell cycle blockade after a considerable time delay (Kipling, D., Nature Genet 9, 1995: 104-105).
- telomere inhibition by hTR antisense vectors which leads to a telom lead shortening and senescence of the corresponding culture has been demonstrated only once in HeLa cells (Feng, J., Funk, W., Wang, SS, Weinrich, SL,. Avilion, AA, Chiu, CP, Adams, RR, Chang , E., Allsopp, RC, Yu, J., Le, S., West, MD, Harley, CB, Andrews, WH, Greider, CW, Villeponteau, B, Science 1995, 269: 1236-1241).
- RNA component may not be the best target for telomerase introduction because it is also expressed in normal cells.
- Nucleoside analogs e.g. the known inhibitor of reverse transcriptases azidothymidine, work well in the cell-free system, but show strong non-specific side effects in cells (Ray, C, Blackburn, E., Mol Cell Biol 16, 1996, 53-65; Janta-Lipinski, Matthes, MDC Book, personal communication). Other strategies to inhibit telomerase such as B.
- Antisense technology with peptide-coupled nucleic acids or the use of non-nucleosides have so far only been tested in the cell-free system.
- the GUC sequence is one of the most easily cleavable targets. Inhibition of telomerase and subsequent telomere shortening by ribozymes against hTR have been described (Yokoyama, Y., Takahashi, Y., Shinohara, A., Lian, Z., Wan, X., Niwa, K., Tamaya, T., Cancer Res., 58, 1998: 5406-5410). So far, no reliable inhibition of cell growth has been achieved with ribozymes against hTR. Ribozymes with activity against hTERT, the mRNA of the catalytic subunit of telomerase, have not previously been described.
- telomeres are hypersensitive to oxidative stress (Petersen, S., Saretzki, G., von Zglinicki, T. Exp. Cell Res. 1998, 239: 152-160).
- telomere shortening leads to the induction of apoptosis (Kondo, Y., Kondo, S., Li, G., Silvermann, RH, Cowell, JK, Oncogene 1998, 16: 3323-3330) or to sensitization to cis- Platinum (Kondo, Y., Kondo. S., Tanaka, Y., Haqqi, T., Barna, BP, Cowell, JK, Oncogene 1998, 16: 2243-2248) within a few days. ie before a significant telomere shortening can occur.
- telomerase inhibitors are described several times in the patent literature. They are directed primarily against the RNA component of the enzyme (e.g. EP 666313 WO 97/37691 and WO 98/28442). Methods for cancer treatment using telomerase inhibitors are reported in US Patents US 5767278, US 5770613, US 57031 16, US 5760062 and 5656638.
- the catalytic subunit of human telomerase has the international patent application WO 98/14593 and the resulting European (EP 841396) or German patent application (DE 19743497) to the content.
- the polynucleotides and plasmids described therein are suitable for the diagnosis, prognosis and treatment of human diseases and for changing the proliferation capacity of cells and organisms.
- the patent specifications WO 98/14593 and WO 98/14592 relate to plasmids, including those which span the region of the T motif of hTERT, both expression plasmid (s) and antisense plasmids. Antisense plasmids can be used to inhibit telomerase.
- German patent application DE 19720151 describes a chemically modified oligodeoxynucleotide which on the one hand exerts an antisense effect against hTR and on the other hand reacts at its 5 'end with the protein of the catalytic subunit hTERT.
- Ribozymes i.e. However, polyribonucleotides which connect antisense flanks with a central RNA-cutting structure are described in the abovementioned. Patents not panned. There are no published results on the specific inhibition of the catalytic subunit of telomerase.
- the object of the invention was to reduce the activity of the catalytic subunit of human telomerase (human telomerase enzyme reverse transcriptase, hTERT) and thus to make new telomerase inhibitors available.
- human telomerase human telomerase enzyme reverse transcriptase, hTERT
- the task was solved by new ribozymes, which are directed against the T motif of human telomerase.
- the ribozymes according to the invention contain the following sequences: 1. 5 ' -GCUCGAC CUGAuGAGuCcGUGAgGaCGAA ACGUAC AC A-3 ⁇ 2. 5 ' -GCAGCUC CUGAuGAGuCcGUGAgGaCGAA ACGACGUAC-3 '
- the hammerhead ribozymes according to the invention have catalytic activity in vitro. They cleave the mRNA for human telomerase (hTERT) in the T motif on the sequences planned by the design.
- hTERT human telomerase
- the inhibition of telomerase in cells is achieved by stable transfection of an expression vector into which the ribozyme has been cloned. It can also be achieved with other transfection methods (e.g. transient transfection or infection with a recombinant virus).
- a ribozyme mutated in the catalytic center has no effect. According to the invention, telomere shortening and crisis occur in clones with inhibited telomerase.
- the clones with inhibited telomerase increase the sensitivity to doxorubicin (measured using the XTT assay - colorimetric assay - as a concentration that kills 50% of the cells - LD50) by a factor of 2-3.
- the inhibition of telomerase by the ribozymes according to the invention is achieved both in sole use and in combination with cytostatic administration and / or radiation. This accelerates both the "classic" telomere shortening after inhibition of telomerase, which ultimately leads to the crisis and cell death in the course of several cell divisions, and the rate of telomere shortening due to DNA damage, or it eliminates independent repair properties of telomerase, which increases the rate Sensitivity causes.
- telomere enzyme reverse transcriptase human telomerase enzyme reverse transcriptase
- the ribozymes according to the invention are suitable for use as telomerase inhibitors and for shortening telomeres, also in combination with cytostatic administration and / or radiation or with topoisomerase inhibition and thereby for accelerating the rate of telomeres shortening due to DNA damage and for switching off the repair properties of telomerase .
- the ribozymes according to the invention are suitable for the treatment of tumors and for increasing the sensitivity of tumor cells to cytostatics.
- Ribozymes consist of helices I and III, which hybridize with the target sequences flanking the interface, as well as the catalytic core and the stem loop (Helix II) with the structure CUGAuGAGuCcGUGAgGaCGAA.
- the ribozymes can be produced, for example, as an oligoribonucleotide.
- the sequence is synthesized from the ribonucleotides G, C, A and U as described by known methods.
- stabilization of the 3 'and 5 ' ends by means of modified nucleotides or cap structures is possible; the influence of these modifications on the catalytic activity of the ribozyme must be tested in individual cases.
- These ribozymes can be used directly.
- ribozyme Another possibility is the synthesis of the cDNA for the ribozyme from the deoxyribonucleotides G, C, A and T.
- This form of the ribozymes can be used in connection with suitable promoters and transfection vectors (eg adeno- or retroviral vectors).
- cDNA sequence of the T motif from hTERT (GenBank AF015950): Nucleotides not belonging to the T motif are shown in italics. The possible interfaces and the sequences of the antisense helices for the possible ribozymes 1-13 result from the sequence. The interface of the first ribozyme (Rl) is shown in bold and the flanking sequences are underlined once or twice.
- Example 2 Detection of the catalytic activity of the ribozymes 1-4 in vitro
- a 224 nucleotide (nt) long RNA which includes the sequence of the T motif, was obtained by in vitro transcription from the cDNA of hTERT linked to a T7 promoter produced (target RNA). During the transcription, the radioactive labeling was carried out using P j2 -UTP.
- Ribozymes were synthesized by standard methods from ribonucleotides with 2'-hydroxyl groups protected by Fpmp (1 l- (2-fluorophenyl) -4-methoxy-piperidin-l-yl) and purified by HPLC. They were deprotected before use.
- the target RNA was incubated with ribozyme 1, 2, 3 or 4 or without ribozyme (/) for 60 and 180 min and the reaction products were separated electrophoretically in the polyacrylamide gel.
- the gel was evaluated in the phosphoimager and shows cleavage of the target RNA at the designated sites by the ribozymes 3 and 4 with high efficiency and low effectiveness of the ribozymes 1 and 2 (FIG
- telomere inhibition by stable transfection and expression of ribozyme 4 in HBL100, an immortal mammary epithelial cell line with high telomerase activity, and in MCF-7, a breast tumor cell line.
- a ribozyme imitated in the catalytic center has no effect.
- Both strands of the cDNA coding for the ribozyme R4 (4th ribozyme in the list) and for the ribozyme mutR4 mutated in the catalytic center were synthesized as oligodeoxyribonucleotides by standard methods. They were cloned into the expression vector (plasmid) pCDNA3.1 and stably expressed in MCF-7 (FIG. 2a) or HBL-100 cells (FIG. 2b). The telomerase activity in the numbered clones was measured using a semiquantitative TRAP assay (Telomerase Repeat Amplification Protocol).
- the intensity of the conductor pattern in the respective track in relation to the intensity of the control band is a measure of the activity of the telomerase.
- Example 4 Detection of telomere shortening in clones with inhibited telomerase
- the telomere length in the cell lines MCF-7 (FIG. 3A) and HBL-100 (FIG. 3B) was measured in the Southern blot and quantified as described (Petersen, S., Saretzki, G., by Zglinicki, T. Exp. Cell Res. 1998, 239: 152-160). The number of clones n examined and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated.
- telomere length in mutR4-transfected clones does not differ significantly from that in parental cells.
- the telomere length in the clones with clearly inhibited telomerase is, however, significantly shorter.
- Net proliferation rates were determined by cell counting in each passage. The number of examined clones n and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated. In clones with a telomerase activity below 25% of the starting cells, cell growth is inhibited (FIG. 4A). Evidence of an altered morphology in telomerase-incorporated MCF-7 clones. The morphology of living cells was checked in the phase contrast reversal microscope. Clones stably transfected with mutR4 (left) show normal, rapid growth and the same morphology as parental cells.
- Clones with telomerase inhibited by R4 show restricted growth and for the most part, especially on the periphery of the resulting, comparatively small colonies, cells with characteristic senescent morphology (same magnification left and right) (FIG. 4B).
- R4 was cloned into a retroviral expression vector (pBabe) and recombinant viruses were generated according to the standard procedure. 10 MCF-7 cells were infected either with the unmodified vector (left) or with R4-pBabe (right). The mass cultures are shown 2 weeks after infection. Infection with R4-pBabe reduces telomerase activity and blocks growth in the culture. Numerous cells die and detach from the culture dish. The few over- living cells show a senescent phenotype (same magnification left and right) ( Figure 4C).
- Example 6 Detection of a sensitivity of clones with inhibited telomerase to doxorubicin increased by a factor of 2-3
- HBL-100 cells were transfected with R4 or mutR4. Telomerase activity was measured using a TRAP assay. The clones were treated with doxorubicin in concentrations between 10 and 1000 ng / ml for three days and then cell survival was measured with an XTT assay. The doxorubicin concentration resulting in a 50% reduced XTT signal (colorimetric signal) (LD50) was calculated. The number of clones n examined and the respective telomerase activity (in% of the activity in parental / mutR4-transfected cells, X axis) is indicated. Clones with a telomerase activity ⁇ 25% of the starting cells have an LD50 reduced by a factor of 2 (FIG. 5A). Determination of the LD50 for doxorubicin in MCF-7 clones (see above). Clones with a telomerase activity below 25% are three to four times more sensitive to doxorubicin ( Figure 5B).
- the sensitivity to the specified cytostatics was measured as LD50 using the XTT assay.
- the ratio of the LD50 of the telomerase-positive to the telomerase-negative clones is given.
- MutR4-transfected vs. R4-transfected HBL-100 and MCF-7 clones and hTERT-expressing vs parental BJ fibroblasts Bodnar, AG, Oulette, M., Frolkis, M., Holt, SE, Chiu, CP Morin, GB, Harley, CB, Shay, JW, Lichtsteiner, S., Wright, W. Science 1998, 279: 349-352).
- telomeres with reduced telomerase activity are more sensitive than the isogenic clones with active telomerase to all investigated topoisomerase inhibitors (mitoxantrone, etoposide and doxorubicin - Römpp Chemie Lexikon 1995), but not to the cytostatic agents cis-platinum and bleomycin or the alkylating agent N-methyl -N'-nitro-N-nitrosoguanidine (MN G) or oxidative exposure using hydrogen peroxide (H 2 O9) ( Figure 6).
Abstract
Description
Claims
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2000594909A JP2002536967A (en) | 1999-01-22 | 2000-01-21 | Ribozymes targeting the catalytic subunit of human telomerase (hTERT) |
EP00910502A EP1149161A2 (en) | 1999-01-22 | 2000-01-21 | Ribozymes directed against the catalytic subunit of the human telomerase (htert) |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19903961 | 1999-01-22 | ||
DE19903961.5 | 1999-01-22 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2000043501A2 true WO2000043501A2 (en) | 2000-07-27 |
WO2000043501A3 WO2000043501A3 (en) | 2000-11-16 |
Family
ID=7896056
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/DE2000/000227 WO2000043501A2 (en) | 1999-01-22 | 2000-01-21 | Ribozymes directed against the catalytic subunit of the human telomerase (htert) |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1149161A2 (en) |
JP (1) | JP2002536967A (en) |
DE (1) | DE10003356A1 (en) |
WO (1) | WO2000043501A2 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1330759C (en) * | 2004-08-24 | 2007-08-08 | 四川大学 | Nucleusase gene hTERT-5'R2 cDNA of inhibiting endgranulase activity and its recombined carrier and nucleusase |
WO2010018731A2 (en) * | 2008-08-12 | 2010-02-18 | Japan Health Sciences Foundation | A mammalian rna dependent rna polymerase |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5656638A (en) * | 1995-04-18 | 1997-08-12 | Geron Corporation | Telomerase inhibitors |
EP0841396A1 (en) * | 1996-10-01 | 1998-05-13 | Geron Corporation | Human telomerase catalytic subunit |
-
2000
- 2000-01-21 EP EP00910502A patent/EP1149161A2/en not_active Withdrawn
- 2000-01-21 WO PCT/DE2000/000227 patent/WO2000043501A2/en not_active Application Discontinuation
- 2000-01-21 JP JP2000594909A patent/JP2002536967A/en active Pending
- 2000-01-21 DE DE10003356A patent/DE10003356A1/en not_active Withdrawn
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5656638A (en) * | 1995-04-18 | 1997-08-12 | Geron Corporation | Telomerase inhibitors |
EP0841396A1 (en) * | 1996-10-01 | 1998-05-13 | Geron Corporation | Human telomerase catalytic subunit |
Non-Patent Citations (4)
Title |
---|
KONDO YASUKO ET AL: "Inhibition of telomerase increases the susceptibility of human malignant glioblastoma cells to cisplatin-induced apoptosis." ONCOGENE, Bd. 16, Nr. 17, 30. April 1998 (1998-04-30), Seiten 2243-2248, XP000864718 ISSN: 0950-9232 * |
WAN MARGARET S K ET AL: "Synthetic 2'-O-methyl-modified hammerhead ribozymes targeted to RNA component of telomerase as sequence-specific inhibitors of telomerase activity." ANTISENSE & NUCLEIC ACID DRUG DEVELOPMENT, Bd. 8, Nr. 4, August 1998 (1998-08), Seiten 309-317, XP000907692 ISSN: 1087-2906 * |
YOKOYAMA Y ET AL: "Application of hammerhead ribozyme targeting telomerase molecule for cancer therapy." NIPPON RINSHO. JAPANESE JOURNAL OF CLINICAL MEDICINE, (1998 MAY) 56 (5) 1126-30. REF: 19 , XP000864684 * |
YOKOYAMA YASUHIRO ET AL: "Attenuation of telomerase activity by a hammerhead ribozyme targeting the template region of telomerase RNA in endometrial carcinoma cells." CANCER RESEARCH, Bd. 58, Nr. 23, 1. Dezember 1998 (1998-12-01), Seiten 5406-5410, XP000915164 ISSN: 0008-5472 in der Anmeldung erw{hnt * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1330759C (en) * | 2004-08-24 | 2007-08-08 | 四川大学 | Nucleusase gene hTERT-5'R2 cDNA of inhibiting endgranulase activity and its recombined carrier and nucleusase |
WO2010018731A2 (en) * | 2008-08-12 | 2010-02-18 | Japan Health Sciences Foundation | A mammalian rna dependent rna polymerase |
WO2010018731A3 (en) * | 2008-08-12 | 2010-07-15 | Japan Health Sciences Foundation | A mammalian rna dependent rna polymerase |
Also Published As
Publication number | Publication date |
---|---|
DE10003356A1 (en) | 2000-07-27 |
JP2002536967A (en) | 2002-11-05 |
EP1149161A2 (en) | 2001-10-31 |
WO2000043501A3 (en) | 2000-11-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
DE3852539T3 (en) | Ribozymes. | |
EP1798285B1 (en) | Methods and medicament for inhibition the expression of a defined gene | |
US5589580A (en) | Ribozymes | |
US5543508A (en) | Ribozymes | |
DE69933653T2 (en) | To inhibit the expression of the CCR5 receptor capable of ribozymes | |
US6001989A (en) | Nucleotide based endonucleases | |
EP0918853A2 (en) | Antisense rna with a secondary structure | |
EP0711835A1 (en) | Selection and expression of heterologous proteins using a selection-amplification-system | |
WO2003062432A1 (en) | Method for increasing the efficiency of an inhibitor of tyrosine kinase activity | |
DE69921609T2 (en) | RIBOZYMALE NUCLEIC ACID CUT THE CCR5 OR CXCR4 | |
DE10230996A1 (en) | Method for inhibiting viral replication, useful particularly for treating hepatitis C infection, by altering the 3'-untranslated region of the virus | |
WO2000043501A2 (en) | Ribozymes directed against the catalytic subunit of the human telomerase (htert) | |
DE69432444T2 (en) | Promoter sequence of the p55 receptor for tumor necrosis factor | |
DE69930862T2 (en) | EXPRESSION SYSTEMS FOR THE FUNCTIONAL EXPRESSION OF NUCLEIC ACIDS | |
DE69933382T2 (en) | PREPARATION OF SSDNA INSIDE THE CELL | |
DE19731609C2 (en) | Cholesteryl ester transfer protein (CETP) mRNA as a target molecule in the therapy of atherosclerosis | |
DE60023921T2 (en) | GAS1 POLYPEPTIDES |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 594909 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09890024 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000910502 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2000910502 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000910502 Country of ref document: EP |