WO2000042208A1 - Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use - Google Patents

Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use Download PDF

Info

Publication number
WO2000042208A1
WO2000042208A1 PCT/EP2000/000265 EP0000265W WO0042208A1 WO 2000042208 A1 WO2000042208 A1 WO 2000042208A1 EP 0000265 W EP0000265 W EP 0000265W WO 0042208 A1 WO0042208 A1 WO 0042208A1
Authority
WO
WIPO (PCT)
Prior art keywords
adenovirus
fiber
protein
tpl
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2000/000265
Other languages
English (en)
French (fr)
Other versions
WO2000042208A8 (en
Inventor
Glen Robert Nemerow
Daniel J. Von Seggern
Paul L. Hallenbeck
Susan C. Stevenson
Yelena Skripchenko
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Pharma GmbH Austria
Novartis AG
Scripps Research Institute
Original Assignee
Novartis Erfindungen Verwaltungs GmbH
Novartis AG
Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Erfindungen Verwaltungs GmbH, Novartis AG, Scripps Research Institute filed Critical Novartis Erfindungen Verwaltungs GmbH
Priority to AU24372/00A priority Critical patent/AU772630B2/en
Priority to IL14406000A priority patent/IL144060A0/xx
Priority to JP2000593765A priority patent/JP2002534130A/ja
Priority to CA002359795A priority patent/CA2359795A1/en
Priority to EP00902591A priority patent/EP1141357A1/en
Priority to KR1020027012687A priority patent/KR100688631B1/ko
Publication of WO2000042208A1 publication Critical patent/WO2000042208A1/en
Anticipated expiration legal-status Critical
Publication of WO2000042208A8 publication Critical patent/WO2000042208A8/en
Priority to AU2004201067A priority patent/AU2004201067A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C03GLASS; MINERAL OR SLAG WOOL
    • C03BMANUFACTURE, SHAPING, OR SUPPLEMENTARY PROCESSES
    • C03B37/00Manufacture or treatment of flakes, fibres, or filaments from softened glass, minerals, or slags
    • C03B37/01Manufacture of glass fibres or filaments
    • C03B37/012Manufacture of preforms for drawing fibres or filaments
    • C03B37/014Manufacture of preforms for drawing fibres or filaments made entirely or partially by chemical means, e.g. vapour phase deposition of bulk porous glass either by outside vapour deposition [OVD], or by outside vapour phase oxidation [OVPO] or by vapour axial deposition [VAD]
    • C03B37/018Manufacture of preforms for drawing fibres or filaments made entirely or partially by chemical means, e.g. vapour phase deposition of bulk porous glass either by outside vapour deposition [OVD], or by outside vapour phase oxidation [OVPO] or by vapour axial deposition [VAD] by glass deposition on a glass substrate, e.g. by inside-, modified-, plasma-, or plasma modified- chemical vapour deposition [ICVD, MCVD, PCVD, PMCVD], i.e. by thin layer coating on the inside or outside of a glass tube or on a glass rod
    • CCHEMISTRY; METALLURGY
    • C03GLASS; MINERAL OR SLAG WOOL
    • C03BMANUFACTURE, SHAPING, OR SUPPLEMENTARY PROCESSES
    • C03B37/00Manufacture or treatment of flakes, fibres, or filaments from softened glass, minerals, or slags
    • C03B37/01Manufacture of glass fibres or filaments
    • C03B37/012Manufacture of preforms for drawing fibres or filaments
    • C03B37/014Manufacture of preforms for drawing fibres or filaments made entirely or partially by chemical means, e.g. vapour phase deposition of bulk porous glass either by outside vapour deposition [OVD], or by outside vapour phase oxidation [OVPO] or by vapour axial deposition [VAD]
    • C03B37/018Manufacture of preforms for drawing fibres or filaments made entirely or partially by chemical means, e.g. vapour phase deposition of bulk porous glass either by outside vapour deposition [OVD], or by outside vapour phase oxidation [OVPO] or by vapour axial deposition [VAD] by glass deposition on a glass substrate, e.g. by inside-, modified-, plasma-, or plasma modified- chemical vapour deposition [ICVD, MCVD, PCVD, PMCVD], i.e. by thin layer coating on the inside or outside of a glass tube or on a glass rod
    • C03B37/01807Reactant delivery systems, e.g. reactant deposition burners
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C03GLASS; MINERAL OR SLAG WOOL
    • C03BMANUFACTURE, SHAPING, OR SUPPLEMENTARY PROCESSES
    • C03B37/00Manufacture or treatment of flakes, fibres, or filaments from softened glass, minerals, or slags
    • C03B37/01Manufacture of glass fibres or filaments
    • C03B37/012Manufacture of preforms for drawing fibres or filaments
    • C03B37/014Manufacture of preforms for drawing fibres or filaments made entirely or partially by chemical means, e.g. vapour phase deposition of bulk porous glass either by outside vapour deposition [OVD], or by outside vapour phase oxidation [OVPO] or by vapour axial deposition [VAD]
    • C03B37/018Manufacture of preforms for drawing fibres or filaments made entirely or partially by chemical means, e.g. vapour phase deposition of bulk porous glass either by outside vapour deposition [OVD], or by outside vapour phase oxidation [OVPO] or by vapour axial deposition [VAD] by glass deposition on a glass substrate, e.g. by inside-, modified-, plasma-, or plasma modified- chemical vapour deposition [ICVD, MCVD, PCVD, PMCVD], i.e. by thin layer coating on the inside or outside of a glass tube or on a glass rod
    • C03B37/01884Means for supporting, rotating and translating tubes or rods being formed, e.g. lathes
    • C03B37/01892Deposition substrates, e.g. tubes, mandrels
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C03GLASS; MINERAL OR SLAG WOOL
    • C03BMANUFACTURE, SHAPING, OR SUPPLEMENTARY PROCESSES
    • C03B2203/00Fibre product details, e.g. structure, shape
    • C03B2203/10Internal structure or shape details
    • C03B2203/22Radial profile of refractive index, composition or softening point
    • CCHEMISTRY; METALLURGY
    • C03GLASS; MINERAL OR SLAG WOOL
    • C03BMANUFACTURE, SHAPING, OR SUPPLEMENTARY PROCESSES
    • C03B2203/00Fibre product details, e.g. structure, shape
    • C03B2203/10Internal structure or shape details
    • C03B2203/22Radial profile of refractive index, composition or softening point
    • C03B2203/26Parabolic or graded index [GRIN] core profile
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10345Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10351Methods of production or purification of viral material
    • C12N2710/10352Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/108Plasmid DNA episomal vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/30Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C12N2810/6009Vectors comprising as targeting moiety peptide derived from defined protein from viruses dsDNA viruses
    • C12N2810/6018Adenoviridae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE

Definitions

  • Adenovirus Vectors Packaging Cell Lines, Compositions, and Methods for telomeres
  • the present invention relates to gene therapy, especially to adenovirus-based gene therapy.
  • novel packaging cell lines are disclosed, for use in facilitating the development of high-capacity and targeted vectors.
  • High-capacity adenovirus vectors are also disclosed herein, as are related compositions, kits, and methods of preparation and use of the disclosed vectors, cell lines and kits.
  • adenovirus a human DNA virus which readily infects epithelial cells (Horwitz, "Adenoviridae and Their Replication", in Virology, Fields and Knipe, eds., Raven Press, NY (1990) pp. 1679-1740).
  • This invention utilizes recombinant adenovirus constructs which duplicate the cell receptor binding and DNA delivery properties of intact adenovirus virions and thus represents an improved method for gene therapy and cell targeting as well as for antisense-based antiviral therapy.
  • the use of recombinant adenovirus-de ved vectors according to one aspect of the present invention provides certain advantages for gene delivery.
  • the Ad-derived vectors of the present invention possess all of the functional properties required for gene therapy including binding to epithelial cell receptors and penetration of endocytic vesicles.
  • Therapeutic viral vectors of the present invention may also be engineered to target the receptors of and achieve penetration of non-epithelial cells; means of engineering viral vectors to accomplish these ends are described in detail herein below.
  • the vectors of the present invention have deletions of substantial portions of the Ad genome, which not only limits the ability of the Ad-derived vectors to "spread” to other host cells or tissues, but allows significant amounts of "foreign” (or non-native) nucleic acids to be incorporated into the viral genome without interfering with the reproduction and packaging of the viral genome. Therefore, the vectors of the present invention are ideal for use in a wide variety of therapeutic applications.
  • an adenovirus from a group with less homology to the group C viruses may be used to engineer recombinant viruses with little propensity for recombination with the Ad5 sequence contained in the packaging lines.
  • the invention describes the preparation of packaging cells lines which stably expresses adenovirus proteins or polypeptides. These cell lines are useful for complementing viral vectors bearing deletions of regulatory and/or structural genes, irrespective of the serotype from which such a vector was derived.
  • constructs and methods of the present invention will support the design and engineering of chimeric viral vectors which express amino acid residue sequences derived from two or more Ad serotypes.
  • this invention allows the greatest possible flexibility in the design and preparation of useful viral vectors and cell lines which support their construction and propagation ⁇ all with a decreased risk of recombining with wild-type Ad to produce potentially-harmful recombinants.
  • the present invention discloses a simpler, alternative means of reducing the recombination between viral and cellular sequences than those discussed in the art.
  • One such means is to increase the size of the deletion in the recombinant virus and thereby reduce the extent of shared sequences between that virus and any Ad genes present in a packaging cell line e.g., the Ad5 genes in 293 cells, or the various Ad genes in the novel cell lines of the present invention.
  • this invention discloses the preparation, propagation and use of recombinant Ad-derived vectors having deletions of all or part of various gene sequences encoding Ad structural proteins, both as a way of reducing the risk of wild-type adenovirus contamination in virus preparations, as a way of allowing foreign DNA to be packaged in such vectors for a variety of diagnostic and therapeutic applications and as a way of targeting an adenovirus vector to a specific cell type.
  • the invention further discloses a wide variety of nucleic acid sequences and viral vectors.
  • the invention discloses a nucleic acid sequence encoding any one of the adenovirus fiber proteins mentioned in the specification, polypeptides or fragments thereof -- including, without limitation, those that include deletions or other mutations; those that are chimeric; and those that have linkers, foreign amino acid residues, or other molecules attached for various purposes as disclosed herein.
  • Nucleic acid sequences encoding various other adenovirus structural and/or regulatory proteins or polypeptides are also within the scope of the present invention.
  • the adenovirus is a Group C adenovirus selected from serotypes 1 , 2, 5 or 6; while in other embodiments, adenovirus selected from other serotypes, such as for example Ad37 (subgroup D) are useful as disclosed herein.
  • the invention is also directed to an isolated nucleic acid molecule comprising an adenovirus tripartite leader (TPL) nucleotide sequence, said TPL nucleotide sequence comprising (a) first and second different TPL exons or (b) first, second and third same or different TPL exons, said TPL exons selected from the group consisting of complete TPL exon 1 , partial TPL exon 1 , complete TPL exon 2 and complete TPL exon 3, wherein said isolated nucleic acid molecule may not comprise the nucleic acid sequence consisting of partial TPL exon 1 , complete TPL exon 2 and complete TPL exon 3.
  • TPL adenovirus tripartite leader
  • a preferable embodiment of the invention may further comprise an intron operatively linked to the TPL, wherein said intron also contains requisite processing signals for the intron's removal.
  • Another preferable embodiment of the invention is directed to the isolated nucleic acid molecule wherein said TPL nucleotide sequence consists essentially of complete TPL exon 1 operatively linked to complete TPL exon 2 operatively linked to complete TPL exon 3.
  • a related embodiment may further include an intron and appropriate processing signals. Additional embodiments of the invention are directed to nucleic acid molecules contained in plasmids selected from the group; consisting of pCLF, pDV60, pDV67, pDV69, pDV80 and PDV90.
  • Packaging cell lines and adenovirus particles containing the nucleic acids described above are also included in the invention.
  • the invention is further directed to methods for producing an adenovirus vector particle containing a helper-independent fiberless recombinant adenovirus vector genome comprising providing a) a packaging cell line which complements replication and packaging of said genome and b) a helper-independent fiberless recombinant adenovirus vector genome which is deficient in expressing sufficient functional fiber protein to support assembly of fiber-containing particles.
  • the genome is introduced into the cell line. Additional embodiments of the invention may also include the following steps; a) growing the cell line produced under conditions for producing particles; and/or b) harvesting an adenovirus vector particle containing said helper-independent fiberless recombinant adenovirus vector genome.
  • the method may also include a cell line that expresses a fiber protein and complements a fiber mutation in the vector.
  • the invention is also directed to an adenovirus vector packaging cell line comprising a stably integrated nucleic acid molecule as described above, an operatively-linked promoter and a nucleic acid sequence which encodes an adenovirus structural protein, wherein said TPL sequence consists essentially of a first TPL exon operatively linked to a complete second TPL exon operatively linked to a complete third TPL exon, wherein said packaging cell comprises an isolated nucleic acid molecule comprising an adenovirus tripartite leader (TPL) nucleotide, said TPL nucleotide sequence comprising (a) first and second different TPL exons or (b) first, second and third different TPL exons, said TPL exons selected from the group consisting of complete TPL exon 1 , partial TPL exon 1 , complete TPL exon 2 and complete TPL exon 3 and, wherein said isolated nucleic acid molecule may not comprise the nucleic acid sequence consisting of partial TPL exon
  • the invention is further directed to a recombinant adenovirus particle comprising a recombinant adenovirus vector genome wherein said genome:(a) does not encode or does not express sufficient adenovirus fiber protein to support packaging of a fiber-containing adenovirus particle without complementation of said fiber gene, and (b) encodes an adenovirus packaging signal and inverted terminal repeats containing adenovirus origin of replication.
  • the invention is also directed to a helper-independent fiberless recombinant adenovirus vector genome comprising genes which (a) encode all adenovirus structural gene products but do not express sufficient adenovirus fiber protein to package a fiber-containing adenovirus particle without complementation of said fiber gene or said genome lacks at least the fibre gene and (b) encodes an exogenous protein.
  • Either of the above embodiments may substitute a helper-dependent for a helper-independent recombinant adenovirus vector genome.
  • no fiber protein is expressed.
  • the recombinant adenovirus particle fails to express sufficient fiber protein to allow fiber incorporation into the particle such that the particle can use the fiber pathway for infection.
  • the invention is further directed to a method for producing an adenovirus vector particle containing a helper-independent fiberless recombinant adenovirus vector genome, said method comprising providing a packaging cell line which complements replication and packaging of said genome and a helper-independent fiberless recombinant adenovirus vector genome which is deficient in expressing sufficient functional fiber protein to support assembly of fiber-containing particles, wherein said packaging cell comprises an isolated nucleic acid molecule comprising an adenovirus tripartite leader (TPL) nucleotide, said TPL nucleotide sequence comprising (a) first and second different TPL exons or (b) first, second and third different TPL exons, said TPL exons selected from the group consisting of complete TPL exon 1 , partial TPL exon 1 , complete TPL exon 2 and complete TPL exon 3 and, wherein said isolated nucleic acid molecule may not comprise the nucleic acid sequence consisting of partial TPL exon 1 ,
  • the adenovirus particle further comprises an exogenous protein or a modified fiber protein.
  • the method may also comprise a step of coating a particle (i.e. providing fiber protein in any way) with an adenovirus fiber protein.
  • Another aspect of the invention is directed to a method for pseudotyping recombinant viral vectors comprising complementing a missing fiber gene of a helper-independent fiberless recombinant adenovirus vector genome by expressing in packaging cells a fiber gene from a different adenoviral serotype than said recombinant adenovirus vector, thereby pseudotyping said vector.
  • An additional embodiment of the invention is directed to the method for pseudotyping recombinant viral vectors comprising: a) providing a packaging cell line for propagating a fiber gene deleted recombinant adenovirus vector, b) introducing into said cell line a helper-independent fiberless recombinant adenovirus vector genome, and c) complementing the missing fiber gene by expression in the cells of a fiber gene from a different adenoviral serotype thereby pseudotyping the vector.
  • the invention is further directed to a method for specifically targeting an adenovirus vector to a cell of choice comprising introducing a helper-independent or helper-dependent fiberless recombinant adenovirus vector genome into a packaging cell line for producing a fiber gene-deleted adenovirus vector and providing, wherein said gene for a missing fiber protein is complemented with a gene for a desired modification for targeting the vector to a cell of choice
  • the invention is further directed to a method for producing a modified adenovirus comprising providing in vitro an exogenous fiber protein to a fiberless adenovirus. Additional embodiments of the invention may provide any combination of all of the following steps such that the invention be directed to a method for producing a modified adenovirus comprising: a) providing a packaging cell line for producing a fiberless adenovirus vector, b) introducing into said cell line a helper- independent fiberless or helper-dependent fiberless recombinant adenovirus vector genome, c) growing and harvesting a fiberless adenovirus, d) maintaining the fiberless adenovirus in any suitable buffer, and e) providing exogenous fiber, wherein said fiber may be a modified fiber, to the fiberless adenovirus by adding conditioned media or a soluble fiber preparation or a fiber in any suitable buffer to a virus preparation thereby producing the modified adenovirus.
  • the invention is further directed to a method for producing a modified adenovirus comprising providing a packaging cell line for producing a helper- dependent fiberless adenovirus vector genome and providing a helper virus vector, wherein said cell line complements at least a deficient fiber protein gene, thereby producing the modified adenovirus.
  • Another aspect of the invention is directed to a method for producing a modified adenovirus comprising: a) providing a packaging cell line for producing a fiberless adenovirus vector, b) introducing into said cell line a helper dependent fiberless recombinant adenovirus vector genome and a fiberless helper virus vector, c) growing and harvesting a fiberless adenovirus, and d)maintaining the fiberless adenovirus in infectious media, and e) providing exogenous fiber to the fiberless adenovirus by adding conditioned media or a soluble fiber preparation to a virus preparation thereby producing the modified adenovirus.
  • Additional aspects of the invention are directed to hybrid Ad/AAV vectors and to new helper-dependent vectors used with fiberless adenovirus vectors.
  • the invention is also directed to a method for delivering a heterologous gene to an EBV-infected B cells comprising infecting said B cells with a pseudotyped Ad ⁇ gal. ⁇ F particle or other fiber-deleted adenovirus particle, said particle having a chimeric fiber with the receptor-binding knob domain of the adenovirus type 3 fiber.
  • the invention is also directed to an isolated nucleic acid comprising a post- transcriptional regulatory element (PRE) and a TPL.
  • PRE post- transcriptional regulatory element
  • TPL tissue hepatitis virus PRE
  • WPRE woodchuck hepatitis virus PRE
  • the invention is further directed to a composition for preparing a therapeutic vector, said composition comprising a plasmid comprising an adenovirus genome lacking a nucleotide sequence encoding a fiber protein or a genome that is incapable of expressing sufficient fiber to result in packaging.
  • Another aspect of the invention is directed to a method of delivering a heterologous gene to a human or any animal comprising providing an exogenous gene to a target cell comprising contacting said cell in vivo or ex vivo with an amount of a recombinant adenovirus particle sufficient to infect said cell.
  • the invention is also directed to A method for producing a gutless adenoviral vector particle comprising: a) delivering a helper adenovirus vector genome to an adenovirus vector packaging cell, wherein said helper adenovirus vector genome lacks any gene encoding adenovirus fiber protein or lacks the ability to encode sufficient adenovirus fiber protein to produce an adenoviral vector comprising fiber protein in the absence of complemetation by said packing cell and wherein said packaging cell comprises the nucleic acid molecule of claim 2 operably linked to a promoter and to an adenoviral fiber protein or to a chimeric protein that includes an adenovirus fiber protein tail domain; (b) delivering a gutless adenovirus vector genome to said packaging cell; and (c) recovering the gutless adenoviral vector particle produced by said cell.
  • helper adenovirus particle comprising an adenovirus vector genome that does not encode or does not express sufficient adenovirus fiber protein to support packaging of a fiber- containing adenovirus particle without complementation of said fiber gene, wherein said genome has a mutation in its packaging sequence that renders said genome substantially incapable of being packaged.
  • Packaging sequence are those sequences are those sequences involved in packaging the viral particle.
  • the invention is further directed to a helper adenovirus particle comprising an adenovirus vector genome with recombinase sites flanking its packaging sequence, wherein said vector genome does not encode or does not express sufficient adenovirus fiber protein to support packaging of a fiber-containing adenovirus particle without complementation of said fiber gene.
  • the invention is also directed to an adenovirus particle comprising a gutless adenoviral vector genome and a fiberless capsid, as well as an adenovirus particle comprising a gutless adenoviral vector genome and a capsid comprising a modified fiber protein.
  • Another aspect of the invention is directed to a packaging cell for the production of a fiberless or fiber-modified gutless adenovirus particle comprising an adenovirus vector complementing plasmid and a nucleotide sequence encoding a recombinase, wherein said complementing plasmid comprises the nucleic acid molecule of claim 2 operably linked to a promoter and to a nucleotide sequence encoding an adenoviral fiber protein or a chimeric adenoviral fiber protein.
  • the cell line may comprise a recombinase.
  • the recombinase may be Cre.
  • the fiber-deleted adenovirus vectors of the invention and the fiber-complementing adenovirus packaging cells of the invention are used to produce a gutless adenovirus vector particle.
  • a gutless adenoviral vector genome in an adenoviral capsid.
  • the fiber proteins of the capsid may be wild-type fiber, or the modified fiber proteins disclosed herein.
  • such particle may have a fiberless capsid as disclosed herein.
  • the gutless genome contains at least one heterologous gene as described herein.
  • the term "gutless adenoviral vector genome” means an adenoviral vector genome from which all of the viral genes have been deleted..
  • the invention also discloses systems or kits for use in any of the aforementioned methods.
  • the systems or kits may contain any appropriate combination of the within-described vectors, plasmids, cell lines, virus particles and additional therapeutic agents as disclosed.
  • each such kit or system includes a quantity of the appropriate therapeutic substance or sequence sufficient for at least one administration, and instructions for administration and use.
  • one system further comprises an effective amount of a therapeutic agent which enhances the therapeutic effect of the therapeutic viral vector-containing composition.
  • the composition and the therapeutic agent are each included in a separate receptacle or container.
  • FIG. 1 is a schematic diagram of the entire adenoviral E4 transcriptional unit with the open reading frames (ORF) indicated by blocked segments along with the promoter and terminator sequences. The location of primers for amplifying specific portions of E4 are also indicated as further described in Example 1A.
  • ORF open reading frames
  • Figure 2 is a schematic map of plasmid pE4/Hygro as further described in Example 1B.
  • Figure 3 is a schematic map of plasmid pCDNA3/Fiber as further described in Example 1 B.
  • Figure 4 is a schematic map of plasmid pCLF as further described in Example 1B.
  • Figure 5 is a photograph of a Southern blot showing the presence of intact adenovirus E4 3.1 kilobase (kb) insert in the 211 cell line as further described in Example 1C.
  • Figure 6 is an autoradiograph showing labeled fiber protein immunoprecipitated from cells and electrophoresed under native and denaturing electrophoresis conditions as described in Example 1C.
  • the 293 cells lack fiber while the sublines 211A, 211 B and 211 R contain fiber protein detectable in functional trimerized form and denatured monomeric form.
  • Figure 7 is a schematic map of plasmid pDEX/E1 as further described in Example 1 D.
  • Figure 8 is a schematic map of plasmid pEI/Fiber as further described in Example 1 F1.
  • Figure 9 is a schematic map of plasmid pE4/Fiber as further described in Example 1 F2).
  • Figure 10 is a schematic illustration of linearized pD E1 Bb gal delivery plasmids for use in cotransfection and recombination to form a recombinant adenoviral vector having multiple adenoviral gene deletions.
  • the plasmids and recombination event are more fully described in Example 2A.
  • Figure 11 is a schematic of plasmid p11.3 as further described in Example 2A used in the construction of pDV44 delivery plasmid.
  • Figure 12 is a schematic of plasmid 8.2.
  • Figure 13 shows the thmeric structure of the recombinant fiber. 293, 211 A, 211 B, or 211 R cells as indicated were metabolically labeled with [ 35 S]methionine, soluble protein extracts prepared, and fiber was immunoprecipitated. A portion of the precipitated protein was electrophoresed on an 8% SDS-PAGE gel under either semi-native or denaturing conditions. The positions of trimeric (T) and monomeric (M) fiber are indicated. As a control for electrophoretic conditions, recombinant Ad2 fiber produced in baculovirus-infected cells was run under identical conditions and stained with Coomassie blue.
  • Figure 14 shows the complementation of a fiber mutant adenovirus by fiber-producing cells.
  • the cell lines indicated (2x10 6 cells per sample) were infected with the temperature-sensitive fiber mutant adenovirus H5te142 at 10 PFU/cell and incubated at either the permissive (32.5°C, stippled bars) or the restrictive (39.5°C, solid bars) temperature. 48 hours post- infection, virus was isolated by freeze-thaw lysis and yields determined by fluorescent focus assay on SW480 cells. Each value represents the mean of duplicate samples, and the data shown is representative of multiple experiments.
  • Figure 15 shows the incorporation of the recombinant Ad5 fiber into Ad3 particles.
  • Figure 15A the alignment of the N-terminal (penton base-binding) domains of fiber proteins from several different adenovirus serotypes is shown. From top to bottom, the five different serotypes are listed as SEQ ID NOs 21-25.
  • Figure 15B type 3 adenovirus was propagated in 293, 211 B, or 211 R cells as indicated and purified by two sequential CsCI centrifugations. 10 ⁇ g of the purified viral particles was then electrophoresed under denaturing conditions and transferred to a PVDF membrane.
  • Ad5 fiber was detected with a polyclonal rabbit antibody raised against recombinant Ad2 fiber. As a positive control for detection, 400 ng of wild-type Ad2 was run in the lane marked "Ad2". Under these conditions, the mobilities of the Ad2 and Ad5 fibers are indistinguishable and the antibody reacts with both proteins.
  • Figure 16 shows the fiber deletion in pDV44 and the genomic structures of the Ad ⁇ . ⁇ gal. ⁇ F and Ad ⁇ . ⁇ gal.wt vectors:
  • Figure 16A shows pDV44 that was constructed by removing the fiber gene and residual E3 sequences (nt 30819:32743 of AD5) from pBHG10.
  • Figures 16B shows viruses constructed by cotransfection of either pBHG10 or pDV44 with p ⁇ EI B ⁇ gal. Both are E1/E3 deleted Ad5 vectors, and Ad ⁇ . ⁇ gal. ⁇ F has the additional fiber (L5) deletion as in pDV44.
  • Figure 17 shows the analysis of the viral chromosomes.
  • Figure 17A shows the predicted EcoRI restriction maps of Ad ⁇ . ⁇ gal.wt and Ad ⁇ . ⁇ gal. ⁇ F.
  • FIG. 17B shows an ethidium bromide-stained gel of EcoRI-digested viral DNA.
  • Figure 17C shows a Southern blot of the gel as described in Example 2 probed either with labeled fiber or E4 sequences.
  • Figure 18 shows the analysis of vertex proteins in the viral particles.
  • 293 (non-fiber expressing) or 211B (fiber-expressing) cells were infected with Ad ⁇ . ⁇ gal.wt ('wt') or with Ad5. ⁇ gal. ⁇ F(' ⁇ F') and the resulting viral particles were purified on CsCI gradients. 10 ⁇ g of purified virions was then electrophoresed on 5-16% gradient gels and Western blotted. Proteins were detected with polyclonal anti-fiber or anti-penton base antibodies.
  • Figure 19 shows the infectivity of Ad particles on THP-1 monocytic cells.
  • Figure 19A shows THP-1 cells that were infected with Ad ⁇ . ⁇ gal.wt or with fiberless Ad ⁇ . ⁇ gal. ⁇ F at 100,000 particles/cell. Forty-eight hours after infection, cells were fixed and stained with X-gal and the fraction of infected cells was determined by light microscopy.
  • Figure 19B shows cells that were infected with 1000 particles per cell of Ad ⁇ . ⁇ gal.wt or with 100,000 particles/cell of Ad ⁇ . ⁇ gal. ⁇ F. As indicated, cells were pretreated with 100 ⁇ g/ml of recombinant penton base or with 20 ⁇ g/ml of recombinant Ad2 fiber.
  • Figure 20 shows a schematic of improved fiber-complementing cell lines, 633 and 644 as further described in the Examples.
  • Figures 21 and 22 illustrates pseudotyping of fiberless particles with fiber proteins and infectivity data as further described in the Examples.
  • Figure 23 shows the Clal to Bglll fragment of Ad ⁇ .
  • Figure 24 shows the plasmid pGRE ⁇ -2/EBV
  • Figure 2 ⁇ shows the plasmid pGRE ⁇ -E1.
  • Figure 26 shows the plasmid pSE280-E2 BamHI-Smal.
  • FIG. 27 The fiber-deleted adenovirus vector Ad ⁇ .bgal.DF was grown in cells expressing either no fiber (293; ⁇ d ⁇ .bgal.DF/0"), the Ad ⁇ fiber (633; 'Ad ⁇ .bgal.DF/ ⁇ F'), or the Ad37 fiber with modifications as described in the text (70 ⁇ ; 'Ad ⁇ .bgal.DF/37F') and CsCI-purified. 10 ⁇ g of the purified particles were electrophoresed and transferred to a nylon membrane. As controls, 10 ⁇ g of wild- type Ad37 or the fiber gene-containing vector Ad ⁇ .bgal.wt or a sample of purified recombinant Ad37 fiber knob were also run.
  • the blot was probed with polyclonal antisera against recombinant Ad37 fiber or Ad2 fiber proteins.
  • Ad37 fiber or Ad2 fiber proteins As a loading control, the same filter was reprobed with an antibody against the Ad2 penton base (the anti-Ad2 sera cross-recognized the very similar Ad ⁇ fiber and Ad ⁇ penton base proteins).
  • Figure 28 shows PCR analysis for fiber presence.
  • Figure 29 shows the transduction efficiency for fiberless virus with and without soluble fiber.
  • Figure 30 shows the transduction efficiency of AD ⁇ BgF " on HDF cell line with the presence of different amounts of 633 conditioned media.
  • an adenovirus from a group with less homology to the group C viruses may be used to engineer recombinant viruses with little propensity for recombination with the Ad ⁇ sequence in 293 cells.
  • the cell line known as 293 -- may be used or further modified according to within-disclosed methods which stably expresses adenovirus proteins or polypeptides from Ad3 and/or proteins or polypeptides from another non-group-C or group C serotype; such a cell line would be useful to support adenovirus-derived viral vectors bearing deletions of regulatory and/or structural genes, irrespective of the serotype from which such a vector was derived.
  • constructs and methods of the present invention will support the design and engineering of chimeric viral vectors which express amino acid residue sequences derived from two or more Ad serotypes.
  • this invention allows the greatest possible flexibility in the design and preparation of useful viral vectors and cell lines which support their construction and propagation - all with a decreased risk of recombining with wild-type Ad to produce potentially-harmful recombinants.
  • the present invention discloses a simpler, alternative means of reducing the recombination between viral and cellular sequences than those discussed in the art.
  • One such means is to increase the size of the deletion in the recombinant virus and thereby reduce the extent of shared sequences between that virus and any Ad genes present in a packaging cell line -- e.g., the Ad ⁇ genes in 293 cells, or the various Ad genes in the novel cell lines of the present invention. Therefore, the present invention makes it feasible to engineer and produce novel viral vectors that are able to package and deliver significantly larger foreign nucleic acid sequences for efficacious use in a variety of therapeutic applications, without endangering the subject to whom they are administered, due to their impaired ability to self-replicate in non-complementing cell lines. Due to the fact that "helper" viruses or plasmids need not be used in conjunction with many of the viral vectors of the present invention, those vectors of the present invention are also simpler to use than those previously described in the art.
  • Adenoviral Vector or Ad-Derived Vector Any adenovirus-derived plasmid, genome or virus into which a foreign DNA may be inserted or expressed. This term may also be used interchangeably with “viral vector.” This "type" of vector may be utilized to carry nucleotide sequences encoding therapeutic proteins or polypeptides to specific cells or cell types in a subject in need of treatment, as described further herein below.
  • Amino Acid Residue An amino acid formed upon chemical digestion (hydrolysis) of a polypeptide at its peptide linkages.
  • the amino acid residues described herein are preferably in the "L" isomeric form. However, residues in the "D" isomeric form can be substituted for any L-amino acid residue, as long as the desired functional property is retained by the polypeptide.
  • NH 2 refers to the free amino group present at the amino terminus of a polypeptide.
  • COOH refers to the free carboxy group present at the carboxyl terminus of a polypeptide. Standard polypeptide nomenclature described in J. Biol. Chem., 243:3552-59 (1969) and adopted at 37 C.F.R. ⁇ ⁇ 1.821 - 1.822 is used.
  • amino acid residue sequences represented herein by formulae have a left to right orientation in the conventional direction of amino-terminus to carboxyl-terminus.
  • amino acid residue is broadly defined to include the amino acids listed in the Table of Correspondence and modified and unusual amino acids, such as those referred to in 37 C.F.R. ⁇ ⁇ 1.821 -1.822, and incorporated herein by reference.
  • a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino acid residues or to an amino-terminal group such as NH 2 or to a carboxyl-terminal group such as COOH.
  • Complementing Plasmid This term is generally used herein to describe plasmid vectors used to deliver particular nucleotide sequences into a packaging cell line, with the intent of having said sequences stably integrate into the cellular genome.
  • This term is generally used herein to describe a plasmid vector that carries or delivers nucleotide sequences in or into a cell line (e.g., a packaging cell line) for the purpose of propagating therapeutic viral vectors of the present invention.
  • a cell line e.g., a packaging cell line
  • DNA Homolog A nucleic acid having a preselected conserved nucleotide sequence and a sequence encoding a preferred polypeptide according to the present invention, where the nucleic acid is substantial homologous to a named preferred embodiment.
  • substantially homologous is meant having at least 80%, preferably at least 90%, most preferably at least 9 ⁇ % homology therewith.
  • the terms “homology” and “identity” are often used interchangeably. In this regard, percent homology or identity may be determined, for example, by comparing sequence information using a GAP computer program.
  • the GAP program utilizes the alignment method of Needleman and Wunsch (J. Mol. Biol. 48:443 (1970), as revised by Smith and Waterman (Adv. Appl. Math. 2:482 (1981). Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) which are similar, divided by the total number of symbols in the shorter of the two sequences.
  • the preferred default parameters for the GAP program may include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov and Burgess, Nucl. Acids Res. 14:674 ⁇ (1986), as described by Schwartz and Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National Biomedical Research Foundation, pp. 3 ⁇ 3-3 ⁇ 8 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.
  • nucleic acid molecules Whether any two nucleic acid molecules have nucleotide sequences that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% "identical” can be determined using known computer algorithms such as the "FAST A” program, using for example, the default parameters as in Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988). Alternatively the BLAST function of the National Center for Biotechnology Information database may be used to determine identity
  • sequences are aligned so that the highest order match is obtained. "Identity" per se has an art-recognized meaning and can be calculated using published techniques.
  • identity is well known to skilled artisans (Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073 (1988)). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073 (1988). Methods to determine identity and similarity are codified in computer programs.
  • Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCG program package (Devereux, J., et al., Nucleic Acids Research 12(l):387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S.F., et al., J Molec Biol 215:403 (1990)).
  • the term "identity" represents a comparison between a test and a reference polypeptide or polynucleotide.
  • a test polypeptide may be defined as any polypeptide that is 90% or more identical to a reference polypeptide.
  • the term at least "90% identical to” refers to percent identities from 90 to 99.99 relative to the reference polypeptides. Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polynucleotide length of 100 amino acids are compared. No more than 10% (i.e., 10 out of 100) amino acids in the test polypeptide differs from that of the reference polypeptides.
  • Comparisons may be made between a test and reference polynucleotides. Such differences may be represented as point mutations randomly distributed over the entire length of an amino acid sequence or they may be clustered in one or more locations of varying length up to the maximum allowable, e.g. 10/100 amino acid difference (approximately 90% identity). Differences are defined as nucleic acid or amino acid substitutions, or deletions.
  • An embodiment of the invention may use polynucleotides at least 90% or 95% identical to those encoding the TPL nucleic acid sequences.
  • a further embodiment of the invention may include those polynucleotides that encode a polypeptide of interest that are at least 9 ⁇ % identical when the variation in such a polynucleotide is due to more than merely degenerate changes.
  • Expression or Delivery Vector Any plasmid or virus into which a foreign DNA may be inserted for expression in a suitable host cell - i.e., the protein or polypeptide encoded by the DNA is synthesized in the host cell's system.
  • Vectors capable of directing the expression of DNA segments (genes) encoding one or more proteins are referred to herein as "expression vectors.” Also included are vectors which allow cloning of cDNA (complementary DNA) from mRNAs produced using reverse transcriptase.
  • Foreign Gene This term is used to identify a DNA molecule not present in the exact orientation and position as the counterpart DNA molecule found in wild- type adenovirus. It may also refer to a DNA molecule from another organism or species (i.e., exogenous) or from another Ad serotype.
  • Gene A nucleic acid whose nucleotide sequence encodes an RNA or polypeptide.
  • a gene can be either RNA or DNA. Genes may include regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
  • Isolated This term is used to indicate a nucleic acid or polypeptide sequence separated from the genetic environment from which the sequences were obtained. It may also mean altered from the natural state. For example, a polynucleotide or a polypeptide naturally present in a living animal is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated", as the term is employed herein. Thus, a polypeptide or polynucleotide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention.
  • isolated polypeptide or an “isolated polynucleotide” are polypeptides or polynucleotides that have been purified, partially or substantially, from a recombinant host cell or from a native source.
  • a recombinantly produced version of a compounds can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31 -40 (1988). The terms isolated and purified are sometimes used interchangeably.
  • isolated is meant that the DNA is free of the coding sequences of those genes that, in the naturally-occurring genome of the organism (if any) from which the DNA of the invention is derived, immediately flank the gene encoding the DNA of the invention.
  • the isolated DNA may be single-stranded or double-stranded, and may be genomic DNA, cDNA, recombinant hybrid DNA, or synthetic DNA. It may be identical to a native DNA sequence, or may differ from such sequence by the deletion, addition, or substitution of one or more nucleotides.
  • Isolated or purified as it refers to preparations made from biological cells or hosts should be understood to mean any cell extract containing the indicated DNA or protein including a crude extract of the DNA or protein of interest.
  • a purified preparation can be obtained following an individual technique or a series of preparative or biochemical techniques and the DNA or protein of interest can be present at various degrees of purity in these preparations.
  • the procedures may include for example, but are not limited to, ammonium sulfate fractionation, gel filtration, ion exchange change chromatography, affinity chromatography, density gradient centrifugation and electrophoresis.
  • a preparation of DNA or protein that is "pure” or “isolated” should be understood to mean a preparation free from naturally occurring materials with which such DNA or protein is normally associated in nature. "Essentially pure” should be understood to mean a “highly” purified preparation that contains at least 9 ⁇ % of the DNA or protein of interest.
  • a cell extract that contains the DNA or protein of interest should be understood to mean a homogenate preparation or cell-free preparation obtained from cells that express the protein or contain the DNA of interest.
  • the term "cell extract” is intended to include culture media, especially spent culture media from which the cells have been removed.
  • Packaging Cell line is a cell line that provides a missing gene product or its equivalent.
  • the adenovirus (Ad) particle is relatively complex and may be resolved into various substructures.
  • the particle is the minimal structural or functional unit of a virus.
  • a virus can refer to a single particle, a stock of particles or a viral genome.
  • Penton The terms “penton” or “penton complex” are preferentially used herein to designate a complex of penton base and fiber.
  • the term “penton” may also be used to indicate penton base, as well as penton complex.
  • the meaning of the term “penton” alone should be clear from the context within which it is used.
  • Plasmid An autonomous self-replicating extrachromosomal circular DNA
  • Post-transcriptional Regulatory Element is a regulatory element found in viral or cellular messenger RNA that is not spliced, i.e. intronless messages. Examples include, but are not limited to, human hepatitis virus, woodchuck hepatitis virus, the TK gene and mouse histone gene.
  • the PRE may be placed before a polyA sequence and after a heterologous DNA sequence.
  • Pseudotyping This term as generally used herein describes the production of adenoviral vectors having modified capsid protein or capsid proteins from a different serotype than the serotype of the vector itself.
  • One example is the production of an adenovirus ⁇ vector particle containing a chimeric Ad3/Ad ⁇ fiber protein. This may be accomplished by producing the adenoviral vector in packaging cell lines expressing different fiber proteins.
  • Useful promoters according to the present invention may be inducible or constitutive. Inducible promoters will initiate transcription only in the presence of an additional molecule; constitutive promoters, on the other hand, do not require the presence of any additional molecule to regulate gene expression.
  • a regulatable or inducible promoter may also be described as a promoter wherein the rate of RNA polymerase binding and initiation is modulated by external stimuli. Such stimuli include various compounds or compositions, light, heat, stress, chemical energy sources, and the like. Inducible, suppressible and repressible promoters are considered regulatable promoters.
  • Receptor is a term used herein to indicate a biologically active molecule that specifically binds to (or with) other molecules.
  • the term "receptor protein” may be used to more specifically indicate the proteinaceous nature of a specific receptor.
  • Recombinant As used herein, the term is intended to refer to any progeny formed as the result of genetic engineering. This may also be used to describe a virus formed by recombination of plasmids in a packaging cell.
  • Transgene or Therapeutic Nucleotide Sequence includes DNA and RNA sequences encoding an RNA or polypeptide. Such sequences may be “native” or naturally-derived sequences; they may also be “non-native” or “foreign” sequences which are naturally- or recombinantly-derived.
  • the term “transgene,” which may be used interchangeably herein with the term “therapeutic nucleotide sequence,” is often used to describe a heterologous or foreign (exogenous) gene that is carried by a viral vector and transduced into a host cell.
  • therapeutic nucleotide sequences may also include antisense sequences or nucleotide sequences which may be transcribed into antisense sequences.
  • Therapeutic nucleotide sequences (or transgenes) further comprise sequences which function to produce a desired effect in the cell or cell nucleus into which said therapeutic sequences are delivered.
  • a therapeutic nucleotide sequence may encode a functional protein intended for delivery into a cell which is unable to produce that functional protein.
  • Fiber plays a crucial role in adenovirus infection by attaching the virus to a specific receptor on the cell surface.
  • the fiber is an elongated protein which exists as a trimer of three identical polypeptides (polypeptide IV) of 682 amino acids in length.
  • An adenovirus fiber consists of three domains: an N-terminal tail domain that interacts with penton base; a shaft composed of variable numbers of repeats of a 1 ⁇ -amino-acid segment that forms beta-sheet and beta-bends; and a knob at the C-terminus (“head domain”) that contains the type-specific antigen and is responsible for binding to the cell surface receptor.
  • the gene encoding the fiber protein from Ad2 has been expressed in human cells and has been shown to be correctly assembled into trimers, glycosylated and transported to the nucleus. (See, e.g., Hong and Engler, Virology 185: 768-761 , 1991).
  • alteration of the fiber in recombinant Ad vectors can lead to alteration in gene delivery. This has great utility for a variety of gene therapy applications and is one of the objects of the present invention.
  • Hexon, penton and fiber capsomeres are the major components on the surface of the virion. Their constituent polypeptides, nos. II, III and IV, contain tyrosine residues that are exposed on the surface of the virion and can be labeled - e.g., by iodination of intact particles.
  • the 3 ⁇ ,000+ base pair (bp) genome of adenovirus type 2 has been sequenced and the predicted amino acid sequences of the major coat proteins (hexon, fiber and penton base) have been described.
  • major coat proteins hexon, fiber and penton base
  • Ad ⁇ DNA was completed more recently; its sequence includes a total of 36,936 bp. Portions of many other adenovirus genomes have also been sequenced. It is presently understood that the upper packaging limit for adenovirus virions is about 106% of the wild-type genome length. (See, e.g., Bett, et al., J. Virol. 67(10): 6911-21 , 1993). Thus, for Ad2 and Ad ⁇ , this would be an upper packaging limit of about 38kb of DNA.
  • Adenovirus DNA also includes inverted terminal repeat sequences (ITRs) ranging in size from about 100 to 160 bp, depending on the serotype.
  • ITRs inverted terminal repeat sequences
  • the inverted repeats enable single strands of viral DNA to circularize by base-pairing of their terminal sequences, and the resulting base-paired "panhandle" structures required for replication of the viral DNA.
  • the ITRs and the packaging signal (a few hundred bp in length) comprise the "minimum requirement" for replication and packaging of a genomic nucleic acid into an adenovirus particle.
  • Helper-dependent vectors lacking all viral ORFs but including these essential cis elements have been constructed, but the virions package less efficiently that the helper and package as multimers part of the time, which suggests that the virus may "want" to package a fuller DNA complement (see, e.g., Fisher, et al., Virology 217: 11 -22, 1996).
  • the viral vectors of the present invention may retain their ability to express the genome packaged within - i.e., they may retain their "infectivity" -- they do not act as infectious agents, however, to the extent that they cause disease in the subjects to whom they are administered for therapeutic purposes.
  • Ad vectors have several distinct advantages over other viral vectors in the art. For example, recombination of such vectors is rare; there are no known associations of human malignancies with adenoviral infections despite common human infection with adenoviruses; the genome may be manipulated to accommodate foreign genes of a fairly substantial size; and host proliferation is not required for expression of adenoviral proteins.
  • Ad-derived viral vectors disclosed herein may be used to target and deliver genes into specific cells by incorporating the attachment sequence for other receptors (such as CD4) onto the fiber protein by recombinant DNA techniques, thus producing a chimeric molecule.
  • the within- disclosed delivery systems thus provide for increased flexibility in gene design to enable gene delivery into proliferating and nonproliferating cell types.
  • modified penton base polypeptides such as those described in Wickham, et al. (J. Virol. 70: 6831-8, 1996) may have therapeutic utility when used according to the within-disclosed methods.
  • Ad proteins and polypeptides may be used as components of the various disclosed vectors and cell lines.
  • chimeric molecules comprised of proteins, polypeptides, and/or fragments thereof which are derived from different Ad serotypes may be used in any of the within-disclosed methods, constructs and compositions.
  • recombinant DNA sequences of the present invention may be prepared using nucleic acid sequences derived from different Ad serotypes, in order to design useful constructs with broad applicability, as disclosed and claimed herein.
  • Ad serotypes 1 , 2, 5, 6 or 37 - are specifically recited in various examples herein, the present invention is in no way limited to those serotypes alone.
  • therapeutic viral vectors, packaging cell lines, and plasmids of the present invention may be constructed from components of any and all Ad serotypes ⁇ and the within-disclosed methods of making and using the various constructs and cell lines of the present invention apply to all of said serotypes.
  • Adenoviridae includes many members with at least 47 known serotypes of human adenovirus (Ad1-Ad47) (Shenk, Virology, Chapter 67, in Fields et al., eds. Lippincott-Raven, Philadelphia, 1996,) as well as members of the genus Mastadenovirus including human, simian, bovine, equine, porcine, ovine, canine and opossum viruses, and members of the Aviadenovirus genus, including bird viruses, e.g. CELO.
  • the disclosed inventions can be applied to any adenovirus species, and the invention need not be so limited.
  • the first generation of recombinant adenoviral vectors currently available typically have a deletion in the first viral early gene region which is generally referred to as E1 , which comprises the E1 a and E1 b regions. (These regions span genetic map units 1.30 to 9.24.)
  • Figure 3 in chapter 67 of Fields Virology, 3d Ed. illustrates a transcription and translation map of adenovirus type 2 (Ad2).
  • E1 complementation is typically provided by a cell line expressing E1 , such as the human embryonic kidney packaging cell line, i.e. an epithelial cell line, called 293.
  • Cell line 293 contains the E1 region of adenovirus, which provides E1 gene region products to "support" the growth of E1 -deleted virus in the cell line (see, e.g., Graham et al., J. Gen. Virol.
  • Packaging cell lines disclosed herein support viral vectors with deletions of major portions of the viral genome, without the need for helper viruses. Additionally, the invention provides novel cell lines and helper viruses for use with helper-dependent vectors.
  • a packaging cell line having DNA sequences stably integrated into the cellular genome wherein the DNA sequences encode one or more adenovirus regulatory and/or structural polypeptides which complement the genes deleted or mutated in the adenovirus vector genome to be replicated and packaged.
  • the packaging cell line expresses one or more adenovirus structural proteins, polypeptides, or fragments thereof, wherein said structural protein is selected from the group consisting of penton base, hexon, fiber, polypeptide Ilia, polypeptide V, polypeptide VI, polypeptide VII, polypeptide VIM, and biologically active fragments thereof.
  • sequences are constitutively expressed; in another, one or more sequences is under the control of a regulatable promoter. In a preferred embodiment expression is constitutive. In various preferred embodiments, the polypeptides expressed by the DNA sequences are biologically active.
  • the packaging cell line of the present invention supports the production of a viral vector.
  • the viral vector is a therapeutic vector.
  • the present invention also discloses a packaging cell line which complements a viral vector having a deletion or mutation of a DNA sequence encoding an adenovirus structural protein, regulatory polypeptides E1A and E1 B, and/or one or more of the following regulatory proteins or polypeptides: E2A, E2B, E3, E4, L4, or fragments thereof.
  • each DNA sequence is introduced into the genome of the within-disclosed cell lines via a separate complementing plasmid.
  • the complementing plasmid comprises a DNA sequence encoding adenovirus fiber protein, polypeptide or fragment thereof.
  • An example of a useful complementing plasmid according to the present invention is a plasmid having the characteristics of pCLF (for deposit details, see Example 3)
  • a packaging cell useful in the preparation of recombinant adenovirus viral vectors comprising a delivery plasmid comprising an adenovirus genome lacking a nucleotide sequence encoding fiber.
  • the delivery plasmid further comprises a nucleotide sequence encoding a foreign polypeptide.
  • a preferred delivery plasmid is pDV44, pE1 B gal, or pE1sp1 B.
  • the cell further comprises a complementing plasmid containing a nucleotide sequence encoding fiber, the plasmid being stably integrated into the cellular genome of the cell.
  • a composition comprises a cell containing first and second delivery plasmids wherein a first delivery plasmid comprises an adenovirus genome lacking a nucleotide sequence encoding fiber and incapable of directing the packaging of new viral particles in the absence of a second delivery plasmid, and a second delivery plasmid comprises an adenoviral genome capable of directing the packaging of new viral particles in the presence of the first delivery plasmid.
  • the first and second delivery plasmids interact within the cell to produce a therapeutic viral vector.
  • the cell further comprises a complementing plasmid containing a nucleotide sequence encoding fiber, the plasmid being stably integrated into the cellular genome of the cell.
  • the first or second delivery plasmid further comprises a nucleotide sequence encoding a foreign polypeptide.
  • the polypeptide is a therapeutic molecule.
  • compositions as before wherein the first delivery plasmid lacks adenovirus packaging signal sequences.
  • the second delivery plasmid contains a LacZ reporter construct.
  • the second delivery plasmid further lacks a nucleotide sequence encoding an adenovirus regulatory protein.
  • the regulatory protein is E1.
  • the complementing plasmid has the characteristics of pCLF.
  • a composition wherein the first delivery plasmid lacks a nucleotide sequence encoding an adenovirus structural protein and the second delivery plasmid lacks a nucleotide sequence encoding adenovirus E1 protein.
  • the first delivery plasmid lacks a nucleotide sequence encoding adenovirus E4 protein and the second delivery plasmid lacks a nucleotide sequence encoding adenovirus E1 protein.
  • the cell contains at least one complementing plasmid encoding an adenoviral regulatory protein and a structural protein.
  • a packaging cell line expresses fiber protein.
  • the fiber protein has been modified to include a non-native amino acid residue sequence which targets a specific receptor, but which does not disrupt trimer formation or transport of fiber into the nucleus.
  • the non-native amino acid residue sequence alters the binding specificity of the fiber for a targeted cell type.
  • the structural protein is fiber comprising amino acid residue sequences from more than one adenovirus serotype.
  • the nucleotide sequences encoding fiber protein or polypeptide need not be modified solely at one or both termini; fiber protein - and indeed, any of the adenovirus structural proteins, as taught herein ⁇ may be modified "internally" as well as at the termini.
  • the non-native amino acid residue sequence is coupled to the carboxyl terminus of the fiber.
  • the non-native amino acid residue sequence further includes a linker sequence.
  • the fiber protein further comprises a ligand coupled to the linker.
  • a suitable ligand may be selected from the group consisting of ligands that specifically bind to a cell surface receptor and ligands that can be used to couple other proteins or nucleic acid molecules.
  • any of the packaging cell lines of this invention may have a DNA sequence encoding all or part of a fiber protein ⁇ including modified or chimeric proteins - stably integrated into the genome.
  • a packaging cell line of the present invention is derived from a procaryotic cell line; in another, it is derived from a eucaryotic cell line. While various embodiments suggest the use of mammalian cells, and more particularly, epithelial cell lines, a variety of other, non-epithelial cell lines are used in various embodiments. Thus, while various embodiments disclose the use of a cell line selected from the group consisting of 293, A549, W162, HeLa, Vero, 211 , and 211 A cell lines, it is understood that various other cell lines are likewise contemplated for use as disclosed herein.
  • a therapeutic viral vector or composition of the present invention comprises a nucleotide sequence, nucleic acid molecule or segment as described herein.
  • the nucleic acid molecule or molecule encodes a protein or polypeptide molecule -- or a biologically active fragment thereof -- which may be used for therapeutic applications.
  • a nucleotide sequence may further comprise an enhancer element or a promoter located 3' or 5' to and controlling the expression of such a therapeutic nucleotide sequence or gene.
  • a subject nucleotide sequence consists of a nucleic acid molecule that comprises at least 2 different operatively linked DNA segments.
  • the DNA can be manipulated and amplified by PCR as described herein and by using standard techniques, such as those described in Molecular Cloning: A Laboratory Manual, 2nd Ed., Sambrook et al., eds., Cold Spring Harbor, New York (1989).
  • the sequence encoding the selected polypeptide and the promoter or enhancer are operatively linked to a DNA molecule capable of autonomous replication in a cell either in vivo or in vitro.
  • the enhancer element or promoter and the nucleotide sequence By operatively linking the enhancer element or promoter and the nucleotide sequence to the vector, the attached segments are replicated along with the vector sequences.
  • a recombinant DNA molecule (rDNA) of the present invention is a hybrid DNA molecule comprising at least 2 nucleotide sequences not normally found together in nature.
  • one of the sequences is a sequence encoding an Ad-derived polypeptide, protein, or fragment thereof.
  • a nucleotide sequence of the present invention is one that encodes an expressible protein, polypeptide or fragment thereof, and it may further include an active constitutive or regulatable (e.g. inducible) promoter sequence.
  • a nucleotide sequence of the present invention is optimally from about 20 base pairs to about 40,000 base pairs in length.
  • the nucleotide sequence is from about 50 bp to about 38,000 bp in length.
  • the nucleotide sequence is of sufficient length to encode one or more adenovirus proteins or functional polypeptide portions thereof. Since individual Ad polypeptides vary in length from about 19 amino acid residues to about 967 amino acid residues, corresponding nucleotide sequences will range from about 50 bp up to about 3000 bp, depending on the number and size of individual polypeptide-encoding sequences that are "replaced" in the viral vectors by therapeutic nucleotide sequences of the present invention.
  • TPL Tripartite Leader
  • adenovirus late proteins such as the structural proteins in a packaging cell line according to the present invention is substantially improved when the expression cassette present on the complementing plasmid or in the packaging cell line's genome contains an adenovirus tripartite leader (TPL) nucleic acid sequence.
  • TPL adenovirus tripartite leader
  • the invention contemplates a nucleic acid molecule comprising a TPL nucleotide sequence.
  • the TPL nucleotide sequence may be operatively linked to an intron containing RNA processing signals (such as for example, splice donor or splice acceptor sites) suitable for expression in the packaging cell line.
  • the intron contains a splice donor site and a splice acceptor site.
  • the TPL nucleotide sequence may not comprise an intron.
  • a subject nucleic acid molecule of this invention is isolated, i.e., separated from the genetic environment from which the component sequences were obtained.
  • molecular cloning of fragments of a gene will produce an isolated nucleic acid, as will the chemical synthesis of an oligonucleotide to build a nucleic acid molecule.
  • the intron useful in the present invention is any nucleotide sequence which functions in the packaging cell line to provide RNA processing signals, as are well known in the art, including splicing signals. Introns have been well characterized from a large number of structural genes, and therefor the invention should not be considered as limited. Well characterized and preferred introns include a native intron 1 from adenovirus, such as Ad ⁇ 's TPL intron 1 ; others include the SV40 VP intron; the rabbit beta-globin intron, and synthetic intron constructs. See, for example, Petitclerc et al., J. Biothechnol., 40:169, 1996, and Choi et al., Mol. Cell. Biol., 11:3070, 1991.
  • the TPL nucleotide sequence comprises either (a) first and second TPL exons or (b) first, second and third TPL exons, where each TPL exon in the sequence is selected from the group consisting of complete TPL exon 1 , partial TPL exon 1 , complete TPL exon 2 and complete TPL exon 3.
  • a complete exon is one which contains the complete nucleic acid sequence based on the sequence found in the wild type viral genome.
  • the TPL exons are from Ad2, Ad3, Ad ⁇ , Ad7 and the like, however, they may come from any Ad serotype, as described herein.
  • a preferred partial TPL exon 1 is described in the Examples. The use of a TPL with a partial exon 1 has been reported (W098/13499).
  • the intron and the TPL exons can be operatively linked in a variety of configurations to provide a functional TPL nucleotide sequence, although in some embodiments of the invention, an intron may not be a part of the construct.
  • the intron can be positioned between any of TPL exons 1 , 2 or 3, and the exons can be in any order of first and second, or first/second/third.
  • the intron can also be placed preceding the first TPL exon or following the last TPL exon.
  • complete TPL exon 1 is operatively linked to complete TPL exon 2 operatively linked to complete TPL exon 3.
  • adenovirus TPL intron 1 is positioned between complete TPL exon 1 and complete TPL exon 2. It may also be possible to use analogous translational regulators from other viral systems such as rabiesvirus.
  • a preferred "complete" TPL nucleic acid molecule containing complete TPL exons 1 , 2 and 3 with adenovirus intron 1 inserted between exons 1 and 2 has a nucleotide sequence shown in SEQ ID NO: 32.
  • a preferred "partial" TPL nucleic acid molecule containing partial TPL exon 1 and complete TPL exons 2 and 3 in that order has a nucleotide sequence shown in SEQ ID NO: 26.
  • the construction of these preferred TPL nucleotide sequences is described in the Examples.
  • preferred expression cassettes and complementing plasmids for expressing adenovirus structural genes, particularly fiber protein contain an adenovirus TPL nucleotide sequence as described herein.
  • Preferred packaging cell lines containing the subject nucleic acid molecules also contain a TPL nucleotide sequence of the invention.
  • the invention describes in a related embodiment nucleic acid molecules and nucleotide sequences, typically in the form of DNA plasmid vectors, which are capable of expression of an adenovirus structural protein or regulatory protein. Because these expression plasmids are used to complement the defective genes of a recombinant adenovirus vector genome of this invention, the plasmids are referred to as complementing or complementation plasmids.
  • the complementing plasmid contains an expression cassette, a nucleotide sequence capable of expressing a protein product off the gene encoded by the nucleotide sequence.
  • Expression cassettes are described in more detail herein, but typically contain a promoter and a structural gene operatively linked to the promoter and whose expression is controlled by the promoter.
  • a preferred complementing plasmid further includes a TPL nucleotide sequence described herein to enhance expression of the structural gene product when used in the context of adenovirus genome replication and packaging.
  • a complementing plasmid comprises a promoter nucleotide sequence operatively linked to a nucleotide sequence encoding an adenovirus structural polypeptide.
  • the adenovirus structural polypeptide is selected from the group consisting of penton base; hexon; fiber; polypeptide Ilia; polypeptide V; polypeptide VI; polypeptide VII; polypeptide VIII; and biologically active fragments thereof.
  • a complementing plasmid further comprises a nucleotide sequence encoding a first adenovirus regulatory polypeptide, a nucleotide sequence encoding a second regulatory polypeptide, a nucleotide sequence encoding a third regulatory polypeptide; or any combination of the foregoing.
  • the present invention also discloses a complementing plasmid comprising a promoter nucleotide sequence operatively linked to a nucleotide sequence encoding an adenovirus structural protein, polypeptide or fragment thereof and a nucleotide sequence encoding an adenovirus regulatory protein, polypeptide or fragment thereof.
  • the early region polypeptide is E4; in another, the plasmid comprises pE4/Hygro.
  • the early region polypeptides are E1 and E4.
  • the complementing plasmid used to transform a cell line of the present invention further comprises a DNA sequence encoding an adenovirus regulatory protein, polypeptide or fragment thereof.
  • the regulatory protein is selected from the group consisting of E1A, E1 B, E2A, E2B, E3, E4 and L4 (also referred to as "the 100K protein"); an exemplary complementing plasmid has the characteristics of is pE4/Hygro (for deposit details, see the Examples).
  • the complementing plasmid used to transform a cell line of the present invention further comprises a DNA sequence encoding two or more of the above mentioned adenovirus regulatory proteins, polypeptides or fragments thereof.
  • Preferred complementing plasmids include pCLF, pDV60, pDV61 , pDV67, pDV69, pDV80, pDV90 and the like plasmids described in the Examples.
  • the nucleic acid sequence of particularly preferred complementing plasmids are shown in SEQ ID NO: 43 for pDV60, SEQ ID NO: 44 for pDV67, SEQ ID NO: 47 for pDV69, SEQ ID NO: 64 for pDV80 and SEQ ID NO: 65 for pDV90.
  • a nucleic acid molecule comprising synthetic oligonucleotide sequences of the present invention can be prepared using any suitable method, such as, the phosphotriester or phosphodiester methods. See Narang et al., Meth. Enzymol., 68:90, (1979); U.S. Patent No. 4,356,270; and Brown et al., Meth. Enzymol., 68:109, (1979).
  • the synthesis of the family members can be conducted simultaneously in a single reaction vessel, or can be synthesized independently and later admixed in preselected molar ratios.
  • the nucleotide residues that are conserved at preselected positions of the sequence of the family member can be introduced in a chemical synthesis protocol simultaneously to the variants by the addition of a single preselected nucleotide precursor to the solid phase oligonucleotide reaction admixture when that position number of the oligonucleotide is being chemically added to the growing oligonucleotide polymer.
  • nucleotide residues to those positions in the sequence that vary can be introduced simultaneously by the addition of amounts, preferably equimolar amounts, of multiple preselected nucleotide precursors to the solid phase oligonucleotide reaction admixture during chemical synthesis.
  • amounts preferably equimolar amounts
  • nucleotide precursors for example, where all four possible natural nucleotides (A,T,G and C) are to be added at a preselected position, their precursors are added to the oligonucleotide synthesis reaction at that step to simultaneously form four variants.
  • Nucleotide bases other than the common four nucleotides (A,T,G or C), or the RNA equivalent nucleotide uracil (U), can also be used in the present invention.
  • inosine (I) is capable of hybridizing with A, T and G, but not C.
  • examples of other useful nucleotide analogs are known in the art and may be found referred to in 37 C.F.R. ⁇ 1.822.
  • oligonucleotide sequence is designed to contain oligonucleotides that can hybridize to four sequences that vary at one position
  • the composition can contain four members, where a preselected position contains A,T,G or C.
  • a composition can contain two nucleotide sequence members, where a preselected position contains I or C, and has the capacity the hybridize at that position to all four possible common nucleotides.
  • other nucleotides may be included at the preselected position that have the capacity to hybridize in a non-destabilizing manner with more than one of the common nucleotides in a manner similar to inosine.
  • nucleic acid molecules can be constructed in synthetic oligonucleotide pieces, and assembled by complementary hybridization and ligation, as is well known.
  • One key component of the present invention for producing gene therapy reagents comprised of recombinant adenovirus particles is the recombinant adenovirus vector genome which is encapsulated in the virus particle and which expresses exogenous genes in a gene therapy setting.
  • the components of an recombinant adenovirus vector genome include the ability to express selected adenovirus structural genes, to express a desired exogenous protein, and to contain sufficient replication and packaging signals that the genome is packaged into a gene delivery vector particle.
  • the preferred replication signal is an adenovirus inverted terminal repeat containing an adenovirus origin of replication, as is well known and described herein.
  • a preferred recombinant adenovirus vector genome is "helper independent" which means the genome can replicate and be packaged without the help of a second, complementing helper virus. Instead, the complementation is provided by a packaging cell line of the present invention. Additional embodiments of the invention, however, are drawn to a vector genome referred to as “gutless” which is “helper dependent.”
  • the adenovirus vector genome does not encode a functional adenovirus fiber protein.
  • a non-functional fiber gene refers to a deletion, mutation or other modification to the adenovirus fiber gene such that the gene does not express any or insufficient adenovirus fiber protein to package a fiber-containing adenovirus particle without complementation of the fiber gene by a complementing plasmid or packaging cell line.
  • Such a genome is referred to as a "fiberless" genome, not to be confused with a fiberless particle.
  • a fiber protein may be encoded but is insufficiently expressed to result in a fiber containing particle.
  • the invention describes a helper-independent fiberless recombinant adenovirus vector genome comprising genes which (a) express all adenovirus structural gene products but express insufficient adenovirus fiber protein to package a fiber-containing adenovirus particle without complementation of said fiber gene, (b) express an exogenous protein, and (c) contains an adenovirus packaging signal and inverted terminal repeats containing adenovirus origin of replication.
  • exogenous DNA into eucaryotic cells has become one of the most powerful tools of the molecular biologist.
  • exogenous encompasses any therapeutic composition of this invention which is administered by the therapeutic methods of this invention.
  • exogenous may also be referred to herein as “foreign,” “non-native,” and the like.
  • the methods of this invention preferably require efficient delivery of the DNA into the nucleus of the recipient cell and subsequent identification of cells that are expressing the foreign DNA.
  • the adenovirus vector genome is propagated in the laboratory in the form of rDNA plasmids containing the genome, and upon introduction into an appropriate host, the viral genetic elements provide for viral genome replication and packaging rather than plasmid-based propagation. Exemplary methods for preparing an Ad- vector genome are described in the Examples.
  • a widely-used plasmid is pBR322, a vector whose nucleotide sequence and endonuclease cleavage sites are well known.
  • pBR322 a vector whose nucleotide sequence and endonuclease cleavage sites are well known.
  • Various other useful plasmid vectors are described in the Examples that follow.
  • a nucleic acid vector of the present invention comprises a nucleic acid (preferably DNA) molecule capable of autonomous replication in a cell and to which a DNA segment, e.g., a gene or polynucleotide, can be operatively linked so as to bring about replication of the attached segment.
  • a DNA segment e.g., a gene or polynucleotide
  • one of the nucleotide segments to be operatively linked to vector sequences encodes at least a portion of a therapeutic nucleic acid molecule - in effect, a nucleic acid sequence that encodes one or more therapeutic proteins or polypeptides, or fragments thereof.
  • vectors are disclosed.
  • one "type” of vector is used to deliver particular nucleotide sequences into a packaging cell line, with the intent of having said sequences stably integrate into the cellular genome; these "types” of vectors are generally identified herein as complementing plasmids.
  • a further "type” of vector described herein carries or delivers nucleotide sequences in or into a cell line (e.g., a packaging cell line) for the purpose of propagating therapeutic viral vectors of the present invention; hence, these vectors are generally referred to herein as delivery plasmids.
  • a third "type" of vector described herein is utilized to carry nucleotide sequences encoding therapeutic proteins or polypeptides to specific cells or cell types in a subject in need of treatment; these vectors are generally identified herein as therapeutic viral vectors or Ad-derived vectors and are in the form of a virus particle encapsulating a viral nucleic acid containing an expression cassette nucleic acid sequence for expressing the therapeutic gene.
  • a peptide-coding sequence of the therapeutic gene is inserted into an expression vector and expressed; however, it is also feasible to construct an expression vector which also includes some non-coding sequences as well. Preferably, however, non-coding sequences are excluded. Alternatively, a nucleotide sequence for a soluble form of a polypeptide may be utilized.
  • Another preferred therapeutic viral vector includes a nucleotide sequence encoding at least a portion of a therapeutic nucleotide sequence operatively linked to the expression vector for expression of the coding sequence in the therapeutic nucleotide sequence.
  • operatively linked generally means the sequences or segments have been covalently joined into one piece of DNA, whether in single or double stranded form.
  • viral vector into which a therapeutic nucleotide sequence of this invention is operatively linked depends directly, as is well known in the art, on the functional properties desired, e.g., vector replication and protein expression, and the host cell to be transformed - these being limitations inherent in the art of constructing recombinant DNA molecules.
  • adenovirus serotypes are recited herein in the form of specific examples, it should be understood that the present invention contemplates the use of any adenovirus serotype, including hybrids and derivatives thereof.
  • a translatable nucleotide sequence is a linear series of nucleotides that provide an uninterrupted series of at least 8 codons that encode a polypeptide in one reading frame.
  • the nucleotide sequence is a DNA sequence.
  • the vector itself may be of any suitable type, such as a viral vector (RNA or DNA), naked straight-chain or circular DNA, or a vesicle or envelope containing the nucleic acid material and any polypeptides that are to be inserted into the cell.
  • an expression nucleic acid in an Ad-derived vector of the present invention may also include a promoter sequence.
  • promoters are DNA segments that contain a DNA sequence that controls the expression of a gene located 3' or downstream of the promoter.
  • the promoter is the DNA sequence to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that gene, typically located 3' of the promoter
  • a promoter also includes DNA sequences which direct the initiation of transcription, including those to which RNA polymerase specifically binds. If more than one nucleic acid sequence encoding a particular polypeptide or protein is included in a therapeutic viral vector or nucleotide sequence, more than one promoter or enhancer element may be included, particularly if that would enhance efficiency of expression.
  • regulatable (inducible) as well as constitutive promoters may be used, either on separate vectors or on the same vector.
  • constitutive and regulatable promoters are useful in constructs and methods of the present invention.
  • some useful regulatable promoters are those of the CREB-regulated gene family and include inhibin, gonadotropin, cytochrome c, glucagon, and the like. (See, e.g., published International App. No. WO96/14061.
  • a regulatable or inducible promoter may be described as a promoter wherein the rate of RNA polymerase binding and initiation is modulated by external stimuli.
  • external stimuli include various compounds or compositions, light, heat, stress, chemical energy sources, and the like.
  • Inducible, suppressible and repressible promoters are considered regulatable promoters.
  • Regulatable promoters may also include tissue-specific promoters.
  • Tissue-specific promoters direct the expression of the gene to which they are operably linked to a specific cell type. Tissue-specific promoters cause the gene located 3' of it to be expressed predominantly, if not exclusively, in the specific cells where the promoter expressed its endogenous gene. Typically, it appears that if a tissue-specific promoter expresses the gene located 3' of it at all, then it is expressed appropriately in the correct cell types (see, e.g., Palmiter et al., Ann. Rev. Genet. 20: 465-499, 1986).
  • tissue-specific promoter controls the expression of a gene
  • that gene will be expressed in a small number of tissues or cell types rather than in substantially all tissues and cell types.
  • tissue-specific promoters include the immunoglobulin promoter described by Brinster et al., Nature 306: 332-336 (1983) and Storb et al., Nature 310: 238-231 (1984); the elastase-l promoter described by Swift et al., Cell 38: 639-646 (1984); the globin promoter described by Townes et al., Mol. Cell. Biol. 5: 1977-1983 (1985), and Magram et al., Mol. Cell. Biol.
  • adenovirus consists of many proteins, not all adenovirus proteins are required for assembly of a recombinant adenovirus particle (vector) of this invention. Thus, deletion of the appropriate genes from a recombinant Ad vector as taught herein will thus allow the vector to accommodate even larger "foreign" DNA segments. Thus, if the sequences encoding one or more adenovirus polypeptides or proteins are supplanted by a recombinant nucleotide sequence of the present invention, the length of the recombinant sequence can conceivably extend nearly to the packaging limit of the relevant adenovirus-derived vector.
  • the entire wild-type Ad genome cannot be completely supplanted by recombinant nucleic acid molecules without transforming such a vector into a vector requiring "help" of some kind.
  • most of the Ad- derived vectors of the present invention do not depend on a helper virus; instead, the vectors of the present invention are propagated in cell lines stably expressing proteins or polypeptides that have been removed from said vectors to allow the addition of "foreign" DNA into the vectors.
  • Ad-derived vectors of the present invention may easily include 12 kb or more of foreign (or "therapeutic") DNA sequences.
  • adenovirus viral vectors which comprise nucleotide sequences encoding a packaging signal and a foreign protein or polypeptide, wherein the nucleotide sequence encoding an adenovirus structural protein has been deleted.
  • the nucleotide sequence encoding the foreign protein or polypeptide is a DNA molecule up to about 3 kb in length; in another, the nucleotide sequence encoding the foreign protein or polypeptide is a DNA molecule up to about 9.5 kb in length; in still another, the nucleotide sequence encoding the foreign protein or polypeptide is a DNA molecule up to about 12.6 kb in length. Nucleotide sequences of intermediate lengths are also contemplated by the present invention, as are sequences in excess of 12.5 kb.
  • the invention also discloses viral vectors wherein the sequence encoding a foreign protein or polypeptide is a sequence encoding an anti-tumor agent, a tumor suppressor protein, a suicide protein, or a fragment or functional equivalent thereof.
  • nucleotide sequences encoding one or more regulatory proteins have also been deleted from the vector.
  • the regulatory proteins are selected from the group consisting of E1A, E1 B, E2A, E2B, E3, E4, and L4 (100K protein).
  • a therapeutic viral vector which lacks a DNA sequence encoding fiber protein, or a portion thereof.
  • a therapeutic viral vector may further or alternatively comprise deletion of a DNA sequence encoding one or more regulatory proteins, polypeptides, or fragments thereof.
  • foreign DNA sequences are inserted in place of the DNA sequence encoding fiber protein in the viral vectors of the present invention.
  • the therapeutic viral vectors further comprise foreign DNA sequences inserted in place of the DNA sequences encoding one or more regulatory proteins, polypeptides, or fragments thereof, and/or one or more structural proteins, polypeptides, or fragments thereof.
  • a viral vector comprises a deletion or mutation of a DNA sequence encoding an adenovirus structural protein, polypeptide, or fragment thereof.
  • a vector may further comprise deletion or mutation of the DNA sequences encoding regulatory polypeptides E1A and E1B; and it may still further comprise deletion or mutation of the DNA sequence encoding one or more of the following regulatory proteins or polypeptides: E2A, E2B, E3, E4, L4, or fragments thereof.
  • the structural protein comprises fiber. Any combination of the foregoing is also contemplated by the present invention.
  • the viral vectors of the present invention are suitable for the preparation of pharmaceutical compositions comprising any of the therapeutic viral vectors disclosed herein -- including combinations thereof - are also disclosed herein.
  • a further use of the viral vectors of the present invention is for targeting specific cells in a cell population comprising different cell types.
  • a foreign DNA sequence encoding one or more foreign proteins, polypeptides or fragments thereof has been inserted in place of any of the deletions in the therapeutic viral vector.
  • the foreign DNA encodes a tumor-suppressor protein or a biologically active fragment thereof.
  • the foreign DNA encodes a suicide protein or a biologically active fragment thereof.
  • a viral vector comprises a foreign DNA sequence encoding one or more foreign proteins, polypeptides or fragments thereof wherein said DNA sequence has been inserted in place of any structural and/or regulatory proteins (or portions thereof) that have been deleted.
  • the foreign DNA encodes a therapeutic molecule such as a tumor-suppressor protein; a suicide protein; a cystic fibrosis transmembrane conductance regulator (CFTR) protein; or a biologically active fragment of any of them.
  • CFTR cystic fibrosis transmembrane conductance regulator
  • the therapeutic (or foreign) nucleotide sequence can be a gene or gene fragment that encodes a protein or polypeptide -- or a biologically active fragment thereof.
  • a gene or gene fragment that encodes a protein or polypeptide -- or a biologically active fragment thereof.
  • a therapeutic protein or polypeptide expressed by a therapeutic viral vector of the present invention may be used in conjunction with another therapeutic agent when appropriate -- e.g., a thymidine kinase metabolite may be used in conjunction with the gene encoding thymidine kinase and its gene product -- in order to be even more effective.
  • a therapeutic viral vector can include a DNA or RNA oligonucleotide sequence that exhibits therapeutic activity without needing to be translated into a polypeptide product before exerting a therapeutic effect.
  • examples of the latter include antisense oligonucleotides that will inhibit the transcription of deleterious genes or ribozymes that act as site-specific ribonucleases for cleaving selected mutated gene sequences.
  • a therapeutic nucleotide sequence of the present invention may comprise a DNA construct capable of generating therapeutic nucleotide molecules, including ribozymes and antisense DNA, in high copy numbers in target cells, as described in published PCT application No.
  • WO 92/06693 (the disclosure of which is incorporated herein by reference).
  • Other preferred therapeutic nucleotide sequences according to the present invention are capable of delivering HIV antisense oligonucleotides to latently-infected T cells via CD4.
  • delivery of Epstein-Barr Virus (EBV) EBNa-1 antisense oligonucleotides to B cells via CR2 is capable of effecting therapeutic results.
  • EBV Epstein-Barr Virus
  • a preferred recombinant adenovirus vector genome is based on the vector described in the Examples and designated Ad ⁇ . ⁇ gal. ⁇ F.
  • This vector is a helper independent, fiberless vector genome which can host, upon insertion, an exogenous gene for expression of an exogenous or therapeutic protein.
  • the genome of Ad ⁇ . ⁇ gal. ⁇ F has a nucleotide sequence shown in SEQ ID NO: 27.
  • a virus particle containing Ad ⁇ . ⁇ gal. ⁇ F vector genome has been prepared as described in the Examples and is deposited with the ATCC as Accession No. VR- 2636
  • Ad ⁇ . ⁇ gal. ⁇ F genome nucleic acid can be manipulated to contain any exogenous gene in place of the beta-galactosidase gene present in the construct, as described herein.
  • the invention discloses a method of constructing therapeutic viral vectors, comprising introducing a delivery plasmid into an Ad fiber- expressing complementing cell line, wherein the DNA sequence encoding Ad fiber protein has been deleted from the delivery plasmid.
  • the delivery plasmid further includes a DNA sequence encoding a foreign protein, polypeptide, or fragment thereof.
  • a combination of pDV44 and p ⁇ EI B ⁇ gal or a similar construct such as, for example, that found in pDV44, p ⁇ E1 B ⁇ gal or the equivalent.
  • a recombinant adenovirus particle may be produced with a fiber protein, or it may be produced without a fiber protein ("fiberless particle") according to the present invention.
  • the particle is made without fiber, such as by passaging the fiberless viral vector genome, e.g., Ad ⁇ . ⁇ gal. ⁇ F in the 293 cells, a fiberless genome is replicated and packaged in a fiberless particle.
  • the fiberless genome Ad ⁇ . ⁇ gal. ⁇ F is passaged in the 211 B or other fiber expressing cells, a fiberless genome is replicated and packaged into a fiber-containing particle.
  • Recombinant adenovirus particles may be made such that they include no fiber proteins, modified fiber proteins or other exogenous proteins. They may also be produced in systems using either helper-independent or helper-dependent adenovirus recombinant genomes, i.e. with or without helper viruses.
  • a preferred viral vector particle in which therapeutic nucleotide compositions of this invention are present is derived from adenovirus (Ad).
  • Ad adenovirus
  • viral vector particles of this invention may be designed and constructed in such a way that they specifically target a preselected recipient cell type, depending on the nature of therapy one seeks to administer. Methods of making and using therapeutic viral vectors that target specific cells are further described in the Examples that follow.
  • Novel vectors, viral particles or compositions may also be designed and prepared to preferentially target cells that might not otherwise be targeted by wild- type adenovirus virions.
  • a therapeutic vector particle including a nucleotide sequence encoding a foreign protein, polypeptide or other ligand directed to a non-epithelial cell or to a different receptor than that generally targeted by a particular adenovirus.
  • useful ligands directed to specific receptors include the V3 loop of HIV gp120 (CD4); transferring (transferrin receptor); LDL, apolipoprotein B100, apolipoprotein E (LDL receptors); and deglycosylated proteins (asialoglycoprotein receptor).
  • CD4 V3 loop of HIV gp120
  • transferring transferrin receptor
  • LDL LDL
  • apolipoprotein B100 apolipoprotein E
  • LDL receptors deglycosylated proteins
  • deglycosylated proteins asialoglycoprotein receptor
  • the non-native amino acid residue sequence is incorporated into the fiber amino acid residue sequence at a location other than one of the fiber termini.
  • the non-native amino acid residue sequence alters the binding specificity of the fiber for a targeted cell type.
  • the linker sequence alters the binding specificity of the fiber for a targeted cell type.
  • the expressed fiber may, in various embodiments, bind to a specific targeted cell type not usually targeted by adenovirus and/or may comprise amino acid residue sequences from more than one adenovirus serotype.
  • Useful ligands may be encoded by a foreign nucleotide sequence contained within a viral vector of the present invention, or may be linked to proteins or polypeptides, include antibodies and attachment sequences, as well as receptors themselves.
  • antibodies to cell receptor molecules such as integrins and the like, MHC Class I and Class II, asialoglycoprotein receptor, transferrin receptors, LDL receptors, CD4, and CR2 are but a few which are useful according to the present invention.
  • the ligands typically bound by receptors, as well as analogs to those ligands may be used as cellular targeting agents, as disclosed herein.
  • the recombinant adenovirus vectors of the present invention typically in the form of an adenovirus particle encapsulating a recombinant adenovirus vector genome containing an expression cassette for expressing a therapeutic gene, are particularly suited for gene therapy.
  • various therapeutic methods are contemplated by the present invention.
  • Ad-derived viral vectors are capable of delivering a therapeutic nucleotide sequence to a specific cell or tissue, based on the tissue tropism of the particle, thereby expanding and enhancing treatment options available in numerous conditions in which more conventional therapies are of limited efficacy. Accordingly, methods of gene therapy utilizing a recombinant adenovirus particle containing a modified fiber or chimeric fiber which targets a preselected tissue, as described herein, is within the scope of the invention. Vector particles are typically purified and then an effective amount is administered in vivo or ex vivo (in vitro) ⁇ nXo the subject.
  • administration is often accomplished by first isolating a selected cell population from a patient such as lung epithelial cells, lymphocytes and the like followed by in vitro or ex vivo gene transfer of the therapeutic compositions of this invention and the replacement of the cells into the patient.
  • In vivo therapy is also contemplated, e.g., via the administration of therapeutic compositions of this invention by various delivery means.
  • aerosol administration and administration via subcutaneous, intravenous, intraperitoneal, intramuscular, ocular means and the like are also within the scope of the present invention.
  • the present invention also contemplates various methods of targeting specific cells ⁇ e.g., cells in a subject in need of diagnosis and/or treatment.
  • the present invention contemplates that the viral vectors and compositions of the present invention may be directed to specific receptors or cells, for the ultimate purpose of delivering those vectors and compositions to specific cells or cell types.
  • the viral vectors and constructs of the present invention are particularly useful in this regard.
  • adenovirus attachment and uptake into cells are separate but cooperative events that result from the interaction of distinct viral coat proteins with a receptor for attachment and ccv integrin receptors for intemalization.
  • Adenovirus attachment to the cell surface via the fiber coat proteins has been discovered to be dissociable and distinct from the subsequent step of intemalization, and the present invention is able to take advantage of and function in conjunction with these differing receptors.
  • the invention also discloses methods of transforming a pathologic hyperproliferative mammalian cell comprising contacting the cell with any of the vectors described herein.
  • methods of infecting a mammalian target cell with a viral vector containing a preselected foreign nucleotide sequence are disclosed.
  • One such variation comprises the following steps: (a) infecting the target cell with a viral vector of the present invention, the viral vector carrying a preselected foreign nucleotide sequence; and (b) expressing the foreign nucleotide sequence in the targeted cell.
  • the invention also encompasses mammalian target cells infected with a preselected foreign nucleotide sequence produced by the methods disclosed herein.
  • the target cells are selected from the group consisting of replicating, slow-replicating and non-replicating human cells.
  • Methods of treating an acquired or hereditary disease are also disclosed.
  • One method comprises (a) administering a pharmaceutically acceptable dose of a viral vector to a target cell, wherein the vector comprises a preselected therapeutic nucleotide sequence; and (b) expressing the therapeutic sequence in the target cell for a time period sufficient to ameliorate the acquired or hereditary disease in the cell.
  • Method of gene therapy comprising administering to a subject an effective amount of a therapeutic viral vector produced by a packaging cell line of the present invention are also disclosed.
  • Also contemplated by the present invention are various methods of inhibiting the proliferation of a tumor in a subject comprising administering an effective amount of a therapeutic viral vector of the present invention under suitable conditions to the subject.
  • the gene encodes an anti-tumor agent.
  • the agent is a tumor-suppressor gene.
  • the agent is a suicide gene or a functional equivalent thereof.
  • the vector is administered via intra-tumoral injection.
  • a composition of this invention may be used prophylactically or therapeutically in vivo to disrupt HIV infection and mechanisms of action by inhibiting gene expression or activation, via delivery of antisense HIV sequences or ribozymes to T cells or monocytes.
  • therapeutic viral vectors as disclosed herein to specific cells and tissues, including hematopoietic cells, as infection of such cells appears to be mediated by distinct integrins to which viral vectors of the present invention may readily be targeted.
  • therapeutic nucleotide sequences include antisense nucleotide sequences complementary to EBV EBNa-1 gene. Use of such therapeutic sequences may remediate or prevent latent infection of B cells with EBV. As discussed herein and in the Examples below, targeting and delivery may be accomplished via the use of various ligands, receptors, and other appropriate targeting agents.
  • a therapeutic method of the present invention comprises contacting the cells of a subject infected with EBV or HIV with a therapeutically effective amount of a pharmaceutically acceptable composition comprising a therapeutic nucleotide sequence of this invention.
  • the contacting involves introducing the therapeutic nucleotide sequence composition into cells having an EBV or HIV-mediated infection.
  • subject should be understood to include any animal - particularly mammalian - patient, such as any murine, rat, bovine, porcine, canine, feline, equine, ursine, or human patient.
  • the vector is useful to treat or reduce hyperproliferative cells in a subject, to inhibit tumor proliferation in a subject or to ameliorate a particular, related pathology.
  • the present invention also contemplates methods of depleting suitable samples of pathologic mammalian hyperproliferative cells contaminating hematopoietic precursors during bone marrow reconstitution via the introduction of a wild-type tumor suppressor gene into the cell preparation using a vector of this invention.
  • a suitable sample is defined as a heterogeneous cell preparation obtained from a patient, e.g., a mixed population of cells containing both phenotypically normal and pathogenic cells.
  • Administration includes ⁇ but is not limited to - the introduction of therapeutic agents of the present invention into a cell or subject via various means, including direct injection, intravenously, intraperitoneally, via intra-tumor injection, via aerosols, or topically.
  • Therapeutic agents as disclosed herein may also be combined for administration of an effective amount of the agents with a pharmaceutically-acceptable carrier, as described herein.
  • effective amount generally means the amount of vector particle (or proteins produced/released thereby) which achieves a positive outcome in the subject to whom the vector is administered.
  • the total volume administered will necessarily vary depending on the mode of administration, as those of skill in the relevant art will appreciate, and dosages may vary as well.
  • the dose of a biologic vector is somewhat complex and may be described in terms of the concentration (in plaque-forming units per milliliter (pfu/ml)), the total dose (in pfus), or the estimated number of particles administered per cell (the estimated multiplicity of infection or MOI).
  • concentration in plaque-forming units per milliliter (pfu/ml)
  • total dose in pfus
  • MOI the estimated multiplicity of infection
  • an effective amount administered in a single dose preferably contains from about 10 ⁇ to about 10 ⁇ infectious units.
  • a typical course of treatment would be one such dose per day over a period of five days.
  • an effective amount may vary depending on (1) the pathology or other condition to be treated, (2) the status and sensitivity of the patient, and (3) various other factors well known to those of skill in the art, such as the patient's tolerance to other courses of treatment that may have been applied previously.
  • those of skill in the art may easily and precisely determine effective amounts of the agents/vectors of the present invention which may be administered to a particular patient, based on their understanding of and evaluation of such factors.
  • the present invention also contemplates methods of ameliorating pathologies characterized by hyperproliferative cells or genetic defects in a subject, by administering to the subject an effective amount of a vector as described herein.
  • a vector as described herein.
  • Such vectors preferably contain a foreign gene encoding a gene product (e.g. polypeptide or protein) having the ability to ameliorate the pathology, under suitable conditions.
  • a gene product e.g. polypeptide or protein
  • the term "genetic defect” means any disease, condition or abnormality which results from inherited factors, e.g. Huntington's Disease, Tay-Sachs Disease, or Sickle Cell Disease.
  • the present invention further provides methods for reducing the proliferation of tumor cells in a subject by introducing into the tumor mass an effective amount of an adenoviral expression vector containing an anti-tumor gene other than a tumor suppressor gene.
  • the anti-tumor gene can encode, for example, thymidine kinase (TK).
  • TK thymidine kinase
  • the therapeutic agent is a thymidine kinase metabolite such as ganciclovir (GCV), 6-methoxypurine arabinonucleoside (araM), or a functional equivalent thereof.
  • GCV ganciclovir
  • Both the thymidine kinase gene and the thymidine kinase substrate must be used concurrently in order to exert a toxic effect on the host cell.
  • GCV is phosphorylated and becomes a potent inhibitor of DNA synthesis, whereas araM is converted to the cytotoxic anabolite araATP.
  • the precise method of action or synergism is not relevant to therapeutic efficacy; what is relevant is the fact that the concurrent use of appropriate genes and therapeutic agents may effectively ameliorate a specific disease condition.
  • Another useful example contemplates use of a vector of the present invention which expresses the enzyme cytosine deaminase.
  • a vector of the present invention which expresses the enzyme cytosine deaminase.
  • Such a vector could be used in conjunction with administration of the drug 5-fluorouracil (Austin and Huber, Mol. Pharm. 43: 380-387, 1993) or the recently-described E. coli Deo gene in combination with 6-methyl-purine-2'-deoxyribonucleoside (Sorscher et al., Gene Therapy 7: 233-238, 1994).
  • the use of other anti-tumor genes provides a treatment for the uncontrolled cell growth or proliferation characteristic of tumors and malignancies.
  • the present invention provides therapies to halt the uncontrolled cellular growth in a patient, thereby alleviating the symptoms or the disease or cachexia present in the patient.
  • the effect of this treatment includes, but is not limited to, prolonged survival time of the patient, reduction in tumor mass or burden, apoptosis of tumor cells, or the reduction in the number of circulating tumor cells. Means of quantifying the beneficial effects of this therapy are well known to those of skill in the art.
  • the present invention provides a recombinant adenovirus expression vector characterized by the partial or total deletion of one or more adenoviral structural protein genes, such as the gene encoding fiber, which allows the vector to accommodate a therapeutic, foreign nucleic acid sequence encoding a functional foreign polypeptide, protein, or biologically active fragment thereof.
  • a therapeutic gene sequence may be introduced into a tumor mass by combining the adenoviral expression vector with a suitable pharmaceutically acceptable carrier. Introduction can be accomplished, for example, via direct injection of the recombinant Ad vector into the tumor mass.
  • a method of tumor-specific delivery of a tumor-suppressor gene is accomplished by contacting target tissue in a subject with an effective amount of a recombinant Ad-derived vector of this invention.
  • the gene is intended to encode an anti-tumor agent, such as a functional tumor suppressor gene product or suicide gene product.
  • the term "contacting" is intended to encompass any delivery method for the efficient transfer of the vector, such as via intra-tumoral injection.
  • adenovirus vectors of the present invention can be used to transfer genes to central nervous system (CNS) tumors in vivo.
  • CNS central nervous system
  • the present invention also contemplates methods for determining the efficacy of the within-disclosed therapeutic compositions and methods.
  • One such method for confirming efficacy utilizes the human/SCID (severe combined immunodeficient) mouse model of EBV-induced LPD (lymphoproliferative disease) to ascertain whether EBV-antisense therapeutic nucleotide sequences block tumor formation.
  • SCID severe combined immunodeficient mouse model of EBV-induced LPD (lymphoproliferative disease
  • Ad vectors of the present invention to prepare medicaments for the treatment, therapy and/or diagnosis of various diseases is also contemplated by this invention.
  • other anti-tumor genes may be used in combination with the corresponding therapeutic agent to reduce the proliferation of tumor cells.
  • Such other gene-and-therapeutic-agent combinations are known to those of skill in the art and may be applied as taught herein.
  • compositions of the present invention may contain a physiologically tolerable carrier together with one or more therapeutic nucleotide sequences of this invention, dissolved or dispersed therein as an active ingredient.
  • the composition is not immunogenic or otherwise able to cause undesirable side effects when administered to a subject for therapeutic purposes.
  • compositions, carriers, diluents and reagents are used interchangeably and represent that the materials are capable of administration to or upon a subject -- e.g., a mammal - without the production of undesirable physiological effects such as nausea, dizziness, gastric upset and the like.
  • the present invention comprises therapeutic compositions useful in the specific targeting of epithelial or non-epithelial cells as well as in delivering a therapeutic nucleotide sequence to those cells.
  • Therapeutic compositions designed to preferentially target to epithelial cells may comprise a recombinant adenovirus-derived vector particle including a therapeutic nucleotide sequence.
  • a number of adenovirus-derived moieties are described, including particles lacking fiber, particles that contain wild type adenovirus fiber, and particles that contain modified or chimeric fiber, each type providing a different tissue tropism to the particle.
  • compositions that contains active ingredients dissolved or dispersed therein are well understood in the art.
  • compositions are prepared as injectables -- either as liquid solutions or suspensions -- however, solid forms suitable for solution or suspension in liquid prior to use can also be prepared.
  • a preparation can also be emulsified, or formulated into suppositories, ointments, creams, dermal patches, or the like, depending on the desired route of administration.
  • Physiologically tolerable carriers are well known in the art.
  • Exemplary of liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline.
  • aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes.
  • Liquid compositions can also contain liquid phases in addition to and to the exclusion of water.
  • additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions.
  • a therapeutic composition typically contains an amount of a therapeutic material, i.e., a nucleotide sequence or adenovirus vector particle of the present invention, sufficient to deliver a therapeutically effective amount to the target tissue, typically an amount of at least 0.1 weight percent to about 90 weight percent of therapeutic material per weight of total therapeutic composition.
  • a weight percent is a ratio by weight of therapeutic material, e.g., a nucleotide sequence, to total composition.
  • 0.1 weight percent is 0.1 grams of DNA segment per 100 grams of total composition.
  • the cell lines, viral vectors and methods of the present invention may also be used for purposes other than the direct administration of therapeutic nucleotide sequences.
  • the production of large quantities of biologically active proteins or polypeptides in cells transfected with the within- disclosed viral vectors is contemplated herein.
  • human lymphoblastoid cells may be transfected with a viral vector of the present invention carrying a human hematopoietic growth factor such as the gene for erythropoietin (EPO); cells so transfected are thus able to produce biologically active EPO.
  • EPO erythropoietin
  • Adenovirus packaging cell lines that are commonly used for growing adenovirus are useful as host cells for the preparation of adenovirus packaging cell lines.
  • Preferred cells include 293 cells, an adenovirus-transformed human embryonic kidney cell line obtained from the ATCC, having Accession Number CRL 1573; HeLa, a human epithelial carcinoma cell line (ATCC Accession Number CCL-2); A549, a human lung carcinoma cell line (ATCC Accession Number CCL 1889); and the like epithelial- derived cell lines.
  • the 293 cells contain the E1 early region regulatory gene. All cells were maintained in complete DMEM + 10% fetal calf serum unless otherwise noted.
  • the cell lines of this invention allow for the production and propagation of novel adenovirus-based gene delivery vectors having deletions in preselected gene regions, that are obtained by cellular complementation of adenoviral genes.
  • plasmid vectors that contain preselected functional units were designed as described herein. Such units include but are not limited to E1 early region, E4 and the viral fiber gene. The preparation of plasmids providing such complementation, thereby being "complementary plasmids or constructs," that are stably inserted into host cell chromosomes are described below.
  • the viral E4 regulatory region contains a single transcription unit which is alternately spliced to produce several different mRNAs.
  • the E4-expressing plasmid prepared as described herein and used to transfect the 293 cell line contains the entire E4 transcriptional unit as shown in Figure 1.
  • these oligonucleotides were designed to create novel sites for the restriction enzymes EcoRI and BamHI, respectively, as indicated with underlined nucleotides.
  • DNA was amplified via PCR using 30 cycles of 92 C for 1 minute, 50 C for 1 minute, and 72 C for 3 minutes resulting in amplified full-length E4 gene products.
  • the amplified DNA E4 products were then digested with EcoRI and BamHI for cloning into the compatible sites of pBluescript/SK+ by standard techniques to create the plasmid pBS/E4.
  • a 2603 base pair (bp) cassette including the herpes simplex virus thymidine kinase promoter, the hygromycin resistance gene, and the thymidine kinase polyadenylation signal was excised from the plasmid pMEP4 (Invitrogen, San Diego, CA) by digestion with Fspl followed by addition of BamHI linkers ( ⁇ 'CGCGGATCCGCG3') (SEQ ID NO: 3) for subsequent digestion with BamHI to isolate the hygromycin-containing fragment.
  • the isolated BamHI- modified fragment was then cloned into the BamHI site of pBS/E4 containing the E4 region to create the plasmid pE4/Hygro containing 8710 bp ( Figure 2).
  • the pE4/Hygro plasmid has been deposited with the ATCC as described in Example 3.
  • the complete nucleotide sequence of pE4/Hygro is listed in SEQ ID NO: 4.
  • Position number 1 of the linearized vector corresponds to approximately the middle portion of the pBS/SK+ backbone as shown in Figure 2 as a thin line between the 3' BamHI site in the hygromycin insert and the 3' EcoRI site in the E4 insert.
  • the ⁇ ' and 3' ends of the E4 gene are located at respective nucleotide positions 3820 and 707 of SEQ ID NO: 4 while the 5' and 3' ends of the hygromycin insert are located at respective nucleotide positions 3830 and 6470.
  • the E4 and hygromycin resistance genes were divergently transcribed.
  • primers were designed to amplify the fiber coding region from Ad5 genomic DNA with the addition of unique BamHI and Notl sites at the 5' and 3' ends of the fragment, respectively.
  • the Ad5 nucleotide sequence is available with the GenBank Accession Number M18369.
  • the 5' and 3' primers had the respective nucleotide sequences of
  • the 5' primer also contained a nucleotide substitution 3 nucleotides ⁇ ' of the second ATG codon (C to A) that is the initiation site. The nucleotide substitution was included so as to improve the consensus for initiation of fiber protein translation.
  • the amplified DNA fragment was inserted into the BamHI and Notl sites of pcDNA3 (Invitrogen) to create the plasmid designated pCDNA3/Fiber having 7148 bp, the plasmid map of which is shown in Figure 3.
  • the parent plasmid contained the CMV promoter, the bovine growth hormone (BHG) terminator and the gene for conferring neomycin resistance.
  • the viral sequence included in this construct corresponds to nucleotides 31040-32791 of the Ad ⁇ genome.
  • the complete nucleotide sequence of pCDNA3/Fiber is listed in SEQ ID NO: 7 where the nucleotide position 1 corresponds to approximately the middle of the pcDNA3 vector sequence.
  • the ⁇ 1 and 3' ends of the fiber gene are located at respective nucleotide positions 916 with ATG and 2661 with TAA.
  • a Bglll fragment containing the tripartite leader (TPL) of adenovirus type 5 was excised from pRD112a (Sheay et al., BioTechniques, 16:856-862 (1993) and inserted into the BamHI site of pCDNA3/Fiber to create the plasmid pCLF having 7469 bp, the plasmid map of which is shown in Figure 4.
  • the adenovirus tripartite leader sequence present at the 5' end of all major late adenoviral mRNAs as described by Logan et al., Proc. Natl. Acad.
  • the corresponding cDNA sequence of the partial tripartite leader sequence present in pCLF is listed in SEQ ID NO: 8 bordered by BamHI/Bglll 5' and 3' sites at respective nucleotide positions 907-912 to 1228-1233.
  • the nucleotide sequence of an isolated partial TPL of the present invention is also listed separately as SEQ ID NO: 8
  • ID NO: 26 with the noted 5' and 3' restriction sites and with the following nucleotide regions identified: 1-6 nt Bglll site; 1 -18 nt polylinker; 19-27 nt last 9 nt of the first leader segment (exon 1); 28-99 nt second leader segment (exon 2); 100-187 nt third leader segment (exon 3); 188-301 nt contains the nt sequence immediately following the third leader in the genome with an unknown function; and 322-327 nt
  • the pCLF plasmid has been deposited with the ATCC as described in
  • Example 3 The complete nucleotide sequence of pCLF is listed in SEQ ID NO: 8 where the nucleotide position 1 corresponds to approximately the middle of the pcDNA3 parent vector sequence.
  • the 5' and 3 ends of the Ad5 fiber gene are located at respective nucleotide positions 1237-1239 with ATG and 2980-2982 with
  • the 293 cell line was selected for preparing the first adenovirus packaging line as it already contains the E1 gene as prepared by Graham et al., J. Gen. Virol., 38:69-74 (1977) and as further characterized by Spector, Virol., 730:533-638 (1983).
  • 293 cells were grown in RPMI medium + 10% fetal calf serum.
  • Four x 10 ⁇ cells were electroporated with 20 ⁇ g each of pE4/Hygro DNA and pCLF DNA using a BioRad GenePulser and settings of 300 V, 25 ⁇ F.
  • DNA for electroporation was prepared using the Qiagen system according to the manufacturer's instructions (Bio-Rad, Richmond, CA).
  • E4 DNA was isolated using the "MICROTURBOGEN" system (Invitrogen) according to manufacturer's instructions.
  • the presence of integrated E4 DNA was assessed by PCR using the primer pair E4R and ORF6L (5TGCTTAAGCGGCCGCGAAGGAGA AGTCC3') (SEQ ID NO: 9), the latter of which is a 5' forward primer near adenovirus ⁇ open reading frame 6.
  • E4R and ORF6L 5TGCTTAAGCGGCCGCGAAGGAGA AGTCC3'
  • SEQ ID NO: 9 5' forward primer near adenovirus ⁇ open reading frame 6.
  • Figure 1 for position of the primers relative to the E4 genes.
  • One clone, designated 211 was selected exhibiting altered growth properties relative to that seen in parent cell line 293.
  • the 211 clone contained the expected product, indicating the presence of inserted DNA corresponding to most, if not all, of the E4 fragment contained in the pE4/Hygro plasmid.
  • the 211 cell line has been deposited with the ATCC as described in Example 3. This line was further evaluated by amplification using the primer pair E4L/E4R described above, and a product corresponding to the full-length E4 insert was detected. Genomic Southern blotting was performed on DNA restricted with EcoRI and BamHI.
  • the E4 fragment was then detected at approximately one copy/genome compared to standards with the EcoRI/BamHI E4 fragment as cloned into pBS/E4 for use as a labeled probe with the Genius system according to manufacturer's instructions (Boehringer Mannheim, Indianapolis, IN).
  • the expected labeled internal fragment pE4/Hygro hybridized with the isolated E4 sequences.
  • the probe hybridized to a larger fragment which may be the result of a second insertion event ( Figure 5).
  • the 211 cell line was not selected by neomycin resistance, thus indicating the absence of fiber gene, to confirm the lack of fiber gene, the 211 cell line was analyzed for expression of fiber protein by indirect immunofluorescence with an anti-fiber polyclonal antibody and a FITC-labeled anti-rabbit IgG (KPL) as secondary. No immunoreactivity was detected. Therefore, to generate 211 clones containing recombinant fiber genes, the 211 clone was expanded by growing in RPMI medium and subjected to additional electroporation with the fiber-encoding pCLF plasmid as described above.
  • Lines positive for nuclear staining in this assay were then subjected to Western blot analysis under denaturing conditions using the same antibody.
  • Several lines in which the antibody detected a protein of the expected molecular weight (62 kd for the Ad ⁇ fiber protein) were selected for further study including 211 A, 211 B and 211 R.
  • the 211 A cell line has been deposited with ATCC as described in Example 3.
  • Immunoprecipitation analysis using soluble nuclear extracts from these three cell lines and a seminative electrophoresis system demonstrated that the fiber protein expressed is in the functional trimeric form characteristic of the native fiber protein as shown in Figure 6.
  • the predicted molecular weight of a trimerized fiber is 186 kd.
  • the lane marked 293 lacks fiber while the sublines contain detectable fiber.
  • plasmid vectors containing E1 alone or in various combinations with E4 and fiber genes are constructed as described below.
  • the region of the adenovirus genome containing the E1 a and E1 b gene is amplified from viral genomic DNA by PCR as previously described.
  • the primers used are E1L, the 5' or forward primer, and E1 R, the 3' or backward primer, having the respective nucleotide sequences ⁇ 'CCG AGCTAGC GACTGAAAATGAG3' (SEQ ID NO: 10) and ⁇ 'CCTCTCGAG AGACAGC AAGACAC3' (SEQ ID NO: 11 ).
  • the E1L and E1 R primers include the respective restriction sites Nhel and Xhol as indicated by the underlines.
  • the sites are used to clone the amplified E1 gene fragment into the Nhel/Xhol sites in pMAM commercially available from Clontech (Palo Alto, CA) to form the plasmid pDEX/E1 having 11162 bp, the plasmid map of which is shown in Figure 7.
  • the complete nucleotide sequence of pDEX/E1 is listed in SEQ ID NO: 12 where the nucleotide position 1 corresponds to approximately 1464 nucleotides from the 3' end of the pMAM backbone vector sequence.
  • the pDEX/E1 plasmid includes nucleotides 562 to 4090 of the adenovirus genome positioned downstream (beginning at nucleotide position 1460 and ending at 4998 in the pDEX/E1 plasmid) of the glucocorticoid-inducible mouse mammary tumor virus (MMTV) promoter of pMAM.
  • the pMAM vector contains the E.
  • the pMAM backbone occupies nucleotide positions 1-1454 and 5006-11162 of SEQ ID NO: 12.
  • adenovirus packaging cell lines equivalent to that of the 211 sublines, 211 A, 211 B and 211 R, as described in Example 1C, alternative cell lines lacking adenoviral genomes are selected for transfection with the plasmid constructs as described below.
  • Acceptable host cells include A549, Hela, Vero and the like cell lines as described in Example 1.
  • the selected cell line is transfected with the separate plasmids, pDEX/EI and pCLF, respectively for expressing E1 , and fiber complementary proteins.
  • clones containing stable insertions of the two plasmids are isolated by selection with neomycin and HAT. Integration of full- length copy of the E1 gene is assessed by PCR amplification from genomic DNA using the primer set E11JE1 R , as described above. Functional insertion of the fiber gene is assayed by staining with the anti-fiber antibody as previously described.
  • the resultant stably integrated cell line is then used as a packaging cell system to complement adenoviral gene delivery vectors having the corresponding adenoviral gene deletions as described in Example 2.
  • the selection of packaging cell, content of the delivery plasmids and content of the complementing plasmids for use in generating recombinant adenovirus viral vectors of this invention thus depends on whether other adenoviral genes are deleted along with the adenoviral fiber gene, and, if so, which ones.
  • a DNA fragment containing sequences for the CMV promoter, adenovirus tripartite leader, fiber gene and bovine growth hormone terminator is amplified from pCLF prepared in Example 1 B using the forward primer 5'GACGGATCGGGAGATCTCC3' (SEQ ID NO: 13), that anneals to the nucleotides 1-19 of the pCDNA3 vector backbone in pCLF, and the backward primer ⁇ 'CCGCCTCAGAAGCCATAGAGCC3' (SEQ ID NO: 14) that anneals to nucleotides 1278-1267 of the pCDNA3 vector backbone.
  • the fragment is amplified as previously described and then cloned into the pDEX/E1 plasmid, prepared in Example 1 D.
  • the pDEX/E1 vector is first digested with Ndel, that cuts at a unique site in the pMAM vector backbone in pDEX/E1 , then the ends are repaired by treatment with bacteriophage T4 polymerase and dNTPs.
  • the resulting plasmid containing E1 and fiber genes designated pE1/Fiber, provides both dexamethasone-inducible E1 function as described for DEX/E1 and expression of Ad ⁇ fiber protein as described above.
  • a schematic plasmid map of pE1/Fiber, having 14466 bp, is shown in Figure 8.
  • the complete nucleotide sequence of pE1 /Fiber is listed in SEQ ID NO: 16 where the nucleotide position 1 corresponds to approximately to 1469 nucleotides from the 3' end of the parent vector pMAM sequence.
  • the 5' and 3 ends of the Ad ⁇ E1 gene are located at respective nucleotide positions 1460 and 4998 followed by pMAM backbone and then separated from the Ad ⁇ fiber from pCLF by the filled-in blunt ended Ndel site.
  • the ⁇ ' and 3' ends of the pCLF fiber gene fragment are located at respective nucleotide positions 10922-14223 containing elements as previously described for pCLF.
  • the resultant pE1/Fiber plasmid is then used to complement one or more delivery plasmids expressing E1 and fiber.
  • the pE1/Fiber construct is then used to transfect a selected host cell as described in Example 1 E to generate stable chromosomal insertions preformed as previously described followed by selection on HAT medium.
  • the stable cells are then used as packaging cells as described in Example 2.
  • pCLF prepared as described in Example 1 B is partially digested with Bglll to cut only at the site in the pCDNA3 backbone.
  • the pE4/Hygro plasmid prepared in Example 1A is digested with BamHI to produce a fragment containing E4.
  • the E4 fragment is then inserted into the BamHI site of pCLF to form plasmid pE4/Fiber.
  • the resultant plasmid provides expression of the fiber gene as described for pCLF and E4 function as described for pE4/Hygro.
  • the complete nucleotide sequence of pE4/Fiber is listed in SEQ ID NO: 16 where the nucleotide position 1 corresponds to approximately 14 bp from the 3' end of the parent vector pCDNA3 backbone sequence.
  • the 5' and 3 ends of the Ad5 E4 gene are located at respective nucleotide positions 21 and 3149 followed by fused Bglll/BamHI sites and pCDNA3 backbone including the CMV promoter again followed by Bglll/BamHI sites.
  • the adenovirus leader sequence begins at nucleotide position 4051 and extends to 4366 followed by fused BamHI/Bglll sites and the 5' and 3' ends of the fiber gene located at respective nucleotide positions 4372 and 6124.
  • Adenoviral delivery vectors of this invention are prepared to separately lack the combinations of E1 /fiber and E4/fiber. Such vectors are more replication- defective than those previously in use due to the absence of multiple viral genes.
  • a preferred adenoviral delivery vector of this invention that is replication competent but only via a non-fiber means is one that only lacks the fiber gene but contains the remaining functional adenoviral regulatory and structural genes. Furthermore, the adenovirus delivery vectors of this invention have a higher capacity for insertion of foreign DNA.
  • the plasmid p ⁇ El B ⁇ gal was constructed as follows. A DNA fragment containing the SV40 regulatory sequences and E. coli ⁇ -galactosidase gene was isolated from pSV ⁇ gal (Promega) by digesting with Vspl, filling the overhanging ends by treatment with Klenow fragment of DNA polymerase I in the presence of dNTP's and digesting with Bam H1.
  • Plasmid DNA may be prepared by the alkaline lysis method as described by Bimboim and Doly, Nuc.
  • plasmid DNAs may be purified from E. coli by standard methods known in the art (e.g. see Sambrook et al.)
  • the second plasmid (pDV44), prepared as described herein, is derived from pBHGI O, a vector prepared as described by Bett et al., Proc. Natl. Acad. Sci., USA, 91 :8802-8806 (1994), now described in International Application Publication Number WO 9600666, with methodology well known to one of ordinary skill in the art and also is commercially available from Microbix, which contains an Ad ⁇ genome with the packaging signals at the left end deleted and the E3 region (nucleotides 28133:30818) replaced by a linker with a unique site for the restriction enzyme Pad.
  • This fragment was replaced with a 3,4 kb fragment containing the ITR segments and the E4 gene which was generated by PCR amplification from pBHGI O using the following oligonucleotide sequences ( ⁇ ' TGTACACCG GATCCGGCGCACACC3' SEQ ID NO: 17) and ( ⁇ 'CACAACGAGCTC AATTAATTAATTGCCACATCCTC3' SEQ ID NO: 18). These primers incorporated sites for Pad and BamHI. Cloning this fragment into the Pa and blunt ended Sail sites of the p11.3 backbone resulted in a substitution of the fused ITRs, E4 region and fiber gene present in pBHGIO, by the ITRs and E4 region alone.
  • plasmid pDV43a The resultant p11.3 plasmid containing the ITR and E4 regions, now called plasmid pDV43a, was then digested with BamHI. This BamHI fragment was then used to replace a BamHI fragment in pBHGIO thereby creating pDV44 in a pBHGIO backbone.
  • pDV44 as above was constructed by removing the fiber gene and some of the residual E3 sequences from pBHGIO (Microbix Biosystems). As above, to simplify manipulations, the 11.9 kb BamHI fragment including the rightmost part of the Ad5 genome was removed from pBHGI O and inserted into pBS/SK. The resulting plasmid was termed p11.3.
  • the 3.4 kb DNA fragment corresponding to the E4 region and both ITRs of adenovirus type ⁇ was amplified as described above from pBHGIO using the oligonucleotides listed above and subcloned into the vector pCR2.1 (Invitrogen) to create pDV42.
  • This step is the additional cloning step to facilitate the incorporation of a Sail restriction site.
  • pDV42 was then digested with Pad, which cuts at a unique site (bold type) in one of the PCR primers, and with Sail, which cuts at a unique site in the pCR2.1 polylinker.
  • pDV44 was constructed by replacing the 11.9 kb BamHI fragment of pBHGIO by the analogous BamHI fragment of pDV43. As generated in the first procedure, pDV44 therefore differs from pBHGIO by the deletion of Ad ⁇ nucleotides 30819:32743 (residual E3 sequences and all but the 3'-most 41 nucleotides of the fiber open reading frame).
  • pDV44 fiber-deleted Ad5 genomic plasmid
  • Figure 16A pDV44 contains a wild-type E4 region, but only the last 41 nucleotides of the fiber ORF (this sequence was retained to avoid affecting expression of the adjacent E4 transcription unit).
  • Both pBHGI O and pDV44 contain unpackageable Ad5 genomes, and must be rescued by cotransfection and subsequent homologous recombination with DNA carrying functional packaging signals.
  • pDV44 or pBHGIO was cotransfected with p ⁇ EI B ⁇ gal, which contains the left end of the Ad ⁇ genome with an SV40-driven ⁇ -galactosidase reporter gene inserted in place of the E1 region.
  • the method for virus production by recombination of plasmids followed by complementation in cell culture involves the isolation of recombinant viruses by cotransfection of any one of the adenovirus packaging cell systems prepared in Example 1 , namely 211 A, 211 B, 211 R, A549, Vero cells, and the like, with plasmids carrying sequences corresponding to viral gene delivery vectors.
  • a selected cell line is plated in dishes and cotransfected with pDV44 and p ⁇ EI B ⁇ gal using the calcium phosphate method as described by Bett et al., Proc. Natl. Acad. Sci., USA, 97:8802-8806 (1994).
  • Recombination between the overlapping adenovirus sequences in the two plasmids leads to the creation of a full-length viral chromosome where pDV44 and p ⁇ EI B ⁇ gal recombine to form a recombinant adenovirus vector having multiple deletions.
  • the deletion of E1 and of the fiber gene from the viral chromosome is compensated for by the sequences integrated into the packaging cell genome, and infectious virus particles are produced.
  • the plaques thus generated are isolated and stocks of the recombinant virus are produced by standard methods.
  • a pDV44-derived virus is expected to be replication-defective due to the fiber deletion, so that the cells in which it is grown must complement this defect.
  • the 211 B cell line (a derivative of 293 cells which expresses the wild-type (wt) AD5 fiber and is equivalent to 211 A on deposit with ATCC as described in Example 3) was used for rescue and propagation of the virus described here.
  • pDV44 and p ⁇ EI B ⁇ gal were cotransfected into 211 B cells, and the monolayers were observed for evidence of cytopathic effect (CPE). Briefly, for virus construction, cells were transfected with the indicated plasmids using the Gibco Calcium Phosphate Transfection system according to the manufacturer's instructions and observed daily for evidence of CPE.
  • Ad ⁇ . ⁇ gal. ⁇ F virus
  • Ad ⁇ . ⁇ gal. ⁇ F virus
  • a crude freeze-thaw lysate was prepared from these cells and the resulting virus (termed Ad ⁇ . ⁇ gal. ⁇ F) was plaque purified twice and then expanded.
  • purified viral preparations cells were infected with the indicated Ad and observed for completion of CPE. Briefly, at day zero, 211 B cells were plated in DMEM plus 10% fetal calf serum at approximately 1 X 10 7 cells/150 cm 2 flask or equivalent density. At day one, the medium was replaced with one half the original volume of fresh DMEM containing the indicated Ad, in this case Ad ⁇ . ⁇ gal. ⁇ F, at approximately 100 particles/cell.
  • Ad preparations were titered by plaque assay on 211 B cells.
  • Cells were plated on polylysine-coated 6 well plates at 1.5 x 10 6 cells/well.
  • Duplicate dilutions of virus stock were added to the plates in 1 ml/well of complete DMEM. After a five hour incubation at 37°C, virus was removed and the wells overlaid with 2 ml of 0.6% low-melting agarose in Medium 199 (Gibco). An additional 1 ml of overlay was added at five day intervals.
  • the first-generation virus Ad ⁇ . ⁇ gal.wt which is identical to Ad ⁇ . ⁇ gal. ⁇ F except for the fiber deletion, was constructed by cotransfection of pBHGIO and p ⁇ EI B ⁇ gal ( Figure 16B). In contrast to the low efficiency of recovery of the fiberless genome (1/58 dishes), all of 9 dishes cotransfected with p ⁇ EI B ⁇ gal and pBHGIO produced virus.
  • a delivery plasmid is prepared that does not require the above- described recombination events to prepare a viral vector having a fiber gene deletion.
  • a single delivery plasmid containing all the adenoviral genome necessary for packaging but lacking the fiber gene is prepared from plasmid pFG140 containing full-length Ad5 that is commercially available from Microbix.
  • the resultant delivery plasmid referred to as pFG140-f is then used with pCLF stably integrated cells as described above to prepare a viral vector lacking fiber.
  • the fiber gene is replaced with a therapeutic gene of interest for preparing a therapeutic delivery adenoviral vector.
  • Other embodiments including production of fiberless vector with a complete TPL are described in Example ⁇ .
  • Vectors for the delivery of any desired gene and preferably a therapeutic gene are prepared by cloning the gene of interest into the multiple cloning sites in the polylinker of commercially available p ⁇ E1sp1 B (Microbix Biosystems), in an analogous manner as performed for preparing p El B ⁇ gal as described above. The same cotransfection and recombination procedure is then followed as described herein to obtain viral gene delivery vectors as further discussed in later Examples. 1. Characterization of the Ad ⁇ . ⁇ gal. ⁇ F Genome
  • the DNA isolated from viral particles was analyzed. Briefly, purified viral DNA was obtained by adding 10 ⁇ l of 10 mg/ml proteinase K, 40 ⁇ l of O. ⁇ M EDTA and 50 ⁇ l of 10% SDS to 800 ⁇ l of adenovirus-containing culture supernatant. The suspension was then incubated at 56C for 60 minutes. The solution was then extracted once with 400 ⁇ l of a 24:1 mixture of chloroform:isoamyl alcohol. The aqueous phase was then removed and precipitated with sodium acetate/ethanol. The pellet was washed once with 70% ethanol and lightly dried.
  • the complete nucleotide sequence of Ad ⁇ . ⁇ gal. ⁇ F is presented in SEQ ID NO: 27 and is contained in the virus particle on deposit with ATCC.
  • Ad ⁇ . ⁇ gal. ⁇ F was fiber-defective
  • 293 cells which are permissive for growth of E1 -deleted Ad vectors but do not express fiber
  • Ad ⁇ . ⁇ gal. ⁇ F or Ad ⁇ . ⁇ gal.wt were infected with Ad ⁇ . ⁇ gal. ⁇ F or with Ad ⁇ . ⁇ gal.wt.
  • Twenty-four hours post infection the cells were stained with polyclonal antibodies directed either against fiber or against the penton base protein.
  • Cells infected with either virus were stained by the anti-penton base antibody, while only cells infected with the Ad ⁇ . ⁇ gal.wt control virus reacted with the anti-fiber antibody. This confirms that the fiber-deleted Ad mutant does not direct the synthesis of fiber protein.
  • Ad ⁇ . ⁇ gal. ⁇ F was found to readily be propagated in 211 B cells.
  • CsCI-purified stocks of either Ad ⁇ . ⁇ gal. ⁇ F or Ad ⁇ . ⁇ gal.wt contained similar numbers of viral particles (Table 1), and the particles appeared to band normally on CsCI gradients.
  • infectivity of the Ad ⁇ . ⁇ gal. ⁇ F particles was lower than the Ad ⁇ . ⁇ gal.wt control, as indicated by an increased particle/PFU ratio (Table 1). This is likely due to a reduced amount of fiber protein incorporated into mutant particles during growth in the
  • Ad ⁇ . ⁇ gal. ⁇ F was also found to plaque more slowly than the control virus.
  • Ad ⁇ . ⁇ gal.wt plaques appeared within ⁇ -7 days, while plaques of Ad ⁇ . ⁇ gal. ⁇ F continued to appear until as much as 16-18 days post infection. Despite their slower formation, the morphology of Ad ⁇ . ⁇ gal. ⁇ F plaques was essentially normal. 4. Production of Fiberless Ad ⁇ . ⁇ gal. ⁇ F Particles
  • Ad ⁇ . ⁇ gal. ⁇ F represents a true fiber null mutation and its stocks are free of helper virus
  • the fiber mutant phenotype was readily investigated.
  • a single round of growth in cells (such as 293) which do not produce fiber generating a homogeneous preparation of fiberless Ad allowed for the determination of whether such particles would be stable and/or infectious.
  • Either Ad ⁇ . ⁇ gal.wt or Ad ⁇ . ⁇ gal. ⁇ F was grown in 293 or 211 B cells, and the resulting particles purified on CsCI gradients as previously described.
  • Ad ⁇ . ⁇ gal. ⁇ F particles were readily produced in 293 cells at approximately the same level as the control virus and behaved similarly on the gradients, indicating that there was not a gross defect in morphogenesis of fiberless capsids (Table 1).
  • particles of either virus contained similar amounts of penton base regardless of the cell type in which they were grown. This demonstrated that fiber is not required for assembly of the penton base complex into virions.
  • the Ad ⁇ . ⁇ gal. ⁇ F particles produced in 293 cells did not contain fiber protein.
  • 21 I B-grown Ad ⁇ . ⁇ gal. ⁇ F also contained less fiber than the Ad ⁇ . ⁇ gal.wt control virus ( Figure 18).
  • the infectivities of the different viral preparations on epithelial cells (Table 1) correlated with the amount of fiber protein present.
  • the fiberless Ad particles were several thousand-fold less infectious than the first-generation vector control on a per-particle basis, while infectivity of 21 I B-grown Ad ⁇ . ⁇ gal. ⁇ F was only 60-100 fold less than that of Ad ⁇ . ⁇ gal.wt. These studies confirmed fiber's crucial role in infection of epithelial cells via CAR binding.
  • the proteins contained in particles of 293-grown Ad ⁇ . ⁇ gal. ⁇ F were compared to those in Ad ⁇ . ⁇ gal.wt, to determine whether proteolysis or particle assembly was defective in this fiber null mutant (data not shown).
  • the overall pattern of proteins in the fiberless particles was observed to be quite similar to that of a first-generation vector, with the exception of reduced intensity of the composite band resulting from both proteins Ilia and IV (fiber) (data not shown).
  • the fiberless particles also had a reduced level of protein VII. Although substantial amounts of uncleaved precursors to proteins VI, VII, and VIII were not seen, it is possible that the low-molecular weight bands migrating ahead of protein VII represent either aberrantly cleaved viral proteins or their breakdown products.
  • Three-dimensional image reconstructions of fiberless and wild-type particles at -20 A resolution showed similar sizes and overall features, with the exception that fiberless particles lacked density corresponding to the fiber protein.
  • the fiber was truncated in the wild-type structure as only the lower portion of its flexible shaft follows icosahedral symmetry.
  • the RGD protrusions on the fiberless penton base were angled slightly inward relative to those of the wild-type structure.
  • THP-1 cells Infection of THP-1 cells was assayed by infecting 2 x 10 5 cells at the indicated m.o.i. in 0.5 ml of complete RPMI. Forty-eight hours post-infection, the cells were fixed with glutaraldehyde and stained with X-gal, and the percentage of stained cells was determined by light microscopy.
  • virus particles are produced by growth in the packaging lines described in Example 1 and are purified by CsCI gradient centrifugation. Following titering, virus particles are administered to mice via systemic or local injection or by aerosol delivery to lung.
  • the LacZ reporter gene allows the number and type of cells which are successfully transduced to be evaluated.
  • the duration of transgene expression is evaluated in order to determine the long-term effectiveness of treatment with multiply-deleted recombinant adenoviruses relative to the standard technologies which have been used in clinical trials to date.
  • the immune response to the improved vectors described here is determined by assessing parameters such as inflammation, production of cytotoxic T lymphocytes directed against the vector, and the nature and magnitude of the antibody response directed against viral proteins.
  • adenovirus binding to target cells is largely determined by the fiber protein
  • viral particles that incorporate modified fiber proteins or fiber proteins from different adenoviral serotypes have different specificities.
  • the methods of expression of the native Ad ⁇ fiber protein in adenovirus packaging cells as described above is also applicable to production of different fiber proteins.
  • chimeric fiber proteins are produced according to the methods of Stevenson et al., J. Virol., 89:2860-2867 (1995). The authors showed that the determinants for fiber receptor binding activity are located in the head domain of the fiber and that isolated head domain is capable of trimerization and binding to cellular receptors. The head domains of adenovirus type 3 (Ad3) and Ad ⁇ were exchanged in order to produce chimeric fiber proteins. Similar constructs for encoding chimeric fiber proteins for use in the methods of this invention are contemplated. Thus, instead of the using the intact Ad ⁇ fiber-encoding construct prepared in Example 1 as a complementing viral vector in adenoviral packaging cells, the constructs described herein are used to transfect cells along with E4 and/or E1 -encoding constructs.
  • Ad ⁇ and Ad3 fiber genes were amplified from purified adenovirus genomic DNA as a template.
  • the Ad ⁇ and Ad3 nucleotides sequences are available with the respective GenBank Accession Numbers M18369 and M1241 1.
  • Oligonucleotide primers are designed to amplify the entire coding sequence of the full-length fiber genes, starting from the start codon, ATG, and ending with the termination codon TAA.
  • the 5' and 3' primers contain the respective restriction sites BamHI and Notl for cloning into pcDNA plasmid as described in Example 1A. PCR is performed as described above.
  • the resultant products are then used to construct chimeric fiber constructs by PCR gene overlap extension, as described by Horton et al., BioTechniques, 8:625- 535 (1990).
  • the Ad ⁇ fiber tail and shaft regions (6TS; the nucleotide region encoding amino acid residue positions 1 to 403) are connected to the Ad3 fiber head region (3H; the nucleotide region encoding amino acid residue positions 136 to 319) to form the 5TS3H fiber chimera.
  • Ad3 fiber tail and shaft regions (3TS; the nucleotide region encoding amino acid residues positions 1 to 136) are connected to the Ad ⁇ fiber head region ( ⁇ H; the nucleotide region encoding the amino acid residue positions 404 to 581) to form the 3TS5H fiber chimera.
  • the fusions are made at the conserved TLWT (SEQ ID NO: 19) sequence at the fiber shaft-head junction.
  • the resultant chimeric fiber PCR products are then digested with BamHI and Notl for separate directional ligation into a similarly digested pcDNA 3.1.
  • the TPL sequence is then subcloned into the BamHI as described in Example 1 A for preparing an expression vector for subsequent transfection into 211 cells as described above or into the alternative packaging cell systems as previously described.
  • the resultant chimeric fiber construct-containing adenoviral packaging cell lines are then used to complement adenoviral delivery vectors as previously described.
  • Other fiber chimeric constructs are obtained using a similar approach with the various adenovirus serotypes known.
  • the methods of this invention contemplate the use of the modified proteins including novel epitopes as described by Michael et al., Gene Therapy, 2:660-668 (1995) and in International Publication WO 95/26412.
  • Both publications describe the construction of a cell-type specific therapeutic viral vector having a new binding specificity incorporated into the virus concurrent with the destruction of the endogenous viral binding specificity.
  • the authors described the production of an adenoviral vector encoding a gastrin releasing peptide (GRP) at the 3' end of the coding sequence of the Ad ⁇ fiber gene.
  • the resulting fiber-GRP fusion protein was expressed and shown to assemble functional fiber trimers that were correctly transported to the nucleus of HeLa cells following synthesis.
  • heterologous ligands contemplated for use herein to redirect fiber specificity range from as few as 10 amino acids in size to large globular structures, some of which necessitate the addition of a spacer region so as to reduce or preclude steric hindrance of the heterologous ligand with the fiber or prevent trimerization of the fiber protein.
  • the ligands are inserted at the end or within the linker region.
  • Preferred ligands include those that target specific cell receptors or those that are used for coupling to other moieties such as biotin and avidin.
  • a preferred spacer includes a short 12 amino acid peptide linker composed of a series of serines and alanine flanked by a proline residue at each end.
  • linkers One of ordinary skill in the art is familiar with the preparation of linkers to accomplish sufficient protein presentation and for altering the binding specificity of the fiber protein without compromising the cellular events that follow viral intemalization.
  • preparation of modified fibers having ligands positioned internally within the fiber protein and at the carboxy terminus as described below are contemplated for use with the methods described herein.
  • the preparation of a fiber having a heterologous binding ligand is prepared essentially as described in the above-cited paper. Briefly, for the ligand of choice, site-directed mutagenesis is used to insert the coding sequence for a linker into the 3' end of the Ad ⁇ fiber construct in pCLF as prepared in Example 1.
  • the 3' or antisense or mutagenic oligonucleotide encodes a preferred linker sequence of ProSerAlaSerAlaSerAlaSerAlaProGlySer (SEQ ID NO: 20) followed by a unique restriction site and two stop codons, respectively, to allow the insertion of a coding sequence for a selected heterologous ligand and to ensure proper translation termination. Flanking this linker sequence, the mutagenic oligonucloetide contains sequences that overlap with the vector sequence and allo its incorporation into the construct.
  • a nucleotide sequence encoding a preselected ligand is obtained, linkers corresponding to the unique restriction site in the modified construct are attached and then the sequence is cloned into linearized corresponding restriction site.
  • the resultant fiber-ligand construct is then used to transfect 211 or the alternative cell packaging systems previously described to produce complementing viral vector packaging systems for use with the methods of this invention.
  • intact fiber genes from different Ad serotypes are expressed by 211 cells or an alternative packaging system as previously described.
  • a gene encoding the fiber protein of interest is first cloned to create a plasmid analogous to pCLF, and stable cell lines producing the fiber protein are generated as described above for Ad ⁇ fiber.
  • the adenovirus vector described which lacks the fiber gene is then propagated in the cell line producing the fiber protein relevant for the purpose at hand.
  • the adenoviruses produced contain only the fiber protein of interest and therefore have the binding specificity conferred by the complementing protein.
  • Such viral particles are used in studies such as those described above to determine their properties in experimental animal systems.
  • Ad ⁇ . ⁇ gal. ⁇ F The following virus, Ad ⁇ . ⁇ gal. ⁇ F , deposit was deposited on January 15, 1999, with the ATCC as listed above and provided with accession number VR2636.
  • Plasmids pDV60, pDV67, pDV69, pDV80 and pDV90 were also deposited at the ATCC on 5 January, 2000 and provided with accession numbers PTA-1144, PTA-1145, PTA-1146, PTA-1147 and PTA-1148 respectively.
  • the native fiber protein is a homotrimer (Henry L.J. et al., J. Virol. 68:6239-5246 (1994)), and trimerization is essential for assembly of the penton/fiber complex (Novelli A et al., J. Biol. Chem. 288:9299-9303 (1991 )).
  • To assess the multimeric structure of the recombinant fiber protein produced by the cell lines cells were labeled with 50 ⁇ Ci/ml [ 3S S] Translabel (ICN) for two hours at 37°C, lysed in RIPA buffer, and fiber protein was immunoprecipitated as described (Harlow E et a., Antibodies. Cold Spring Harbour Laboratory, Cold Spring Harbor (1988).
  • Immune complexes were collected on Protein A-Sepharose beads (Pierce), extensively washed with RIPA buffer, and incubated at room temperature in 0.1 M triethylamine, pH 11.5 to release bound fiber protein. A portion of the precipitated fiber was electrophoresed on a 8% SDS-PAGE gel under denaturing (1 % SDS in loading buffer, samples boiled for 5 minutes) or semi-native (0.1% SDS in loading buffer, samples not heated) conditions.
  • Cell lines 293, 211 A, 211 B and 211 R (2 x 10 6 cells/sample) were infected with H ⁇ te142 at 10 pfu/cell. 48 hours later, cells were detached with 25 mM EDTA and virus was harvested by four rapid freeze-thaw cycles. Debris was removed by a 10 minute spin at 1500 x g, and viral titers determined by fluorescent focus assay (Thiel J.F et al., Proc. Soc. Exp. Biol. Med. 125:892-895 (1967)) on SW480 cells with a polyclonal anti-penton base Ab (Wickham T et al., Cell 73:309-319 (1993)). As shown in Fig.
  • the fiber mutant virus replicated to high titers in 293 cells at 32.5°C (the permissive temperature), but to a much lower extent at the restrictive temperature of 39.6°C.
  • the fiber-producing packaging lines 211 A, 211 B, or 21 1 R supported virus production at 39°C to levels within two- to three-fold of those seen at the permissive temperature in 293 cells, indicating that these cells provided partial complementation of the fiber defect.
  • virus yields from the fiber-producing cell lines were also somewhat higher than those from 293 cells at 32.5°C (the 'permissive' temperature). This suggests that fiber produced by the ts142 virus may be partially defective even at the permissive temperature.
  • a non-specific increase in adenoviral titer could result when viruses are grown in the packaging cells, by a mechanism not involving fiber complementation.
  • viruses with wild type fiber genes such as Ad.RSV ⁇ gal
  • replicate to identical levels either in our packaging lines or in 293 cells data not shown.
  • the fiber mutant grows to higher titers at 32°C than at 39.5°C. This incomplete complementation may be due to the packaging lines' expression of fiber at a level somewhat below that seen in a wild- type infection (data not shown).
  • a recent study reported an E4-deleted vector which coincidentally reduced fiber protein expression, resulting in a large reduction in the titer of virus produced (Brough et al., J. Virol. 70:6497-6501 (1996)).
  • Another possibility is that the defective te142 fiber protein produced at the restrictive temperature might form complexes with some of the wild type protein produced by the cells and prevent its assembly into particles.
  • adenovirus type 3 was grown either in fiber-producing cell lines or in 293 cells. Viral particles were purified by two sequential centrifugations (3 h at 11 1 ,000 x g) on preformed 16-40% CsCI gradients to remove soluble cellular proteins and then dialyzed extensively against 10 mM Tris-HCl, pH 8.1 , 150 mM NaCl, 10% glycerol.
  • Ad ⁇ fiber protein was detected by immunoblotting using the polyclonal anti-fiber serum, followed by detection with a horseradish peroxidase-conjugated goat anti- rabbit antibody (Kirkegaard and Perry Laboratories) and the ECL chemiluminescence substrate (Amersham).
  • the purified Ad3 particles contained Ad ⁇ fiber protein after a single passage through a fiber-expressing cell line but not after passage through 293 cells
  • Ad vectors equipped with different fiber proteins may be produced simply by growth in cells expressing the fiber of interest, without the time-consuming step of generating a new vector genome for each application.
  • Replacing or modifying the fiber gene in the vector chromosome would also require that the new fiber protein bind a receptor on the surface of the cells it which it is to be grown.
  • the packaging cell approach will allow the generation of Ad particles containing a fiber which can no longer bind to its host cells, by a single round of growth in cells expressing the desired fiber gene. This will greatly expand the repertoire of fiber proteins which can be incorporated into particles, as well as simplifying the process of retargeting gene delivery vectors.
  • the present invention contemplates the use of tripartite leader sequences (TPLs) that are useful in enhancing the expression of complementing adenoviral proteins, particularly fiber protein, for use in preparing an adenoviral gene delivery vector.
  • TPLs tripartite leader sequences
  • One preferred TPL is the complete Ad ⁇ tripartite leader contained in complementing vectors such as pDV67 and pDV69, both of which are prepared as described below.
  • the complete Ad5 TPL was constructed by assembling PCR fragments.
  • the third TPL exon (exon 3) (nt 9644-9731 of the Ad ⁇ genome) was amplified from Ad ⁇ genomic DNA using the synthetic oligonucleotide primers ⁇ 'CTCAACAATTGTGGATCCGTACTCC3'(SEQ ID NO: 28) and ⁇ 'GTGCTCAGCAGATCTTGCGACTGTG3' (SEQ ID NO: 29).
  • the resulting product was cloned to the BamHI and Bglll sites of p ⁇ E1 Sp1 a (Microbix Biosystems) using novel sites in the primers (shown in bold) to create plasmid pDV52.
  • a fragment corresponding to the first TPL exon (exon 1 ), the natural first intron (intron 1), and the second TPL exon (exon 2) (Ad ⁇ nt 6049-7182) was then amplified using primers 5'GGCGCGTTCGGATCCACTCTCTTCC3' (SEQ ID NO:30) and ⁇ 'CTA CATGCTAGGCAGATCTCGTTCGGAG3' (SEQ ID NO: 31), and cloned into the BamHI site of pDV52 (again using novel sites in the primers) to create pDV ⁇ .
  • This plasmid contains a 1.2 kb BamHI/Bglll fragment consisting of the first TPL exon, the natural first intron, and the fused second and third TPL exons.
  • the nucleotide sequence of the complete TPL containing the noted ⁇ ' and 3' restriction sites is shown in SEQ ID NO: 32 with the following nucleotide regions identified: 1-6 nt BamHI site; 7-47 nt first leader segment (exon 1); 48-1068 nt natural first intron (intron 1 ); 1069-1140 nt second leader segment (exon 2); 1141 -1146 nt fused BamHI and Bglll sites; 1147-1234 nt third leader segment (exon 3); and 1235-1240 nt Bglll site.
  • TPLs fragments containing two of the three exons, exons in non-native order, or containing either the first or second TPL intron are also constructed for use in preparing complementing plasmids for use in the methods of the present invention.
  • DNA fragments containing any combination of 2 TPL exons can be constructed as follows: Exon 1 is amplified from genomic DNA as prepared above by using the oligonucleotides 5'GGCGCGTTCGGATCCACTCTCTTCC3'(SEQ ID NO: 33) and ⁇ 'GGGAGTAGATCTCCCAACAG3' (SEQ ID NO: 34).
  • Exon 2 is similarly amplified from the same genomic DNA using oligonucleotides ⁇ 'CCC I I I I I I I I I GGATCCCTCGCGG3' (SEQ ID NO: 35) and 5'CTACATGCTAGGCAGATCTCGTTCGGAG3' (SEQ ID NO: 36).
  • Exon 3 is amplified using the oligonucleotides 5'CTCAACAATTGTTGGATCCGTACTCC3' (SEQ ID NO: 37) and ⁇ 'GTGCTCAGCAGATCTTGCGACTGTG3' (SEQ ID NO: 38).
  • the amplified exons are ligated together in any desired number and/or order by virtue of the unique BamHI and Bglll restriction sites (bold) in the primers for subsequent ligation into a construct analogous to pDV67, prepared as described below, for expression of viral structural genes.
  • a fragment consisting of the first TPL exon (exon 1), the native first intron (intron 1), and the second TPL exon (exon 2) is produced by amplification from Ad ⁇ genomic DNA with the oligonucleotide pair ⁇ 'GGCGCGTTCGGATCC ACTCTCTTCC3' (SEQ ID NO: 39) and 5'CTACATGCTAGGCAGATCT CGTTCGGAG3' (SEQ ID NO: 40).
  • a fragment consisting of the second TPL exon (exon 2), the native second intron (intron 2), and the third TPL exon (exon 3) is produced by amplification using the oligonucleotides 5'CCCTTTTTTTTGGATCC CTCGCGG3' (SEQ ID NO: 41) and 5'GTGCTCAGCAGATCTTGCGACTGTG3' (SEQ ID NO: 42). Either of the intron-containing fragments are used either alone or in combination with another TPL fragment(s) in constructs analogous to pDV67.
  • Introns in addition to adenoviral intron 1 used herein that have been shown to increase the expression of recombinant proteins when included in expression constructs include SV40 VP1 intron, rabbit ⁇ -globin intron among others. The use of these alternative intron sequences are contemplated for use in preparing a TPL in the present invention.
  • Plasmids were first constructed as described below that contained TPLs are described above.
  • the resultant plasmids containing different selectable markers such as neomycin or zeocin were then used to prepare stable cell lines for use as complementing vectors for preparing adenoviral vectors for use in the present invention.
  • the resulting cell lines represent improvements over preexisting fiber-complementing cell lines in that fiber expression is enhanced with the use of alternative TPLs.
  • pDV60 was constructed by inserting this TPL cassette of SEQ ID NO: 32 into the BamHI site upstream of the Ad ⁇ fiber gene in pcDNA3/Fiber, a neomycin selectable plasmid, prepared as described in Example 1 and also as described by Von Seggern et al., J. Gen Virol., 79: 1461 (1998).
  • the nucleotide sequence of pDV60 is listed in SEQ ID NO: 43.
  • pDV61 To construct pDV61 , an Asp718/Notl fragment containing the CMV promoter, partial Ad ⁇ TPL, wildtype Ad ⁇ fiber gene, and bovine growth hormone terminator was transferred from pCLF, prepared as described in Example 1 and also as described by Von Seggern et al., J. Gen Virol., 79: 1461 (1998), to a zeocin selectable cloning vector referred to as pCDNA3.1/Zeo (+) (commercially available from Invitrogen and the sequence is also available).
  • pCDNA3.1/Zeo (+) commercially available from Invitrogen and the sequence is also available.
  • pDV67 ln an analogous process, pDV67 containing complete TPL was constructed by transferring an Asp 718/Xbal fragment from pDV60 to the pcDNA3.1/Zeo(+) backbone.
  • the nucleotide sequence of pDV67 is listed in SEQ ID NO: 44.
  • the chimeric Ad3/Ad5 fiber gene was amplified from pGEM6TS3H (Stevenson et al., J. Virol., 69: 2850-2867, 1995)) using the primers 5'ATGGGAT
  • E1 -2a S8 cells are derivatives of the A549 lung carcinoma line (ATCC # CCL 185) with chromosomal insertions of the plasmids pGRE5-2.E1 (also referred to as GRE5-E1-SV40-Hygro construct and listed in SEQ ID NO: 48) and pMNeoE2a-3.1 (also referred to as MMTV-E2a-SV40-Neo construct and listed in SEQ ID NO: 49), which provide complementation of the adenoviral E1 and E2a functions, respectively.
  • This line and its derivatives were grown in Richter's modified medium (BioWhitaker) + 10% FCS.
  • E1-2a S8 cells were electroporated as previously described (Von Seggern et al., J. Gen Virol., 79: 1461 (1998)) with pDV61 , pDV67, or with pDV69, and stable lines were selected with zeocin (600 ⁇ g/ml).
  • the cell line generated with pDV61 is designated 601.
  • the cell line generated with pDV67 is designated 633 while that generated with pDV69 is designated 644.
  • Candidate clones were evaluated by immunofluorescent staining with a polyclonal antibody raised against the Ad2 fiber. Lines expressing the highest level of fiber protein were further characterized.
  • 0.3 ⁇ M of dexamethasone was added to cell cultures 16-24 hours prior to challenge with virus for optimal growth kinetics.
  • 5 X 10 5 cells/well in 6 well plates are prepared and pre-induced with the same concentration of dexamethasone the day prior to infection with 0.5 ⁇ M included at a final concentration in the agar overlay after infection.
  • This example shows the construction of S.8 cells
  • the Adenovirus 5 genome was digested with Seal enzyme, separated on an agarose gel, and the 6,095 bp fragment comprising the left end of the virus genome was isolated.
  • the complete Adenovirus 5 genome is registered as Genbank accession #M73260, incorporated herein by reference, and the virus is available from the American Type Culture Collection, Manassas, Virginia, U.S.A., under accession number VR-5.
  • the Seal 6,095 bp fragment was digested further with Clal at bp 917 and Bglll at bp 3,328.
  • PCR Polymerase chain reaction
  • This amplified DNA fragment (sometimes hereinafter referred to as Fragment A) then was digested with Xhol and Clal, which cleaves at the native Clal site (bp 917), and ligated to the Xhol and Clal sites of pSE280-E, thus reconstituting the 5( end of the E1 region beginning 8 bp upstream of the ATG codon.
  • PCR then was performed to amplify Adenovirus ⁇ DNA from bp 3,323 through 4,090 contiguous with an EcoRI restriction site.
  • the primers which were employed were as follows: 5' end, Ad ⁇ bp 3323-3360: ⁇ '-CATGAAGATCTGGAAGGTGCTGAGGTACGATGAGACC-3' (SEQ ID NO: 68) 3' end, Ad ⁇ bp 4090-4060: ⁇ '-GCGACTTAAGCAGTCAGCTG-AGACAGCAAGACACTTGCTTGATCCAAATCC-3 ' (SEQ ID NO: 69)
  • This amplified DNA fragment (sometimes hereinafter referred to as Fragment B) was digested with Bglll, thereby cutting at the Adenovirus 5 Bglll site (bp 3,382) and EcoRI, and ligated to the Bglll and EcoRI sites of pSE280-AE to reconstruct the complete E1 a and E1 b region from Adenovirus ⁇ bp 652 through 4,090.
  • the resulting plasmid is referred to as pSE280-E1 ( Figure 23).
  • a construct containing the intact E1a/b region under the control of the synthetic promoter GRE5 was prepared as follows.
  • the intact E1a/b region was excised from pSE280-E1 , which was modified previously to contain a BamHI site 3' to the E1 gene, by digesting with Xhol and BamHI.
  • the Xhol to BamHI fragment containing the E1a/b fragment was cloned into the unique Xhol and BamHI sites of pGRE ⁇ -2/EBV ( Figure 4, U.S. Biochemicals, Cleveland, Ohio) to form pGRE ⁇ -E1 ( Figure 24).
  • Plasmid DNA was prepared and purified by banding in CsTFA prior to use for transfection of cells. Construction of plasmid including Adenovirus 5 E2A sequence.
  • the Adenovirus ⁇ genome was digested with BamHI and Spel, which cut at bp 21 ,662 and 27,080, respectively. Fragments were separated on an agarose gel and the 5,618 bp BamHI to Spel fragment was isolated. The 5,518 bp BamHI to Spel fragment was digested further with Smal, which cuts at bp 23,912. The resulting 2,350 bp BamHI to Smal fragment was purified from an agarose gel, and ligated into the superiinker shuttle plasmid pSE280, and digested with BamHI and Smal to form pSE280-E2 BamHI-Smal ( Figure 26).
  • PCR then was performed to amplify Adenovirus 5 DNA from the Smal site at bp 23,912 through 24,730 contiguous with Nhel and EcoRI restriction sites.
  • the primers which were employed were as follows: 5' end, Ad ⁇ bp 24,732-24,708: ⁇ '-CACGAATTCGTCAGCGCTTCTCGTCGCGTCCAAGACCC-3' (SEQ ID NO: 70) 3' end, Ad ⁇ bp 23,912-23,934: ⁇ '-CACCCCGGGGAGGCGGCGGCGACGGGGACGGG-3' (SEQ ID NO: 71)
  • This amplified DNA fragment was digested with Smal and EcoRI, and ligated to the Smal and EcoRI sites of pSE280-E2 Bam-Sma to reconstruct the complete E2a region from Ad5 bp 24,730 through 21 ,662.
  • the resulting construct is pSE280-E2a.
  • Figure 27. ln order to convert the BamHI site at the 3' end of E2a to a Sail site, the E2a region was excised from pSE280-E2a by cutting with BamHI and Nhel, and recloned into the unique BamHI and Nhel sites of pSE280.
  • Plasmid DNA was prepared and purified by banding in CsTFA. Circular plasmid DNA was linearized at the Xmnl site within the ampicillin resistance gene of pMAMneo-E2a, and further purified by the phenol/chloroform extraction and ethanol precipitation prior to use for transfection of cells. Transfection and selection of cells.
  • this process involved the sequential introduction, by calcium phosphate precipitation, or other means of DNA delivery, of two plasmid constructions each with a different viral gene, into a single tissue culture cell.
  • the cells were transfected with a first construct and selected for expression of the associated drug resistance gene to establish stable integrants.
  • Individual cell clones were established and assayed for function of the introduced viral gene.
  • Appropriate candidate clones then were transfected with a second construct including a second viral gene and a second selectable marker. Transfected cells then were selected to establish stable integrants of the second construct, and cell clones were established. Cell clones were assayed for functional expression of both viral genes.
  • E2a function was screened by complementation of the temperature-sensitive mutant Ad ⁇ ts125 virus which contains a temperature-sensitive mutation in the E2a gene.
  • One of the transfected A549 cell lines showed good E1 a/b and E2a expression and was selected for further characterization. It was designated the S8 cell line.
  • Ad ⁇ . ⁇ gal. ⁇ F in S8 cells containing alternative forms of TPL for enhancing the expression of fiber proteins the protocol as described in Example 2 for preparing Ad ⁇ . ⁇ gal. ⁇ F in 211 B cells was followed with the exception of pretreatment with 0.3 ⁇ M dexamethasone for 24 hours as described above.
  • viral particles with the wildtype Ad ⁇ fiber protein on their surface and containing the fiberless Ad ⁇ . ⁇ gal. ⁇ F genome were produced in 633 cells.
  • Particles produced in 644 cells also contained the fiberless Ad ⁇ . ⁇ gal. ⁇ F genome, but had the chimeric 6T3H fiber protein, with the Ad3 fiber knob, on their surface.
  • FIG. 20 The preparation of the cell lines and demonstration of stable nuclear expression of either wild-type Ad5 fiber protein or chimeric Ad ⁇ /Ad3 protein is shown in Figure 20.
  • Figure 20 schematic diagrams are presented of the constructs used to generate the cell lines as well as immunofluorescence results indicating the presence of expressed fiber protein in the nucleus of the cells.
  • An indirect immunofluorescence assay of A649 based cell lines which stably express the different Ad fibers is shown.
  • Line 633 expresses the native Ad ⁇ fiber protein and line 644 expresses a chimeric fiber protein with the tail and shaft domains of the Ad ⁇ protein and the knob domain of the Ad3 fiber.
  • Previous work (Stevenson et al., 1996) showed that a virus containing this protein had the tropism expected for Ad3.
  • these viral preparations are useful for targeting delivery of Ad ⁇ . ⁇ gal. ⁇ F fiberless genome with either wild- type or modified fibers, embodiments of which uses have been previously discussed and as further exemplified with the pseudotyping and infectivity results described in Example 7.
  • viral particles were purified from either 633 (expressing wilt type Ad ⁇ fiber) or 644 cells (expressing the chimeric Ad ⁇ /Ad3 fiber) 10 ⁇ g of the purified particles were Western blotted and probed with a polyclonal rabbit antibody against the Ad2 fiber (which detects both the Ad ⁇ and chimeric 6T3H fiber proteins.). Equal amounts of purified Ad. ⁇ gal.wt or Av9LacZ (which has the chimeric fiber gene in the viral chromosome) were run as controls. The results are shown in Figure 21 where both fiber proteins were detectable confirming pseudotyping.
  • the results shown in Figure 22 indicate that adenoviral vectors could be retargeted by pseudotyping using packaging cell lines expressing different fiber proteins.
  • the data marked with “none” indicates virus grown in 293 cells and lacking fiber, while "Ad5" indicates virus prepared in 633 cells (containing the wild type fiber) and Ad3 indicates virus prepared in 644 cells (containing the chimeric 5T3H fiber.)
  • Particles containing either fiber were equally infectious on 211 B cells, while MRC- ⁇ fibroblasts and THP-1 cells were more readily infected by virus containing the chimeric fiber.
  • the A-10 rat endothelial cells were more readily infected by particles containing the wildtype Ad5 fiber protein.
  • a vector lacking the fiber gene as described above in Example 2A but containing a gene of interest for delivery is amplified by growth in cells which do not produce a fiber protein, such as the 211 cells prepared in Example 1 or 293 or S8 cells as described herein, thereby producing large numbers of particles lacking fiber protein.
  • the recovered fiber-free viral particles are then used to deliver the inserted gene of interest following the methods of this invention via targeting mechanisms provided by other regions of the adenoviral vector, i.e., via the native penton base.
  • a general method of constructing a fiber-deleted Ad vector containing a therapeutic gene of interest (in this example, the Herpes Simplex Virus Thymidine Kinase (TK) gene) is described here.
  • Linear viral DNA is isolated from a preparation of Ad ⁇ . ⁇ gal. ⁇ F particles. This DNA is digested with the restriction enzyme Clal, which removes the leftmost viral sequences including the left ITR, the packaging signals, and part of the SV40-driven ⁇ -galactosidase gene.
  • Clal restriction enzyme
  • the large Clal fragment with the remainder of the fiber-deleted viral genome is then isolated by centrifugation on a sodium chloride or sucrose gradient.
  • the plasmid pAdShuttleTK which contains the left part of the Ad chromosome with an RSV-driven TK gene inserted in place of the E1 region, is linearized by digestion with Notl.
  • the nucleotide sequence of the pAdShuttleTK is shown in SEQ ID NO: 50.
  • the large Clal fragment of Ad ⁇ . ⁇ gal. ⁇ F and the linearized pAdShuttleTK are cotransfected into 211 B cells, and an infectious adenovirus genome is generated by homologous recombination.
  • a virus deleted for E1 , E3, and fiber that contains the TK cassette in the place of the E1 deletion is thus recovered.
  • a virus containing any desired therapeutic gene of interest can be created in this manner by replacing the TK gene of the example with the gene of interest.
  • RDS retinal degeneration-slow
  • a plasmid (pDV50) analogous to p ⁇ EI B ⁇ gal but containing a CMV-driven RDS gene was constructed as follows. First, a fragment containing the CMV promoter and enhancer was excised from pCHaMIEP by digestion with Hindlll, filling the overhanging ends with the large fragment of E. coli DNA polymerase 1 , ligation of BamHI linkers (5'CGCGGATCCCG3' SEQ ID NO: 61) to the blunt ends, and digesting with BamHI. The resulting fragment was then ligated into the BamHI site of p ⁇ E1sp1 a (Mikrobix) to create pDV4 ⁇ .
  • a fragment containing the SV40 polyadenylation signal was amplified from pSV ⁇ gal (Promega) using the oligonucleotides ⁇ 'CTGACAAACTCAGATCTTGTTTATTG3' (SEQ ID NO: 51) and 5'GTCGACTCTAGAGGATCCAGA3' (SEQ ID NO: 62). This fragment was ligated into the Bglll site of pDV45 to create pDV46, using the unique BamHI and Bglll sites (bold type) in the primers.
  • the human RDS open reading frame was amplified from the plasmid pRDS-T7 using the oligonucleotides ⁇ 'CCGGACTCT AGATGGCAACCATGGCGCTAC3' (SEQ ID NO: 53) and 5'GGA GGGGAAGCTTGGCCCTCAGCCAGCCTCT3' (SEQ ID NO: 64).
  • This fragment was inserted into the Hindlll and Xbal sites of pDV46, again using unique restriction sites in the primers, to create pDV50.
  • pDV ⁇ O therefore contains a cassette consisting of the CMV promoter, the RDS open reading frame, and the SV40 terminator sequences inserted in place of the Ad ⁇ E1 region.
  • Ad ⁇ . ⁇ gal. ⁇ F pDV ⁇ O and pDV44 are then co-transfected into 211B cells, and an infectious Ad genome (Ad ⁇ .RDS. ⁇ F) is recovered.
  • Ad ⁇ .RDS. ⁇ F infectious Ad genome
  • a fiber-deleted Ad vector containing any desired gene to be expressed can be constructed by replacing the RDS gene of this example with the gene of interest.
  • adenovirus type ⁇ (Ad ⁇ ) is being developed as a vector for gene therapy. Its ability to deliver therapeutic genes to cells is mediated by the interaction of the adenoviral fiber protein with the coxsackievirus-adenoviral receptor (CAR). Because a wide-range of cells express CAR, it can be difficult to use adenoviruses to deliver genes to specific cell types. One way to address this is to target the virus to a particular cell type by genetically altering the fiber. However, the genetic manipulations involved in cloning and production of the viruses with altered fibers can be time-consuming. Thus it would be a significant advancement in the field of adenoviral gene therapy to have a more streamlined system for testing modified fiber genes.
  • CAR coxsackievirus-adenoviral receptor
  • pDV60 is an pcDNA3.1 -based expression plasmid that contains the CMV promoter, Ad ⁇ tripartite leader, an intron, and the Ad ⁇ fiber gene sequence.
  • pDV ⁇ contains no fiber gene and serves as the negative control.
  • Ad ⁇ . ⁇ gal. ⁇ F and 211 B are described above.
  • 293T cells are identical to 293 cells except they express an integrated SV40 large T antigen gene.
  • HDF cells are human diploid fibroblasts.
  • 293T cells express CAR and ocv integrins; HDF cells express ov integrins but no CAR.
  • Transfections with fiber expression plasmids were performed with Lipofectamine (GIBCO-BRL) using 20mg DNA and 60ml Lipofectamine per 15cm dish. Cells were maintained in DMEM supplemented with 10% fetal bovine serum.
  • the fiber deletion mutation of Ad ⁇ . ⁇ gal. ⁇ F is complemented in trans by passaging virions through 211B, a cell line that stably expresses functional Ad ⁇ fiber.
  • the present system was designed to complement Ad ⁇ . ⁇ gal. ⁇ F by modified fibers expressed from transfected episomal plasmids in 293T cells. The result is a simplified and rapid method to incorporate modified fibers on a viral particle containing the Ad ⁇ . ⁇ gal. ⁇ F genome that does not require propagation of the virus.
  • the virions containing no fiber (pDV ⁇ ) or wildtype fiber (pDV60) were applied to monolayers of 293T and HDF cells at different multiplicity of infection (MOI's).
  • 293T cells express CAR and a cVintegrins;
  • HDF cells express o integrins but no CAR.
  • the cells were fixed and stained with X-gal to detect the ⁇ galactosidase reporter gene activity. The results showed low transduction efficiency for the pDV ⁇ -complemented virions in both cell lines.
  • the pDV60-complemented virions transduced 293T cells to a high degree but did not transduce HDF cells, indicating that functional fiber proteins had been expressed from the episomal plasmids and incorporated into the virions.
  • This transduction efficiency was comparable to or better than that of Ad ⁇ . ⁇ gal. ⁇ F virions passaged through the 211 B cells.
  • Episomal plasmid transcomplementation system is suitable for quickly expressing and evaluating the properties of modified fibers in the context of a viral particle. Episomal plasmid transcomplementation will also be of great utility for quickly evaluating a bank of modified fibers for other binding properties, including novel tropism and the ablation of the native tropism. In addition to the rapid generation and testing of large numbers of modified fibers, there are other advantages to the Ad ⁇ . ⁇ gal. ⁇ F transcomplementation system in terms of production and safety. Episomal plasmid transcomplementation has the inherent advantage over transcomplementation in that it is not necessary to make a stable cell line for every modified fiber with which you want to complement Ad ⁇ . ⁇ gal. ⁇ F .
  • Ad ⁇ . ⁇ gal. ⁇ F is deleted in E1 , E3 and fiber, there is an additional gene deletion compared to other first generation vectors. This makes Ad ⁇ . ⁇ gal. ⁇ F more replication defective and presumably safer.
  • the presence of the fiber gene deletion decreases the opportunity to generate replication-competent virus via recombination in the packaging cells. In terms of production a single Ad vector prep could be retargeted to any number of different cell types simply by transfecting the cells with the appropriate fiber-expression construct.
  • Adenovirus type 37 (subgroup D) has been associated with infections of the eye and genital tract, and may be useful for targeting these tissues or other mucous membranes, as well as other cell types.
  • the tropism of Ad37 is due to the binding preference of its fiber protein, which binds to an as yet-unidentified receptor located on the surface of cells including Chang C, conjunctival epithelial cell line (Huang et al., J. Virology 73(4):2798-2802 (1999)). As this fiber directs viral infection to cell types different than those infected by Ad ⁇ , it is likely to provide a method for targeting gene delivery.
  • This example describes construction of packaging cell lines expressing the Ad37 fiber protein, and their use in generating particles of a fiber- deleted Ad vector (such as Ad ⁇ . ⁇ gal. ⁇ F ) containing this fiber protein.
  • the fiber protein is attached to the viral capsid by binding to the penton base protein through its N-terminus, and the Ad37 fiber was modified in order to make its N-terminal sequence more closely match that of the Ad ⁇ protein to ensure that it would efficiently bind the Ad ⁇ penton base in these vectors.
  • Ad37 fiber open reading frame was amplified from Ad37 genomic DNA (obtained from the ATCC - accession number VR- 929)using the synthetic oligonucleotides primers L37 (5' TGT CTT GGA TCC AAG ATG AAG CGC GCC CGC CCC AGC GAA GAT GAC TTC 3') (SEQ ID NO: 66) and 37FR (5' AAA CAC GGC GGC CGC TCT TTC ATT CTT G 3') (SEQ ID NO: 67).
  • L37 contains nucleotides that differ from the Ad37 genomic sequence in order to add an unique Bam H1 site (bold in the above sequence) and create point mutations to make the N-terminal sequence of the fiber more closely match that of the Ad6 protein (underlined in the above sequence; the start codon is italicized). 37FR incorporates changes to create a unique Not 1 site (bold). The PCR product was inserted into the Bam H1 and Not 1 sites of pCDNA3.1zeo(+) (Invitrogen) to create pDV78. The correct sequence of the Ad37 fiber gene, including the predicted changes, was confirmed by sequencing.
  • pDV80 DNA was purified using the Qiagen method and electroporated into the adenovirus-complementing cell line E1-2a S8 (Gorziglia et al., J. Virology 70(5):4 J ⁇ 73-4178 (1996)) as previously described (Von Seggern, et al., J. Gen. Virol. 79:1461-1418), and stable clones were selected with 600 ⁇ g/ml zeocin (Invitrogen). Clones were expanded and screened for fiber expression by indirect immunofluorescence using a rabbit polyclonal antibody directed against the Ad37 fiber. Two clones (lines 705 and 731) that expressed the protein at a uniformly high level were selected for further study.
  • Ad37 fiber-expressing 705 cells were infected (approximately 1000 particles/cell) with Ad ⁇ . ⁇ gal. ⁇ F or with Ad ⁇ .GFP. ⁇ F.
  • Ad ⁇ . ⁇ gal. ⁇ F is prepared as previously described.
  • Ad ⁇ .GFP. ⁇ F was constructed by recombination in bacteria using a modification of the method of (He, et al, PNAS 95:2609-2514 (1998)).
  • a fiber-deleted genomic plasmid was constructed by removing the fiber gene from pAdEasyl (He, et al, PNAS 95:2509- 2514 (1998)).
  • pDV43 (Von Seggern, et al, J. Virol. 73:1601-1608 (1999)) was digested with Pac 1 , the ends blunted by treatment with the large fragment of E. coli DNA polymerase and dNTPs, and the product re-ligated.
  • the resulting plasmid, pDV76 is identical to pDV43 except for loss of the Pac 1 site and contains the right end of the Ad ⁇ genome with E3 and fiber deletions.
  • a 4.2 kb fragment was amplified from pDV76 using the oligonucleotides primers 5' CGC GCT GAC TCT TA GGA CTA GTT TC 3' (SEQ ID NO: 68) (including the unique Spe 1 site in the Ad5 genome, bold) and ⁇ ' GCG CTT AAT TAA CAT CAT CAA TAA TAT ACC TTA TTT T 3' (SEQ ID NO: 69) (including a novel Pac 1 site (bold) adjacent to the right Ad ⁇ ITR).
  • This PCR fragment therefore contains nucleotides 27,082 to 36,936 of the Ad5 genome with a deletion of nucleotides 28133 to 32743 (the E3 and fiber genes), and was used to replace the corresponding Spe 1/ Pac 1 fragment of PAdEasyl to create pDV77.
  • E. coli strain BJ6183 was electroporated with a mixture of pDV77 and Pme 1 - linearized pAdTrack as described (He et al., 1998), and DNA was isolated from kanamycin-resistant colonies.
  • the resulting plasmid, pDV83 contains a complete E1 -, E3-, and fiber-deleted Ad ⁇ genome with a CMV-driven GFP reporter gene inserted at the site of the E1 deletion.
  • the full-length Ad chromosome was isolated by Pac 1 digestion, and transfected to the E1 - and fiber-complementing 633 cells (Von Seggern et al, J. Virol January 2000). The recovered virus was then plaque purified by plating on 633 cells and stocks were prepared.
  • Ad5-pseudotyped particles were generated by virus growth in 633 cells, which express the wild type Ad5 fiber protein. Viral particles were isolated and purified over CsCI gradients as previously described (Von Seggern et al., J. Virol. 73:1601- 1608, 1999). For analysis of viral proteins, ten ⁇ g of the purified particles were electrophoresed on 8-16% gradient gels and the protein transferred to nylon membranes. The blot was then probed with rabbit polyclonal antibodies raised against recombinant Ad37 fiber or Ad ⁇ fiber or penton base proteins expressed in baculovirus-infected cells (Figure 27).
  • mRNA transcribed from the woodchuck hepatitis virus (WHV) genome contains an element (the WHV post-transcriptional regulatory element, or WPRE) which can increase expression of a protein encoded by the mRNA via a post-transcriptional mechanism (Loeb et al, Human Gene Therapy 70:2295-2306 (1999)).
  • WPRE WHV post-transcriptional regulatory element
  • the WPRE has also been shown to enhance expression of transgenes delivered by retroviral vectors. (Zufferey, R. et al, J. Virol. 73:2886-2892 (1999)).
  • This example describes the construction of a fiber expression construct (pDV90) containing a WPRE as well as the promoter and TPL sequences as contained in pDV67.
  • pBS/WPRE A plasmid (pBS/WPRE) which contains the WPRE was obtained from Dr. Thomas Hope, Salk Institute. Digestion of pBS/WPRE with C/a1 releases a 600 bp fragment containing the WPRE (nt 193-1684 of the WHV genome.) Following C/a1 digestion, the ends of this fragment were filled by treatment with the large fragment of E. coli DNA polymerase 1 in the presence of dNTPs to render them blunt.
  • pDV67 DNA was digested with Xba (which cuts at a unique site in the transcribed region downstream of the Ad ⁇ fiber open reading frame) and the ends filled by the same treatment.
  • pDV90 SEQ ID NO: 65.
  • GenBank accession no. J04514 Entire genome
  • pDV90 was electroporated into E1-2a S8 cells and stable clones expressing fiber isolated as described previously for pDV80.
  • the receptor-binding knob domain of the Ad ⁇ fiber protein contains several surface loops which are attractive candidates for the insertion of heterologous peptide sequence, as an additional ligand for vector targeting.
  • This example describes the construction of a fiber gene which encodes a fiber protein containing a 6 amino acid peptide linker in the HI loop, and retains the ability to trimerize.
  • the modified gene also contains a unique novel restriction site at the position of the linker insertion to facilitate addition of the targeting ligand into the HI loop.
  • Ad ⁇ fiber gene was amplified from Ad ⁇ genomic DNA (ATCC accession number VR- ⁇ ) using the primers Fiber ATG (5' TGA AGC GCG CAA GAC CGT CTG AAG 3') (SEQ ID NO: 60) and Fiber TAA (5' CAT AAC ACT GCA GAT TCT TTA TTC TTG G 3') (SEQ ID NO: 61), and cloned to the Ndel (filled with the large fragment of E. coli DNA polymerase 1 in the presence of dNTPs) and Pst 1 sites of pT7-7 using a unique Pst 1 site (bold) in the 'Fiber TAA' oligo.
  • the resulting plasmid, pT7/fiber was digested with Xba 1 and Pst 1 to excise the fiber gene, which was then cloned into the Pst 1 and Xba 1 sites of pUC119 to create pUC/fiber.
  • This pUC-derived plasmid contains an origin for single-stranded DNA replication and can therefore be used to create template DNA for site-directed mutagenesis.
  • the modified fiber gene was excised from pDV14 by digestion with Pst 1 and Xba 1 and cloned into the Pst 1 and Xba 1 sites of pGEM3Z (Promega) to create pDV18.
  • In vitro transcription/translation experiments with pDV18 demonstrated that the modified fiber gene encoded a protein which was capable of trimerizing.
  • Ad ⁇ fiber open reading frame is amplified from Ad5 genomic DNA (wildtype Ad ⁇ was purchased from the ATCC) using the oligonucleotides 5' ATG GGA TCC AAG ATG AAG CGC GCA AGA CCG 3' (SEQ ID NO: 72) and 5' CAT AAC CTG CAG GAT TCT TTA TTC TTG GGC 3' (SEQ ID NO:,73) and inserted into the BamH ⁇ and Pst 1 sites of pGEM-3Zf(+) (Promega Inc., Madison, Wl) via novel restriction sites (bold type) designed into the primers.
  • the ⁇ ' oligonucleotide also contains a G to A change 3 nucleotides ⁇ ' of the initial ATG codon (underlined), designed to improve the consensus for translation initiation.
  • Site-directed mutagenesis is performed by the method of Kunkel (Proc. Nat. Acad. Sci. 82:488-492 (1986)), using the synthetic oligonucleotide 5' GGT ACA CAG GAA ACA GGA GGT TCC GGA GGT GGA GGA GAC ACA ACT CC 3' ((SEQ ID NO: 74).
  • This operation introduced sequence (bold type) encoding 6 novel amino acids (Gly Gly Ser Gly Gly Gly) immediately following Threonine 542 of the Ad ⁇ fiber, and including a unique restriction site for the insertion of further heterologous sequences (underlined).
  • the resulting plasmid (pDV18A) contains the modified fiber gene under the control of the T7 promoter in the parental pGEM-3Zf(+) and can be used for in vitro transcription/translation reactions to produce labeled fiber protein.
  • Adenoviral vectors which lack essentially all Ad genes have recently been developed.
  • vectors which contain an adeno-associated virus (AAV) or retroviral genome have been generated.
  • AAV and retroviral genomes integrate into the chromosome of the target cells the hybrid Ad/AAV or Ad/retroviral vectors have the potential to provide very long-term gene expression.
  • Ad.AAVI Ad vector genome
  • AAV vector genome a transgene insert flanked by the AAV inverted terminal repeats
  • recombination between the AAV sequences generates a minimal Ad chromosome which carries the Ad inverted terminal repeats and packaging signal flanking the AAV vector genome.
  • This chromosome cannot direct the synthesis of Ad proteins, but can be packaged into Ad vector particles.
  • the remaining unrecombined Ad chromosomes provide the Ad structural proteins in trans, and both the full-length and minimal genomes are packaged into particles.
  • the particles carrying the minimal Ad/AAV hybrid vector are then isolated by CsCI centrifugation.
  • These particles have the capsid structure of adenovirus, and infect cells using the efficient fiber- and penton base-mediated pathway used by Ad.
  • the hybrid genome is able to integrate into the cell's chromosomes by virtue of its AAV sequences.
  • the AAV vector genome is inserted into the E1 region of a fiber-deleted vector, and the resulting vector is grown in packaging lines expressing either the Ad ⁇ or Ad37 fiber proteins.
  • the particles recovered therefore have the tropisms expected from the respective fiber proteins combined with the ability to integrate their AAV genome into target cells.
  • Such pseudotyping should be possible with any of a number of modified fiber proteins, as for the fiber-deleted vectors already described by us.
  • the Ad vector is constructed in a manner analogous to that described for Ad ⁇ . ⁇ gal. ⁇ F , by recombination between pAd.AAVI (Lieber et al. J. Virol. 73.-9314- 9324, 1999) and pDV44 (as described earlier in the specification.)
  • pAd.AAVI carries an MLV promoter-driven secreted alkaline phosphatase gene (SEAP) as a reporter, and an SV40-driven neomycin phosphotransferase (neo) gene to allow the selection of cells stable transduced by the AAV cassette.
  • SEAP secreted alkaline phosphatase gene
  • neo SV40-driven neomycin phosphotransferase
  • the resulting vector (Ad.AAVI . ⁇ F) has the AAV vector cassette of Ad.AAVI inserted into the E1 region of a genome with the fiber deletion of Ad ⁇ . ⁇ gal. ⁇ F .
  • Growth of Ad.AAVI . ⁇ F in 633 cells results in particles carrying the AAV genome and the Ad ⁇ fiber, and which have the tropism associated with Ad ⁇ .
  • Growth of Ad.AAVI . ⁇ F in 706 cells produces particles bearing the Ad37 fiber and therefore having its associated different tropism.
  • Tropism is evaluated by infecting Chang C cells (which express the Ad37 receptor) and A649 cells which do not express this protein but do express the Ad ⁇ receptor (CAR). The extent of infection is monitored by assaying alkaline phosphatase expression, and the fraction of cells stable transduced is assayed by selection with neomycin. By using purified recombinant Ad5 or Ad37 fiber proteins as competitors during infection, the usage of the expected receptors by the pseudotyped particles is evaluated.
  • Gutted Ad vectors are those from which most or all viral genes have been deleted. They are grown by co-infection of the producing cells with a "helper" virus (such as using an E1 -deleted Ad vector).
  • the helper virus frans-complements the missing Ad functions, including production of the viral structural proteins needed for particle assembly.
  • the helper virus is a fiber- deleted Ad (such as that described in Von Seggern et al, J. Virol 73:1601-1608 (1999)).
  • the vector is prepared in a fiber expressing cell line such as has been previously described by Von Seggern et al, J. Gen. Virol 79:1461 -1468 (1998), Von Seggern et al, J. Virol.
  • Ad proteins except fiber are provided by the fiber-deleted helper virus, and the particles are equipped with the particular fiber expressed by the host cells.
  • a concern with gutted vectors has been contamination of a vector preparation with residual helper virus.
  • the helper virus in one aspect of this invention is deleted for both E1 and for fiber, it is more replication defective and therefore safer than those currently used.
  • a helper adenovirus vector genome and a gutless adenoviral vector genome are delivered to the packaging cells of the invention.
  • the cells are maintained under standard cell maintenance or growth conditions, whereby the helper vector genome and the packaging cell together provide the complementing proteins for the packaging of the adenoviral vector particle.
  • Such gutless adenoviral vector particles are recovered by standard techniques.
  • the helper vector genome may be delivered in the form of a plasmid or similar construct by standard transfection techniques, or it may be delivered through infection by a viral particle containing the genome. Such viral particle is commonly called a helper virus.
  • the gutless adenoviral vector genome may be delivered to the cell by transfection or viral infection.
  • the helper virus genome is preferably the fiberless adenovirus vector genome as disclosed herein.
  • such genome also lacks the genes encoding the adenovirus E1A and E1B proteins.
  • the genome further lacks the adenovirus genes encoding the adenovirus E3 proteins.
  • the genes encoding such proteins may be present but mutated so that they do not encode functional E1A, E1 B and E3 proteins.
  • such vector genome may not encode other functional early proteins, such as E2A, E2B, and E4 proteins.
  • the genes encoding such other early proteins may be present but mutated so that they do not encode functional proteins.
  • the helper virus genome is used in conjunction with the packaging cell of the invention.
  • the packaging cell also provides proteins necessary for the complementation of the gutless vector so that an adenovirus particle containing the gutless vector genome may be produced.
  • the packaging cell can provide wild-type or modified fiber protein as described herein.
  • the cell could package a fiberless particle which could be used by itself or to which exogenously provided fiber could be added as described elsewhere herein.
  • the helper virus genome is also packaged, thereby producing helper virus.
  • it is preferable to delete or otherwise modify the packaging sequence in the helper virus genome so that packaging of the genome is prevented or limited. Since the gutless vector genome will have a packaging sequence, it will be preferentially packaged.
  • One way to do this is to mutate the packaging sequence by deleting one or more of the nucleotides comprising the sequence or otherwise mutating the sequence to inactivate or hamper the packaging function.
  • An alternative approach is to engineer the helper genome so that recombinase target sites flank the packaging sequence and to provide a recombinase in the packaging cell.
  • the action of recombinase on such sites results in the removal of the packaging sequence from the helper virus genome.
  • the recombinase is provided by a nucleotide sequence in the packaging cell that encodes the recombinase. Most preferably, such sequence is stably integrated into the genome of the packaging cell.
  • Various kinds of recombinase are known by those skilled in the art.
  • the preferred recombinase is Cre recombinase, which operates on so-called lox sites, which are engineered on either side of the packaging sequence as discussed above. Further information about the use of Cre-loxP recombination is found in U.S. Pat. No. 5,919,676 and Morsy and Caskey, Molecular Medicine Today, Jan. 1999, pgs. 18-24, both inco ⁇ orated herein by reference.
  • helper viruses have provided all Ad functions except E1 , and E1 is complemented by growth in 293 cells or the equivalent.
  • the resulting virus particles are harvested, and the helper virus is typically removed by CsCI gradient centrifugation (the vector chromosome is generally shorter than the helper chromosome, resulting in a difference in buoyant density between the two particles).
  • pAd ⁇ RSVDys An example of a gutless vector is pAd ⁇ RSVDys (Haecker et al, Human Gene Therapy 7:1907-1914 (1996)).
  • This plasmid contains a full-length human dystrophin cDNA driven by the RSV promoter and flanked by Ad inverted terminal repeats and packaging signals.
  • 293 cells are infected with a first-generation Ad which serves as a helper virus, and then transfected with purified pAd ⁇ RSVDys DNA. Both the helper Ad genome and the pAd ⁇ RSVDys DNA are replicated as Ad chromosomes, and packaged into particles using the viral proteins produced by the helper virus.
  • Particles are isolated and the pAd ⁇ RSVDys-containing particles separated from the helper by virtue of their smaller genome size and therefore different density on CsCI gradients.
  • the vector is grown in either 633 or 705 cells and Ad ⁇ . ⁇ gal. ⁇ F is used as a helper virus.
  • Ad ⁇ . ⁇ gal. ⁇ F is used as a helper virus.
  • both the Ad ⁇ . ⁇ gal. ⁇ F and Ad ⁇ RSVDys genomes replicate and are packaged into particles.
  • the Ad ⁇ . ⁇ gaL ⁇ F helper provides all the essential Ad proteins except fiber, and the fiber protein is that produced by the cells (Ad ⁇ fiber in 633 cells and Ad37 fiber in the case of 705 cells).
  • the particles containing Ad ⁇ RSVDys genomes are then isolated by centrifugation.
  • Tropism is evaluated by infecting Chang C cells (which express the Ad37 receptor) and A549 cells which do not express this protein but do express the natural Ad ⁇ receptor (CAR). The extent of infection is assessed by immunofluorescence staining of the infected cells with an anti-dystrophin antibody. By using purified recombinant Ad ⁇ and Ad37 fiber proteins as competitors during infection, the usage of the expected receptors by the pseudotyped particles is evaluated.
  • Ad3 adenovirus type 3
  • THP-1 , MRC-5, FaDu, and A-10 cells were purchased from the ATCC.
  • 211 B is a 293-derived cell line that expresses the wild-type Ad ⁇ fiber protein (Von Seggem et al, J. Gen. Virol 79:1461-1468 (1998)).
  • E1- 2a (Gorziglia et al., J. Virol. 70:4173-4178 (1996)) is an A ⁇ 49-derived cell line which complements adenoviral E1 and E2a functions.
  • the JR, TO, and TL LCL lines were established as described (Huang et al, Proc. Natl. Acad. Sci.
  • THP-1 and all LCL lines were maintained in RPMI 1640 medium (Gibco) + 10% fetal calf serum (FCS) (Hyclone).
  • FCS fetal calf serum
  • 211 B, MRC-5, and A-10 cells were grown in DMEM + 10% FCS.
  • E1 -2a and its derivatives were grown in Richter's modified medium (BioWhitaker) + 10% FCS.
  • Peripheral blood mononuclear cells were isolated from normal human blood (General Clinical Research Center, Scripps Clinic) by sedimentation on Ficoll-Paque (Pharmacia) per the manufacturer's instructions. Wild type Ad2 and Ad3 were purchased from the ATCC.
  • Ad ⁇ . ⁇ gal.wt and Ad ⁇ . ⁇ gal. ⁇ F (Von Seggern et al, J. Virol. 73:1601-1608 (1999)) has been previously described.
  • Av1 LacZ4 (Mitttereder et al, J. Virol. 70:7498-7609 (1996)) is a first-generation Ad ⁇ vector containing an RSV-driven ⁇ -galactosidase reporter gene.
  • Av9LacZ4 (Stevenson et al, J. Virol.
  • the complete Ad5 tripartite leader contained in pDV67 and pDV69 was constructed by assembly of PCR fragments.
  • pDV ⁇ was constructed similar to Example 5.
  • This plasmid contains a 1.2 kb Bam HVBgl II fragment consisting of the first TPL exon, the natural first intron, and the fused second and third TPL exons.
  • pDV60 was constructed by inserting this TPL cassette into the Bam HI site upstream of the Ad5 fiber gene in pcDNA3/Fiber (Von Seggern et al, J. Gen. Virol. 79:1461 -1468 (1998)).
  • pDV61 and pDV67 were then constructed similar to example 6.
  • the chimeric Ad3/Ad ⁇ fiber gene was amplified from pGEM6T3H (Stevenson et al, J.Virol. 69:2860-2857 (1995) using the primers 5' ATG GGA TCC AAG ATG AAG CGC GCA AGA CCG 3'(SEQ ID NO: 75) and 5' CAC TAT AGC GGC CGC ATT CTC AGT CAT CTT 3' (SEQ ID NO:76) , and cloned to the Bam HI and Not I sites of pcDNA3.1/Zeo(+) via novel Bam HI and Not I sites (bold) engineered into the primers to create pDV68. Finally, the complete TPL fragment described above was then added to the unique Bam HI site of this plasmid to create pDV69.
  • E1 -2a cells were electroporated as previously described (Von Seggern et al, J. Gen. Virol. 79:1461 -1468 (1998)) with pDV61 , pDV67, or pDV69, and stable lines were selected with 600 ⁇ g/ml Zeocin (Invitrogen).
  • Candidate clones were evaluated by immunofluorescence (Von Seggem et al, J. Gen. Virol. 79:1461 -1468 (1998)) using a polyclonal antibody generated against the Ad2 fiber (Wickham et al, Cell 73:309-319 (1993). Those lines expressing the highest level of nuclear fiber expression were further characterized.
  • Line 601 and 633 were produced by transfection of pDV61 and pDV67, respectively, and therefore express the wildtype Ad ⁇ fiber.
  • Line 644 contains pDV69 and expresses the chimeric 5T3H fiber.
  • Adenovirus stocks were prepared in the indicated cell lines, and plaque-titered on 633 cells essentially as described (Von Seggern et al, J. Virol. 73:1601 -1608 (1999)).
  • E1-2a cells (Gorziglia et al, J. Virol. 70:4173- 4178 (1996). and their derivatives contain a dexamethasone-inducible construct for complementation of E1a. 601 , 633, or 644 cells were therefore treated with 0.3 ⁇ M dexamethasone for 24 hours prior to infection, and 0.5 ⁇ M dexamethasone was included in the overlay for plaque assays.
  • Western blotting was performed as described (Von Seggern et al, J. Gen. Virol. 79:1461 -1468 (1998)) using polyclonal rabbit antibodies raised against either the Ad2 (Wickham et al, Cell 73:309-319 (1993) or Ad3 fibers (Stevenson et al, J. Virol. 77:4782-4790 (1997).
  • Determination of infection and binding to receptor was performed using methods known to those of skill in the art. 2 x 10 5 cells in a total volume of 200 ⁇ l were incubated with the indicated Ad preparation for three hours at 37 °C. Cells were then washed twice with fresh medium, and returned to 37 °C. Two days later, cells were fixed and stained with X-gal and counted by light microscopy as described (Von Seggern et al, J. Virol. 73:1601 -1608 (1999)).
  • CsCI-purified Ad2 or Ad3 was labeled with 125 l using lodogen tubes (Pierce). Free iodine was removed by filtration with a PD-10 Sephadex column (Pharmacia). Cells (1 x 10 6 cells in a volume of 200 ⁇ l either with or without a 100-fold excess of unlabeled virus) were rocked at 4 °C for two hours with 1 x 10 6 cpm of the labeled virus, washed three times with PBS and counted.
  • EBV-infected B cells could allow the development of therapies for a variety of lymphoprol iterative disorders. For example, ex vivo purging of donor marrow to eliminate infected cells could reduce the risk of EBV-associated lymphoproliferative disease, and EBV-induced malignancies such as AIDS- associated lymphoma are also potential targets.
  • B cells nor EBV- transformed lymphoblastoid cell lines (LCLs) are efficiently infected by Ad ⁇ -based vectors. As the tropism of Ad3-pseudotyped particles appeared to be somewhat broader, it was asked whether EBV-infected LCLs could be infected using this system.
  • Ad3-pseudotyped particles to infect LCLs generated by EBV infection of lymphocytes from three different normal human donors was tested. In agreement with previous reports, there was little or no infection of these by particles carrying the Ad ⁇ fiber. In contrast, virus particles equipped with the chimeric fiber protein were able to efficiently infect all of these lines. At equal particle/cell ratios, all LCLs examined were at least 10-fold more infectible using the Ad3 receptor.
  • PBMCs peripheral blood mononuclear cells
  • EBV-infected cells were mixed at varying ratios with PBMCs isolated from a normal human donor, and the mixture was then infected with Ad ⁇ . ⁇ gal. ⁇ F particles containing the 6T3H fiber protein. No infection of normal PBMCs alone was detected. Moreover, the percent of total cells infected increased with the fraction of JR cells added.
  • Production of fiberless virus by standard methods may include a two-step preparation protocol. This has been described in the earlier examples and is briefly described here again as follows:
  • Step I - amplification of fiber containing fiberless virus (Ad ⁇ /F7F + or Ad ⁇ . ⁇ gal. ⁇ F - fiberless, but there is fiber on the surface, not encoded in genome) on 21 1 B cell line (which stably expresses fiber), followed by CsCI-purification and characterization.
  • Step II preparation of virus particles lacking fiber (Ad ⁇ F " ) by infection of S.8 cell line with Ad ⁇ /F7F + , followed by CsCI purification and characterization. This produces a large stock of particles which do not contain fiber.
  • Step 1 is necessary because the infection efficiency of fiberless virus is extremely low, e.g. the dose of 20,000 particles/cell of Ad ⁇ / ⁇ g F " gives only 10% infected cells.
  • the production of fiberless virus by addition of exogenous fiber involves only a one-step protocol.
  • the fiberless virus is amplified using the S.8 cell line with addition of exogenous fiber into infection media.
  • the amount of exogenous fiber necessary for production is very low, no more than 7 ⁇ ng of purified fiber required per roller bottle. If desired the process may be followed by CsCI purification.
  • one advantage to this protocol is that it should provide no chance for recombination of adenovector during preparation.
  • a 10 roller bottle (RB) preparation of fiberless virus was made using the above two-step procedure.
  • the yield of adenovector was 6.6x10 12 particles - total Ad/ ⁇ galF " .
  • a 1 RB preparation of fiberless adenovector was also made from the same initial material using a one-step procedure with exogenous fiber. The total yield was 2.6x10 11 particles - Ad ⁇ galF " (one step procedure).
  • PCR assay was developed for detection of very low amounts of fiber contamination, as low as 10 "18 g. PCR assay showed much lower contamination for the preparation which was done by adding exogenous fiber (10 "15 g one-step procedure) vs. 10 "8 two-step procedure). Therefore, less contamination was obtained by simpler one-step approach.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Life Sciences & Earth Sciences (AREA)
  • Geochemistry & Mineralogy (AREA)
  • Manufacturing & Machinery (AREA)
  • Materials Engineering (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Manufacture, Treatment Of Glass Fibers (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/EP2000/000265 1999-01-14 2000-01-14 Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use Ceased WO2000042208A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
AU24372/00A AU772630B2 (en) 1999-01-14 2000-01-14 Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
IL14406000A IL144060A0 (en) 1999-01-14 2000-01-14 Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
JP2000593765A JP2002534130A (ja) 1999-01-14 2000-01-14 アデノウイルスベクター、パッケージ細胞系、組成物および製法および使用法
CA002359795A CA2359795A1 (en) 1999-01-14 2000-01-14 Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
EP00902591A EP1141357A1 (en) 1999-01-14 2000-01-14 Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
KR1020027012687A KR100688631B1 (ko) 1999-01-14 2000-03-25 기판 튜브 및 광섬유용 예비성형체 제조방법
AU2004201067A AU2004201067A1 (en) 1999-01-14 2004-03-12 Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US11592099P 1999-01-14 1999-01-14
US60/115,920 1999-01-14

Publications (2)

Publication Number Publication Date
WO2000042208A1 true WO2000042208A1 (en) 2000-07-20
WO2000042208A8 WO2000042208A8 (en) 2002-05-10

Family

ID=22364147

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2000/000265 Ceased WO2000042208A1 (en) 1999-01-14 2000-01-14 Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use

Country Status (7)

Country Link
EP (1) EP1141357A1 (https=)
JP (1) JP2002534130A (https=)
KR (1) KR100688631B1 (https=)
AU (2) AU772630B2 (https=)
CA (1) CA2359795A1 (https=)
IL (1) IL144060A0 (https=)
WO (1) WO2000042208A1 (https=)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002024933A3 (en) * 2000-09-25 2002-07-11 Galapagos Genomics Nv Viral vectors having tissue tropism for t-lymphocytes, b- and mast cells
WO2002056917A1 (fr) * 2001-01-18 2002-07-25 Virgene Biotechnology Limited Virus recombinant capable d'eradiquer de maniere specifique une tumeur associee au virus eb et son procede de construction
WO2004099422A2 (en) 2003-03-28 2004-11-18 The Scripps Research Institute Adenovirus particles with enhanced infectivity of dendritic cells and particles with decreased infectivity of hepatocytes
EP1470251A4 (en) * 2001-07-15 2006-02-22 Keck Graduate Inst EXPONENTIAL AMPLIFICATION OF NUCLEIC ACIDS USING NICKING AGENTS
US7232899B2 (en) 1996-09-25 2007-06-19 The Scripps Research Institute Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
US7332337B2 (en) 2000-05-16 2008-02-19 Galapagos Nv Viral vectors having tissue tropism for T-lymphocytes, B- and mast cells
WO2009147271A2 (es) 2008-06-04 2009-12-10 Proyecto De Biomedicina Cima, S.L. Sistema para empaquetamiento de adenovirus de alta capacidad
AU2007231692B2 (en) * 2001-10-11 2011-11-10 Msd Italia S.R.L. Hepatitis C virus vaccine
US8163892B2 (en) 2002-07-08 2012-04-24 Oncolys Biopharma, Inc. Oncolytic virus replicating selectively in tumor cells
US8530234B2 (en) 2001-10-11 2013-09-10 Merck Sharp & Dohme Corp. Hepatitis C virus vaccine
US9200041B2 (en) 2010-06-10 2015-12-01 University Of Washington Through Its Center For Commercialization Methods and systems for adenovirus interaction with desmoglein 2 (DSG2)
CN112805387A (zh) * 2018-10-09 2021-05-14 耐克基因有限责任公司 用于制备病毒载体的组合物和方法
US11077156B2 (en) 2013-03-14 2021-08-03 Salk Institute For Biological Studies Oncolytic adenovirus compositions
US11130968B2 (en) 2016-02-23 2021-09-28 Salk Institute For Biological Studies High throughput assay for measuring adenovirus replication kinetics
US11401529B2 (en) 2016-02-23 2022-08-02 Salk Institute For Biological Studies Exogenous gene expression in recombinant adenovirus for minimal impact on viral kinetics
US11813337B2 (en) 2016-12-12 2023-11-14 Salk Institute For Biological Studies Tumor-targeting synthetic adenoviruses and uses thereof
US12365878B2 (en) 2018-04-09 2025-07-22 Salk Institute For Biological Studies Oncolytic adenovirus with enhanced replication properties comprising modifications in E1A, E3, and E4
US12514887B2 (en) 2014-09-24 2026-01-06 Salk Institute For Biological Studies Oncolytic tumor viruses and methods of use

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110832072B (zh) * 2017-04-21 2023-11-07 真基因太科公司 用于生产非复制型腺病毒的细胞系以及制备所述细胞系的方法

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995000655A1 (en) * 1993-06-24 1995-01-05 Mc Master University Adenovirus vectors for gene therapy
WO1996039530A2 (en) * 1995-06-05 1996-12-12 The Trustees Of The University Of Pennsylvania Recombinant adenovirus and adeno-associated virus, cell lines, and methods of production and use thereof
WO1997037220A1 (en) * 1996-04-03 1997-10-09 Chugai Pharmaceutical Co., Ltd. Compositions and methods for screening drug libraries
WO1998013499A2 (en) * 1996-09-25 1998-04-02 Novartis Ag Packaging cell lines for use in facilitating the development of high-capacity adenoviral vectors
WO1998017783A1 (en) * 1996-10-23 1998-04-30 Regents Of The University Of Michigan Improved adenovirus vectors
EP0892047A2 (de) * 1997-07-09 1999-01-20 Hoechst Marion Roussel Deutschland GmbH Humanes und murines Semaphorin L

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR9713218A (pt) * 1996-09-24 2000-04-04 Henkel Ecolab Gmbh & Co Ohg Limpador compacto contendo tensoativo

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995000655A1 (en) * 1993-06-24 1995-01-05 Mc Master University Adenovirus vectors for gene therapy
WO1996039530A2 (en) * 1995-06-05 1996-12-12 The Trustees Of The University Of Pennsylvania Recombinant adenovirus and adeno-associated virus, cell lines, and methods of production and use thereof
WO1997037220A1 (en) * 1996-04-03 1997-10-09 Chugai Pharmaceutical Co., Ltd. Compositions and methods for screening drug libraries
WO1998013499A2 (en) * 1996-09-25 1998-04-02 Novartis Ag Packaging cell lines for use in facilitating the development of high-capacity adenoviral vectors
WO1998017783A1 (en) * 1996-10-23 1998-04-30 Regents Of The University Of Michigan Improved adenovirus vectors
EP0892047A2 (de) * 1997-07-09 1999-01-20 Hoechst Marion Roussel Deutschland GmbH Humanes und murines Semaphorin L

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
FALGOUT B AND KETNER G: "Characterization of adenovirus particles made by deletion mutants lacking the fiber gene", JOURNAL OF VIROLOGY, vol. 62, XP000909209 *
HARDY S ET AL: "CONSTRUCTION OF ADENOVIRUS VECTORS THROUGH CRE-LOX RECOMBINATION", JOURNAL OF VIROLOGY,US,THE AMERICAN SOCIETY FOR MICROBIOLOGY, vol. 71, no. 3, 1 March 1997 (1997-03-01), pages 1842 - 1849, XP000670223, ISSN: 0022-538X *
PARKS R J ET AL: "A HELPER.DEPENDENT ADENOVIRUS VECTOR SYSTEM: REMOVAL OF HELPER VIRUS BY CRE-MEDIATED EXCISION OF THE VIRAL PACKAGING SIGNAL", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA,US,NATIONAL ACADEMY OF SCIENCE. WASHINGTON, vol. 93, no. 24, 26 November 1996 (1996-11-26), pages 13565 - 13570, XP000617948, ISSN: 0027-8424 *
STEVENSON S C ET AL: "HUMAN ADENOVIRUS SEROTYPES 3 AND 5 BIND TO TWO DIFFERENT CELULAR RECEPTORS VIA THE FIBER HEAD DOMAIN", JOURNAL OF VIROLOGY,US,THE AMERICAN SOCIETY FOR MICROBIOLOGY, vol. 69, no. 5, May 1995 (1995-05-01), pages 2850 - 2857, XP002911347, ISSN: 0022-538X *
STEVENSON S C ET AL: "Selective targeting of human cells by a chimeric adenovirus vector containing a modified fiber protein", JOURNAL OF VIROLOGY,US,THE AMERICAN SOCIETY FOR MICROBIOLOGY, vol. 71, no. 6, June 1997 (1997-06-01), pages 4782 - 4790, XP002121965, ISSN: 0022-538X *
VON SEGGERN DAN ET AL.,: "An adenoviral gene therapy vector deleted for E1, E3 and fiber: Structure and infectivity of fiberless particles", CANCER GENE THERAPY, vol. 5, no. 6, December 1998 (1998-12-01), pages s14, XP000909076 *
VON SEGGERN DAN J ET AL.,: "A helper-independent adenovirus vector with E1, E3, and fiber deleted: Structure and infectivity of fiberless particles.", JOURNAL OF VIROLOGY, vol. 73, no. 2, February 1999 (1999-02-01), pages 1601 - 1608, XP000906914 *
VON SEGGERN DAN J ET AL.,: "Adenovirus vector pseudotyping in fiber-expressing cell lines: Improved transduction of Epstein-Barr virus-transformed B cells.", JOURNAL OF VIROLOGY, vol. 74, no. 1, January 2000 (2000-01-01), pages 354-362, XP000906911 *
VON SEGGERN DAN J ET AL.,: "Complementation of a fibre mutant adenovirus by packaging cell lines stably expressing the adenovirus type 5 fibre protein", JOURNAL OF GENERAL VIROLOGY, vol. 79, June 1998 (1998-06-01), pages 1461-1468, XP002138278 *
ZUFFEREY R ET AL.,: "Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors", JOURNAL OF VIROLOGY, vol. 73, no. 4, April 1999 (1999-04-01), pages 2886 - 2892, XP000906913 *

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7232899B2 (en) 1996-09-25 2007-06-19 The Scripps Research Institute Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
US7332337B2 (en) 2000-05-16 2008-02-19 Galapagos Nv Viral vectors having tissue tropism for T-lymphocytes, B- and mast cells
WO2002024933A3 (en) * 2000-09-25 2002-07-11 Galapagos Genomics Nv Viral vectors having tissue tropism for t-lymphocytes, b- and mast cells
WO2002056917A1 (fr) * 2001-01-18 2002-07-25 Virgene Biotechnology Limited Virus recombinant capable d'eradiquer de maniere specifique une tumeur associee au virus eb et son procede de construction
EP1470251A4 (en) * 2001-07-15 2006-02-22 Keck Graduate Inst EXPONENTIAL AMPLIFICATION OF NUCLEIC ACIDS USING NICKING AGENTS
AU2007231692B2 (en) * 2001-10-11 2011-11-10 Msd Italia S.R.L. Hepatitis C virus vaccine
US8530234B2 (en) 2001-10-11 2013-09-10 Merck Sharp & Dohme Corp. Hepatitis C virus vaccine
US8163892B2 (en) 2002-07-08 2012-04-24 Oncolys Biopharma, Inc. Oncolytic virus replicating selectively in tumor cells
WO2004099422A2 (en) 2003-03-28 2004-11-18 The Scripps Research Institute Adenovirus particles with enhanced infectivity of dendritic cells and particles with decreased infectivity of hepatocytes
ES2330826B1 (es) * 2008-06-04 2010-07-26 Proyecto De Biomedicina Cima, S.L. Sistema para empaquetamiento de adenovirus de alta capacidad.
ES2330826A1 (es) * 2008-06-04 2009-12-15 Proyecto De Biomedicina, S.L Sistema para empaquetamiento de adenovirus de alta capacidad.
WO2009147271A2 (es) 2008-06-04 2009-12-10 Proyecto De Biomedicina Cima, S.L. Sistema para empaquetamiento de adenovirus de alta capacidad
US9200041B2 (en) 2010-06-10 2015-12-01 University Of Washington Through Its Center For Commercialization Methods and systems for adenovirus interaction with desmoglein 2 (DSG2)
US11077156B2 (en) 2013-03-14 2021-08-03 Salk Institute For Biological Studies Oncolytic adenovirus compositions
US12589128B2 (en) 2013-03-14 2026-03-31 Salk Institute For Biological Studies Oncolytic adenovirus compositions
US12514887B2 (en) 2014-09-24 2026-01-06 Salk Institute For Biological Studies Oncolytic tumor viruses and methods of use
US11130968B2 (en) 2016-02-23 2021-09-28 Salk Institute For Biological Studies High throughput assay for measuring adenovirus replication kinetics
US11401529B2 (en) 2016-02-23 2022-08-02 Salk Institute For Biological Studies Exogenous gene expression in recombinant adenovirus for minimal impact on viral kinetics
US12281324B2 (en) 2016-02-23 2025-04-22 Salk Institute For Biological Studies Exogenous gene expression in recombinant adenovirus for minimal impact on viral kinetics
US11813337B2 (en) 2016-12-12 2023-11-14 Salk Institute For Biological Studies Tumor-targeting synthetic adenoviruses and uses thereof
US12365878B2 (en) 2018-04-09 2025-07-22 Salk Institute For Biological Studies Oncolytic adenovirus with enhanced replication properties comprising modifications in E1A, E3, and E4
CN112805387A (zh) * 2018-10-09 2021-05-14 耐克基因有限责任公司 用于制备病毒载体的组合物和方法

Also Published As

Publication number Publication date
WO2000042208A8 (en) 2002-05-10
JP2002534130A (ja) 2002-10-15
EP1141357A1 (en) 2001-10-10
IL144060A0 (en) 2002-04-21
KR20030017483A (ko) 2003-03-03
AU2004201067A1 (en) 2004-04-08
KR100688631B1 (ko) 2007-03-02
AU772630B2 (en) 2004-05-06
AU2437200A (en) 2000-08-01
CA2359795A1 (en) 2000-07-20

Similar Documents

Publication Publication Date Title
US20090098599A1 (en) Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
EP1471146B1 (en) A packaging cell line expressing for use in facilitating the development of high capacity adenoviral vectors
JP3565859B2 (ja) 改良されたアデノウイルスおよびその使用法
US7270811B2 (en) Serotype of adenovirus and uses thereof
US6156497A (en) Recombinase-mediated generation of adenoviral vectors
Krasnykh et al. Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism
WO2000042208A1 (en) Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
US20100034774A1 (en) Serotype of adenovirus and uses thereof
AU2001295193A1 (en) Vectors for ocular transduction and use thereof for genetic therapy
AU2002344190B8 (en) Adenovirus protein IX, its domains involved in capsid assembly, transcriptional activity and nuclear reorganization
AU2001263689B2 (en) Modified bovine adenovirus having altered tropism
AU2002344190A1 (en) Adenovirus protein IX, its domains involved in capsid assembly, transcriptional activity and nuclear reorganization
AU2001263689A1 (en) Modified bovine adenovirus having altered tropism
WO2007094653A1 (en) Adenovirus particles having a chimeric adenovirus spike protein, use thereof and methods for producing such particles.
EP1593742A2 (en) Recombinant adenoviral vectors expressing chimeric fiber proteins for cell specific infection
US20100173387A1 (en) Method for producing adenovirus vectors for gene therapy and dna sequences used therefor
US7560527B1 (en) Modified adenovirus fibre and uses
US20020137213A1 (en) Adenovirus particles with mutagenized fiber proteins
AU2004202701A1 (en) Packaging cell lines for use in facilitating the development of high-capacity adenoviral vectors
WO2002083902A2 (en) Adenovirus serotype 30 (ad30) fiber protein and uses thereof
AU3345801A (en) Recombinase-mediated generation of adenoviral vectors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 24372/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 144060

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2000902591

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 512874

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 2359795

Country of ref document: CA

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2000 593765

Country of ref document: JP

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2000902591

Country of ref document: EP

AK Designated states

Kind code of ref document: C1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

AK Designated states

Kind code of ref document: B8

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: B8

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i
WWG Wipo information: grant in national office

Ref document number: 24372/00

Country of ref document: AU

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)