WO2000033880A2

WO2000033880A2 - Conjugate used for enriching in neuronal cells

Info

Publication number: WO2000033880A2
Application number: PCT/DE1999/003924
Authority: WO
Inventors: Achim LÖHR; Manfred Schwab
Original assignee: Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts
Priority date: 1998-12-04
Filing date: 1999-12-03
Publication date: 2000-06-15
Also published as: WO2000033880A3; DE19856052A1

Abstract

The invention relates to a conjugate for introducing active substances into neuronal cells, whereby the conjugate comprises the heavy chain of a toxin of the genus Clostridium and has at least one active substance, whereby the light chain of the toxin is absent. The invention also relates to a method for producing a conjugate of this type, to a kit and to the use of said conjugate.

Description

Conjugate for enrichment in neuronal cells

The present invention relates to a conjugate for enrichment in neuronal cells, a method for producing the conjugate, a kit and the use of these objects.

There are various diseases that affect cells of the central and / or peripheral nervous system. Examples include Parkinson's disease, Alzheimer's disease, stroke, brain tumors (e.g. gliomas, medulloblastomas, astrocytomas) or neuroblastomas. Neuroblastoma accounts for about 8-10% of all cancers in children and is the most common extracranial solid tumor in children. Neuroblastoma arises from neuroectodermal cells of the neural crest. These cells migrate from the neural crest during embryonic development and form the sympathetic nervous system and the adrenal medulla. It is now certain that around 30% of the higher malignant neuroblastomas are amplified by MYC N, whereby the amount of amplification of MYC N is correlated with the aggressiveness of tumor growth. Overall, it can be stated for all neuroblastomas that they are characterized by a complex clinical picture and a heterogeneous course of the disease. While there is spontaneous regression of the tumor in some patients, the disease progresses in about half of the patients despite intensive therapy. Therapy is also difficult for brain tumors. This is due in particular to the fact that most medications cannot pass certain cell barriers, such as the blood-brain barrier, and cannot reach the desired site of action at all. Radiological treatments are also not as successful as desirable. Drug pretreatment of the tumors for photosensitization would certainly contribute to the success of the subsequent radiation treatment (photodynamic therapy). But also this fails because there are no ways in which the agents can get into the diseased cells. The problems outlined above with neuroblastomas and brain tumors generally exist for all diseases of the nervous system, since the therapeutic and diagnostic active substances do not reach nerve cells efficiently even in diseases other than cancer.

The object of the present invention is to provide a means with which a wide variety of substances or active ingredients can be introduced into neuronal cells.

This object is solved by the subject matter of the claims.

The inventors found that with a conjugate that contains the heavy chain of a toxin of the genus Clostridium, a wide variety of substances or active substances with therapeutic or diagnostic effects can be transported into neuronal cells. The heavy chain of a toxin of the genus Clostridium gives the active substances the desired cell permeability for neuronal cells. According to the invention, the "heavy chain of a toxin of the genus Clostridium" should also be understood to mean fragments or modifications (e.g. exchanges, inversions, deletions or insertions), but which still have transport properties in neuronal cells. A "toxin of the genus Clostridum" means, for example, the tetanus toxin, botulinum toxin and its serotypes (A-G). The primary site of action of tetanus toxin is the central nervous system and botulinum toxin is the peripheral nervous system.

Cell permeability here refers to the property of substances or active ingredients to penetrate into neuronal cells. However, as already stated above, this property is naturally only found in a few substances. Most substances require aids or processes in order to To invade cells. Examples include microinjection, electroporation, association with cationic lipids, liposome formation, receptor-mediated endocytosis and virus infection. However, these tools and methods have major disadvantages. In particular, they are expensive, require complex experimental arrangements and can only be used to a limited extent. Furthermore, their efficiency is low and they often prove to be toxic. These problems can be avoided with the conjugates according to the invention. This applies in particular because only the non-toxic heavy chain of the toxin is used and not the entire toxin, as in WO 95/32738, which is composed of two polypeptide chains (light chain and heavy chain). The toxin of the genus Clostridium was modified according to the invention in such a way that the toxic light chain of the molecule was eliminated or replaced by a domain which confers an affinity for the substances to be introduced into neuronal cells. The inventors have found that conjugates containing only the heavy chain of a Clostridium toxin accomplish the above object because the functions of neurospecific binding and uptake, as well as transport and release into the cytoplasm, are all in the sequence of the heavy ones Chain are encoded. The latter is an important advantage of the heavy chain compared to the C fragment.

The expression "mediation of cell permeability to substances" indicates that the heavy chain of a toxin of the genus Clostridium can mediate cell permeability to active substances of any kind and origin. The active ingredients can be, for example, (poly) peptides, proteins, nucleic acids or chemical compounds. Examples of polypeptides are structural polypeptides, tumor ornecrosis factor, interferons, interleukins, lymphokines, growth factors, plasma proteins, for example coagulation factors and metabolic enzymes, and receptors. In particular, the polypeptides can be those which can increase the immunogenicity of cells. These can be polypeptides that tumor cells lack, for example cytokines such as IL-2 and GM-CSF, and costimulatory molecules such as B7-1. tumor-associated antigens, for example MAGE1, tyrosinases and viral polypeptides, for example E7 from human papilloma virus and EBNA-3 polypeptide from Epstein-Barr virus. Furthermore, the polypeptides can be adapter polypeptides, oligomerization motifs of a polypeptide, polypeptide fragments of virus envelope polypeptides, hormones and ribozymes. Examples of nucleic acids are those encoding the above polypeptides. Furthermore, they can be antisense oligonucleotides (in particular for the inhibition of MYC N in the treatment of neuroblastoma tumors), peptide nucleic acids and consenus sequences for transcription factors. Examples of chemical compounds are drugs that do not have a polypeptide structure. These can include cytostatics, anesthetics, antihistamines, antibiotics, photoactive substances, radioactive substances, substances capable of fluorescence or substances for fluorine magnetic resonance spectroscopy. Examples of chemotherapy drugs are antivirals, antiprotozoal agents, cytostatic agents and antibiotics. Representatives of these are, for example, doxorubicin, daunorubicin, tetracyclines, antimetabolites, such as methotrexate, and derivatives thereof. Examples of the photoactive substances are porphyrins, such as o-, m- and / or p-tetracarboxyphenylporphyrin (TCPP), chlorins and bacteriochlorins. An example of the radioactive substance is a tyrosine labeled with radioactive iodine. Examples of the substances capable of fluorescence are fluorescent dyes, such as fluorescein, aminofluorescein (AF1), and derivatives and analogues thereof. Examples of the substances for fluorine nuclear spin spectroscopy are polyfluorocarboxylic acids such as trifluoroacetic acid.

One or more of the above active ingredients can be present in the conjugate according to the invention. If there are several, these can be the same or different from one another.

In a preferred embodiment, the heavy chains of a toxin of the genus Clostridium are linked to the active ingredient via a linker. In principle, conjugation with the heavy chain can be achieved in two ways: a) The active ingredient to be coupled is modified with an amino-reactive, bispecific crosslinker and activated in the process. This modified molecule then reacts with the free SH group of the heavy chain via an activated disulfide bridge, which originates from the linker, and forms a covalent disulfide bridge. Suitable crosslinkers are SPDP, LC-SPDP or Sulfo-LC-SPDP; SMPT or Sulfo-LC-SMPT; SMCC or sulfo-SMCC; MBS or Sulfo-MBS, SIAB or Sulfo-SIAB, SMPB or Sulfo-SMPB; GMBS or Sulfo-GMBS, SIAX or SIAXX; SIAC or SIACC, NPIA (all from Pierce, Rockford, USA) b) The heavy chain is activated by a crosslinker, which then ensures binding to an active ingredient. For example, the heavy chain can be reacted with NHS-SS-biotin, then binding via biotin to avidin or streptavidin. Other suitable linkers are D-biotin or biocytin; NHS-biotin or sulfo-NHS-biotin, NHS-LC-biotin or sulfo-NHS-LC-biotin; NHS iminobiotin; Sulfo-NHS-SS biotin; Biotin BMCC; Biotin-HPDP; Iodoacetyl LC biotin; Biotin hydrazide or Biotin LC hydrazide, biocytin hydrazide, 5- (biotinamido) pentylamine (all from Pierce, Rockford, USA).

Further linkers known to the person skilled in the art can also be used. The linker can be present at the N-terminus, at the C-terminus, on primary amino groups or SH groups, it also being possible to modify amino acids located in the middle of the molecule. With the adjustment of the pH value in the reaction, the reaction can be controlled in such a way that modifications are preferably made at the N-terminus. Lysine residues are also reactive, especially at high pH. In the case of the desired binding of a protein, peptide or ribozyme as an active ingredient, it has proven useful to carry out the coupling to the heavy chain of the clostridium toxin by means of a chemical crosslinker. The procedure is as follows, for example. The heavy chain of a toxin, preferably tetanus toxin (Clostridium tetani), is separated from the light chain by means of isoelectric focusing (Weller et al., Eur. J. Biochem. 182, pp. 649-656 (1989)), whereby it and is present in a solution containing urea (eg 2 M urea, 50 mM DTT). To get back to the natural conformation, this solution is dialyzed against a physiological buffer. Native disulfide bridging occurs spontaneously in the C-terminal part, and the cysteine group, which normally forms the bond to the light chain, is exposed at the N-terminus of the heavy chain. In order to achieve the desired disulfide bond there, a bispecific crosslinker, such as sulfo-LC-SPDP (from Pierce, USA), can be used. In principle, the reaction proceeds in such a way that the substance to be coupled first reacts with the NHS group of the linker via a primary amino group and produces a stable amide bond. In the second step, the resulting construct is implemented with the heavy chain of the toxin. A disulfide exchange takes place between the linker and the SH group of the heavy chain of the toxin. This creates a stable disulfide bridge that connects the substance to be coupled with the heavy chain of the toxin.

In another preferred embodiment, the heavy chain of a toxin of the genus Clostridium is in the form of a fusion polypeptide. The term "heavy chain of a toxin of the genus Clostridium" therefore also encompasses a fusion polypeptide or protein in which the heavy chain of the toxin has been recombinantly produced as a continuous polypeptide or protein with another polypeptide or protein. This other peptide or protein is said to give the heavy chain of the toxin binding properties for the above substances, the binding (e.g. in the case of nucleic acids) taking place via ionic interactions. These peptides or proteins which confer binding properties on the toxin are in particular basic proteins, such as e.g. the HMG (High Mobility Group) -1 protein, His ton proteins, protamine, spermidine or polypeptides with special DNA binding motifs, e.g. Helix-turn-helix, zinc finger or leucine zipper.

Another possibility, in particular for attaching nucleic acids to the heavy chain, is the coupling of an oligonucleotide (eg via crosslinker), with this Oligonucleotide is able to form a so-called triple helix with special nucleic acid sequences, for example on a plasmid. This binds the nucleic acids to the heavy chain via hydrogen bonds with the oligonucleotide. The advantage is that this bond is more stable than ionic interactions under physiological conditions.

The mediation of cell permeability to active substances can be demonstrated by conventional methods. It is favorable to incubate cells with the toxin-linked substances and to detect the penetration or presence of the heavy chain of a Clostridium toxin and / or the substances in the cells. This can e.g. by means of specific antibodies (e.g. as part of the immunofluorescence method) or reagents that react directly or indirectly with the heavy chain of a Clostridu toxin or the substances.

The heavy chain of the Clostridium toxin must be separated from the light chain before it is conjugated to the therapeutic or diagnostic agents. The heavy chain is preferably produced recombinantly, but can also be carried out in other ways known to the person skilled in the art.

One way that the use of the heavy chain offers is to imitate the native composition of the toxin as identically as possible in order to produce a construct that has all the functions of the toxin protein with the exception of the toxic properties. For this purpose, the light chain of the toxin is preferably replaced by other proteins or substances which, like in the native toxin, are bound to the heavy chain via a disulfide bridge.

Nucleic acids such as anti-sense oligonucleotides are preferably coupled to a fusion protein of the heavy chain of a Clostridium toxin. This is described in detail in one of the examples below. Such constructs are ideal for gene therapy purposes, for example for the treatment of Neuroblastoma tumors if the anti-sense oligonucleotide inhibits the expression of MYC N, for example.

Another object of the present invention is a kit. Such comprises one or more of the following components:

(a) the heavy chain of a toxin of the genus Clostridium

(b) usual auxiliaries, such as carriers, buffers, solvents, controls, etc.

One or more representatives of each of the individual components can be present. With regard to the individual terms, reference is made to the above explanations.

The present invention makes it possible to impart cell permeability for neuronal cells to substances of all types and origins. The cells can also be present ex vivo or in vivo. Furthermore, cell permeability does not trigger any toxic effects.

The present invention is therefore ideal for diagnosis and therapy. The latter includes intervening in the expression of genes and in metabolic processes. The present invention is particularly suitable for the diagnosis and therapy of severe diseases, e.g. of tumors. The present invention is particularly distinguished by the fact that it can be used for both conservative and gene therapy treatment measures.

The invention is described below with reference to the figures.

Fig. 1: Recording of conjugates in neuroblastoma cells AI: Dapi nuclear staining of the HDN-16 cells

Figure A2 A2: Avidin signals from HDN-16 cells which were incubated with a conjugate from the heavy chain of the tetanus toxin and avidin. Avidin was detected using a FITC-labeled secondary antibody that recognizes a specific avidin antibody.

Bl: Propidium iodide nuclear staining of the Kelly cells from image B2.

B2: FITC signal of oligonucleotides incubated with a tetanus toxin heavy chain conjugate, avidin and biotinylated oligonucleotides (FITC-labeled).

Fig. 2: Evidence of the inclusion of the full-length

Fusion protein from the truncated HMG-1 protein and the heavy chain of the tetanus toxin in the neuroblastoma cell line IMR-32 A: Dapi nuclear staining of the cells from image BB: detection of the fusion protein via a polyclonal AK against the C fragment of the heavy one Chain of tetanus toxin and a CY-2 labeled secondary antibody

The invention is described below using the examples. The working methods are based on Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning; A Laboratory Manual, Cold Spring Habor, and Current Protocols in Molecular Biology, John Wiley and Sons, 1994-1998.

Example 1: Isolation and cloning of the heavy gene

Chain of the tetanus toxin from Clostridium tetani

A 1 y ophi 1 isi er t es bacterial sediment from Clostridium tetani (Massachusetts strain), which was obtained from ATCC under the number ATCC 10709, was used as the starting material. After DNA extraction, the goal was to use the Pfu polymerase and subsequent primers that introduced the restriction sites for cloning to add the approximately 2.5 kb heavy chain gene without mutations amplify. The following parameters were selected: large amount of starting DNA (0.5 μg), large amount of polymerase (10 U), long extension times for the "proof-reading" function of the polymerase (7 min for the 2.5 kb gene ), small number of cycles (5 cycles at 54 ° C, since the restriction sites are not complementary in the first cycles, then 15 cycles at 60 ° C):

PCR approach: 0.5 μg DNA

25 pmol cloning primer 1

25 pmol cloning primer 2

5 ul 10 x Pfu buffer (200 mM Tris-HCl, pH

8.8 20 mM MgS0 ₄ 100 mM KC1 100 mM (NH ₄ ) ₂ S0 ₄ 1% Triton 1 mg / ml BSA)

10 ul dNTP mix

10 U Pfu polymerase ad 50 ul H ₂ 0

Cloning Primer 1: HCH.FOR

GCATATCCATGGATTTAGGAGGAGAATTTATGTATAAA

Ncol

Cloning Primer 2: HCH.REV

TATATACCCGGGATCATTTGTCCATCCTTCATCTGT

Smal

Under the above PCR conditions, it was possible to form the expected 2.5 kb fragment with no by-products. After a preparative agarose gel electrophoresis with subsequent gel extraction, the DNA fragment was cut with Ncol and Smal and cloned into the expression vector pCYB4 (IMPACT system, New England Biolabs, Beverly, USA) prepared according to the manufacturer's instructions. The vector obtained was named pCYB4-HCH. The cloning was verified by sequencing.

For reasons of cloning, the recombinant protein at the C-terminus also had the amino acids glycine and proline before the intein cleavage site. At the amino terminus it was shortened by three amino acids compared to the wild-type protein. Consequently was the first amino acid of the recombinant protein after formyl methionine an aspartate. This amino acid can destabilize the protein in eukaryotic cells by inducing rapid degradation. To ensure that the recombinant heavy chain is stable after the uptake of human cells, the amino terminus has been completed. For this purpose, an oligo adapter was introduced into pCYB4-HCH via an Ncol and BseRI interface, which codes for the three missing amino-terminal amino acids. Thus the first amino acid was a serine that is stabilizing for the protein. The cloning was verified by sequencing.

AD-A 5 '-CATGTCATTAACAGATTTAGGAGGAGAATTATGTAT-3'

AD-B 3 -AGTAATTGTCTAAATCCTCCTCTTAATACA-5 'new: Ser Leu Thr old: Asp Leu ...

The new construct was named pCYB4-Ad-A + B-HCH.

The IMPACT T7 system (New England Biolabs, Beverley, USA) was used as a further expression system. In contrast to the original system, this uses the T7 polymerase to transcribe the expression plasmid. Since an additional purification via an N-terminal Histag was also to be made possible with this system, an appropriate adapter was cloned into the expression plasmid pTYBl. The vector was digested with Ndel and Xhol and the adapter I + II ligated.

Ad-I 5 '-TATGCACCATCACCATCACCATC-3' Ad-II 3 '-ACGTGGTAGTGGTAGTGGTAGAGCT-5'

His His HIs His His His Leu Glu

The cloning was verified by sequencing. The construct was named pTYBl-Ad-I + II.

The plasmid pTYBl-Ad-I + II was digested with SapI, the overhanging bases were filled with the Klenow fragment and the Vector digested again with Xhol.

Starting from the plasmid pCYB4-Ad-A + B-HCH with the complete heavy chain gene, a PCR with the Pfu polymerase was carried out for the cloning. This amplified the heavy chain gene which had an Xhol cleavage site at the 5 'end and had exchanged the aspartate codon (last amino acid wt heavy chain) with the serine codon at the 3' end. This amino acid exchange had become necessary because aspartate would have caused total in vivo cleavage of the HCH-intein fusion protein (manual IMPACT system). After Xhol digestion, the PCR product was ligated into the prepared vector pTYBl-Ad-I + II sticky / blunt. With this strategy, the heavy chain gene was cloned without an additional amino acid at the C-terminus directly before the first amino acid of the inte.

The construct was called pTYBl-HCH.

1. Primer: XhoHCH. FOR TATATACTCGAGTCATTAACAGATTTAGGA

GGAGAATT

2nd Primer: BluntHCH-A. REV GCTATTTGTCCATCCTTCATCTGTAGGTA-

CAAAGTA

PCR parameters

5 min 95 ° C

25 and 1 min 95 ° C

1 min 55 ° C

7.5 minutes at 72 ° C

10 min 72 ° C, then 4 ° C

Pruiz-π αes iMPACTÖvstems Example 2: Expression and purification of the heavy chain of the

Tetanus toxins in E. coli

A 200 ml LB-Amp overnight culture was inoculated from an E. coli K12 bacterial culture from pTYBl-HCH. The next day, this was added to 800 ml LB-Amp and shaken at 37 ° C. to an OD ₆₀₀ of 1.0 to 1.5. 50 ml of these bacteria were taken as an uninduced sample and sedimented. IPTG was added to the remaining batch at a final concentration of 1 mM and the bacteria were shaken at room temperature for 4-5 hours. After the induction period, the bacteria were sedimented and were able to

-20 ° C can be stored. All subsequent steps were carried out on ice or in the cold room.

The sediments, which corresponded to a bacterial suspension of approx. 250 ml, were resuspended with 6.25 ml lysis buffer (20 mM HEPES, PH8, 0, optionally 2M urea 500 µM EDTA 0.1% Triton X-100). To prevent proteolytic degradation, COMPLETE proteinase inhibitor (from Boehringer Mannheim) was added according to the manufacturer's instructions. The cell disruption was carried out by means of ultrasound (Branson-Sonifier 250; 5x1 min, 20% performance, each with a 30 sec break). After the subsequent centrifugation at 12,000 g for 30 min, the supernatant was placed on a chitin column equilibrated with lysis buffer. The flow through was collected and passed over the column again. The first washing step with the 4-fold column volume was carried out with the lysis buffer. A washing step was concluded with washing buffer 1 (20 mM HEPES, pH 8.0; 500 mM NaCl; 0.1 mM EDTA; 0.1% Triton X-100) (8-fold column volume) and washing buffer 2 (50 mM BICINE, pH 8.5; 150 mM NaCl; 1 MM EDTA) (4-fold column volume). To induce protein cleavage, 3 column volumes of cleavage buffer (50 mM BICINE, pH 8.5; 150 mM NaCl; 1 mM EDTA, 30 M ß-mercaptoethanol) were passed over the column and the column was then closed overnight. Elution was carried out with washing buffer 2 and the protein concentration was determined using the BioRad detection system. After the C-terminal purification of the recombinant proteins described above, products of heterogeneous size eluted. As a further purification step, the full length protein, which had 6 histidines at the N-terminus, should therefore be homogeneously isolated using a Ni-agarose affinity matrix.

The Ni agarose suspension was equilibrated with washing buffer 2 (4 M urea, 100 mM NaH ₂ PO ₄ , 10 mM Tris-HCl, pH 6.3). The protein solution was adjusted to a urea concentration of 4 M by adding the same volume of wash buffer 1 (8 M urea, 100 mM NaH ₂ PO ₄ , 10 mM Tris-HCl, pH 6.3). After the Ni beads had been added, the suspension was incubated in a reaction vessel on a tumble roller mixer at 4 ° C. for 30-60 min. The mixture was then poured into an empty column, which retained the beads by means of a frit. Unbound proteins were removed with 10 times the column bed volume of wash buffer 2. Before the elution, the urea was removed by washing buffer 3 (50 mM NaH ₂ PO ₄ , pH 8.0, 150 mM NaCl) and the pH was adjusted to 8.0. The bound proteins were released through the elution buffer and collected.

Example 3; Expression and purification of a fusion protein from the HMG-1 gene and the tetanus toxin heavy chain gene

Another goal was to combine the tetanus toxin heavy chain gene with another gene to obtain a fusion protein with new properties. The heavy chain functions, which include cell type specific binding, uptake and release of the toxin, should be complemented by a DNA binding domain. For this purpose, the human chromatin protein HMG-1 was cloned.

The term HMG stands for High Mobility Group and refers to the running behavior of the proteins in polyacrylamide gel electrophoresis. The proteins belong to the non-histone Share of chromatin and are divided into three families: 1. HMG-1/2; 2. HMG-14/17; 3. HMG-I (Y). HMG-1/2 proteins are expressed in all cells, but their exact function is not known. The molecular weight is about 25 kDa. Similar to histones, these are proteins with a highly conserved sequence. The homology between the HMG-T of the trout and the human HMG-1 is still 70%. The two so-called HMG boxes A and B, which are homologous to other HMG proteins, are characteristic of the HMG-1 protein. These boxes are located in the N-terminal area, have a net charge of +20 and cause unspecific DNA binding. The binding is approximately 14 bp, the DNA being bent. In contrast to the HMG boxes, the C-terminus is negatively charged, so that the total charge is -5.

An IMAGE clone was identified by database research, which contained the desired gene. The clone p998B091570 (clone ID 645032) was supplied by the Resource Center Berlin (MPI for Molecular Genetics).

The gene was amplified with the Pfu polymerase using sequence-specific primers which had an Ncol or Smal site at the 5 'end.

Approach: s. example 1

Cloning Primer 1: HMG-l.FOR

GCATATCCATGGGCAAAGGAGATCCTAAGAA

Ncol

Cloning primer 2: HMG-la.REV

TATATAGGGCCCTTCATCATCATCATCTTCTTC

Smal

PCR parameters 5 min 95 ° C

5 cycles 1 min 95 ° C

1 min 56 ° C

7 min 72 ° C

15 cycles 1 min 95 ° C

1 min 62 ° C

7 min 72 ° C

10 min 72 ° C, then 4 ° C The plasmid pCYB4-HCH (see Example 1) was digested with Ncol and BseRI and the adapter Ad X + Y was inserted. This adapter made it possible to ligate the HMG-1 PCR fragment digested with Ncol and Smal in frame in front of the heavy chain gene via Ncol and SnaBI (as well as Smal blunt). The adapter also completed the 5 'end of the heavy chain and inserted a peptide linker between the two proteins. The peptide linker had the following sequence: Val-Lys-Ser-Ala-Pro-Ser-Gly.

Ad-X

5 '-CATGGGCGGCCGCTACGTAAAGAGCGCTCCCTCGGGGTCATTAACAGA-

TTTAGGAGGAGAATTATGTAT-3 '

Ad-Y

3 -CCGCCGGCGATG CATTTCTCGCGAGGGAGCCCCA G -

TAATTGTCTAAATCCTCCTCTTAATACA-5 '

All clonings were verified by sequencing. The vector with the inserted adapter was named pCYB4-Ad-X + Y-HCH and the vector with the inserted HMG-1 gene pCYB4-HMG-1-HCH. Since the HMG-1 PCR fragment was also digested with Smal prior to the ligation and bluntly ligated to the adapter, the HMG-1 protein also had the amino acid glycine at the C-terminus (codon: GGG). Thus the fusion protein had the following schematic sequence: ATG-wt HMGl-Gly-Val-Lys-Ser-Al-Pro-Ser-Gly-wt heavy chain tetanus toxin-Gly-Pro-Intein-chitin binding protein.

Since in addition to the product of the correct size, smaller fragments were eluted from all isolates, the expression vector should be changed in such a way that the recombinant proteins could also be purified via the N-terminus. Based on the vector pCYB4-Ad-X + Y-HCH, an adapter was inserted that codes for six histidines according to the start codon and thus enables purification via metal affinity columns. An Xhol interface was located after the His codons. After digestion With Xhol and SnaBI, additional genes could be integrated in frame. The vector was digested with Ncol and SnaBI and the sticky / blunt adapter was ligated to reconstitute the SnaBI (blunt) interface.

Ad-HIS-A 5 '-CATGCACCATCACCATCACCATCTCGAGGGTGGATAC-3' Ad-HIS-B 3 '-GTGGTAGTGGTAGTGGTAGAGCTCCCACCTATG-5'

His His His His His Leu Glu Gly Gly Tyr

The cloning was verified by sequencing. This construct was called pCYB4-HIS-HCH. A purification of the recombinant heavy chain via the His tag was also possible with this plasmid. In addition to the wild-type sequence, this protein had 18 amino acids at the N-terminus (6xHis-Leu-Glu-Gly-Gly-Tyr-Val-Lys-Ser-Ala-Pro-Ser-Gly).

To construct HMG-1 / heavy chain fusion proteins, which can additionally be purified via an amino-terminal His tag, the HMG-1 gene was amplified with sequence-specific primers which introduced an Xhol site at the 5 'end. The testers at the 3 'end of the gene were completely complementary so that sticky / blunt ligation could be performed. As a further variant, a fragment of the HMG-1 gene which was truncated at the 3 'end and which only contained the DNA-binding domains (HMG box A + B) was cloned. The PCR was carried out using the Pfu polymerase and the clone pCYB4-HMG-1-HCH as a template.

Complete HMG-1 gene primer:

XhoHMG-1. FOR GCATACTCGAGGGGAAAGGAGATCCTAAGAAGCC

XhoHMG-1. REV TTCATCATCATCATCTTCTTCTTCATCTTCAT

Truncated HMG-1 gene primer:

XhoHMG-1. FOR GCATATCTCGAGGGGAAAGGAGATCCTAAGAAGCC

DeltaHMG-1. REV AGCTCGATATGCAGCTATATCCTTTTC

PCR parameters

5 min 95 ° C 25 cycles 1 min 95 ° C

1 min 55 ° C

1.5 min 72 ° C 10 min 72 ° C, then 4 ° C

The plasmid pCYB4-HIS-HCH was digested with Xhol and SnaBI and the PCR fragments were ligated in after Xhol digestion. The constructs were named pCYB4-His-HMG-1-HCH and pCYB4-His-ΔHMG-1-HCH. The clonings were verified by sequencing.

The fusion protein was produced recombinantly in E. coli using pCYB4-His-HMG-1-HCH or pCYB4-His-ΔHMG-1-HCH as in Example 2.

Example 4; Uptake of protein conjugates in neuroblastoma

Cells

The bispecific crosslinker Sulfo-LC-SPDP (Pierce, Rockford, USA) has an amino and an SH-reactive group.

The protein neutrAvidin (from Pierce, USA) was in a concentration of 5 mg / ml in 50 mM BICINE (from Sigma), pH 8.5; 80 mM NaCl before. In contrast to the wild type, this was a protein without sugar side chains and thus with a neutral pl value. This prevents the non-specific interactions, for example with cells, which occur with the basic wild-type protein. The crosslinker was dissolved in a concentration of 15 mM in DMSO (storage at -80 ° C). 2.5 mg of avidin was reacted with a three-fold molar excess of the crosslinker for two hours at room temperature. The reaction was stopped by adding Tris buffer pH 8.0. The reaction mixture was purified by gel filtration over a G-25 desalination column (FPLC) in 50 mM MOPS pH 7.4; 80 mM NaCl transferred and the excess crosslinker removed. According to the manufacturer, the protein concentration of the column fractions was determined with the Bio-Rad Protein Assay Kit I (Bio-Rad, Munich) and subsequently, by reducing part of the modified protein, the number of coupled linkers per molecule is determined photometrically according to standard methods. There was a number of 1.9 linkers per avidin molecule.

First, the two proteins were coupled to detect the infiltration of avidin into neuroblastoma cells via the heavy chain. For this purpose, 1 n ol (= 60 μg) of the modified avidine was mixed with 192 pmol (= 19.2 μg) of the heavy chain of tetanus toxin in 50 mM MOPS buffer, pH 7, 4 and 80 mM NaCl at 4 ° C. for 3 days incubated. The reaction mixture was separated on a Superdex-200 gel filtration column, which was equilibrated with 50 mM CHES pH 9.5 and 1.5 M NaCl. 100 μl samples from the first peak fractions were used for immunofluorescence experiments.

The neuroblasto cell line HDN-16 was prepared for this experiment. On the day before the experiment, the cells were sown onto uncoated glass coverslips (0 = 1 cm) and overlaid in β-hole vessels (0 per hole = 3.5 cm) with 4 ml of medium each. Before the start of the experiment, the cells were washed with medium to remove dead cells. The cells were then added to 100 μl elution fraction in 1 ml RPMI medium (+ 10% FCS) and incubated for 5 h without movement. All steps of the immunofluorescence were carried out at room temperature. At the end of the incubation period, the cells were washed extensively with medium and immediately fixed.

Both the first (anti-avidin, rabbit, 2 μg / ml; Rockland, Gilbertsville, USA) and the second antibody (goat-anti-rabbit CY-2; 3.3 μg / ml; Rockland, Gilbertsville, USA) were prepared with the dilution solution (PBS, 0.1% BSA).

The volume was 50 μl. This solution was placed in a 6-hole vessel and the cover slip was placed with the cell side on it. The incubation period was at least 30 min. the cells were then washed extensively with PBS.

To stain the nucleus, the cells were incubated for 10 min with a Dapi solution (5 ng / ml in 2 x SSC) and then washed with PBS.

15 μl of the mounting medium (2.4 g of Mowiol in 6 ml of glycerol, stirring for 1 hour, + 6 ml of H ₂ O, stirring for 2 hours + 12 ml of 0.2 M Tris-HCl, pH 8.5) were placed on a slide , 50 ° C with occasional stirring, centrifugation: 5000 g for 15 min, addition of 23 mg / ml DABCO; storage of 1 ml portions at -20 ° C) and the cover glass with the cell side is slowly placed on, avoiding air bubbles. The slides were stored horizontally and darkened overnight to polymerize. The solidified embedding medium preserves the preparation and the contained Dabco is intended to prevent the dyes from fading in fluorescence microscopy. The preparations could be stored at 4 ° C for several weeks.

The preparations were evaluated with a Zeiss Axiophot epifluorescence microscope. The recordings were made with a CH250 CCD camera from Photometrics (Munich) and documented with the image processing software IPLab-Spectrum 10 (version 3.0).

The clear avidin signals can be seen in FIG. Control batches with a) avidin, b) the heavy chain and c) a batch with unmodified avidin and the heavy chain in the concentration of the elution fraction gave no signals (data not shown).

This experiment demonstrated that the heavy chain of the tetanus toxin is capable of transporting other proteins in neoplasm cells. Example 5: Binding of biotin oligonucleotides to the heavy chain-avidin conjugate

In further approaches, the heavy chain should be coupled with the modified avidin in order to then bind DNA-oligonucleotides (15-mer with random sequence, MWG Biotech, Munich) to these conjugates. For this purpose, 1 nmol (= 100 μg) of the heavy chain of tetanus toxin was mixed with 500 pmol (= 30 μg) of the modified avidine (neutrAvidin, from Pierce, Rockford, USA) in 50 mM Hepes pH 8.5 and 150 mM NaCl for 6 h shaken at room temperature. Then 50 pmol of a 15mer DNA oligonucleotide were added and the mixture was incubated overnight at 4 ° C. without agitation. The oligonucleotides had a biotin group at their 3 'end which enables binding to avidin. At the 5 'end, the oligonucleotides were modified with a FITC group in order to be able to detect possible uptake in cells. The modifications of the oligonucleotides were introduced by the manufacturer during the synthesis (MWG Biotech, Munich).

Although avidin was in a 10-fold molar excess in the batches and theoretically four biotin binding sites were available per avidin, any free oligonucleotides that were still present should be removed from the batches in order to minimize experimental artifacts. For this purpose, the batches were either incubated with magnetic beads which were coupled with streptavidin, or separated using a NickSpin Column (Pharmacia). In the first case, the streptavidin beads with 50 mM Hepes pH 7.4; 150 mM NaCl equilibrated, the batches added and shaken for 15 min. After the beads had been magnetically separated, the batch was removed. The NickSpin Columns, which had a Sephadex G-50 matrix, were equilibrated with the same buffer and the batches were separated according to the manufacturer's instructions. Both samples were used in the immunofluorescence experiments (analogously to Example 4), but showed no significant difference in the signal pattern (cf. FIG. 1). EXAMPLE 6: Uptake of HisΔHMG-1-HCH fusion protein in neuroblastoma cells

The homogeneously isolated fusion protein of a truncated HMG-1 protein and the heavy chain of tetanus toxin was incubated with the neuroblastoma cell line IMR-32 in order to test the uptake of the protein by immunofluorescence analyzes. After a four-hour incubation of approximately 0.5 μg of the fusion protein in 1.5 ml of RPMI medium (+ 10% FCS), the cells were washed extensively with medium, fixed, by means of antibodies against the C fragment of the tetanus toxin (1: 100-1: 300; Charles River, Southbridge, USA) and a CY-2-labeled secondary antibody (goat anti-rabbit CY-2; Rockland, Gilbertsville, USA) detected the fusion protein. The result of the experiment can be seen in FIG. Very strong signals can be seen in almost all cells.

Claims

claims

1) Conjugate for introducing active substances into neuronal cells, the conjugate comprising the heavy chain of a toxin of the genus Clostridium and at least one active substance, the light chain of the toxin being absent.

2) The conjugate according to claim 1, wherein the toxin is of the genus Clostridium tetanus toxin or botulinum toxin.

3) Conjugate according to claim 1 or 2, wherein the active ingredient is selected from (poly) peptides, proteins, nucleic acids or chemical compounds.

4) Conjugate according to one of claims 1 to 3, wherein the active ingredient and the heavy chain of the toxin are connected to one another via a linker.

5) Conjugate according to claim 4, wherein the linker is NHS-SS-biotin, NHS-iminobiotin or sulfo-LC-SPDP.

6) Conjugate according to one of claims 1 to 5, wherein the heavy chain of the toxin is present as a fusion protein.

7) Conjugate according to claim 6, wherein the fusion portion is a basic protein, preferably human HMG-1 protein.

8) Method for producing a conjugate according to any one of claims 1-7, wherein the active ingredient, the heavy chain of a toxin of the genus Clostrium and optionally a linker are reacted with one another.

9) Kit comprising one or more of the following components:

(a) the heavy chain of a genus toxin Clostridium (b) usual auxiliaries, such as carriers, buffers, solvents, controls, etc.

10) Use of the conjugate according to any one of claims 1-7 for enrichment in neuronal cells.

11) Use of the conjugate according to claim 10 for the treatment and / or therapy of neuronal diseases.

12) Use of the conjugate according to claim 10 or 11 for gene therapy treatment of neuroblastoma tumors.