WO2000028009A1 - Compositions biologiques, leurs constituants et leurs applications - Google Patents

Compositions biologiques, leurs constituants et leurs applications Download PDF

Info

Publication number
WO2000028009A1
WO2000028009A1 PCT/AU1999/000993 AU9900993W WO0028009A1 WO 2000028009 A1 WO2000028009 A1 WO 2000028009A1 AU 9900993 W AU9900993 W AU 9900993W WO 0028009 A1 WO0028009 A1 WO 0028009A1
Authority
WO
WIPO (PCT)
Prior art keywords
hbv
variant
hbsag
amino acid
surface antigen
Prior art date
Application number
PCT/AU1999/000993
Other languages
English (en)
Inventor
Stephen Alister Locarnini
Joseph Torresi
Linda Earnest-Silveira
Angeline Ingrid Bartholomeusz
Original Assignee
Melbourne Health
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Melbourne Health filed Critical Melbourne Health
Priority to EP99957236A priority Critical patent/EP1135476A4/fr
Priority to AU15018/00A priority patent/AU777516B2/en
Publication of WO2000028009A1 publication Critical patent/WO2000028009A1/fr
Priority to HK02105055.9A priority patent/HK1043479A1/zh

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10161—Methods of inactivation or attenuation

Definitions

  • the present invention relates generally to an isolated Hepatitis B virus (HBV) with a surface component exhibiting an altered immunological profile relative to a reference HBV.
  • a reference HBV is considered herein to comprise a composite or consensus nucleotide or amino acid sequence from HBV genotypes A through F.
  • the isolated HBV of the present invention is considered herein to be a HBV variant relative to the reference HBV.
  • the altered immunological profile renders the HBV variants of the present invention less susceptible to vaccines directed to the surface component.
  • the HBV variants of the present invention generally arise from selective pressure following one or both of anti-HBV chemical therapy and in particular chemical therapy aimed at disrupting HBV polymerase activity or function and/or following immune pressure directed to the surface component.
  • Immune pressure may result from natural exposure to HBV or following vaccination with an avirulent or attenuated HBV or with a component of an HBV.
  • the present invention further provides a recombinant polypeptide and derivatives and chemical equivalents thereof corresponding to the surface component of the HBV variants.
  • the HBV variants and recombinant polypeptides and their derivatives and chemical equivalents of the present invention are useful in biological compositions capable of inducing a neutralizing immune response to the HBV variant.
  • Recombinant technology is providing the means to generate recombinant components of vaccines as well as providing genetic bases for screening or identifying useful components for therapeutic compositions.
  • Hepatitis B virus can cause debilitating disease conditions ranging from subclinical infection to chronic active and fulminant hepatitis and can lead to acute liver failure.
  • the HBV genome comprises a series of overlapping genes in a circular, partially double- stranded DNA molecule (1) [see also Figure 1].
  • the gene encoding DNA polymerase overlaps the viral envelope genes, Pre-Sl, Pre-S2 and S and partially overlaps the X and core genes.
  • the HBV envelope comprises small, middle and large HBV surface proteins.
  • the large protein component is generally referred to as the HBV surface antigen (HBsAg) and is encoded by the S gene sequence.
  • the Pre-Sl and Pre-S2 gene sequences encode the other envelope components (2).
  • the HBsAg comprises an antigenic region referred to as the "a” determinant (3).
  • the "a” determinant is complex, conformational and dependent upon disulphide bonding among highly conserved cysteine residues. Genetic variation leading to changes in the "a” determinant has been implicated in mutants of HBV which "escape” the immunological response generated to conventional vaccines (4-8).
  • One particularly common mutation is a glycine (G) to arginine (R) substitution at amino acid position 145 (G145R) of HBsAg. This mutation affects the "a" epitope region.
  • Xaa 1 nXaa 2 Specific mutations in amino acid sequence are represented herein as "Xaa 1 nXaa 2 " where Xaa ! is the original amino acid residue before mutation, n is the residue number and Xaa 2 is the mutant amino acid.
  • the abbreviation "Xaa” may be the three letter or single letter amino acid code.
  • a mutation in single letter code is represented, for example, by X 1 nX 2 where X j and X 2 are the same as Xaaj and Xaa 2 , respectively.
  • the amino acid residues for Hepatitis B virus DNA polymerase are numbered with the residue methionine in the motif Tyr Met Asp Asp (YMDD) being residue number 550.
  • the reference HBV is considered herein to comprise a composite or consensus nucleotide or amino acid sequence from HBV genotypes A through F.
  • One aspect of the present invention provides a variant HBV comprising a surface component exhibiting an altered immunological profile compared to a reference HBV.
  • Another aspect of the present invention is directed to a variant HBV comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to a surface antigen from a reference HBV and wherein an antibody generated to the reference surface antigen exhibits reduced capacity for neutralizing said HBV variant.
  • HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence set forth in Formula I and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the surface antigen defined by Formula I and wherein the variant HBV is selected for by a nucleoside analogue of the HBV DNA polymerase.
  • Still another aspect of the present invention is directed to an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence set forth in Formula I and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the surface antigen defined by Formula I and wherein the variant HBV is selected for following immunological therapy directed against the surface antigen as defined in Formula I.
  • HBV variant comprising a nucleotide sequence comprising a single or multiple nucleotide substitution, addition and/or deletion to the nucleotide sequence set forth in Formula III and which HBV variant has a surface antigen exhibiting an altered immunological profile relative to a surface antigen defined by Formula I.
  • Another aspect of the present invention provides an isolated HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof.
  • Yet another aspect of the present invention is directed to an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent exhibits an altered immunological profile compared to an HBsAg from a reference HBV.
  • Still yet another aspect of the present invention provides an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent comprises an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to an HBsAg from a reference HBV and wherein a neutralising antibody directed to a reference HBV exhibits no or reduced neutralising activity to an HBV carrying said variant HBsAg.
  • Another aspect of the present invention contemplates a biological composition comprising a variant HBV or an HBsAg from said variant HBV or a recombinant or derivative form thereof or its chemical equivalent.
  • Figure 1 is a diagrammatic representation showing overlapping genome of HBV.
  • Figure 2 is a representation of the amino acid consensus sequence from HBV DNA polymerase proteins encompassing regions which are conserved in the RNA polymerase protein. These regions are shown as domains A-E and are underlined. In the consensus sequence the M in the YMDD motif is designated as amino acid number 550. The amino acids which are subject to mutation during 3TC and/or FCV treatment are shown in bold. An asterisk (*) indicates greater than three amino acid possibilities at this position of the consensus sequence. The HBsAg major hydrophilic region containing the neutralisation domain is indicated by a double line and the polymerase mutations which alter the HBsAg are indicated in italics.
  • Figure 3 is a representation of the nucleotide sequence from various strains of HBV encoding the surface antigen.
  • the amino acid sequence of the surface antigen beginning at amino acid 108 is shown above the nucleotide sequence.
  • Figure 4 is a graphical representation showing HBsAg binding assay with wild-type (i.e. reference HBV) and various mutants (1, mock; 2; wild-type; 3, F512L; 4, V519L; 5, M550I; 6, S565P; 7, double mutant L256M + M550V; 8, triple mutant V519L + L526M + M550V; 9, W499Q).
  • wild-type i.e. reference HBV
  • Figure 4 is a graphical representation showing HBsAg binding assay with wild-type (i.e. reference HBV) and various mutants (1, mock; 2; wild-type; 3, F512L; 4, V519L; 5, M550I; 6, S565P; 7, double mutant L256M + M550V; 8, triple mutant V519L + L526M + M550V; 9, W499Q).
  • the present invention is predicated in part on the identification of HBV variants exhibiting an altered immunological profile with respect to a surface component relative to a reference standard.
  • variant is used in its broadest context and includes mutants such as vaccine escape mutants, derivatives, modified forms of and altered forms of an HBV relative to a reference HBV.
  • a variant generally contains a single or multiple nucleotide substitution, addition and/or deletion or a truncation mutation in the viral genome and a corresponding single or multiple amino acid substitution, addition and/or deletion or truncation in a viral peptide, polypeptide or protein.
  • a preferred variant in accordance with the present invention with an altered immunological profile is one which would substantially not be affected by a neutralizing immune response directed to a conventional HBV vaccine such as a vaccine comprising a reference HBV or a surface component thereof.
  • a neutralizing immune response directed to a conventional HBV vaccine such as a vaccine comprising a reference HBV or a surface component thereof.
  • the expression "substantially not affected” includes reduced susceptibility to the immune response generated by a vaccine. Reduced susceptibility may also be conveniently determined by reduced susceptibility to chemical agents such as nucleoside analogues which target HBV DNA polymerase. Due to the overlapping nature of reading frames for DNA polymerase and certain viral surface components, an altered surface component may have a corresponding alteration in the DNA polymerase.
  • the preferred surface component of the HBV of the present invention is the HBV surface antigen (HBsAg). It is proposed in accordance with the present invention that the HBsAg of the HBV variants exhibit an altered immune profile relative to an HBsAg from a reference HBV.
  • a reference HBV conveniently comprises an HBsAg with an amino acid sequence substantially as set forth by Norder et al. (9) which encompasses all known genotypes of HBV (currently A through F).
  • the amino acid sequence of an HBsAg and which is considered to define a reference HBV is set forth below in Formula I: FORMULA I
  • X 12 is L or R
  • X 17 is S or Aor VorTor L
  • Xl8 isPorT; X 19 is V or R or T or K or G
  • X 21 is Q or L or K
  • X 22 is S or L; X 24 sTor I;
  • X 83 s S or G or N or D or T;
  • one aspect of the present invention provides a variant HBV comprising a surface component exhibiting an altered immunological profile compared to a reference HBV. More particularly, the present invention is directed to a variant HBV comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to a surface antigen from a reference HBV and wherein an antibody generated to the reference surface antigen exhibits reduced capacity for neutralizing said HBV variant.
  • the amino acid sequence of the HBsAg of the reference HBV is as set forth in Formula I above.
  • the HBV variant of the present invention is also referred to herein as an "escape" mutant since it is substantially incapable of being adversely effected by chemical therapy directed against the HBV polymerase or vaccine therapy directed against the surface antigen.
  • the term "escape" mutant also encompasses reduced susceptibility to chemical or vaccine therapy directed to the reference HBV.
  • the HBV variant of the present invention is also preferably in isolated form.
  • An isolated HBV includes reference to a biologically pure form of the virus.
  • isolated means the virus has undergone at least one purification or isolation step away from non- viral components.
  • the viral preparation comprises at least about 10%, more preferably at least about 20%, still more preferably at least about 30%, even more preferably at least about 40%, yet more preferably at least about 50% or greater of HBV variant relative to the non-viral components as measured by viral infectivity, immunological interactivity, DNA polymerase activity, molecular weight, carbohydrate content or other suitable means.
  • the preferred variants of the present invention are obtained following selective pressure.
  • the preferred selective pressure is chemical pressure (e.g. via nucleoside analogues) directed to the HBV DNA polymerase which selects for a mutation in the gene encoding HBV DNA polymerase and a corresponding mutation in the gene encoding HBsAg. This is due to the overlapping open reading frames for HBV DNA polymerase and HBsAg.
  • a mutation in one or more nucleotides encoding HBV DNA polymerase may have an effect on the nucleotide sequence encoding HBsAg.
  • the present invention also extends to changes in the HBsAg following immunological selection based on vaccines comprising HBsAg or a derivative thereof or an HBV comprising same and wherein the HBsAg comprises an amino acid sequence substantially as set forth in Formula I.
  • an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence set forth in Formula I and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the surface antigen defined by Formula I and wherein the variant HBV is selected for by a nucleoside analogue of the HBV DNA polymerase.
  • the present invention is directed to an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence set forth in Formula I and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the surface antigen defined by Formula I and wherein the variant HBV is selected for following immunological therapy directed against the surface antigen as defined in Formula I.
  • Reference to an altered immunological profile in accordance with the present invention in relation to the surface antigen includes reference to an altered humoral or T cell response.
  • an altered immunological profile include altered specificity to antibodies, altered amino acid sequences of an epitope or within the "a" determinant, an altered capacity to induce proliferation of T cells primed to an HBsAg from a reference HBV.
  • the altered immunological profile means that neutralising antibodies which are capable of substantially neutralising or otherwise reducing serum or blood levels of the reference HBV are substantially incapable of or exhibit reduced capacity to neutralise and/or clear the variant HBV.
  • a viral variant may, in accordance with a preferred aspect of the present invention, carry a mutation only in the DNA polymerase or the surface antigen or may carry a mutation in both molecules.
  • the term "mutation" is to be read in its broadest context and includes a silent mutation not substantially affecting the normal function of the DNA polymerase or surface antigen or may be an active mutation having the effect of selection of nucleoside analogue resistance or a vaccine escape mutant phenotype. Where multiple mutations occur in accordance with the present invention or where multiple phenotypes result from a single mutation, at least one mutation must be active or the virus must exhibit at least one altered phenotype such as nucleoside analogue resistance or reduced immunological interactivity to the surface antigen of a reference HBV.
  • the present invention extends to any novel mutant or novel use of a mutant of the HBsAg carrying a single or multiple substitution, addition and/or deletion or truncation in the amino acid sequence of HBsAg as compared to the amino acid sequence set forth in Formula I.
  • the present invention extends to any single or multiple amino acid substitution, addition and/or deletion or truncation in the amino acid sequence of HBsAg relative to the amino acid sequence set forth in Formula I as defined by a single or multiple amino acid substimtion, addition and/or deletion to the catalytic region of the HBV DNA polymerase set forth below in Formula II:
  • X is any amino acid
  • z 1 is N or D
  • z 2 is I or P
  • z 3 is I or V
  • z 4 is S or D
  • Z 5 is Tor N
  • z 6 is RorN
  • z 7 is N or I
  • z 8 isNorYorH
  • z 9 is H or Y
  • Z 10 s G or R ⁇ sDorN
  • z 12 sDorN z 13 s S or Y; -I4 s N or Q
  • z 16 s KorQ z 17 sYorF; -i ⁇ s RorW
  • Z 50 is V or I
  • M * is amino acid 550.
  • Preferred mutations in the amino acid sequence of HBsAg are amino acid substitutions, 5 deletions and/or additions or truncations in amino acids 1-10, 5-15, 10-20, 15-25, 20-30, 25- 35, 30-40, 35-45, 40-50, 45-55, 50-60, 55-65, 60-70, 65-75, 70-80, 75-85, 80-90, 85-95, 90- 100, 95-105, 100-110, 105-115, 110-120, 115-125, 120-130, 125-135, 130-140, 135-145, 140-150, 145-155, 150-160, 155-165, 160-170, 165-175, 170-180, 175-185, 180-190, 185- 195, 190-200, 195-205, 200-210, 205-215, 210-220, 215-225, 220-226 (referring to the 10 numbering of Formula I) of HBsAg.
  • Particularly useful mutations are Gl 12R, T123P Y/F134S, D144E, G145R, A157D, E164D, F170L, M195I, W196L, S196W, W196 STOP, M198I, W199S, S204T and S210R.
  • stop means a stop codon.
  • the HBsAg mutations of the present invention may also be defined in terms of a corresponding mutation in the HBV DNA polymerase.
  • a mutation in the HBV DNA polymerase may be in amino acids 421-431, 426-436, 431-441, 436-446, 441-451, 446-456, 20 451-461, 456-466, 461-471, 466-476, 471-481, 476-486, 481-491, 486-496, 491-501, 496- 506, 501-511, 506-516, 511-521, 516-526, 521-531, 526-536, 531-541, 536-546, 541-551, 546-556, 551-561, 556-566, 561-571, 566-576, 571-581, 576-586, 581-591, 586-596, 591- 601, 596-601 (referring to number of Formula II).
  • 25 Preferred HBV DNA polymerase mutations include Q476, N480G, N485K, K495R, R499O, G499E, W499Q, FJ12L, I515L, V519L, L526M, M550V, M550I, V553I, S565P.
  • Useful multiple mutants include L526M/M550I, L526M/M550V, V519L/L526M/M550V and V519L/L526M/M550I.
  • the altered HBsAg molecules of the HBV variants of the present invention may also be defined at the nucleotide level.
  • the nucleotide sequence encoding the HBsAg from a reference HBV is set forth below in Formula III:
  • ACN 1 AAACCTN 2 N 3 GGAN 4 GGAAAN 5 TGCACN 6 TGTA TTCCCATCCCATCN 7 TCN 8 TGGGCTTTCGN 9 AAN 10 ATN 11 CCTATGGGAGN 12 GGGCCTCAGN 13 CCGTTT CTCN 14 TGGCTCAGTTTACTAGTGCCATTTGTTCA GTGGTTCGN 15 AGGGCTTTCCCCCACTGTN 16 TGG CTTTCAGN 17 TATATGGATGATGTGGTN 18 TTGGGG GCCAAGTCTGTACAN 19 CATCN 20 TGAGTCCCTTT
  • N 1 is A or C
  • N 2 is Tor A
  • N 3 is C or T
  • N 4 is C or T
  • N 5 is C orT
  • N 6 is C orT
  • N 7 is A or G
  • N 8 is T or C; N 9 is C or G
  • N 10 is G or A
  • N 12 is Tor G, N 13 is T or C; N 14 is C or T; N 15 is T or C; N 16 is T or C; N 17 is T or C;
  • the present invention extends to nucleotide sequences which exhibit at least about 60% nucleotide sequence identity to Formula III or is a sequence capable of hybridising thereto under low stringency conditions at 42 °C and which encode an HBsAg with an altered immunological profile relative to an HBsAg from a reference HBV.
  • an HBV variant comprising a nucleotide sequence comprising a single or multiple nucleotide substitution, addition and/or deletion to the nucleotide sequence set forth in Formula III and which HBV variant has a surface antigen exhibiting an altered immunological profile relative to a surface antigen defined by Formula I.
  • the HBV variant comprises a nucleotide sequence having at least about 80% identity to the nucleotide sequence set forth in Formula III or is capable of hybridising thereto under medium stringency conditions at 42 °C.
  • the percentage identity is at least about 85%, at least about 90%, at least about 95%, but less than 100% relative to the nucleotide sequence set forth in Formula III.
  • nucleotide and sequence comparisons are made at the level of identity rather than similarity. Any number of programs are available to compare nucleotide and amino acid sequences. Preferred programs have regard to an appropriate alignment.
  • Gap Gap which considers all possible alignment and gap positions and creates an alignment with the largest number of matched bases and the fewest gaps. Gap uses the alignment method of Needleman and Wunsch (10). Gap reads a scoring matrix that contains values for every possible GCG symbol match. GAP is available on ANGIS (Australian National Genomic Information Service) at website http://mell.angis.org.au..
  • Reference herein to a low stringency at 42 °C includes and encompasses from at least about 0% v/v to at least about 15% v/v formamide and from at least about 1M to at least about 2M salt for hybridisation, and at least about 1M to at least about 2M salt for washing conditions.
  • Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30%) v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at least about 0.5M to at least about 0.9M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31 % v/v to at least about 50% v/v formamide and from at least about 0.01M to at least about 0.15M salt for hybridisation, and at least about 0.01M to at least about 0.15M salt for washing conditions.
  • the T m of a duplex DNA decreases by 1°C with every increase of 1% in the number of mismatch base pairs (12).
  • the present invention further extends to an isolated surface component from the HBV variants herein described. More particularly, the present invention provides an isolated HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof.
  • the isolated surface component and, more particularly, isolated HBsAg or its recombinant, derivative or chemical equivalents are useful in the development of biological compositions such as vaccine formulations.
  • another aspect of the present invention is directed to an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent exhibits an altered immunological profile compared to an HBsAg from a reference HBV.
  • the present invention provides an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent comprises an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to an HBsAg from a reference HBV and wherein a neutralising antibody directed to a reference HBV exhibits no or reduced neutralising activity to an HBV carrying said variant HBsAg.
  • isolated means the same as it does in relation to an isolated HBV variant.
  • the reference HBV is conveniently defined herein as comprising an HBsAg with an amino acid sequence as set forth in Formula I or as indirectly defined by the amino acid sequence for HBV DNA polymerase set forth in Formula II or by the nucleotide sequence set forth in Formula III encoding an HBsAg.
  • the present invention extends to derivatives and chemical equivalents (i.e. analogues) of the HBV surface component and in particular HBsAg.
  • Derivatives include single or multiple amino acid substitutions, additions and/or deletions to the HBsAg molecule.
  • "Additions" to amino acid sequences include fusions with other peptides, polypeptides or proteins or fusions to nucleotide sequences including fusions to other viral components.
  • Analogues of the variant HBsAg contemplated herein include, but are not limited to, modification to side chains, incorporating of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteinaceous molecule or their analogues. These types of modifications are useful in stabilizing the immunointeractive molecules for use in diagnostic assays or in therapeutic protocols.
  • side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH / ⁇ amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH
  • modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH / ⁇ amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS);
  • the guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
  • the carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitisation, for example, to a corresponding amide.
  • Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4- nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
  • Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides.
  • Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3 -nitro tyrosine derivative.
  • Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate.
  • Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3-hydroxy- 5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D- isomers of amino acids.
  • a list of unnatural amino acid, contemplated herein is shown below in Table 1. The inclusion of such unnatural amino acids or other derivations described herein may assist in stabilising the molecule in a vaccine composition.
  • Non-conventional Code Non-conventional Code amino acid amino acid
  • peptides can be conformationally constrained by, for example, incorporation of C ⁇ and N ⁇ -methylamino acids, introduction of double bonds between C ⁇ and C p atoms of amino acids and the formation of cyclic peptides or analogues by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus.
  • these types of modifications may be important to stabilise the variant HBsAg molecule if administered to an individual or for use as a diagnostic reagent.
  • glycosylation variants from a completely unglycosylated molecule to a modified glycosylated molecule. Altered glycosylation patterns may result from expression of recombinant molecules in different host cells.
  • compositions are particularly useful as therapeutic compositions and may be referred to herein interchangeably as biological, vaccine or pharmaceutical compositions.
  • the biological compositions are particularly useful in inducing immunological memory against infection by an HBV variant such as an HBV escape mutant controlling by administering a variant HBsAg or a recombinant, derivative or chemical form thereof or an HBV comprising same capable of inducing an immune response including immunological memory agents.
  • the present invention contemplates a biological composition comprising a variant HBV or an HBsAg from said variant HBV or a recombinant or derivative form thereof or its chemical equivalent.
  • the biological composition according to this aspect of the present invention generally further comprises one or more pharmaceutically acceptable carriers and/or diluents.
  • the biological composition may comprise an HBsAg or like molecule from one HBV variant or the composition may be a cocktail of HBsAgs or like molecules from a range of HBV variants including the referenced HBV. Similar inclusions apply where the composition comprises an HBV.
  • the biological composition forms suitable for injectable use include sterile aqueous solutions (where water soluble) or sterile powders for the extemporaneous preparation of sterile injectable solutions. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or diluent containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the preventions of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the HBsAg or like molecule or HBV variant or reference strain in the required amount in the appropriate solvent or diluent as followed by sterilization such as by filter sterilization.
  • the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the immunointeractive molecule plus any additional desired ingredient from previously sterile-filtered solution thereof.
  • Routes of administration contemplated by the present invention including intravenous, intraperitoneal, intrathelial, subcutaneous and intracerebral.
  • the biological composition of the present invention may also be given in oral, bucal, nasal spray, inhalation, patch, drip or suppository form.
  • Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like.
  • the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the immunointeractive molecule, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
  • the HBsAg or like molecule or HBV variant or reference strain will be added in a concentration effective to induce an interact immune response against the same molecule or an HBV carrying the same or an immunologically similar molecule.
  • an effective amount of HBsAg may range from about 10 mg to about 2000 ng, or 50 ng to about 1000 mg or 100 ng to about 500 mg or other suitable effective amount. It is sometimes more convenient to express dosage amounts in terms of body weight. Accordingly, the effective amounts may be from, for example, about 0.5 ng/kg body weight to about 500 mg/kg body weight or an amount there between.
  • the overlapping genome of HBV is represented in Figure 1.
  • the gene encoding DNA polymerase (P) overlaps the viral envelope genes, Pre-Sl and Pre-S2, and partially overlaps the X and core (C) genes.
  • the HBV envelope comprises small, middle and large HBV surface antigens.
  • the large protein component is referred to as the HBV surface antigen (HBsAg) and is enclosed by the S gene sequence.
  • the Pre-Sl and Pre-S2 gene sequences encode the other envelope components.
  • the nucleotide sequence from various strains of HBV encoding the surface antigen is shown in Figure 3.
  • the amino acid sequence of the surface antigen beginning at amino acid 108 is shown above the nucleotide sequence.
  • the effect of the Pre-S/S gene escape mutations on the binding of anti-HBs antibody is assessed using an RIA binding assay.
  • the results are shown in Figure 4. Briefly, the expressed mutant HBsAg from transfected cell cultures is purified through a sucrose density gradient. The ability of subviral and viral particles to block the binding of wild type HBsAg to anti-HBs antibody, which does not recognise S gene escape mutants, is assessed in an RIA format (AUSAB, Abbott). This analysis involves the binding of anti-HBs in pooled vaccine serum to increasing concentrations of wild type and mutant S protein using limiting concentrations of serum and detecting the unbound anti-HBs by AUSAB RIA.
  • the mutant S proteins analysed are shown on the right of Figure 4 together with mock and wild type HBV.
  • concentration of HBsAg decreases the amount of unbound anti- HBs increase, leaving a higher anti-HBs concentration to be detected by the AUSAB assay.
  • Even at high concentration of HBsAg from the W499Q mutant the amount of residual anti- HBs detected is similar to that of the mock transfected sample (these are represented by the two curves at the top of the graph).
  • the amount of residual anti-HBs after binding of antibody with the other mutant HBsAg proteins is analogous to the wild type HBsAg, indicating that these variant vHBsAg proteins recognise the anti-HBs with similar efficiency as the wild type protein.
  • the dual mutant in Figure 4 represents L526M/M550V while the triple mutant represents V519L/L526M/M550V.
  • FCV famciclovir

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Cette invention a trait, d'une façon générale, à un virus isolé de l'hépatite B (VHB) possédant un constituant de surface faisant montre d'un profil immunologique modifié et ce, en comparaison d'un virus VHB de référence. Ce VHB de référence est réputé, dans le cadre de cette invention, renfermer une séquence nucléotidique ou aminoacide composite ou consensus provenant des génotypes A à F du VHB. Le VHB selon l'invention est réputé être un variant de VHB et ce, par rapport au VHB de référence. La modification du profil immunologique fait que les variants du VHB sont moins sensibles à des vaccins intéressant le constituant de surface. Ces variants sont le fait d'une pression sélective exercée sur le VHB et survenant après une chimiothérapie anti-VHB ou aux deux et, notamment, une chimiothérapie visant à interrompre l'activité ou la fonction VHB-polymérase, et/ou survenant après qu'une pression immune s'est exercée sur le constituant de surface. Cette pression immune peut résulter d'une exposition d'origine naturelle au VHB ou découler d'une vaccination par VHB avirulent ou atténué ou bien par vaccination par un constituant du VHB. Cette invention porte également sur un polypeptide de recombinaison ainsi que sur ses dérivés et équivalents chimiques correspondant au constituant de surface des variants du VHB. Ces variants, les polypeptides de recombinaison ainsi que leurs dérivés et équivalents chimiques se révèlent des plus utiles dans des compositions biologiques à même de déclencher une réponse immunitaire de neutralisation au variant du VHB.
PCT/AU1999/000993 1998-11-11 1999-11-10 Compositions biologiques, leurs constituants et leurs applications WO2000028009A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP99957236A EP1135476A4 (fr) 1998-11-11 1999-11-10 Compositions biologiques, leurs constituants et leurs applications
AU15018/00A AU777516B2 (en) 1998-11-11 1999-11-10 Biological compositions, components thereof and uses therefor
HK02105055.9A HK1043479A1 (zh) 1998-11-11 2002-07-08 生物學組合物及其成分和用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AUPP7060A AUPP706098A0 (en) 1998-11-11 1998-11-11 Biological compositions, components thereof and uses therefor
AUPP7060 1998-11-11

Publications (1)

Publication Number Publication Date
WO2000028009A1 true WO2000028009A1 (fr) 2000-05-18

Family

ID=3811273

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU1999/000993 WO2000028009A1 (fr) 1998-11-11 1999-11-10 Compositions biologiques, leurs constituants et leurs applications

Country Status (5)

Country Link
EP (1) EP1135476A4 (fr)
CN (1) CN1330712A (fr)
AU (1) AUPP706098A0 (fr)
HK (1) HK1043479A1 (fr)
WO (1) WO2000028009A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2351905A (en) * 1999-04-13 2001-01-17 Binding Site Ltd Eliciting improved immune responses
EP1169452A1 (fr) * 1999-04-09 2002-01-09 Melbourne Health Variantes virales
EP1297109A1 (fr) * 2000-06-09 2003-04-02 Melbourne Health Variantes d'adn polymerase du virus de l'hepatite b et d'antigenes de surface et leurs methodes d'utilisation
JP2014526885A (ja) * 2011-06-30 2014-10-09 グリーン・クロス・コーポレイション Ｂ型肝炎ウイルス表面抗原のエピトープおよびその使用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994012617A1 (fr) * 1992-11-25 1994-06-09 International Biotechnology Laboratories, Inc. Vaccins contre le virus de l'hepatite b
WO1994026904A1 (fr) * 1993-05-07 1994-11-24 Abbott Laboratories Mutants du virus de l'hepatite b, reactifs et procedes de detection
WO1997000698A1 (fr) * 1995-06-20 1997-01-09 The General Hospital Corporation Inhibition de la replication du virus de l'hepatite b
WO1998028004A1 (fr) * 1996-12-24 1998-07-02 The Crown In The Right Of The Queensland Department Of Health (Sir Albert Sakzewski Virus Research Centre) Particule de l'hepatite delta contenant un immunogene de proteine de fusion
WO1999041383A1 (fr) * 1998-02-11 1999-08-19 Maxygen, Inc. Immunisation par bibliotheque d'antigenes

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPO351996A0 (en) * 1996-11-08 1996-12-05 Western Health Care Network Viral variants and methods for detecting same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994012617A1 (fr) * 1992-11-25 1994-06-09 International Biotechnology Laboratories, Inc. Vaccins contre le virus de l'hepatite b
WO1994026904A1 (fr) * 1993-05-07 1994-11-24 Abbott Laboratories Mutants du virus de l'hepatite b, reactifs et procedes de detection
WO1997000698A1 (fr) * 1995-06-20 1997-01-09 The General Hospital Corporation Inhibition de la replication du virus de l'hepatite b
WO1998028004A1 (fr) * 1996-12-24 1998-07-02 The Crown In The Right Of The Queensland Department Of Health (Sir Albert Sakzewski Virus Research Centre) Particule de l'hepatite delta contenant un immunogene de proteine de fusion
WO1999041383A1 (fr) * 1998-02-11 1999-08-19 Maxygen, Inc. Immunisation par bibliotheque d'antigenes

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
ASAHINA ET AL: "Sequential changes in full-length genomes of hepatitis B virus accompanying acute exacerbation of chronis hepatitis B", J. OF HEPATOLOGY,, vol. 25, 1996, pages 787 - 794, XP001029947 *
GRETHE ET AL: "Characterization of unusual escape variants of Hepatitis B virus isolated from a hepatitis B surface antigen-negative subject", J. VIROLOGY,, vol. 72, 1998, pages 7692 - 7696, XP001029941 *
HE J-W ET AL: "Mutations in the "a" determinant of hepatitis B surface antigen among Chinese infants receiving active postexposure hepatitis B immunization", VACCINE,, vol. 16, 1998, pages 170 - 173, XP004098619 *
KARTHIGESU ET AL: "A Hepatitis B Virus variant found in the sera of immunised children induces a conformational change in the HBsAg"a" determinant", J. MEDICAL VIROLOGY,, vol. 58, 1999, pages 346 - 352, XP001029945 *
NORDER ET AL: "Genetic relatedness of hepatitis B viral strains of diverse geographical origin and natural variations in the primary structure of the surface antigen", J. GENERAL VIROLOGY,, vol. 74, 1993, pages 1341 - 1348, XP000197718 *
OKAMOTO ET AL: "Typing Hepatitis B Virus by homology in nucleotide sequence: comparison of surface antigen subtypes", J. GENERAL VIROLOGY,, vol. 69, 1988, pages 2575 - 2583, XP000672123 *
See also references of EP1135476A4 *
TAKESHIMA ET AL: "Structural analysis of the gene coding for hepatitis B virus surface antigen and its product", J. GENERAL VIROLOGY,, vol. 66, 1985, pages 195 - 200, XP001029943 *
TONG ET AL: "Active Hepatitis B Virus Replication in the Presence of anti-HBe is associated with viral variants containing an inactive pre-C region", VIROLOGY,, vol. 176, no. 2, 1990, pages 596 - 603, XP000672434 *
UCHIDA ET AL: "Complete Nucleotide Sequences and the Characteristics of Two Hepatitis B virus Mutants Causing Serologically Negative acute or Chronic Hepatitis B", J. MEDICAL VIROLOGY,, vol. 45, 1995, pages 247 - 252, XP000578444 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8273527B2 (en) 1999-04-09 2012-09-25 Melbourne Health Viral variants
EP1169452A1 (fr) * 1999-04-09 2002-01-09 Melbourne Health Variantes virales
EP2360257A3 (fr) * 1999-04-09 2013-08-28 Melbourne Health Variantes du virus de l'hépatite B (HBV)
EP1169452A4 (fr) * 1999-04-09 2005-05-11 Melbourne Health Variantes virales
US7291453B1 (en) 1999-04-09 2007-11-06 Melbourne Health Viral variants
EP1609865A3 (fr) * 1999-04-09 2008-06-11 Melbourne Health Variantes du virus de l'hépatite B (HBV)
GB2351905B (en) * 1999-04-13 2004-07-14 Binding Site Ltd Eliciting improved immune responses
GB2351905A (en) * 1999-04-13 2001-01-17 Binding Site Ltd Eliciting improved immune responses
EP1297109A4 (fr) * 2000-06-09 2004-12-29 Melbourne Health Variantes d'adn polymerase du virus de l'hepatite b et d'antigenes de surface et leurs methodes d'utilisation
US7931907B2 (en) 2000-06-09 2011-04-26 Melbourne Health Hepatitis B virus DNA polymerase and surface antigen variants and methods of using same
EP2360243A1 (fr) * 2000-06-09 2011-08-24 Melbourne Health Variantes d'ADN polymérase du virus de l'hépatite B et d'antigènes de surface et leurs méthodes d'utilisation
US7431933B2 (en) 2000-06-09 2008-10-07 Melbourne Health Hepatitis B virus DNA polymerase and surface antigen variants and methods of using same
EP1297109A1 (fr) * 2000-06-09 2003-04-02 Melbourne Health Variantes d'adn polymerase du virus de l'hepatite b et d'antigenes de surface et leurs methodes d'utilisation
JP2014526885A (ja) * 2011-06-30 2014-10-09 グリーン・クロス・コーポレイション Ｂ型肝炎ウイルス表面抗原のエピトープおよびその使用
EP2726499A4 (fr) * 2011-06-30 2015-03-04 Green Cross Corp Épitope de l'antigène de surface du virus de l'hépatite b et son utilisation
US9415100B2 (en) 2011-06-30 2016-08-16 Green Cross Corporation Epitope and its use of hepatitis B virus surface antigen

Also Published As

Publication number Publication date
CN1330712A (zh) 2002-01-09
AUPP706098A0 (en) 1998-12-03
EP1135476A4 (fr) 2006-01-25
EP1135476A1 (fr) 2001-09-26
HK1043479A1 (zh) 2002-09-13

Similar Documents

Publication Publication Date Title
US8273527B2 (en) Viral variants
Kaneko et al. Probable implication of mutations of the X open reading frame in the onset of fulminant hepatitis B
US7678374B2 (en) Viral vectors expressing fusion of viral large envelope protein and protein of interest
KR100602771B1 (ko) 진단 분석법
US7604958B2 (en) Synthetic mammalian α-N-acetylglucosaminidase and genetic sequences encoding same
CN113201051A (zh) 一种乙肝病毒表面蛋白突变体及其在抗乙肝病毒中的应用
WO2000028009A1 (fr) Compositions biologiques, leurs constituants et leurs applications
AU777516B2 (en) Biological compositions, components thereof and uses therefor
US20060190186A1 (en) Viral polymerase and modulation thereof
EP1030915A1 (fr) Nouveau gene et ses utilisations
EP0218474A2 (fr) ADN et polypeptide
AU2006311462A1 (en) Diagnostic and therapeutic methods and agents
JP2648122B2 (ja) 新規ポリペプチドおよびその製造法
McGarvey et al. The expression of hepatitis B virus polymerase in hepatocytes during chronic HBV infection
AU2004231119B2 (en) Viral vectors expressing fusion of viral large envelope protein and protein of interest
WO2000020443A1 (fr) Nouveaux peptides
WO2000067777A1 (fr) Procede de prophylaxie et de traitement et agents utilisables dans ce procede
NZ520101A (en) Treatment of obesity with a gene expressed in hypothalamus of obese animals
AU3946900A (en) A ligand of the protein "beacon"
AU1011299A (en) A novel gene and uses therefor

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99814393.6

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2000 15018

Country of ref document: AU

Kind code of ref document: A

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 15018/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1999957236

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09831686

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1999957236

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 15018/00

Country of ref document: AU

WWW Wipo information: withdrawn in national office

Ref document number: 1999957236

Country of ref document: EP