WO1994012617A1 - Vaccins contre le virus de l'hepatite b - Google Patents

Vaccins contre le virus de l'hepatite b Download PDF

Info

Publication number
WO1994012617A1
WO1994012617A1 PCT/US1993/011474 US9311474W WO9412617A1 WO 1994012617 A1 WO1994012617 A1 WO 1994012617A1 US 9311474 W US9311474 W US 9311474W WO 9412617 A1 WO9412617 A1 WO 9412617A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
hepatitis
nucleotide sequence
pro
core
Prior art date
Application number
PCT/US1993/011474
Other languages
English (en)
Inventor
Peter T. S. Souw
Rhonda Wilson O'keefe
Tatyana Lewis
Edward G. Bernstine
Original Assignee
International Biotechnology Laboratories, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by International Biotechnology Laboratories, Inc. filed Critical International Biotechnology Laboratories, Inc.
Priority to AU56793/94A priority Critical patent/AU5679394A/en
Publication of WO1994012617A1 publication Critical patent/WO1994012617A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24151—Methods of production or purification of viral material

Definitions

  • the present invention relates to recombinant vaccinia viruses which are capable of expressing a plurality of hepatitis B virus (HBV) epitopes comprising core antigen epitopes, surface antigen epitopes, or any combination of the foregoing.
  • HBV hepatitis B virus
  • the vaccinia viruses are useful in vaccine formulations to prevent or treat hepatitis or other undesirable consequences of HBV infection.
  • Hepadnaviruses which include human hepatitis B virus (HBV) (Barker et al., 1975, Am. J. Med. Sci. 270:189-196), are hepatropic, lead to persistent infection, and have a common structure. Large concentrations of hepadnaviruses have been detected in the blood of infected organisms. Hepadnavirus virions are approximately 42 nm in diameter and have a double-walled structure consisting of an envelope and nucleocapsid (reviewed in Ganem and Varmus, 1987, Ann. Rev. Biochem. 56:651-693 and
  • the outer coat, or envelope contains three surface antigens, designated major or small (S) , middle (MS) , and large (LS) , as well as carbohydrates and lipids.
  • Hepatitis B surface antigen (HBsag) is found on all three of these surface antigen proteins.
  • the nucleocapsid, or inner coat contains a circular DNA (3.0-3.3 kb in length), a DNA polymerase, protein kinase activity, and hepatitis B core antigen (HBcAg) .
  • the hepadnavirus genome is a small, circular, partly double stranded DNA molecule (reviewed in Ganem and Varmus, supra , and Tiollais et al., supra) .
  • the minus strand is linear and of a fixed length, 3-3.2 kb.
  • the plus strand is of variable length, ranging from 50-100% of that of the minus strand.
  • ORF S encodes a total of 389-400 amino acids, depending upon subtype. ORF S is divided into the preSl region (encoding 108-119 amino acids) , preS2 region (encoding 55 amino acids) , and S gene (encoding 226 amino acids) in 5' to 3' order, each of which begins with an ATG codon capable of functioning as a translation initiation site in vivo .
  • Gene S encodes small (S) antigen, the HBsAg, which is the major envelope protein.
  • a 500 nucleotide sequence upstream of the S gene contains the preSl and preS2 sequences.
  • Middle (MS) protein is encoded by the preS2 and S regions
  • large (LS) protein is encoded by the preSl, preS2 and S regions.
  • ORF C which codes for HBcAg, is divided into the C gene and pre-C region.
  • ORF P encodes the viral polymerase.
  • ORF X encodes a protein which enhances expression of the other viral genes.
  • Core-related antigen production in vivo is a complex process involving two different precursors, precore and core, and post translational truncation at both amino and carboxy termini (Fig. 1) .
  • Two main forms of core-related antigens_ result from this processing: e antigen, which is made from precore and found mainly extracellularly in infected individuals, and core, which is found almost exclusively intracellularly, usually within the nucleus of the cell.
  • Putative nuclear localization sequences of the hepatitis B core protein include a set of direct repeats having the amino acid sequence PRRRRSQS (SEQ ID N0:1) located in tandem in the protamine-like domain of core.
  • Yeh et al. (1990, J. Virol. 64:6141- 6147) suggest that these repeats are necessary for nuclear localization.
  • Eckhardt et al. (1991, J . Virol. 65:575-582) suggest that other sequences may " also be involved.
  • hepatitis B is a widespread and serious health problem resulting from infection by the hepatitis B virus. A large proportion of people living in regions of poor medical - A -
  • HBV liver cancer
  • HBV is endemic in Asia, and causes one of the largest health problems in that region, where about 10% of the population are chronically infected carriers.
  • the toll of this figure on the health of Asians is severe; in addition to the impact of acute HBV infection, chronic carriers are jat ..
  • PHC primary hepatocellular carcinoma
  • HBV infection has been observed to be highly polymorphic, ranging from inapparent forms in which individuals experience mild or no liver injury to acute hepatitis B, a moderately severe illness characterized by hepatocellular injury and inflammation to severe chronic liver disease (reviewed in Ganem and Varmus, 1987, Ann. Rev. Biochem. 56:651- 693) . People infected with HBV are often unaware of it. After a two- to six-month incubation period, HBV infection can lead to acute hepatitis and liver damage, which cause abdominal pain, jaundice, elevated levels of certain enzymes in the blood and other symptoms.
  • hepatitis B viral infection can be diagnosed by detecting hepatitis B surface antigen (HBsAg) in a patient's blood serum. More frequently, the disease remains permanently asymptomatic. Although many chronic carriers appear healthy, they can still transmit the hepatitis B virus to those with whom they have close contact, thereby starting the cycle of disease anew.
  • HBsAg hepatitis B surface antigen
  • Hepatitis B is, therefore, primarily a disease of infants in developing countries, and is mostly confined to adults in Western countries.
  • vidarabine adenine arabinoside
  • vidarabine phosphate A monophosphorylated derivative of vidarabine, vidarabine phosphate, can be administered by rapid intravenous infusion or intramuscularly.
  • vidarabine phosphate therapy resulted in the clearance of serum hepatitis B virus DNA, it did not lead to a sustained improvement in the accompanying liver disease.
  • Other antivirals that have been tested for their effectiveness in treating HBV infection include acyclovir and suramin. Studies have also been undertaken in which patients were treated with alpha-interferons for 1-6 months. It was found that only 25-40% of the patients responded to this therapy. The combination of vidarabine phosphate and human leukocyte interferon proved to be toxic.
  • Other therapies that have been studied include the administration of interleukin-2, gamma interferon, and short course corticosteroids.
  • U.S. Patent No. 4,471,901 discloses a vaccine comprising a 22 nm polypeptide particle made of mature hepatitis B surface antigen.
  • a number of.groups have made constructs consisting of fusions to the core antigen expressed in bacteria, yeast or vaccinia (see, e.g., U.S. Patent No. 4,859,465; U.S. Patent Nos. 4,818,527 and
  • VACCINIA VIRUS Vaccinia virus is a poxvirus (for a review, see Moss, 1990, Virology, 2d ed. , Ch. 74, Fields et al., eds., Raven Press, Ltd., New York, pp. 2079-2111) which replicates within the cytoplasm of infected cells.
  • Vaccinia virus contains a linear double- stranded genome of approximately 187 kilobase pairs, encoding approximately 200 proteins. A large number of proteins are encoded by the virus because the virus establishes infection in the cytoplasm of the cell rather than in the nucleus, and therefore must provide its own set of enzymes to replicate its DNA and to transcribe its genes.
  • a vaccine approach has been described, involving the use of vaccinia virus as a vector to express foreign genes inserted into its genome (Mackett et al., 1982, Proc. Natl. Acad. Sci. USA 79:7415-7419; Mackett et al., 1984, J. Virol. 49:857- 864; Panicali and Paoletti, 1982, Proc. Natl. Acad. Sci. USA 79:4927-4931; PCT International Application No. W0 91/12318; European Patent Publication No. 83,286; Murphy, 1989, Res. Virol. 140:463-491; Moss and Flexner, 1987, Ann. Rev. Immunol. 5:305-324; Hruby, 1990, Clin. Microbiol.
  • the present invention provides recombinant vaccinia viruses which are capable of expressing a plurality of immunogenic HBV epitopes comprising at least one core antigen epitope, at least one surface antigen epitope, or any combination of the foregoing. In one embodiment, a plurality of core and/or surface antigen epitopes is expressed. Core antigen epitopes are selected from the group consisting of wild-type core antigen, e antigen, and derivatives thereof.
  • Surface antigen epitopes are those encoded by ORF S, and are selected from the group consisting of S, MS, LS, preS2, preSl, and derivatives-thereof_ "Epitope' as used herein refers to an antigenic determinant, i.e., an amino acid sequence that is capable of being i munospecifically bound by an antibody.
  • an antigenic determinant i.e., an amino acid sequence that is capable of being i munospecifically bound by an antibody.
  • a protein containing a core antigen epitope can be detected by observing the ability of such protein to be bound by an anti-core protein antibody.
  • the core antigen derivatives provided by the invention are those derivatives (including but not limited to fragments) which display core antigen antigenicity, i.e., are capable of being bound by an anti-core antibody.
  • the surface antigen derivatives provided by the invention are those derivatives (including but not limited to fragments) which display surface antigen antigenicity, i.e., are capable of being bound by an anti-surface antigen antibody.
  • a combination of the foregoing core and/or surface antigen epitopes are expressed as a fusion protein in the vaccinia viruses of the invention.
  • Fusion protein refers to a protein comprising an amino acid sequence from a first protein covalently linked via a peptide bond at its carboxy terminus to the amino terminus of an amino acid sequence from a second, different protein.
  • a vaccine formulation of the invention contains a single type of recombinant vaccinia virus of the invention.
  • a vaccine formulation comprises a mixture of two or more recombinant viruses of the invention.
  • Preferred viruses containing plural HBV antigens include but are not limited to a combination of one of S, MS, LS, and full-length core, core ⁇ S (see Section 6.1.2 infra) , preSl-core ⁇ 8, preSl-complete core, core-preSl*, core-preS2, or core-S* (the asterisks denoting the presence of an immunogenic fragment of the preceding antigen; hyphens denoting a fusion protein) .
  • the core and/or surface antigen epitopes can be expressed by the same recombinant virus, under the control of different promoters active in vaccinia virus.
  • two divergently oriented promoters are used.
  • a recombinant vaccinia virus expresses a surface-core (written in the amino to carboxy-terminal order) or core-surface fusion protein (e . g. , core-preSl, core-preS2, core-S, or preSl-core) under the control of a first promoter, and expresses a surface antigen (e.g., MS) under the control of a second promoter.
  • a surface antigen e.g., MS
  • a mixture of recombinant vaccinia viruses comprises a first virus capable of expressing core-preSl, a second virus capable of expressing core-preS2, and a third virus capable of expressing core-S or core-S*.
  • such a mixture comprises a first virus capable of expressing core-preSl or core-preSl*, a second virus capable of expressing core-preS2, and a third virus capable of expressing S.
  • such a mixture comprises a first virus capable of expressing core-preSl or core-preSl*, and a second virus capable of expressing MS.
  • such a mixture comprises a first virus capable of expressing core-preS2, and a second virus capable of expressing S.
  • FIGURES Figure 1 Schematic diagram of HBV precore and core processing to produce core antigen and e antigen.- Figure 2. Nucleotide sequence (SEQ ID N0: " 2) of the p7.5 promoter.
  • FIG. 1 Schematic diagram of plasmid pGS53.
  • FIG. 1 Nucleotide sequence (SEQ ID NO:3) of the pll promoter.
  • Figure 5 Schematic diagram of plasmid pSClO.
  • Figure 6 Nucleotide sequence (SEQ ID NO:4) of the modified p7.5 promoter.
  • Figure 7. Schematic diagram of plasmid pSC59.
  • FIG. 8 Schematic diagram of the HBV genome, illustrating the core and surface antigen- encoding regions.
  • Figure 9 Schematic diagram of plasmid pAM6.
  • FIG. 10 Schematic diagram of plasmid PT7T318.
  • FIG. 11 Schematic diagram of plasmid pRO-01.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • FIG. 12 Schematic diagram of plasmid pRO-02.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 13 Schematic diagram of plasmid pRO-03.
  • Figure 14 Schematic diagram of plasmid pRO-05.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was .destroyed during cloning procedures.
  • FIG. 15 Schematic diagram of plasmid pRO-06.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • FIG. 16 Schematic diagram of plasmid pT7T3/S.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • FIG. 1 Schematic diagram of plasmid pT7T3/S2.
  • FIG. 18 Schematic diagram of plasmid pLEH-01.
  • Figure 19 Schematic diagram of plasmid pLEH-02.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 20 Schematic diagram of plasmid pLEH-03.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 21 Schematic diagram of plasmid pLEH-04.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 22 Nucleotide sequence (SEQ ID NO:5) and amino acid sequence (SEQ ID NO:6) of LS.
  • Figure 23 Nucleotide sequence (SEQ ID NO:7) and amino acid sequence (SEQ ID NO:8) of MS.
  • Figure 24 Nucleotide sequence (SEQ ID NO:8)
  • FIG. 25 Schematic diagram of plasmid pRO-09B.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • FIG. 26 Schematic diagram of plasmid pT7T3/C.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 27 Schematic diagram of plasmid pT7T3/CHB.
  • Figure 28 Schematic diagram of plasmid pT7T3/CRB.
  • Figure 29 Schematic diagram of plasmid pT7T3/CODM.
  • Figure 30 Nucleotide sequence (SEQ ID NO:12) and amino acid sequence (SEQ ID NO: 13) of core ⁇ 8.
  • FIG 31 Schematic diagram of plasmid pCRB/24.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 32 Schematic diagram of plasmid pCODM/24.
  • Figure 33 Nucleotide sequence (SEQ ID NO: 14) and amino acid sequence (SEQ ID NO: 15) of full- length core in plasmid pCODM/24.
  • FIG. 34 Schematic diagram of plasmid PGS53X.
  • FIG. 35 Schematic diagram of plasmid PGS53/S
  • Figure 36 Schematic diagram of plasmid
  • Figure 37 Schematic diagram of plasmid pGS53/Sl.
  • FIG 38 Schematic diagram of plasmid pHTL-8.
  • Figure 39 Schematic diagram of plasmid pHTL-9.
  • Figure 40 Schematic diagram of plasmid pHTL-10.
  • Figure 41 Schematic diagram of plasmid pHTL-lOM.
  • Figure 42 Schematic diagram of plasmid pHTL-25.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 43 Schematic diagram of plasmid pHTL-26.
  • Figure 44 Nucleotide sequence (SEQ ID NO:25) and amino acid sequence (SEQ ID NO:26) of core-preSl*.
  • Figure 45 Schematic diagram of plasmid pHTL-27 .
  • Figure 46 Nucleotide sequence (SEQ ID NO:29) and amino acid sequence (SEQ ID NO: 30) of core-preS2.
  • Figure 47 Schematic diagram of plasmid pHTL-28.
  • Figure 48 Nucleotide sequence (SEQ ID NO:33) and amino acid sequence (SEQ ID NO:34) of core-S*.
  • Figure 49 Schematic diagram of plasmid pSClO ⁇ lacZ.
  • Figure 50 Schematic diagram of plasmid pDPV.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 51 Schematic diagram of plasmid pDPV-01.
  • Figure 52 Schematic diagram of • plasmid pRO-10.
  • Figure 53 Schematic diagram of plasmid pRO-16. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 54 Schematic diagram of plasmid pRO-ll. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 55 Schematic diagram of plasmid pRO-17. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 56 Schematic diagram of plasmid pRO-22. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 57 Schematic diagram of plasmid pRO-12.
  • Figure 58 Schematic diagram of plasmid pRO-13B.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 59 Schematic diagram of plasmid pRO-18.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 60 Schematic diagram of plasmid pRO-19.
  • Figure 61 Schematic diagram of plasmid pRO-19/24. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 62 Schematic diagram of plasmid pHTL-5. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 63 Schematic diagram of plasmid pHTL-6.
  • Figure 64 Schematic diagram of plasmid pHTL-7.
  • Figure 65 Schematic diagram of plasmid pHTL-11.
  • Figure 66 Schematic diagram of plasmid pHTL-12.
  • FIG. 67 Schematic diagram of plasmid pRO-16M.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 68 Schematic diagram of plasmid pHTL-30.
  • Figure 69 Schematic diagram of plasmid pHTL-13.
  • Figure 70 Schematic diagram of plasmid pHTL-15.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 71 Schematic diagram of plasmid pHTL-17.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 72 Schematic diagram of plasmid pHTL-33.
  • Figure 73 Schematic diagram of plasmid pHTL-34.
  • Figure 74 Schematic diagram of plasmid pHTL-35.
  • Figure 75 Schematic diagram of plasmid pHTL-36.
  • FIG 76 Schematic diagram of plasmid pPB-05.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but.was destroyed during cloning procedures.
  • Figure 77 Schematic diagram of plasmid pPB-09.
  • Figure 78 Schematic diagram of plasmid pET-3d.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 79 Schematic diagram of plasmid pT7/core.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 80 Schematic diagram of plasmid pPB-04.
  • Figure 81 Nucleotide sequence (SEQ ID NO: 1).
  • amino acid sequence SEQ ID NO:45
  • Figure 82 Schematic diagram of plasmid pRO-21.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 83 Nucleotide sequence (SEQ ID NO:48) and amino acid sequence (SEQ ID NO:49) of preSl-full-length core.
  • Figure 84 Schematic diagram of plasmid pRO-23.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 85 Schematic diagram of plasmid pHTL-23. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 86 Schematic diagram of plasmid pHTL-24. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 87 Schematic diagram of plasmid pHTL-18.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 88 Schematic diagram of plasmid pHTL-14. A restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 89 Schematic diagram of plasmid pHTL-31.
  • Figure 90 Schematic diagram of plasmid pHTL-32.
  • a restriction enzyme site shown in parentheses means that the site was present in the parental plasmid construct but was destroyed during cloning procedures.
  • Figure 91 A representative Western blot of polypeptides in cells infected by recombinant vaccinia viruses, probed with anti-S antibodies.
  • Lane A contains proteins isolated from nonrecombinant (wild-type) vaccinia virus.
  • Lane B contains proteins from a recombinant virus which does not express any S-related antigens.
  • Lanes C (pRO-18) and D (pGS53/Sl) are samples from recombinant viruses expressing the two forms of the LS antigen, nonglycosylated and glycosylated polypeptides of expected molecular weights 39 kD and 42 kD.
  • Lanes- E (pGS53/S) and F (pHTL-8) contain proteins from recombinant viruses expressing the two forms of the S antigen, with nonglycosylated and glycosylated forms having expected molecular weights of 24 kD and 27 kD.
  • Lanes G (pHTL-14), H (pGS53/S2) and I (pRO-23) contain proteins from recombinant viruses expressing the two forms of the MS antigen, with singly and doubly glycosylated forms of expected molecular weight 33 kD and 36 kD, respectively.
  • the present invention provides recombinant vaccinia viruses which are capable of expressing a plurality of immunogenic HBV epitopes comprising at least one core antigen epitope, at least one surface antigen epitope, or any combination of the foregoing. In one embodiment, a plurality of core and/or surface antigen epitopes is expressed.
  • Core antigen epitopes are selected from the group consisting of wild-type core antigen, e antigen, and derivatives thereof.
  • Surface antigen epitopes are those encoded by ORF S, and are selected from the group consisting of S, MS,
  • epitope refers to an antigenic determinant, i.e., an amino acid sequence that is capable of being immunospecifically bound by an antibody.
  • a protein containing a core antigen epitope can be detected by observing the ability of such protein to be bound by an anti-core protein antibody.
  • the core antigen derivatives provided by the invention are those derivatives (including but not limited to fragments) which display core antigen antigenicity, i.e., are capable of being bound by an anti-core antibody.
  • the surface antigen derivatives provided by the invention are those derivatives (including but not limited to fragments) which display surface antigen antigenicity, i.e., are capable of being bound by an anti-surface antigen antibody.
  • Fusion protein refers to a protein comprising an amino acid sequence from a first protein covalently linked via a peptide bond at its carboxy terminus to the ammo terminus of an amino acid sequence from a second, different protein.
  • a vaccine formulation of the invention contains a single type of recombinant vaccinia virus of the invention.
  • a vaccine formulation comprises a mixture of two or more recombinant viruses of the invention.
  • Preferred viruses contain plural HBV antigens including but not limited to a combination of one of S, MS, LS, and full-length core, core ⁇ (see Section 6.1.2 infra) , preSl-core ⁇ , preSl-complete core, core-preSl*, core-preS2, or core-S* (the asterisks denoting the presence of an immunogenic fragment of the preceding antigen; hyphens denoting a fusion protein) .
  • the core and/or surface antigen epitopes can be expressed by the same recombinant virus, under the control of different promoters active in vaccinia virus.
  • two divergently oriented promoters are used.
  • a recombinant vaccinia virus expresses a surface-core (written in the amino to carboxy-terminal order) or core-surface fusion protein (e.g., core-preSl, core-preS2 , -core-S, or preSl-core) under the control of a first promoter, and expresses a surface antigen (e.g., MS) under the control of a second promoter.
  • a surface-core written in the amino to carboxy-terminal order
  • core-surface fusion protein e.g., core-preSl, core-preS2 , -core-S, or preSl-core
  • a mixture of recombinant vaccinia viruses comprising a first virus capable of expressing core-preSl, a second virus capable of expressing core-preS2, and a third virus capable of expressing core-S.
  • such a mixture comprises a first virus capable of expressing core-preSl or core-preSl*, a second virus capable of expressing core-preS2, and a third virus capable of expressing S.
  • such a mixture comprises a first virus capable of expressing core-preSl or core-preSl*, and a second virus capable of expressing MS.
  • such a mixture comprises a first virus capable of expressing core-preS2, and a second virus capable of expressing S.
  • the vaccine formulations of the present invention provide efficacious protection against HBV infection, because, as live viral vaccines, multiplication of the vaccine strain and expression of its HBV epitope(s) in the host leads to prolonged immune stimulus, and the combination of HBV immunogenic epitopes thereby expressed leads to protective immunity.
  • the prolonged immune stimulus provided by the live viral vaccines of the invention is of similar kind and magnitude to that occurring in natural subclinical infections, and therefore, can confer substantial long-lasting immunity.
  • the identity and structural context of the immunogenic epitopes expressed according to the invention provide protection against HBV infection.
  • the present invention provides methods of prevention or treatment of HBV infection and its clinical manifestations (hepatitis, hepatoma) comprising administering one or more of the recombinant vaccinia viruses of the invention.
  • the vaccine formulations of the invention provide one or more of the following benefits: stability for long periods without refrigeration; ease of production; low cost of production; ability to be administered by local workers without advanced medical training; and effectiveness in one dose.
  • the vaccinia viruses which express an immunogenic fragment of more than one HBV protein cause immunological reactions against more components of HBV than can be presented by single subunit vaccines.
  • epitopes of HBV antigens can be identified by virtue of their hydrophilicity, by carrying out a hydrophilicity analysis (Hopp and Woods, 1981, Proc. Natl. Acad. Sci. USA 78:3824) to generate a hydrophilicity profile.
  • a hydrophilicity profile can be used to identify the hydrophobic and hydrophilic regions of a protein and the corresponding regions of the gene sequence which encode such proteins.
  • Preferred epitopes are those of the surface and core antigens described supra , specific embodiments of which are disclosed in examples section 6 herein (see also Table I) .
  • many different HBV surface and core antigen proteins or peptides can be expressed.
  • Peptides or proteins comprising surface antigen epitopes include but are not limited to an approximately 42,000 dalton glycoprotein consisting of preSl-preS2-S; an -39,000 dalton unglycosylated protein consisting of preSl-preS2-S; an -36,000 dalton glycoprotein (glycosylated at two sites) consisting of preS2-S; an -33,000 dalton glycoprotein (glycosylated at one site) consisting of preS2-S; an -27,000 dalton glycoprotein (glycosylated at one site) consisting of S; and an -24,000 dalton unglycosylated protein consisting of S.
  • the immunogenic peptides and proteins expressed by the recombinant viruses of the invention can be secreted or not secreted by a host cell infected with the virus. Such proteins which are not secreted can be intracellular proteins or cell surface membrane proteins.
  • the HBV protein or peptide (containing the immunogenic epitope) expressed by the recombinant vaccinia virus is localized extracellularly (secreted) or is a cell surface protein.
  • extracellular or cell surface localization is not required, since intracellular localization can also evoke an effective immune response (see, e . g . , Brown et al., 1987, J. Inf. Disc. 155:86) .
  • sequences encoding the immunogenic peptides or proteins are preferably present in single copies, but can also be present in multiple copies within the vaccinia virus genome. If multiple copies are present, care must be taken to ascertain that the recombinant virus stably maintains each of the multiple copies. In a preferred aspect, in an embodiment in which two copies are present, stability of the copies in the genome is maintained by -localizing the individual copies relatively distant from each other in the genome with essential sequences between the copies, or, perhaps, by orienting the copies divergently. Stability of the copies in the genome can be confirmed by methods known in the art, e . g. , Southern analysis.
  • multiple copies are avoided by employing, in the recombinant vaccinia viruses of the invention, HBV sequences which do not overlap by (i.e., do not contain an identical sequence of) more than 20 nucleotides, and preferably, do not overlap by more than 10 nucleotides.
  • a recombinant virus of the invention encodes a first and a second protein, each protein containing core and/or surface antigen epitopes, to maintain stability, the core and/or surface antigen sequences, or portions thereof displaying the antigenicity of such core and surface antigen sequences, respectively, in the first fusion protein are not present in the second fusion protein.
  • nucleotide sequence encoding the peptide or proteins comprising
  • HBV immunogenic epitope(s) lacks introns, e . g . , is a cDNA sequence, since any introns will not be spliced out. Thus, for example, no introns containing stop codons in the desired reading frame may be contained in the HBV-encoding nucleotide sequence.
  • the nucleotide sequence preferably contains a ribosomal binding site, or is placed within an insertion vector (see Section 5.2) so as to be operatively linked to a ribosomal binding site.
  • the DNA sequence encoding the HBV epitope(s) can be obtained from any.
  • Plasmid pAM6 contains the entire genome of HBV (subtype adw) , and is available from the American Type Culture Collection (ATCC) .
  • the HBV DNA has been inserted into the cloning vector pBR322 at a BamHI restriction enzyme site within the preS2 region to allow replication of the DNA in E . coli .
  • the MS and LS antigen open reading frames (ORFs) in pAM6 are interrupted.
  • ORFs open reading frames
  • the HBV DNA may be cleaved at specific sites using various restriction enzymes.
  • DNasel in the presence of manganese, or mung bean nuclease (McCutchan et al. , 1984, Science 225:626), to fragment the DNA, or the DNA can be physically sheared, as for example, by sonication.
  • the linear DNA fragments can then be separated according to size by standard techniques, including, but not limited to, agarose and polyacrylamide gel electrophoresis and column chromatography.
  • restriction enzymes Any restriction enzyme or combination of restriction enzymes may be used to generate HBV DNA fragment( ⁇ ) containing the desired epitope(s) , provided the enzymes do not destroy the immunopotency of the encoded product. Consequently, many restriction enzyme combinations may be used to generate DNA fragments which, when inserted into an appropriate vector, are capable of directing the production of the peptide containing the HBV epitope(s) .
  • identification of the specific DNA fragment containing the desired HBV sequence may be accomplished in a number of ways. For example, if a small amount of the desired DNA sequence or a homologous sequence is previously available, it can be used as a labeled probe (e.g., nick translated) to detect the DNA fragment containing the desired sequence, by nucleic acid hybridization. Alternatively, if the sequence of the derived gene or gene fragment is known, isolated fragments or portions thereof can be sequenced by methods known in the art, and identified by a comparison of the derived sequence to that of the known DNA or protein sequence.
  • a labeled probe e.g., nick translated
  • the desired fragment can be identified by techniques including but not limited to mRNA selection, making cDNA to the identified mRNA, chemically synthesizing the gene sequence (provided the sequence is known) , or selection on the basis of expression of the encoded protein (e.g., by antibody binding) after "shotgun cloning" of various DNA fragments into an expression system.
  • the sequences encoding HBV peptides to be expressed in recombinant vaccinia viruses according to the present invention, whether produced by recombinant DNA methods, chemical synthesis, or purification techniques include but are not limited to sequences encoding all or part (fragments) of the amino acid sequences of HBV-specific antigens, as well as other derivatives and analogs thereof.
  • the derivative or analog is functionally active, i.e., capable of exhibiting one or more functional activities associated with a full-length, wild-type HBV antigen (e.g., core or surface antigen) .
  • a full-length, wild-type HBV antigen e.g., core or surface antigen
  • such derivatives or analogs which have the desired immunogenicity or antigenicity can be encoded.
  • a surface antigen derivative which retains the ability to assemble into 22 nm particles is encoded.
  • a core antigen derivative which retains the ability to assemble into core particles see, e . g. , Cohen and Richmond, 1982, Nature 296:677-678) is encoded.
  • core and/or surface antigen derivatives which retain the ability to assemble into viral particles are encoded.
  • Derivatives or analogs of HBV antigens can be tested for the desired activity by procedures known in the art, including but not limited to standard immunoassays.
  • HBV antigen derivatives can be made by altering the encoding HBV antigen nucleotide sequences by substitutions, additions or deletions that provide for functionally equivalent molecules. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as a native HBV gene or portion thereof may be used in the practice of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of HBV genes or cDNAs which are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a silent change.
  • Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine, and histidine.
  • the negatively charged (acidic) amino acids include aspartic and glutamic acid.
  • HBV antigens include but are not limited to those peptides which are substantially homologous to an HBV antigen or fragments thereof, or whose encoding nucleic acid is capable of hybridizing to an HBV antigen-encoding nucleic acid sequence, e.g., under conditions of high stringency (e.g., 0.1 X SSC, 65°C) .
  • the HBV antigen derivatives and analogs can be produced by various methods known in the art. For example, a cloned HBV gene sequence can be modified by any of numerous strategies known in the art (Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d ed.
  • the sequence can be cleaved at appropriate sites with restriction endonuclease(s) , followed by further enzymatic modification if desired, isolated, and ligated in vitro .
  • care should be taken to ensure that the modified gene remains within the same translational reading frame as the antigen, uninterrupted by translational stop signals, in the gene region where the desired HBV epitope(s) are encoded.
  • the HBV antigen-encoding nucleic acid sequence can be mutated in vitro or in vivo , to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification.
  • Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site- directed mutagenesis (Hutchinson, C. , et al., 1978, J. Biol. Chem 253:6551), use of TAB® linkers (Pharmacia), etc.
  • the encoded HBV antigen derivative is a chimeric, or fusion, protein comprising an HBV protein or fragment thereof fused to a non-HBV amino acid sequence.
  • a chimeric protein is encoded by a nucleic acid encoding the HBV coding sequence joined in-frame to a non-HBV coding sequence.
  • Such a chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame.
  • a DNA sequence encoding an HBV epitope which is a hapten, i.e., a molecule that is antigenic in that it can react selectively with cognate antibodies, but not immunogenic in that it cannot elicit an immune response when administered without adjuvants or carrier proteins, can be isolated for use in the vaccine formulations of the present invention, since it is envisioned that, in particular embodiments, presentation by the vaccinia viruses of the invention can confer i munogenicity to the hapten expressed by the virus.
  • the HBV DNA containing the sequence(s) of interest is then inserted into a recombinant vaccinia virus such that it can be expressed by such virus.
  • this is accomplished by first inserting the HBV DNA into a plasmid vector which is capable of subsequent transfer to a vaccinia virus genome by homologous recombination (see Section 5.2 infra) .
  • the desired DNA sequence encoding the HBV epitope(s) is inserted, using recombinant DNA methodology (see
  • HBV sequences are placed in the vector such that they can be expressed under the control of a promoter functional in vaccinia virus. Expression of foreign DNA in recombinant vaccinia viruses requires the positioning of promoters functional in vaccinia so as to direct the expression of the protein-coding HBV DNA sequences. Plasmid insertion vectors have been constructed to insert chimeric genes into vaccinia virus.
  • One type of plasmid insertion vector is composed of: (a) a vaccinia virus promoter including the transcriptional initiation site; (b) one dr-more ⁇ unique restriction endonuclease cloning sites located downstream from the transcriptional start site for insertion of foreign DNA fragments; (c) nonessential vaccinia virus DNA (such as the thymidine kinase (TK) gene) flanking the promoter and cloning sites which directs insertion of the chimeric gene into the homologous nonessential region of the virus genome; and (d) a bacterial origin of replication and antibiotic resistance marker for replication and selection in E . coli . Examples of such vectors are described by Mackett (Mackett et al., 1984.
  • HBV epitope(s) is inserted into a suitable restriction endonuclease cloning site (b, above) .
  • a suitable restriction endonuclease cloning site e.g., a suitable restriction endonuclease cloning site (b, above) .
  • Various derivatives of this prototype insertion vector can also be used, e.g., with multiple restriction sites, with the ⁇ -galactosidase gene (lacZ) to allow selection of plaques by color, with inducible gene expression (e.g., by inclusion of a bacterial lac repressor system), etc. (see, e.g., Boyle et al., 1985, Gene 35:169-177; Chakrabarti et al., 1985, Moi. Cell. Biol. 5:3403-3409; Falkner et al., 1988, J.
  • insertion vectors based on single- stranded M13 bacteriophage DNA (Wilson et al., 1986, Gene 49:207-213) can be used.
  • the inserted HBV DNA should preferably not contain introns since intron sequences will not be removed during the viral life cycle, and insertion should preferably be so as to place the HBV coding sequences in close proximity to the promoter, with no other start codons in between the initiator ATG and * the 5' end of the transcript.
  • a plasmid insertion vector such as described supra , with a convenient restriction site for insertion of the HBV DNA
  • the ends of the DNA molecules may be modified. Such modifications include producing blunt ends by digesting back single-stranded DNA termini or by filling the single-stranded termini so that the ends can be blunt-end ligated.
  • any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction site recognition sequences. Other methods known in the art may be used.
  • the plasmid insertion vector should contain transcriptional and translational regulatory elements that are active in vaccinia virus. High expression levels in the derived recombinant virus can be obtained by using strong promoters or, less preferably, by inserting multiple copies of a single HBV sequence. In the use of multiple copies, care should be taken to confirm stable maintenance of the copies in the vaccinia virus genome (see discussion supra) .
  • the plasmid should be configured so that the HBV sequences are under the control of a promoter active in vaccinia virus.
  • a promoter can be a native vaccinia promoter or a non- native promoter active in vaccinia virus.
  • the promoter can be natural or synthetic.
  • the plasmid can contain more than one promoter, each directing the expression of a different sequence encoding HBV epitope(s) . In a preferred aspect, two such divergently oriented promoters are used. Promoters which can be used in the insertion vectors include but are not limited to the vaccinia virus thymidine kinase (TK) promoter, the 7.5K promoter (termed herein
  • p7.5 a modified p7.5 (see infra)
  • the UK promoter (termed herein “pll”)
  • the F promoter Pieris et al., 1984, Proc. Natl. Acad. Sci. USA 81:193-197
  • various early and late vaccinia promoters see Moss, 1990, Virology, 2d ed. , ch. 74, Fields et al., eds., Raven Press, Ltd., New York, pp. 2079-2111.
  • a promoter active both early and late in the viral life cycle is preferred.
  • the plasmid insertion vector contains (for eventual transfer into vaccinia virus) a T7 RNA polymerase coding sequence under the control of a promoter active in vaccinia virus, and the HBV coding sequences under the control of the T7 promoter.
  • a plasmid insertion vector contains a co-expression system consisting of divergently oriented promoters, one directing transcription of -the HBV sequences, the other directing transcription of a reporter gene or selectable marker, to facilitate detection or selection of the eventual recombinant vaccinia virus (see, e . g . , Fuerst et al., 1987, Moi. Cell. Biol. 5:1918-1924).
  • the p7.5, pll, or modified versions thereof are employed, some of which are described in more detail below.
  • a strong vaccinia promoter denoted here as “p7.5” (Cochran et al., 1985, J. Virol. 54:30-37), having the sequence provided in Figure 2 (SEQ ID NO:2), can be one of several-vaccinia -or vaccinia-like promoters used to direct expression of the HBV sequences.
  • the p7.5 promoter is so named because it normally directs expression of a vaccinia polypeptide of 7.5 kilodaltons molecular weight.
  • the transition from early to late events in viral replication is generally considered to be marked by the onset of viral DNA replication, and p7.5 contains elements which are active both early and late in viral replication, making it act as a constitutive promoter.
  • Promoter p7.5 is contained in plasmid pGS53 (Fig. 3) (Chakrabarti et al., 1985, Moi. Cell. Biol.
  • This plasmid contains fragments of the vaccinia thymidine kinase (TK) gene positioned so as to facilitate homologous recombination of the plasmid into that site in the vaccinia genome.
  • TK thymidine kinase
  • pll in nature directs expression of a vaccinia structural protein of 11 kilodaltons (European patent application 0198328, Hoffman LaRoche) .
  • pll unlike the p7.5 promoter, is active only late in viral replication.
  • the nucleotide sequence of pll is shown in Figure 4 (SEQ ID NO: 3) .
  • SEQ ID NO: 3 The nucleotide sequence of pll is shown in Figure 4 (SEQ ID NO: 3) .
  • pSCIO a plasmid called pSCIO (Fig. 5, Chakrabarti et al., supra ; kindly provided by Dr.
  • a pll-jS-gal cassette is inserted into the middle of the vaccinia TK gene so that this expression unit can be inserted by in vivo recombination into the TK gene in the virus.
  • modified p7.5 A strong vaccinia-like promoter used to direct expression of the hepatitis B antigens, termed herein "modified p7.5" has the nucleotide sequence set forth in Figure 6 (SEQ ID NO: ).
  • the modified p7.5 promoter (constructed in the laboratory of Dr. Bernard Moss) is a strong synthetic promoter that is active both early and late in viral replication.
  • the modified p7.5 promoter has a sequence based partly on the sequence of the p7.5 promoter.
  • the modified p7.5 promoter is contained in plasmid pSC59 (Fig. 7; kindly provided by Dr. Bernard Moss) .
  • Specific initiation signals are also required for efficient translation of inserted protein coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire HBV gene including its own initiation codon and adjacent sequences are inserted into the appropriate vectors, no additional translational control signals may be needed. However, in cases where only a portion of the gene sequence is inserted, exogenous translational control signals, including the ATG initiation codon, must be provided. The initiation codon must furthermore be in phase with the reading frame of the protein coding sequences to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic.
  • the ATG initiation codon of the HBV antigen or portion thereof is "upregulated, " i.e., contains a sequence upstream of that encoding the initiator methionine that matches a consensus sequence associated with strong ribosome binding.
  • the ATG codon of MS is upregulated.
  • the plasmid insertion vector contains at least one set of HBV coding sequences operatively linked to a promoter, flanked by sequences preferably nonessential for vaccinia viral replication.
  • nonessential sequences include but are not limited to the TK gene (Mackett et al., 1984, J. Virol. 49:857-864), the vaccinia Hindlll-F DNA fragment (Paoletti et al., 1984, Proc. Natl. Acad. Sci. USA 81:193-197), the vaccinia growth factor gene situated within both terminal repeats (Buller et al., 1988, J. Virol.
  • TK sequences are preferred for use; use of such sequences results in the generation of TK ⁇ recombinant viruses.
  • TK ⁇ recombinants have been shown to be attenuated relative to the parent strain (Buller et al., 1985, Vaccines 85:163), which may be an advantage from a safety standpoint in the development of new vaccinia-based vaccines.
  • the HBV-encoding sequences are inserted into a region of the vaccinia genome that does not encode protein, e.g., an intergenic region.
  • insertion into such a non-coding region in conjunction with insertion into a nonessential coding region such as TK might enable the generation of recombinant vaccinia viruses with multiple insertions which are no more attenuated than those viruses with a single insertion only in a nonessential coding region.
  • the strategy for choosing a non-coding region is based on several parameters, one of which is the length of the region, i.e., the distance between surrounding genes. A larger distance is preferable to a smaller distance in order to avoid regulatory regions necessary for the expression of surrounding genes. Another parameter is the function of the surrounding genes, nonessential genes being preferable to essential genes.
  • a sequence and map of the wild-type vaccinia Copenhagen strain is found in Goebel et al., 1990, Virology 179:247-266. For strains which have not been sequenced, the sequence of the chosen non-coding region is obtained or determined according to conventional nucleotide sequence techniques.
  • construction of an insertion vector with intergenic flanking regions can be carried out as follows:
  • PCR polymerase chain reaction
  • Primers are preferably chosen such that there is between 100 and 300 nucleotides between primers of a pair. 300 nucleotides has been designated herein as an upper length limit because the largest known non-coding region in the Copenhagen strain is approximately 400 nucleotides in length. In order to avoid potential regions of control of surrounding genes, it is preferable to leave a minimum of 50 nucleotides untouched on either side of the insertion region.
  • Primers hybridizing within the surrounding genes are used. Primers are designed so as to hybridize to complementary strands and allow amplification of the region between them. To facilitate later cloning, it is desirable to build a convenient restriction site into the primer sequence. Examples of sets of primers which may be used for the following non-coding regions, along with convenient restriction sites, are as follows.
  • A53R-A55R 5'GTTGGAATTCCGCTACTGAT3' 54 EcoRI 5 AACCAAGTATCGATATAAT3' 55 Clal Viral DNA is isolated from the wild type, e.g., Wyeth virus according to known procedures.
  • the primers are then hybridized to the viral DNA under non-denaturing conditions.
  • PCR see Section 5.3
  • the amplified DNA is then digested with restriction enzymes which cut within the primer sequences and the resulting fragment is gel purified.
  • the gel purified DNA is cloned into an appropriate vector using standard cloning techniques.
  • the cloned non-coding region is digested with a restriction enzyme at a site within the non- coding region.
  • Noncoding regions which can potentially be used, with their approximate size and a convenient restriction site for insertion, are set forth in Table 2.
  • the desired promoter/HBV DNA construct is inserted within the cloned non-coding region using the appropriate restriction enzymes and sites.
  • the HBV sequences are inserted so as to be flanked by at least about 100 bp of the noncoding vaccinia DNA.
  • the sequences are inserted into the vector so as to be surrounded by about 500 bp of vaccinia DNA on each side, which may include some DNA from nonessential vaccinia genes.
  • vaccinia viruses are preferably produced by transfection of the recombinant insertion vectors containing the HBV sequences into cells previously infected with vaccinia virus. Alternatively, transfection can take place prior to infection with vaccinia virus. Homologous recombination takes place within the infected cells and results in the insertion of the foreign gene into the viral genome, in the region corresponding to the insertion vector flanking regions. The infected cells can be screened using a variety of procedures such as immunological techniques, DNA plaque hybridization, or genetic selection for recombinant viruses which subsequently can be isolated. These vaccinia recombinants preferably retain their essential functions and infectivity and can be constructed to accommodate up to approximately 35 kilobases of foreign DNA.
  • Transfections may be performed by procedures known in the art, for example, a calcium chloride-mediated procedure (Mackett et al., 1985, The construction and characterization of vaccinia virus recombinants expressing foreign genes, in DNA Cloning, Vol. II, Rickwood and Hames (eds.) , IRL Press, Oxford-Washington, D.C.) or a liposome-mediated procedure (Rose et al., 1991, Biotechniques 10:520-525) .
  • a calcium chloride-mediated procedure Mackett et al., 1985, The construction and characterization of vaccinia virus recombinants expressing foreign genes, in DNA Cloning, Vol. II, Rickwood and Hames (eds.) , IRL Press, Oxford-Washington, D.C.
  • liposome-mediated procedure Rose et al., 1991, Biotechniques 10:520-525
  • flanking TK sequences are used to promote homologous recombination
  • the resulting recombinant viruses thus have a disrupted TK region, permitting them to grow on a TK- host cell line such as Rat2 (ATCC Accession No. CRL 1764) in the presence of 5-bromo-2 '-deoxyuridine (BUDR) , under which conditions non-recombinant (TK + ) viruses will not grow.
  • a TK- host cell line such as Rat2 (ATCC Accession No. CRL 1764)
  • BUDR 5-bromo-2 '-deoxyuridine
  • TK- recombinants have been shown to be attenuated relative to the parent strain (Buller et al., 1985, Infectious vaccinia virus TK ⁇ recombinants that express foreign genes are less virulent than wild-type virus in mice, in Vaccines 85, Molecular and Chemical Basis of Resistance to Parasitic, Bacterial and Viral Disease , R.A. Lerner, Chanock, R.M., and Brown, F. (eds.), Cold Spring
  • recombinant vaccinia viruses of the invention are made by in vitro cloning, and then packaging with a poxvirus sensitive to a selection condition, rather than by homologous recombination.
  • the HBV DNA sequences can be inserted into vaccinia genomic DNA using standard recombinant DNA techniques in vitro; this recombinant DNA can then be packaged in the presence of a "helper" poxvirus such as a temperature sensitive vaccinia virus mutant or a fowlpox virus which can be selected against under the appropriate conditions.
  • a "helper" poxvirus such as a temperature sensitive vaccinia virus mutant or a fowlpox virus which can be selected against under the appropriate conditions.
  • Various vaccinia virus strains known in the art can be used to generate the recombinant viruses of the invention. Characterized strains of low virulence are preferred.
  • a preferred vaccinia virus is the New York City Department of Health Laboratories strain, prepared by Wyeth (available from the American Type Culture Collection (ATCC) , Accession No. VR-325) .
  • Other vaccinia strains include but are not limited to the Elstree and Moscow strains, the strain of Rivers (CV-1 and CV-2) , and the LC16m8 strain of Hashizume.
  • Selection of the recombinant vaccinia virus can be by any method known in the art, including hybridization techniques (e.g., using HBV DNA sequences as a hybridization probe) , immunological techniques (e.g., assay for binding to antibodies recognizing the encoded HBV epitope(s)), etc.
  • TK flanking sequences are used in the insertion vector
  • selection is for TK- recombinants, as described above; screening for the correct recombinant is then carried out by molecular analyses as described infra .
  • the method of choice for selection is dictated by the choice of insertion vector used to generate the recombinant viruses.
  • a coexpression system vector containing a reporter gene or selectable marker
  • detection of recombinants is carried out by screening for the reporter gene expression or selecting for selectable marker expression.
  • color screening methods known in the order can be used to detect expression of ⁇ -galactosidase. Incorporation of neomycin or gpt genes allows selection by antibiotic resistance. Plaque size can also be used for screening. Many other methods will be known to the skilled artisan and can be used.
  • the selected recombinant vaccinia virus is then generally plaque-purified (preferably by at least three rounds of purification from a single viral plaque) , and subjected to molecular analyses to verify its identity and purity.
  • molecular analyses Preferably, two types of molecular analyses are carried out: (i) nucleic acid analyses; and (ii) assays for expression of the encoded HBV epitope(s) .
  • hybridization assays are preferably carried out using a labelled nucleic acid containing HBV sequences as a hybridization probe.
  • a labelled nucleic acid containing HBV sequences for example, plaque-lift hybridizations (see Mackett et al., 1985, in DNA Cloning, Vol. II, Rickwood and Hames (eds.), IRL Press, Oxford-Washington, D.C.), Southern hybridizations (Southern, 1975, J. Moi. Biol. 98:503- 517; see Section 8.1. infra) , and Northern hybridizations (Freeman et al., 1983, Proc. Natl. Acad.
  • DNA sequence analysis e.g., according to Maxam and Gilbert, 1980, Meth. Enzymol. 65:499-560; Sanger et al., 1977, Proc. Natl. Acad. Sci. USA 74:5463; or Tabor and Richardson, U.S. Patent No. 4,795,699; or by use of an automated DNA sequenator
  • PCR polymerase chain reaction
  • U.S. Patent Nos. 4,683,202, 4,683,195 and 4,889,818 Gyllenstein et al., 1988, Proc. Natl. Acad. Sci.
  • Southern blot hybridisation can also be carried out using a hybridization probe containing the desired vaccinia sequences to ensure that the HBV sequences have been inserted into the desired region of the vaccinia genome.
  • Protein analyses to confirm expression of the encoded HBV epitope(s) by the selected recombinant vaccinia virus, can be carried out by any method known in the art, including functional or immunological assays, and are preferably accomplished by immunoassay methods employing antibodies to the encoded HBV epitope(s) .
  • immunoassays known in the art can be used, including but not limited to competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay) , "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example) , western blots, immunoprecipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays) , complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.
  • antibody binding is detected by detecting a label on the primary antibody.
  • the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
  • the secondary antibody is labelled.
  • Many means are known in the art for detecting binding in an immunoassay and are envisioned for use. in specific embodiments, western blot analyses can be carried out as described in Section 8.2. infra .
  • ELISA can be carried out as described in Section 8.3 infra .
  • Several immunoassays for HBV S or e antigens are commercially available (Abbott Laboratories, No. Chicago, IL) .
  • Recombinant viruses containing a combination of epitopes from core and surface elements are a preferred embodiment of the invention and can be generated using the plasmids described in the examples sections infra , and homologous recombination.
  • Immunopotency of the HBV epitope(s) in their live vaccinia vaccine formulation can be determined by monitoring the immune response of test animals following immunization with the recombinant vaccinia virus(es) expressing the HBV epitope(s).
  • Generation of a humoral response may be taken as an indication of a generalized immune response, other components of which, particularly cell-mediated immunity, may be important for protection against HBV.
  • Test animals may include mice, rabbits, chimpanzees and eventually human subjects. HBV can be made to infect chimpanzees experimentally, although they do not develop chronic infections.
  • the antibody response to an HBV vaccine of the invention can first be studied in a number of smaller, less expensive animals, with the goal of finding one or two best candidate viruses or best combinations of viruses to use in chimpanzee efficacy studies.
  • Methods of introduction of the vaccine may include oral, intracerebral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal or any other standard routes of immunization.
  • the immune response of the test subjects can be analyzed by various approaches such as: the reactivity of the resultant immune serum to HBV antigens, as assayed by known techniques, e . g . , enzyme linked immunosorbent assay (ELISA) , immunoblots, radioimmunoprecipitations, etc.; or protection from HBV infection and/or attenuation of hepatitis symptoms in immunized hosts.
  • ELISA enzyme linked immunosorbent assay
  • recombinant vaccinia virus vaccines of the invention can be prepared in large quantities for animal studies.
  • this is done by infecting roller bottles containing 10 8 to 10 9 cells with virus, and harvesting after several days of infection.
  • the cells are pelleted, washed, and then disrupted by resuspension and homogenization in a hypotonic buffer.
  • Nuclei and cellular debris are then pelleted and the virus-containing supernatant is sonicated to break up any virus aggregates.
  • the viruses are then pelleted through a cushion of 36% sucrose in a hard spin, followed by banding in a 24-40% sucrose gradient.
  • the purified virus is then harvested by a hard spin, resuspended in a small volume, and titrated to determine viral concentration and yield. This process may be scaled up using a tangential flow filtration apparatus, and a continuous flow ho ogenizer.
  • HBV vaccines of the invention may be tested in rabbits for the ability to induce an antibody response to HBV antigens.
  • Male specific-pathogen-free (SPF) young adult New Zealand White rabbits may be used.
  • the test group of rabbits each " receives approximately 5 x 10 8 pfu (plaque forming units) of the vaccine.
  • a control group of rabbits receives an injection in 1 mM Tris-HCl pH 9.0 of the parental non-recombinant vaccinia virus or of a recombinant virus which does not express HBV antigens.
  • Blood samples may be .drawn from the rabbits every one or two weeks, and serum analyzed for antibodies to the HBV antigens using, e.g., a radioimmunoassay (Abbott Laboratories) .
  • the presence of antibodies specific for core protein or the surface antigens may be assayed using an ELISA.
  • the sera may also be analyzed for antibodies to vaccinia, e.g., in an enzyme-linked immunoassay. Because rabbits may give a variable response due to their outbred nature, it may also be useful to test the vaccines in mice.
  • mice respond differently to HBV antigens depending on their H-2 (histocompatibility) type (Milich and Chisari, 1982, J. Immunol. 129:320-325) . Because there is little information available regarding the expression of HBV antigens from recombinant vaccinia viruses in mice, an HBV- responsive strain of mouse must be chosen, and an appropriate dose of vaccinia virus must be administered to render the mouse strain responsive to recombinant viruses of the invention (see Section 8.4, infra) .
  • Patas monkeys may be used to test for immunogenicity of HBV vaccine formulation, although challenge experiments cannot be carried out since they are resistant to HBV infection. Chimpanzees may be tested for HBV vaccine efficacy (e.g., challenge experiments) , since they can be infected by the virus.
  • monkeys each receive intradermally approximately 5 x 10 8 pfu of recombinant Wyeth virus. A control monkey receives Wyeth (control) virus intradermally. Blood is drawn weekly for 12 weeks, and serum is analyzed for antibodies to vaccinia, core, and S.
  • VACCINE FORMULATION AND ADMINISTRATION The purpose of this embodiment of the invention is to formulate a vaccine in which the immunogen is one or several recombinant vaccinia virus(es) that express(es) HBV epitope(s) so as to elicit a protective immune (humoral and/or cell mediated) response against HBV infections for the prevention of hepatitis, hepatoma and/or other undesirable correlates of HBV infection.
  • the immunogen is one or several recombinant vaccinia virus(es) that express(es) HBV epitope(s) so as to elicit a protective immune (humoral and/or cell mediated) response against HBV infections for the prevention of hepatitis, hepatoma and/or other undesirable correlates of HBV infection.
  • Many methods may be used to introduce the vaccine formulations of the invention; these include but are not limited to oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal routes, and via scarification (scratching through the top layers of skin, e . g. , using a bifurcated needle) .
  • scarification is employed; intravenous administration is disfavored, since it is preferred to have the virus replicate in the skin and not spread systemically.
  • the vaccine formulations of the invention comprise the recombinant vaccinia virus and a pharmaceutically acceptable carrier or excipient.
  • the recombinant virus can be replicating or nonreplicating, although replicating is preferred.
  • an enveloped virus is preferred over the non-enveloped form.
  • Pharmaceutically acceptable carriers include but are not limited to saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, and combinations thereof. The formulation should suit the mode of administration.
  • composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • the composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • an ampoule of sterile diluent can be provided so that the ingredients may " be mixed prior to administration.
  • the lyophilized recombinant vaccinia virus of the invention is provided in a first container; a second container comprises diluent consisting of an aqueous solution of 50% glycerin, 0.25% phenol, and an antiseptic (e.g., 0.005% brilliant green).
  • a second container comprises diluent consisting of an aqueous solution of 50% glycerin, 0.25% phenol, and an antiseptic (e.g., 0.005% brilliant green).
  • Boosting is possible but not preferred.
  • boosting it may be preferable to boost with the HBV antigen in purified form rather than using a recombinant virus of the invention, since long-lasting immunity to vaccinia virus may limit the utility of recombinant vaccinia virus for repetitive boosting (see id. ) .
  • Effective doses may also be extrapolated from dose-response curves derived from animal model test systems.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the vaccine formulations of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the vaccine formulations of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the antibodies generated against HBV by immunization with the recombinant viruses of the present invention also have potential uses in diagnostic immunoassays, passive im unotherapy, and generation of antiidiotypic antibodies.
  • the generated antibodies may be isolated by standard techniques known in the art (e.g., immunoaffinity chromatography, centrifugation, precipitation, etc.) and used in diagnostic immunoassays.
  • the antibodies may also be used to monitor treatment and/or disease progression.
  • Any immunoassay system known in the art, such as those listed supra may be used for this purpose including but not limited to competitive and noncompetitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme-linked immunosorbent assays) , "sandwich” immunoassays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays and immunoelectrophoresis assays, to name but a few.
  • the vaccine formulations of the present invention can also be used to produce antibodies for use in passive immunotherapy, in which short-term protection of a host is achieved by the administration of pre-formed antibody directed against a heterologous organism (in this case, HBV) .
  • HBV heterologous organism
  • the antibodies generated by " che vaccine formulations of the present invention can also be used in the production of antiidiotypic antibody.
  • the antiidiotypic antibody can then in turn be used for immunization, in order to produce a subpopulation of antibodies that bind the initial antigen of the pathogenic microorganism (Jerne, 1974, Ann. Immunol.
  • the recombinant vaccinia viruses of the invention are administered therapeutically, for the treatment of hepatitis or other undesirable correlates of HBV infection.
  • Administration of such viruses e.g., to neonates and other human subjects, can be used as a method of immunostimulation, to boost the host's immune system, enhancing cell-mediated and/or humoral immunity, and facilitating the clearance of HBV.
  • the viruses of the invention can be administered alone or in combination with other anti-viral therapies, including but not limited to ⁇ -interferon and vidarabine phosphate. 6. CONSTRUCTION OF VECTORS ENCODING HBV EPITOPES
  • vectors which were constructed, and which have utility in generating the recombinant viruses of the invention upon further manipulation (with respect to the cloning vectors) , or with a plasmid that provides T7 polymerase (with respect to HBV sequences operably linked to a T7 promoter) are also described infra .
  • HBV genome (subtype adw) is contained in plasmid pAM6 (Moriarty et al., 1981, Proc. Natl. Acad. Sci. USA 78:2606-2610, available from the American Type Culture Collection (ATCC) Accession No. 45020, Fig. 9.) , a pBR322-based vector that is replicable in E. coli .
  • pAM6 Moarty et al., 1981, Proc. Natl. Acad. Sci. USA 78:2606-2610, available from the American Type Culture Collection (ATCC) Accession No. 45020, Fig. 9.
  • ORFs MS/LS open reading frames in pAM6 are interrupted by pBR322 DNA
  • these ORFs were resected using the 2883 bp cloning vector pT7T318 (Pharmacia cat. no. 27-3512; Fig. 10), which contains multiple restriction sites.
  • pAM6 plasmid DNA was double digested with BamHI and Bglll enzymes, and the fragments generated by the digestion were electrophoretically separated on an 0.8% agarose gel with appropriate size markers in IX TBE (89.2 mM Tris pH 8.0, 89 mM boric acid, 2 mM EDTA), and the fragment corresponding to the 799 bp insert containing preSl and part of preS2 was excised from the ethidium-bromide stained gel.
  • IX TBE 89.2 mM Tris pH 8.0, 89 mM boric acid, 2 mM EDTA
  • This fragment was eluted from the gel by electrophoresis into a dialysis bag in 0.5X TBE and ligated, using T4 DNA ligase, to the pT7T318 DNA which had been linearized by BamHI digestion, similarly gel-purified, and treated with bacterial alkaline phosphatase (BAP) to prevent recircularization of the vector.
  • BAP bacterial alkaline phosphatase
  • a fraction of the ligation mix was transformed into E. coli (strain DH5 ⁇ F'I Q , available from BRL Life Technologies, Inc., cat. no. 8288SA) which had previously been made competent to take up the DNA by standard techniques (Sambrook et al., supra) .
  • the transformed cells were plated on plates of LB agar plus 50 ⁇ g/ml ampicillin to select for cells which had been transformed with the plasmid.
  • Small 1 ml cultures of LB broth (10 g/1 bactotryptone, 5 g/1 bacto-yeast extract, 10 g/1 NaCl pH 7.5) plus 50 ⁇ g/ml ampicillin were then grown.
  • DNA was prepared from these cultures by a boiling lysis miniprep protocol (Sambrook et al., supra) followed by digestion and electrophoresis on an agarose gel to screen for a colony containing an insert of the expected size and orientation.
  • the size and desired orientation of the insert was verified by digestion with PstI, which cuts in the polylinker of pT7T318 and within the insert, 5 bp from the 3' end of the preS2 region.
  • digestion of pRO-01 with PstI yields fragments of 812 bp and 2870 bp, consistent with the PstI site of the pT7T318 polylinker being at the N-terminus of the open reading frame.
  • Large quantities of the desired DNA and a glycerol stock of the plasmid-harboring E . coli were prepared by standard methods from a 250 ml LB broth plus ampicillin culture of the chosen colony.
  • the 3 ' end of the ORF coding for the three surface antigens was manipulated using similar techniques to connect it to the 5 1 end of the ORF.
  • the 3 '-end fragment with length 1372 bp wa excised from pAM6 by BamHI digestion and purified from an agarose gel.
  • This fragment was inserted into BamHI-linearized and bovine alkaline phosphatase (BAP) -dephosphorylated pRO-01, a fragment of 3683 bp, to generate pRO-02 (Fig. 12) , which contains an intact open reading frame capable of encoding LS, MS and S antigens.
  • BAP bovine alkaline phosphatase
  • pRO-02 Fig. 12
  • the correct orientation of the insert in pRO-02 was verified by double digestion with PstI and Xbal to yield a restriction pattern consistent with fragments of sizes 4018, 800, 224 and 12 bp.
  • each gene was engineered so as to be under the transcriptional control of a vaccinia or vaccinia-like promoter, i.e., a promoter which is recognized by vaccinia virus RNA polymerase.
  • a vaccinia or vaccinia-like promoter i.e., a promoter which is recognized by vaccinia virus RNA polymerase.
  • the 3' end of the vaccinia promoter is often very close to, in the case of early promoters, or superimposed on, in the case of late promoters, the translation initiation codon of the ORF (1990, Virology, Fields, B.N. , ed. , Raven Press, New York), so we deemed this proximity also desirable in recombinant constructs.
  • the translational initiation codons of the MS and S ORFs are contained within a 321 bp Hindi fragment of pRO-02.
  • This Hindi fragment was isolated from pRO-02 and cloned into HincII-linearized and BAP-treated pT7T318 to generate pRO-03 (Fig. 13) .
  • the correct orientation of the inserted fragment was verified by digestion of pRO-03 with BamHI to yield a restriction pattern consistent with fragments of 201 bp and 3003 bp, indicating that the insert had been made such that the BamHI site in the pT7T318 polylinker was located at the 3' end of the insert.
  • pRO-03 From pRO-03 , the initiating ATG of the S ORF was subcloned so as to be in close proximity to useful restriction sites. Specifically, pRO-03 was digested with Nlalll, which digests the plasmid in many places (11 sites) including within the MS-encoding region one base pair upstream of the initiating ATG of the S ORF. Nlalll-digested pRO-03 was also digested with Hindi, which cuts the plasmid at the 3 • end of the S-fragment insert.
  • the 67 bp ATG-containing fragment generated by this Nlalll/Hincll digestion was then isolated from a 5.5% polyacrylamide gel run with appropriate size standards and then cloned into the vector backbone of pT7T318 which had been double digested with SphI and Hindi, generating pRO-05 (Fig. 14) , which contains the initiating ATG of the S ORF.
  • the presence of the insert in pRO-05 was verified by double digestion with Hindlll and EcoRI to yield a restriction pattern consistent with fragments of lengths 103 and 2871 bp.
  • the orientation of the insert in pRO-05 was verified by restriction digestion to be such that the Hindi site at the carboxyl-terminus of the inserted ORF is retained.
  • the initiating ATG of MS was subcloned so as to be closely surrounded by restriction sites.
  • pRO-03 was digested with Haelll, which cuts pRO-03 at 12 sites including one just two base pairs 5' of the initiating ATG of MS, together with Hindi.
  • the resulting 232 bp fragment containing the 5* end of the MS ORF was isolated and subcloned into the 2866 bp vector backbone of pT7T318 which had been double digested by Smal and Hindi, BAP-treated, and gel-purified, generating pRO-06 (Fig. 15) .
  • the size and orientation of the insert were verified by double digestion with
  • the 3 ' end of the S antigen coding region was then added to the S ORF in pRO-05 by Hindi and StuI double digestion of pRO-02 and isolation of the 750 bp fragment coding for this C-terminal region.
  • This fragment was inserted into the 2918 bp Hindi and Smal double digested vector fragment of pRO-05 to generate pT7T3/S (Fig. 16) .
  • Restriction analysis was used to confirm that the orientation of the insert in pT7T3/S was such that the Hindi site within the S ORF had been recreated.
  • pT7T3/S thus contains DNA encoding the entire open reading frame of the S antigen, beginning with the initiating ATG.
  • the 3* end of the S antigen was added to the MS ORF in pRO-06 by double digesting pRO-02 with Hindi and SphI, isolating the fragment corresponding to the 1016 bp 3' end, and inserting this fragment into the 3085 bp vector fragment of Hindi and SphI double digested pRO-06, generating pT7T3/S2 (Fig. 17) . Restriction analysis was used to verify that the insert's orientation in pT7T3/S2 was such that the Hindi site within the S region had been recreated. pT7T3/S2 created in this manner contains DNA encoding the entire open reading frame of the MS antigen, beginning with the initiating ATG of MS.
  • a plasmid construct containing the LS open reading frame closely surrounded by restriction endonuclease sites was constructed using a similar procedure.
  • the 509 bp Hindi fragment of pAM6 containing the LS ATG was subcloned into HincII-linearized pT7T318, generating pLEH-01 (Fig. 18) .
  • pLEH-01 was then double digested with Nlalll, which cuts 10 times including at a site 1 base pair 5' of the initiating ATG of LS, and with Hindi at a site approximately 230 base pairs 3'' of the ATG.
  • the 132 bp middle fragment of the LS ORF stretching from within preSl to within preS2 was then subcloned from HincII/BamHI-cut pRO-02, into the 3091 bp vector backbone of pLEH-02 which had been double digested with H cII and BamHI, generating pLEH-03 (Fig. 20) . Restriction digestion was used to verify that the insert in pLEH-03 was oriented so as to restore both the Hindi and BamHI sites, and that an insert of the expected size had been made.
  • the dideoxy method e.g., Sequenase kit, United States Biochemical Corp. ; Tabor and Richardson, 1989, J. Biol. Chem. 214:6447-6458
  • a primer hybridizing just 3' of the ATG of the S ORF was used to facilitate sequencing of the 5 ' ends of the MS- and LS-encoding sequences.
  • a 530 bp internal Ball/Dral fragment of the S region was subcloned into pT7T318 which had been linearized with Hindi. Sequence data generated using this strategy was analyzed in comparison to the published sequence of one isolate of subtype adw DNA (Ono et al. , 1983, Nucl. Acids Res. 11:1747-1757). When we performed these experiments, our sequence data showed three translatable open reading frames corresponding to DNA encoding LS, MS and S.
  • nucleotide and deduced amino acid sequences of the LS (SEQ ID NO: 5 and NO: 6) , MS (SEQ ID NO: 7 and NO: 8) , and S (SEQ ID NO: 9 and NO: 10) regions are shown in Figures 22, 23, and 24, respectively. Changes in nucleotide and amino acid sequence from the published sequence are noted in Table 4 and are believed to result from variability within the adw subtype.
  • core ⁇ a deleted version of the core gene, referred to as core ⁇ , in which 8 amino acids are deleted as set forth below starting 16 amino acids from the 3 ' end of the full-length core antigen, was used.
  • This 584 bp fragment was then gel-purified and subcloned into HincII-linearized pT7T318, generating a new plasmid, named pRO-09B (Fig. 25) , containing three Bglll sites.
  • the orientation of the insert in pRO-09B was determined to be such that the EcoRI site in the polylinker of pT7T318 is located at the C-terminus of the open reading frame; digestion with Bglll and EcoRI yielded a restriction map consistent with fragments of 24, 68, 420, and 2954 bp.
  • the 24 bp core ⁇ 8 deletion was generated using a partial Bglll digest.
  • the 158 bp Bglll/HincII fragment of pAM6 containing the C-terminus of the core ORF was then subcloned into the purified vector mixture.
  • the resultant minipreps were screened for the presence of a 420 bp band upon Bglll digestion, indicative of insertion in the correct orientation in which the Bglll site has been recreated.
  • the core regions of a number of candidate minipreps were sequenced to identify a clone in which Bglll #2 was the site of digestion in the initial partial digest.
  • the resulting plasmid, called pT7T3/C Fig.
  • pT7T3/C was subjected to oligonucleotide-directed site-specific mutagenesis on double-stranded DNA by published techniques (see for example Inouye, S. and Inouye, M. , "oligonucleotide-directed Site-specific Mutagenesis Using Double-Stranded Plasmid DNA", in Synthesis and Applications of DNA and RNA, ed. S. Narang, Academic Press) . (Polymerase chain reaction could also be used to reinsert the missing nucleotide.) An.
  • oligonucleotide of sequence 5' GGA GGA TCC aGC ATC AAG G 3' was used both to replace the deleted base pair (lower case "a") and to generate for cloning purposes, without changing the core protein's amino acid sequence, a BamHI site (underlined) several bases 5' of the missing base pair.
  • Mutation using this procedure generated two types of DNA plasmids: wild-type and mutant containing the new BamHI site and the inserted adenine.
  • the mutant DNA was then cloned selectively using this BamHI site, such that each of the two pieces of DNA on either side of the BamHI site were first cloned individually and then reunited. To do this, the transformed E.
  • coli containing a mixture of mutated and non-mutated plasmids were inoculated into 250 ml LB broth with 50 ⁇ g/ml ampicillin, and a purified large-scale preparation of the DNA was made by standard techniques (Sambrook et al., supra) . Separate aliquots of this DNA were then digested with either EcoRI/BamHI or Hindlll/BamHI. Part of the EcoRI/BamHI-digested aliquot was subjected to electrophoresis on an agarose gel, and a 448 bp fragment was excised and purified. The same method was used to purify the 269 bp Hindlll/BamHI fragment.
  • Full-length core In order to construct a full-length core gene, pT7T3/CRB was digested with Bglll, which linearizes the plasmid, and ligated to a pair of oligonucleotides designed to hybridize to each other, add 24 bp of sequence, and leave overhanging Bglll-co patible ends.
  • digestion was imposed for an insertion mutant, pCRB/24 (Fig. 31) , which lacks Bglll sites.
  • pCRB/24 is similar to pT7T3/CRB except that pCRB/24 encodes 8 additional amino acids of core antigen sequence and lacks any Bglll sites. The correct orientation of the insert to recreate the authentic core amino acid sequence, and the fact that only a single insert had been made, was confirmed by dideoxy sequencing of pCRB/24.
  • pCRB/24 was digested with EcoRI and BamHI, and the 472 bp fragment containing the 3 ' end of the core gene was subcloned into the 31.01 bp vector fragment of EcoRI/BamHI-digested pT7T3/CHB to generate plasmid pCODM/24 (Fig.
  • p7.5 Fig. 2
  • pll Fig. 4
  • modified p7.5 promoter Fig. 6
  • a unique Xhol restriction site was created downstream of the p7.5 promoter in pGS53. This was done by linearizing pGS53 with BamHI, blunting the ends using Klenow treatment, setting up a ligation reaction in the presence of an excess of an Xhol linker of sequence 5' CCC TCG AGG G 3' (SEQ ID NO: 18) (New England Biolabs, cat. no. 1072), heating to denature, and religating. A fraction of this reaction was used to transform E. coli (DH5 ⁇ F'I Q ) , and minipreps of colonies were screened for the presence of a new Xhol site.
  • the plasmid thus created, pGS53X (Fig. 34) , contains two BamHI sites, one on each side of the Xhol site.
  • the 824 bp S fragment - was then excised from pT7T3/S by digestion with Hindlll and Kpnl followed by treatment with T4 DNA polymerase in the presence of deoxyribonucleotides. This treatment served to fill in overhanging 5 ' ends and remove overhanging 3 ' ends.
  • the 1251 bp MS fragment was excised from pT7T3/S2 by digestion with Kpnl and SphI followed again by T4 polymerase treatment.
  • the 1325 bp LS fragment was excised from pLEH-04 by digestion with Hindlll and EcoRI followed by filling in the overhanging 5' ends with the Klenow fragment of DNA polymerase I.
  • the ends of all three gel-purified fragments thus generated were made Xhol-compatible by addition of the Xhol linkers described above, which in this case had been phosphorylated using T4 polynucleotide kinase and standard procedures, followed by digestion with,Xhol. Each fragment was then subcloned into the 4704 bp Xhol-linearized and BAP-dephosphorylated pGS53X.
  • the single antigen expression vectors thus- created contained the S gene, pGS53/S (Fig. 35) , the MS gene, pGS53/S2 (Fig. 36) , or the LS gene, pGS53/Sl (Fig. 37), each under the control of the p7.5 promoter.
  • each insert was determined using conventional restriction mapping to be such that each open reading frame could be expressed from the p7.5 promoter. Specifically, the correct orientation of the insert was confirmed by Hindi digestion to yield restriction maps consistent with fragments from PGS53/S of 352 and 5186 bp, from pGS53/S2 of 514 and 5447 bp, and from pGS53/Sl of 321, 520 and 5202 bp.
  • the genes in these plasmids were engineered so that the 3 ' end of the p7.5 promoter in these vectors is within approximately 20 bp of the initiating ATG.
  • the expression cassette region is flanked by sequence from the vaccinia virus thymidine kinase gene. This thymidine kinase gene is contained in the Hindlll-J fragment of the vaccinia genome.
  • a similar series of constructs for expression of S, MS, and LS antigens individually directed by the modified p7.5 promoter and designed for insertion into the vaccinia TK gene was made as follows.
  • the S region from pT7T3/S and the LS region from pLEH-04 were amplified by polymerase chain reaction using techniques well known in the art (Erlich, H.A. , ed. , PCR Technology, Principles and Applications for DNA Amplification , M. Stockton Press, New York, 1989).
  • One primer used was of sequence 5' CTC ACT CGA GGG AAT AAG CT 3' (SEQ ID NO: 19), which hybridizes from bases -23 to -4 relative to the initiating ATG in both plasmids.
  • This primer contains a 2 bp change from the plasmid sequence, AA to CG at positions 7 and 8, which was designed to create an Xhol site (CTCGAG) upon amplification.
  • Another primer used 5' TTG TTA GGC CTT AAA TGT AT 3' (SEQ ID NO:20 " ), hybridizes at the carboxy-terminal end of the open reading frames in both of these plasmids (underlined nucleotides indicate position of termination codon TAA on the complementary strand) .
  • This primer contains a 2 bp change from the plasmid sequence, GT to CC at positions 9 and 10, designed to create a StuI site (AGGCCT) upon amplification.
  • the fragments generated by PCR of pT7T3/S and pLEH-04 with these primers are expected to be of sizes 714 and 1203 base pairs, respectively. These pieces were then digested with Xhol and StuI to remove the small fragments at either end, yielding fragments of size 699 and 1188 base pairs, respectively, which were purified from an agarose gel. These latter fragments were inserted into the 4026 bp vector fragment of Xhol and StuI double digested pSC59 so as to reconstruct Xhol and StuI sites at each end of the insert.
  • the S-containing construct named pHTL-8 (Fig. 3 ⁇ ) and the LS containing construct, pHTL-9 (Fig. 39) , each consist of the modified p7.5 promoter situated so as to direct expression of the HBV antigen located downstream.
  • a construct designed to allow expression of the MS antigen from the modified p7.5 promoter was made as follows.
  • a 998 bp EcoRI-StuI fragment of pT7T3/S2 was gel-purified and inserted into the 4032 bp EcoRI-StuI digested vector fragment of pSC59 so as to reconstruct the EcoRI and StuI sites at either end of the insert.
  • the resulting expression plasmid, pHTL-10 (Fig. 40) , contains the MS ORF located downstream of the modified p7.5 promoter. pHTL-10 contains the sequence "CCCATG" surrounding the ATG of preS2. According to M. Kozak (1989, J. Cell Biol.
  • Polymerase chain reaction may be used to modify the surroundings of the preS2 ATG in pHTL-10 or other constructs to match this consensus sequence, as follows, with the goal of shifting expression from S to MS.
  • a fragment of pHTL-10 containing the initiating ATG of preS2 was amplified by PCR, and by the proper choice of primers the sequence upstream of the ATG was made to match the consensus sequence described by Kozak.
  • One primer used was of the sequence 5' GAG CTC GGT ACC ACC ATG AAG TGG A 3' (SEQ ID NO:21), which hybridizes from bases -15 to +10 relative to the preS2 ATG and contains a Kpnl site (GGTACC) as well as the desired C to A change at position 13.
  • a second primer used in conjunction with this first primer is of sequence 5* GAG CAG GGG TCC TAG GAA TC 3' (SEQ ID NO:22).
  • This second primer hybridizes to the opposite strand from the first primer, from bases +204 to +185 relative to the preS2 ATG in pHTL-10, and contains an Avrll site (CCTAGG) .
  • the product of a PCR reaction using these primers was digested with Kpnl and Avrll, run on an agarose gel, and the 197 bp fragment containing the initiating ATG of MS was gel-purified. This fragment was cloned into 5 the 4833 bp gel-purified vector fragment of pHTL-10 generated by digestion with Kpnl and Avrll so as to retain both restriction sites. Dideoxy sequencing was used to confirm that the expected changes had been made upstream of the initiating ATG of preS2 in the
  • fusion polypeptides were expressed from the modified p7.5 promoter (Fig. 6).
  • the first step in generating core to S-region fusions was to subclone the full- __ length core gene downstream of this promoter. This was done by digesting pCODM/24 with PstI, treating with mung bean nuclease (New England Biolabs) to remove single-stranded overhangs according to the manufacturer's directions, and then digesting with
  • a vector was constructed to allow expression of a core-preSl fusion polypeptide (called core-preSl*, because only a portion of preSl is present) .
  • This core-preSl* fusion consists, starting at the amino terminus of the fusion protein, of amino acid residues 1 through 145 of core, a 3 amino acid spacer (ser-ala-cys) , amino acids 1 through 56 of preSl, and a 4 amino acid tail (arg-pro-thr-ser;
  • One primer used was of sequence- 5 * TCA CTA TCC GGA ATC AGC TT 3' (SEQ ID NO:23), which hybridizes from bases -22 to -3 relative to the ATG of preSl and is designed to introduce a BspEI site (TCCGGA) upon amplification and to destroy a potential termination codon (underlined C was changed from an A in pLEH-04) .
  • a second primer used was of sequence 5 • GGT GAA TTC TGG CCC GAA TG 3' (SEQ ID NO:24), which hybridizes to the opposite strand from bases +171 to +152 of the preSl region and is designed to create an EcoRI site (GAATTC) upon amplification.
  • the product of the PCR reaction was double digested with BspEI and EcoRI, and the 178 bp product was gel- purified and cloned into the 4483 bp BspEI and EcoRI double digested vector fragment of pHTL-25 in an orientation which recreated both the EcoRI and BspEI sites at the ends of the insert.
  • the resulting plasmid, pHTL-26 (Fig. 43) , consists of the modified p7.5 promoter oriented so as to drive expression of the core-preSl* fusion.
  • the nucleotide sequence (SEQ ID NO:25) and predicted amino acid sequence (SEQ ID NO:26) of the core-preSl* fusion made from pHTL-26 are shown in Figure 44.
  • a construct was made for expression of a fusion consisting, starting at the amino terminus of the fusion, of amino acid residues 1 through 144 of core, a one amino acid spacer (asp) , residues 1 through 55 of preS2, residues 1 through 8 of S, and a 4 amino acid tail (arg-pro-thr-ser; SEQ ID NO:56).
  • the preS2- and S-region insert in this construct was generated by polymerase chain reaction amplification of pLEH-04.
  • One primer used was of sequence 5 ' CAT CCT CCG GAC ATG CAG TG 3' (SEQ ID NO:27), hybridizes from base +313 of the preSl region to base +8 of preS2, and was designed to create a new BspEI site (TCCGGA) during amplification.
  • a second primer which was used in conjunction with this first primer was of sequence 5 ' GTC CTA GGA ATT CTG ATG TG 3' (SEQ ID NO:28), which hybridizes to the opposite strand from the first from bases +31 to +12 of the S region, and creates a new EcoRI site (GAATTC) during amplification.
  • the product of PCR of pLEH-04 using these primers was digested with EcoRI and BspEI, and the 190 bp fragment was gel- purified. This fragment was then cloned in a manner so as to regenerate EcoRI and BspEI sites at either end of the insert into the 4483 bp gel-purified vector fragment of pHTL-25 which- had been double digested with EcoRI and BspEI.
  • the resulting plasmid, pHTL-27 (Fig. 45) , is designed to allow expression of a core to preS2 fusion from the modified p7.5 promoter.
  • the nucleotide sequence (SEQ ID NO:29) and predicted amino acid sequence (SEQ ID NO:30) of the core-preS2 fusion made from pHTL-27 are shown in Figure 46.
  • a third construct of this type consisting from the amino terminus of amino acid residues 1 through 144 of core, a one amino acid spacer (asp) , residues 107 through 163 of the S antigen, and a 7 amino acid tail (asn-ser-gly-leu-leu-val-lys;
  • SEQ ID NO:57 was made in a similar manner.
  • This fusion polypeptide is referred to herein as core-S* because only a small portion of the S antigen, judged to be most important in terms of antigenicity, is present.
  • Hydrophilic stretches of the S antigen expected to contain antigenic determinants are located between residues 110 and 156 of S (Bhatnagar et al., 1982, Proc. Natl. Acad. Sci. USA 79:4400-4409) .
  • the nonapeptide sequence from 139 to 147 represents all or an essential part of the a determinant of HBsAg, the major epitope in S against which humans make antibodies after exposure to any subtype of the hepatitis B virus (id.) .
  • a 197- bp piece of the S region containing these immunogenic regions was generated by PCR amplification of pLEH-04 using primers 5' GTA TGT TTC CGG ATT GTC CT 3' (SEQ ID NO: 31), which hybridizes from bases +304 to +323 of the S region and was designed to generate a BspEI site (TCCGGA) upon amplification, and 5' TGA GGC CGA ATT CCA TAG GT 3' (SEQ ID NO:32), which hybridizes to the opposite strand from bases +500 to +481 of S and was designed to create an EcoRI site (GAATTC) upon amplification.
  • DUAL EXPRESSION VECTORS A number of constructs were made consisting of two promoters, divergently oriented and subcloned so as to be located within the vaccinia TK gene. Various antigens were then subcloned downstream of one or both of the promoters, with the goal of allowing expression of two non-fused antigens from a single vaccinia recombinant containing the integrated plasmid. The first step in one scheme for making these constructs was to delete the /5-galactosidase gene from pSCIO by digesting the plasmid with BamHI and religating the larger fragment. The resulting plasmid, pSClO ⁇ lacZ (Fig.
  • pDPV was modified to insert S downstream of the 11 kD promoter. This was done by cutting pDPV with Xhol and inserting the 834 bp S-containing Xhol fragment of pGS53/S into this 4811 bp linearized vector.
  • a vector, pRO-16 (Fig. 53) was constructed from pRO-10, allowing expression of the S antigen from the pll promoter and the core ⁇ 8 antigen from the p7.5 promoter. This was done by cutting pT7T3/CODM with Hindlll and EcoRI, filling in the overhanging 5' ends using the Klenow fragment of DNA polymerase I, and gel-purifying the 721 bp fragment containing the core ⁇ antigen. This fragment was then subcloned into the 5645 bp vector fragment of Smal-linearized pRO-10.
  • pRO-16 The orientation of the insert in the resulting plasmid, pRO-16, was determined to be such that the two promoters were oriented back-to-back; BamHI digestion yielded a restriction map consistent with fragments of 275 and 6091 bp.
  • pRO-10 was modified to insert the MS antigen downstream of p7.5 as follows. The 1257 bp MS fragment was removed from pT7T3/S2 by double digestion with Kpnl and Hindlll, blunting the ends of the fragment with T4 DNA polymerase, and gel-purifying the 1.2 kb fragment. This piece was then inserted into Smal-linearized, bacterial alkaline phosphatase (BAP) -treated pRO-10.
  • BAP alkaline phosphatase
  • pRO-11 contains the S and MS ORFs downstream of pll and p7.5, respectively.
  • the S fragment of pRO-11 was also replaced by core ⁇ . This was done by cutting pRO-11 with Xhol, blunting the ends of the pieces by Klenow treating, BAP-treating, and gel-purifying the vector fragment of 6072 bp. Into this blunt-ended vector was inserted the core ⁇ 8 fragment of pT7T3/CODM, generated by cutting pT7T3/CODM with Hindlll and EcoRI, blunting the ends with Klenow, and gel-purifying the 721 bp core-containing region. Orientation of the insert in the resulting plasmid, pRO-17 (Fig.
  • pRO-17 contains core ⁇ downstream of the 11 kD promoter and MS downstream of the 7.5 kD promoter.
  • a plasmid analogous to pRO-17 but containing the full-length core gene instead of core ⁇ was made in a manner identical to pRO-17, except that the 745 bp insert was cut from pCODM/24 instead of pT7T3/CODM. The same vector and restriction sites were used.
  • the orientation of the insert in the resulting plasmid, pRO-22 (Fig. 56) was determined to be such that full- length core should be expressed from the 11 kD promoter; BamHI digestion yielded a restriction map consistent with fragments of sizes 49, 654 and 6114 bp.
  • a vector was also created containing only the divergently oriented p7.5 and pll promoters by cutting pRO-10 with Xhol to excise the ⁇ 34 bp
  • pRO-12 (Fig. 57) contains only the p7.5 and pll promoters and no HBV antigens. This plasmid differs from pDPV in that it lacks the extra ATG downstream of the pll promoter which was removed in the course of making pRO-10 from pDPV-01.
  • a vector- was created consisting of the LS antigen inserted downstream of p7.5. This construct was made by cutting the LS antigen from pLEH-04 using a Hindlll and EcoRI double digest, filling in the overhanging 5' ends by Klenow treatment, and gel-purifying the 1329 bp fragment. This LS fragment was then subcloned into the 4811 bp vector fragment of Smal-digested, BAP-treated pRO-12. The orientation of the insert in the resulting plasmid, pRO-13B (Fig.
  • pRO-13B therefore consists of the pll and p7.5 promoters oriented back-to-back with the LS open reading frame positioned downstream of p7.5.
  • the core ⁇ S antigen was inserted downstream of pll in pRO-13B. This was done by digesting pT7T3/CODM with Hindlll and EcoRI, filling in the overhanging 5' ends with the Klenow fragment, and gel- purifying the 721 bp core ⁇ -containing fragment. This fragment was then subcloned into the 6144 bp Xhol- linearized vector pRO-13B which had been Klenow- and then BAP-treated. The orientation of the insert in the resulting plasmid, pRO-l ⁇ (Fig. 59) , was determined to be such that the core ⁇ open reading frame should be expressed from the 11 kD promoter; digestion with BamHI yielded a restriction map consistent with fragments of sizes 376, 654 and 5835 bp.
  • a vector featuring core ⁇ downstream of pll was made by cutting pRO-17 with Xbal to remove the 1496 bp region containing the pll promoter, core, and most of one-half of the vaccinia DNA, and cloning this piece into the 4040 bp Xbal-cut, BAP-treated vector fragment of pRO-12. Orientation of the insert in the resulting plasmid, pRO-19 (Fig. 60) , was determined to be such that the two promoters, p7.5 alone and pll - ⁇ i -
  • a plasmid analogous to pRO-19 containing the pll-full-length core antigen cassette was made by cutting pCODM/24 with Hindlll and EcoRI, blunting the ends by Klenow treatment, and gel-purifying the 745 bp fragment. This core-containing fragment was subcloned into the 4 ⁇ ll bp Xhol-linearized pRO-12 which had also been made blunt-ended by Klenow. The resulting plasmid features full-length core downstream of pll. Orientation of the insert in the resulting plasmid, pRO-19/24 (Fig. 61) , was determined to be such that the full-length core gene could be expressed from the 11 kD promoter; digestion with BamHI yielded a restriction map consistent with fragments of sizes 654 and 4906 bp.
  • pRO-19/24 was double digested with Xbal and EcoRI to excise the 893 bp fragment containing the pll-full-length core expression cassette. This fragment was gel-purified, the 5* overhanging ends filled in by Klenow fragment of DNA polymerase I, and the piece subcloned into the 4042 bp vector fragment of pSC59 which had been digested with Hindlll and treated with Klenow and BAP.
  • pHTL-5 contains the full-length core gene expressed from the pll promoter, and the modified p7.5 promoter without any antigen cloned downstream.
  • plasmids expressing S or LS from the modified p7.5 promoter and full-length core from the 11 kD promoter were made as follows.
  • the S region from pT7T3/S and. the LS region from pLEH-04 were removed by polymerase chain reaction using the same pair of primers.
  • One primer used was of sequence 5' CTC ACT CGA GGG AAT AAG CT 3' (SEQ ID NO: 36), and was designed to hybridize from bases -23 to -4 relative to the initiating ATG in each plasmid and to generate an Xhol site (CTCGAG) upon amplification.
  • a second primer used in conjunction with the first primer was of sequence 5 • TTG TTA GGC CTT AAA TGT AT 3' (SEQ ID NO:37), and was designed to hybridize to the opposite strand from the first primer from bases +1179 to +1160 relative to the ATG of LS in pLEH-04 and from bases +690 to +671 relative to the ATG of S in pT7T3/S, and to generate a StuI site (AGGCCT) upon amplification.
  • the fragments generated by PCR using these primers on pT7T3/S and pLEH-04 were of sizes 714 and 1203 base pairs, respectively.
  • a plasmid for expressing MS from the modified p7.5 promoter and core ⁇ from the pll promoter was made from pHTL-11.
  • a 649 bp Avrll-BspEI fragment of pHTL-11 containing the two promoters and the 5' end of each open reading frame was gel-purified and cloned into the 5742 bp Avrll-BspEI vector fragment of pRO-17 containing the 3 ' ends of MS and core ⁇ S.
  • the insert was made in such a way as to regenerate the Avrll and BspEI sites, and the resulting plasmid was called pHTL-12 (Fig. 66) .
  • the core ⁇ S antigen has replaced the wild-type core antigen which was present in pHTL-11.
  • pRO-16M (Fig. 67) , which consists of the core ⁇ antigen cloned downstream of the p7.5 promoter. This construct was planned so as to delete an out-of-frame ATG which is present 31 bp upstream of the correct initiating ATG of core ⁇ in pRO-16.
  • pR0-16M was made by linearizing pRO-12 with BamHI, which cuts downstream of the p7.5 promoter, blunting the ends with Klenow treatment, and then treating with BAP.
  • the 719 bp core ⁇ -containing insert was gel-purified from pHTL-12 which had been digested with PstI and then treated with mung bean nuclease.
  • pHTL-30 (Fig. 68) , consisting of MS expressed from the modified p7.5 promoter and core ⁇ 8
  • the p7.5-core ⁇ 8 cassette was excised from pRO-16M by PCR.
  • One primer used for this reaction was of sequence 5 ' GTG GGT AAG CTT CTC GAT GT 3' (SEQ ID NO:38) and is designed to hybridize from bases -230 to bases -211 relative to
  • a second primer used in combination with the first primer was of sequence 5* AGT TTC CAA GCT TAT GAG 3 ' (SEQ ID NO:39), and was designed to hybridize to the
  • pHTL-5 a variant of pRO-16 consisting of S expressed from the pll promoter and full-length 5 core, instead of core ⁇ , expressed from the p7.5 promoter was made. This was done by cutting pHTL-5 with BspEI and Sad to excise the 268 bp fragment coding for the carboxyl terminus of full-length core. This fragment was gel-purified and inserted into the 6123 bp vector fragment of pRO-16 which had been digested with BspEI and Sad and gel-purified. The orientation of the insert in the resulting plasmid, pHTL-13 (Fig. 69) , was determined, based on the recreation of the BspEI and Sad sites, to be such that the two promoters are divergently oriented.
  • pHTL-15 contains the S antigen cloned downstream of the modified p7.5 promoter and full- length core cloned downstream of the p7.5 promoter.
  • This plasmid was made by digesting pHTL-13 with Xbal and Sad to excise the fragment containing the p7.5- full-length core cassette. This fragment was gel purified, treated with mung bean nuclease, and the 1008 bp resulting fragment inserted into the 4729 bp vector fragment of pHTL-8 which had been linearized with Bell, Klenow filled, and BAP-treated.
  • Presence of and correct orientation of the insert in pHTL-15 was verified by digestion with PstI to yield a restriction map consistent with pieces of 2223 and 3514 bp.
  • This plasmid may be used for additional cloning; however, it is preferably not used for making recombinant vaccinia viruses because there is a segment of about 600 bp of vaccinia DNA between the two expression cassettes which may interfere with the recombination of both cassettes into the vaccinia genome. However, by deletion of this sequence, a plasmid useful for making recombinant viruses can be made.
  • pHTL-17 Fig. 71
  • This plasmid was made by digesting pHTL-13 with Xbal and Sad to excise the fragment containing the p7.5-full-length core cassette. This fragment was gel-purified, treated with mung bean nuclease, and the lOO ⁇ bp resulting fragment inserted into the 5034 bp vector fragment of pHTL-10 which had been linearized with Bell and Klenow filled.
  • Presence of the insert in pHTL-17 was verified by digestion with PstI, which yielded a restriction map consistent with pieces of sizes 1000, 2223, and 2 ⁇ l9 bp. Orientation of the insert was verified by this digest to be such that the two promoters are back-to-back.
  • This plasmid may be used for additional cloning; however, it is preferably not used for making recombinant vaccinia viruses because there is a segment of about 600 bp of vaccinia DNA between the two expression cassettes which may interfere with the recombination of both cassettes into the vaccinia genome. However, by deletion of this sequence, a plasmid useful for making recombinant viruses can be made.
  • pHTL-33 (Fig. 72) , consisting of full-length core cloned downstream of p7.5 and MS with the upregulated ATG cloned downstream of the modified p7.5 promoter.
  • This plasmid was made by polymerase chain reaction amplification of the p7.5-full-length core cassette out of pHTL-15 using primers of the sequence 5' CTC GAT GTC GAC TAG CCA TA 3' (SEQ ID NO:5 ⁇ ), which hybridizes to pHTL-15 from positions -237 to -218 relative to the ATG of core and the last four bases of which are part of an Ndel site .(CATATG) , and 5' AAG TTG TCG ACC TTA TGA GT 3' (SEQ ID NO:59), which hybridizes to the opposite strand from positions +587 to +568, downstream of the termination codon for full- length core, and which contains a Sail site (GTCGAC) .
  • GTCGAC Sail site
  • the product of the PCR reaction was digested with Sail and Ndel and the 798 bp fragment containing the core expression cassette was isolated from an agarose gel and cloned into the 5046 bp gel purified vector fragment of pHTL-30 which had been digested with Sail and Ndel. Presence of the insert and situation of the two cassettes in a back-to-back orientation in pHTL-33 was determined by digestion with Sail and Ndel to yield a restriction map consistent with fragments of sizes 798 and 5046 bp.
  • pHTL-34 (Fig. 73) , consisting of S expressed from the modified p7.5 promoter and full-length core expressed from the p7.5 promoter.
  • This plasmid was made by digesting pHTL-8 with Xhol and Clal and gel purifying the 767 bp fragment containing the S antigen. This fragment was cloned into the gel purified 4772 bp vector fragment of pHTL-33 which had also been digested with Xhol/Clal. Presence and correct orientation of the insert in pHTL-34 were verified by digestion of the plasmid with Xhol/Clal to yield a restriction map consistent with fragments of 767 and 4772 bp.
  • pHTL-35 (Fig. 74-) ,-- consisting of LS expressed from the modified p7.5 promoter and full-length core expressed from the p7.5 promoter.
  • This plasmid was made by gel purifying the 1256 bp Xhol/Clal fragment of pHTL-9 containing the LS antigen and inserting it into the 4772 bp vector fragment of pHTL-33 which had also been digested with Xhol/Clal. Presence and correct orientation of the insert in pHTL-35 were verified by digestion of the plasmid with Xhol and Clal to yield a restriction map consistent with fragments of 1256 and 4772 bp.
  • PreSl-core fusions included only the preSl region of the LS antigen (i.e., lacking the preS2 and S regions) fused to one of the two types of core (full length or core ⁇ ) .
  • pPB-05 (Fig. 76) contains the preSl-encoding region fused to the core ⁇ gene, with preSl constituting the amino terminus of the resulting fusion protein.
  • pPB-09 (Fig. 77) contains the preSl-encoding region fused to the full-length core gene in the same orientation.
  • Both of these constructs consist of inserts into the standard cloning vector, pT7T31 ⁇ , so that the open reading frames are flanked by restriction endonuclease sites and can be further manipulated into expression vectors as needed.
  • the core ⁇ open reading frame was cloned by polymerase chain reaction amplification from pT7T3/CODM.
  • the primers used to accomplish this were of sequence 5 • GCG CCA TGG ACA TTG ACC CTT ATA 3' (SEQ ID N0:40), which hybridizes from bases -5 to +19 relative to the initiating ATG of core ⁇ , and 5 ' CCC TGA TCA CTA ACA TTG AGA TTC CCG A 3' (SEQ ID N0:41), which hybridizes to the opposite strand from bases +543 to +516 relative to the ATG.
  • These primers were designed to generate a new Ncol site (CCATGG) at the 5' end and a new Bell site
  • pET-3d a vector for bacterial expression of cloned inserts from the T7 promoter (Studier et al., 1990, Meth. Enzymol. 185:60-69).
  • pET system vectors were obtained from Novagen, Inc. (Madison, WI) ; and cut with Ncol and BamHI (compatible with Bell) .
  • the resulting plasmid, pT7/core (Fig. 79) , contains the core ⁇ ORF cloned downstream of the T7 promoter. Restriction mapping was used to determine that the insert in pT7/core had been made so as to retain the Ncol site at the 5 ' end of the ORF encoding the amino terminus.
  • Plasmid pT7/core was then transformed into a derivative of E . coli strain BL21 (F _ ompT r B - mB -) containing the DE3 lysogen.
  • DE3 is a lambda derivative that carries in the int gene a DNA fragment containing the lad gene, the lacUV5 promoter, the beginning of the lacZ gene, and the gene for T7 RNA polymerase.
  • the lacUV5 promoter is inducible by isopropyl- ⁇ -D-thiogalactopyranoside (IPTG) , such that addition of IPTG to a growing culture of this lysogen induces T7 RNA polymerase (Studier et al., supra) .
  • IPTG isopropyl- ⁇ -D-thiogalactopyranoside
  • the BL21(DE3) lysogen was transformed with pT7/core, and host cells carrying the recombinant pT7/core plasmid were grown in 1 liter of LB broth at 37 * C. Core ⁇ synthesis was induced by the addition of 0.4 mM IPTG, so that the core ⁇ gene was expressed from the T7 promoter in pT7/core.
  • This induced culture was harvested, and the core ⁇ antigen, which is expressed intracellularly, was partially purified.
  • Induced bacterial cells were harvested by low speed centrifugation and resuspended in 20 ml per liter of culture modified lysis and sonication (L&S-l) buffer (50 mM Tris pH ⁇ .0, 10 mM EDTA, 10 mM dithioerythritol (DTT) , 1 mM phenyl ethylsulfonyl fluoride (PMSF) , 0.25 mg/ml lysozyme, 4 mg of deoxycholate (DOC) per gram of cells) .
  • L&S-l culture modified lysis and sonication
  • the cell suspension was sonicated three times (Braun-Sonic 2000, half-max. high, 10 seconds) and then centrifuged at 12,000 x g for 40 min at 4°C.
  • the supernatant was then treated with 30% ammonium sulfate, stirred for 1 hour at 4°C, and centrifuged at 12,000 x g for 40 min.
  • Ammonium sulfate was then added to the supernatant to 40%. This mixture was stirred for 1 hour at 4°C and centrifuged at 12,000 x g for 40 min.
  • the precipitated pellet was then resuspended in 6 M urea, 50 mM Tris pH 8.0, 10 mM EDTA, 10 mM DTT, 1 mM PMSF buffer to a protein concentration of 3 mg/ml.
  • This dissolved solution was loaded onto a sizing column (Bio-Rad A1.5, 2.5 x 100 cm) , equilibrated and eluted with the same buffer.
  • a protein profile of the eluted fractions was obtained by absorbance at 280 nm, or by a micro protein assay (Bio-Rad) .
  • One major peak containing core ⁇ peptide was observed. Fractions containing this peak were pooled and dialyzed against Tris/saline (10 mM Tris, 0.15 M NaCl) , pH 7.5.
  • pPB-05 the preSl-core ⁇ 8 fusion vector
  • pT7/core was digested with Xbal and Hindlll to excise the 1056 bp core ⁇ -containing piece, and this piece was subcloned into the 2659 bp vector backbone of PT7T318 which had been digested with Xbal and Hindlll so as to reconstruct the Xbal and Hindlll sites.
  • the resulting plasmid, pPB-04 (Fig. 80) , contains the core ⁇ S antigen surrounded on either end by restriction sites.
  • the preSl region was cloned by PCR out of pRO-02.
  • the primers used for this purpose were of sequence 5' ATT CTC GAG GGC ATG GGG ACG 3' (SEQ ID NO:42), which hybridizes from bases -12 to +9 relative to the initiating ATG of preSl, and 5* ACT CCA TGG CCT GAG GAT GA 3' (SEQ ID NO:43), which hybridizes to the opposite strand from bases +331 to +312 relative to the ATG.
  • These primers were designed to generate Xhol (CTCGAG) and Ncol (CCATGG) sites at the amino and carboxyl termini, respectively, of the 343 bp amplified preSl ORF.
  • the reaction mixture generated by PCR was digested by Xhol, the ends filled in using the Klenow fragment of DNA polymerase I, and the DNA cut by Ncol.
  • the resulting 333 bp fragment containing the preSl region was gel-purified and cloned into the 3865 bp vector fragment of pPB-04 which had been cut at Smal in the polylinker region at the 5 • end of core ⁇ and at Ncol at the initiating ATG of the core ⁇ antigen.
  • pPB-05 contains a fused preSl-core ⁇ open reading , frame surrounded by restriction sites.
  • the nucleotide sequence (SEQ ID NO:44) and predicted amino acid sequence (SEQ ID NO:45) of the preSl-core ⁇ fusion region in pPB-05 are shown in Figure 81.
  • pPB-05 From pPB-05.was made an expression plasmid, pRO-21 (Fig. 82) , containing the MS antigen expressed from the p7.5 promoter and the preSl-core ⁇ S antigen expressed from the pll promoter.
  • pPB-05 was digested with EcoRI and Hindlll to excise the preSl-core ⁇ S-containing fragment and this fragment was made blunt-ended by Klenow treatment.
  • This 1370 bp insert containing the preSl-core ⁇ 8 fusion was gel- purified and inserted into the 6072 bp Xhol vector fragment of pRO-11 which had been Klenow-blunted and dephosphorylated by BAP treatment.
  • pPB-09 the plasmid containing the preSl-full-length core fusion, was constructed by first amplifying the full-length core antigen from pCODM/24 by PCR.
  • the primers used for this purpose were of sequence 5 ' GCG CCA TGG ACA TTG ACC CTT ATA 3 ' (SEQ ID NO:46), which hybridizes from bases -5 to +19 relative to the initiating ATG of core, and 5' AGT GAA GCT TCC CAC CTT 3' (SEQ ID NO:47), which hybridizes to the opposite strand from bases +592 to +575 relative to the full-length core ATG.
  • These primers were designed to generate Ncol (CCATGG) and Hindlll (AAGCTT) sites at the N-terminal and C-terminal ends of core, respectively, upon amplification.
  • the resulting reaction mixture was digested with Ncol and Hindlll.
  • the 584 bp core-containing piece was then gel-purified and inserted into the 3181 bp gel- purified vector backbone of pPB-05 from which the core ⁇ open reading frame had been removed by Ncol/Hindlll digestion. Restriction mapping was used to verify that the insert in the resulting plasmid, pPB-09, was oriented so as to reconstruct both the Ncol and Hindlll sites. This process had the effect of switching the full-length core antigen for core ⁇ .
  • the nucleotide sequence (SEQ ID N0:4 ⁇ ) and predicted amino acid sequence (SEQ ID NO:49) of the preSl-full- length core fusion in pPB-09 are shown in Figure ⁇ 3.
  • pRO-23 An analogous construct to pRO-21 in which the full-length core antigen was substituted for the core ⁇ antigen was made from pPB-09 and called pRO-23 (Fig. 84).
  • the preSl-full-length core insert was purified from pPB-09 by digesting pPB-09 with EcoRI and Hindlll, and using Klenow fragment to blunt the ends. This 937 bp fragment was gel-purified and subcloned into the 6072 bp vector fragment of pRO-11 which had been digested with Xhol and the ends filled by Klenow.
  • pRO-23 The correct orientation of the insert in the resulting plasmid, pRO-23, was verified to be such as to allow expression of the fusion from the pll promoter; digestion with BamHI yielded a restriction map consistent with fragments of 49, 966 and 5994 base pairs.
  • pRO-23 therefore, consists of MS downstream of the p7.5 promoter and the preSl-full- length core antigen fusion downstream of the pll promoter.
  • a plasmid was made for the expression of the preSl-core ⁇ 8 fusion from the 11 kD promoter. This was done by isolating the 1365 bp
  • a similar plasmid allowing expression of the preSl-full-length-core antigen from the pll promoter was constructed from pHTL-23. This was done by cutting pHTL-5 with Sad, treating with mung bean nuclease to blunt the overhanging ends, and then cutting with Bglll and isolating the 611 bp fragment of pHTL-5 containing the 3 ' end encoding the carboxyl terminus of the full-length core antigen.
  • This insert was then ligated into the 4785 bp vector fragment of pHTL-23 which had been digested with Nhel, mung bean and BAP-treated, and then digested with Bglll to excise the 3 • end encoding the carboxyl terminus of the core ⁇ S antigen.
  • the orientation of the insert in the resulting plasmid, pHTL-24 (Fig. 86) was verified to be such that the preSl-full-length-core antigen could be expressed from the pll promoter; digestion with Bglll and StuI yielded a restriction pattern consistent with fragments of 617 and 4779 bp .
  • plasmid pHTL-18 (Fig. ⁇ 7) , which was made from pRO-23, contains the MS ORF downstream of the modified p7.5 promoter and the preSl-full- length core fusion ORF downstream of the p7.5 promoter.
  • This plasmid was made by isolating a 763 bp fragment containing preSl fused to the 5' end of the full-length core gene generated by cutting pRO-23 with
  • This gel-purified insert was then inserted into the 5579 bp vector fragment of pHTL-17 made by cutting with SphI, blunting with mung bean nuclease, and then digesting with BspEI. Orientation of the insert was determined by restriction mapping to be such that the BspEI site near the 3 ' end of full-length core had been regenerated.
  • This plasmid contains an insertion of vaccinia DNA between the two promoters and as such is difficult to use to make recombinant viruses, but it is useful for cloning purposes. The region between the two promoters can be deleted to make a plasmid which can be used to generate recombinant viruses.
  • pHTL-14 (Fig. ⁇ ) , consisting of the MS antigen downstream of the modified p7.5 promoter, and the preSl-core ⁇ fusion downstream of the p7.5 promoter.
  • the 819 bp core antigen region was isolated from pRO-21 by digestion with Nhel, Klenow blunting and Ncol digestion. This fragment was then gel-purified and inserted into the 5290 bp vector fragment of pHTL-18 which had been digested with PvuII and Ncol.
  • the orientation of the insert in pHTL-14 was verified by restriction mapping to be such that the Ncol site at the junction of the preSl and core ORFs had been regenerated.
  • pHTL-14 contains a region of vaccinia DNA between the two promoters. This region should be deleted, and a larger region of the vaccinia TK gene inserted downstream of the preSl-core ⁇ 8 ORF, in order to use the plasmid for generation of recombinant virus. However, even without these changes, pHTL-14 is useful for cloning purposes.
  • pHTL-14 From pHTL-14, was made an additional plasmid, pHTL-31 (Fig. 89) , consisting of MS with the upregulated ATG as described for pHTL-lOM above, expressed from the modified p7.5 promoter, and the preSl-core ⁇ fusion expressed from the p7.5 promoter.
  • pHTL-14 was digested with Ndel and BspEI to isolate the region containing p7.5-preSl and the 5' end of core ⁇ . This 949 bp fragment was gel-purified and inserted into the 5174 bp vector fragment of pHTL-30 which had also been digested with Ndel and BspEI and gel-purified. The insertion in pHTL-31 was made so as to recreate both the Ndel and the BspEI sites.
  • pHTL-32 (Fig. 90) , consisting of the preSl-core ⁇ antigen expressed from the p7.5 promoter and the modified p7.5 promoter with no antigen downstream.
  • This plasmid was made by digesting pHTL-31 with Xhol and StuI, Klenow filling, gel-purifying the 5121 bp vector fragment from which the MS gene had been deleted, and self-ligating this plasmid to reclose the circle.
  • pHTL-36 (Fig. 75) , which is an analog of pHTL-31 in which full-length core has been substituted for core ⁇ .
  • the plasmid pHTL-36 therefore, consists of MS with the upregulated ATG expressed from the modified p7.5 promoter and the fusion preSl-full- length core expressed from the p7.5 promoter.
  • This plasmid was made by digesting pHTL-33 with BspEI and Sail and gel purifying the 149 bp fragment containing the 3' end of the full-length core antigen.
  • This fragment was inserted into the 5995 bp vector fragment of pHTL-31 which had been digested with BspEI and Sail as well. Presence and correct orientation of the insert in pHTL-36 were verified by digestion of the plasmid with BspEI and Sail to yield a restriction map consistent with fragments of sizes 149 and 5995 bp.
  • Recombinant vaccinia viruses for vaccine use, were made by infecting Vero cells (ATCC Accession No. CCL 81) with wild-type vaccinia virus (New York City Department of Health Laboratories vaccine strain, prepared by Wyeth) , and subsequently transfecting the infected cells with a plasmid containing the genes to be inserted flanked by sequences of the vaccinia TK gene, within which homologous recombination occurred. Transfections were performed by one of several methods described in Section 5.3, supra . Recombinant viruses were selected by plating on Rat2 cells (ATCC Accession No. CRL 1764) in the presence of BUDR.
  • Each recombinant was purified by three rounds of purification from a single viral plaque, and the identity and purity of each viral stock were verified by commercially available immunoassays for S and e (Abbott Laboratories) , and by Southern and western analyses as described in sections below.
  • a conventional Southern blotting procedure (Southern, 1975, J. Moi. Biol. 98:503) was used to verify the identity and purity of the recombinant viruses which had been plaque-purified. Viral and cellular DNA was isolated using a miniprep procedure from a 100 mm dish of infected host cells.
  • the tubes were vortexed and incubated on ice for 10 minutes with occasional vortexing. Tubes were then spun 800 x g 3 minutes to remove cellular material, the supernatant was transferred to a fresh tube and spun 16,000 x g for 10 minutes to pellet viral cores. The pellet of this second spin was resuspended in 100 ⁇ l TE (10 mM Tris, 1 mM EDTA, pH 8.0) and the following were added: 1.5 ⁇ l 10 mg/ml proteinase K, 6.7 ⁇ l 3 M NaCl, 10 ⁇ l 10% SDS, and 0.3 ⁇ l /3-mercaptoethanol. Tubes were mixed gently and incubated 30 minutes at 55 ' C .
  • the blot was washed and the hybridized probe visualized. Specifically, an alkaline phosphatase-conjugated antibody to digoxigenin was added and a chemiluminescent alkaline phosphate substrate (Lumiphos, Boehringer Mannheim, Indianapolis, IN) was used to visualize the bound antibody on X-ray film.
  • a chemiluminescent alkaline phosphate substrate Liphos, Boehringer Mannheim, Indianapolis, IN
  • DNA from recombinant viruses was analyzed for hybridization to probes for the S, preS2, preSl, and core regions, made by techniques analogous to those described supra , from plasmids described supra or others; the identity of the recombinants was thus * verified.
  • a probe hybridizing within the TK gene of vaccinia virus was also used in assessing the identity and purity of recombinants. Such a probe was made by cutting pGS53 with Xbal and EcoRI to excise the TK region, gel-purifying the 630 bp fragment, and labeling this fragment as described supra . Contamination with wild-type vaccinia virus is ruled out by hybridization with such a TK-specific probe, which gives a unique banding pattern for each recombinant or wild-type virus.
  • proteins expressed transiently from recombinant plasmids in infected cells were isolated.
  • the procedure for harvesting samples from recombinant-infected cells was as follows. Infected cells were scraped off a 100 mm dish into a 15 ml centrifuge tube, collected by centrifugation, washed with IX PBS, resuspended in 1 ml IX PBS, and disrupted by 3 cycles of freeze/thaw.
  • the separated proteins were transferred (Protean II apparatus and Trans-blot Cell, BIORAD Laboratories, Richmond, CA) to nitrocellulose (Schleicher & Schuell, Keene, NH) at 70 V for 2 hours in 25 mM Tris pH ⁇ .3, 192 mM glycine, 20% methanol.
  • the membrane containing the transferred proteins was blocked with blocking buffer (2% nonfat dry milk in H 2 0) for 1 hour at room temperature and then incubated overnight at room temperature in 25 ml blocking buffer containing 1/250 rabbit anti-HBsAg polyclonal antibody (cat. no. KM63P, Accurate Chemical & Scientific Corp., Westbury, NY) .
  • the blot was then washed 3 X 10 minutes in 0.1% Tween 20, 100 mM Tris pH 7.5, 1.5 M NaCl, 0.02% JJaN 3 .
  • a goat anti-rabbit IgG alkaline phosphatase-conjugated second antibody cat. no.
  • HBV-specific antibody present in test serum was quantified by interpolation from a standard curve established using serial dilutions of a monoclonal antibody of known titer specific for HBV S, preSl, preS2 , or core regions.
  • Microtiter plates were coated with purified wild-type vaccinia virus, core protein, plasma-derived
  • HBsAg a synthetic peptide derived from preSl, or a synthetic peptide derived from preS2.
  • the microtiter plates were rinsed with water and then blocked with non-fat milk. Plates were then washed with a Tris buffer (10 mM Tris pH 7.5,
  • Tris/saline (10 mM Tris pH 7.5, 150 mM NaCl) plus 1% fetal bovine serum. The reaction was allowed to proceed for 90 minutes at 37 °C, and the plates were washed to remove unbound antibody. Antigen-bound antibody was detected by the addition of polyclonal goat anti-mouse antibody conjugated with alkaline phosphatase. After incubation for 60 minutes at 37 'C, the plates were washed to remove unbound conjugate and the color reaction was developed. After 15 to 30 minutes, dilute sodium hydroxide was added to stop the reaction and the absorbance at 405 nm was read in ari ELISA photometer. The best-fit polynomial equation was calculated for the standards for each assay, and this curve was then used to solve for the concentration of antibody associated with each OD 405 value for the mouse serum samples.
  • mice are often used in initial attempts to assess the immunogenicity of potential vaccines.
  • the immune response of mice to the hepatitis B surface antigens is known to vary depending on the H-2 haplotype of the strain (Milich et al., 1984, J. Exp. Med. 159:41; Milich et al. , 1985, Proc. Natl. Acad. Sci. USA 82: ⁇ l6 ⁇ ).
  • haplotype the response of mice to hepatitis B antigens when expressed from vaccinia virus. We therefore performed an experiment to assess the importance of the mouse strain and dose used.
  • mice of either C57BL/6 or BALB/c strain were inoculated intraperitoneally with 0.5 ml of a 1:1 mixture of recombinant viruses made from pGS53/S2 and pRO-l ⁇ .
  • the combination of these two viruses should result in the expression of all of the following epitopes: core, preSl, preS2, and S; other combinations of viruses could also have been used.
  • Total doses of recombinant vaccinia virus of 1 X 10 7 or 1 X 10 8 plaque forming units (pfu, as determined by titration on Vero cells) were tested in two separate groups (all groups had 10 mice) . Two groups of control animals received equivalent doses of wild-type virus.
  • mice were bled weekly for 16 weeks and pooled sera from each group were tested for antibodies to the S and core antigens using the immunoassays described in example Section ⁇ .3, above.
  • Anti-vaccinia responses were seen in all vaccinia-inoculated mice. Strong anti-S responses were seen in both groups of mice which received the mixture of recombinants at 1 X 10 8 pfu, with the response in the BALB/c mice comparable to that generated in response to 1 ⁇ g of the Merck Recombivax vaccine, and the anti-S response in the C57BL/6 slightly lower in magnitude.
  • Anti-core responses were seen in both groups of mice which had been inoculated with the recombinant viruses at 1 X 10 8 , as well.
  • Anti-preS2 and weak anti-preSl responses were seen in the BALB/c mice at 1 X 10 8 pfu of recombinant virus mixture, as well. Based on this experiment, BALB/c mice were chosen as the better strain in which to pursue further immunogenicity studies. It is also desirable to test the ability of the viruses described supra to overcome nonresponsiveness to S in mouse strains which are genetic S-nonresponders (for example the H-2 S haplotype) . Since no suitable congenic strain to BALB/c with an H-2 S haplotype was readily available, an additional experiment testing the dose response of A.BY mice (H-2 b ) was undertaken.
  • mice for which a suitable H-2 S congenic is available (A.SW) were tested for tolerance of vaccinia virus and for antibody response to the S-expressing recombinant virus made from pGS53/S at doses of 5 x 10 8 and 1 x 10 9 pfu. A good anti-S response was observed at both doses, so that this strain can be used to test the ability of recombinant viruses to overcome S-nonresponsiveness in mice.
  • A.SW H-2 S congenic is available
  • mice Once a mouse strain and dose of virus have been chosen, the immunogenicity of a number of individual viruses and combinations of viruses are compared in mice. The goal is to discover the combination of antigens which gives the best immune response to all the regions (core, preSl, preS2, and S) .
  • the viruses/combinations of viruses that are tested are as follows (other combinations can also be used; the ratio of one virus to the other can be varied to change the ratio of antigens expressed in each candidate vaccine) . Doses of vaccinia virus in the total range of 10 8 to 10 9 total pfu are tested.
  • Group 1 receives a mixture of viruses (1:1 or other) made from pRO-18 (containing promoter-antigen combinations p7.5-LS & pll-core ⁇ ) and pGS53/S2 (p7.5-MS).
  • Group 2 receives a virus made from pHTL-30 (p7.5-core ⁇ & modified p7.5-MS), and group 3 receives a virus made from pHTL-31 (p7.5-preSl-core ⁇ and modified p7.5-MS) .
  • Group 4 receives a mixture of viruses made from pHTL-26 (modified p7.5-core-preSl*) , pHTL-27 (modified p7.5-core-preS2) , and pHTL- ⁇ (modified p7.5-S) .
  • Group 5 receives a mixture of viruses made from pHTL-26 and pHTL-lOM (modified p7.5-MS) .
  • Group 6 receives a mixture of viruses made from pHTL-27 and pHTL- ⁇ .
  • Group 7 receives a virus made from pHTL-35 (modified p7.5-LS and p7.5-full- length core) .
  • Control groups receive viruses from plasmids pHTL-32 (p7.5-preSl-core ⁇ ) , pHTL-lOM, pHTL- ⁇ , and pSCIO (pll-3-galactosidase) , respectively.
  • Additional control groups separately receive peptides, such as those described for preSl and preS2 in Example 8.3, above, (or in the case of S, the S-only vaccine, Merck's Recombivax, the whole S protein) corresponding to the immunodominant epitopes of S, preS2, preSl, and core in the presence of adjuvant such as alum.
  • the immune response of the mice to these various combinations of antigens are assessed by use of the immunoassays described above.
  • One or several viruses or combinations of viruses are chosen for further study based on the strength of the anti-HBV immune response which they generate. Further analysis can include testing in strains of mice which are known to lack the ability to produce an antibody response to S antigen by itself (H-2 S mice) , to see if the addition of other HBV epitopes such as preSl, preS2 and core can overcome S-nonresponsiveness in these mice.
  • H-2 S mice H-2 S mice
  • These same viruses can be analyzed in chimpanzees for the ability to protect the animals from challenge with hepatitis B virus.
  • a vaccine which proves efficacious in chimpanzees can be tested in human clinical trials.
  • Three plasmid insertion vectors containing HBV sequences flanked by vaccinia non-coding regions were constructed, for targeting insertion into the F14L-F15L, C12L-C11R, and A53R-A55R regions of the vaccinia genome, respectively.
  • regions F14L-F15L and C12L-C11R, respectively were used in attempts to generate recombinant vaccinia viruses, no recombinants were obtained out of 10,000 viruses screened (using the blue-white screening method based on -galactoside expression) . These recombinants would have been identifiable because they form blue plaques when overlaid with agarose containing X-gal.
  • MOLECULE TYPE DNA
  • ATC TCT CCA CCT CTA AGA GAC AGT CAT CCT CAG GCC ATG CAG TGG AAC 336 lie Ser Pro Pro Leu Arg Asp Ser His Pro Gin Ala Met Gin Trp Asn 100 105 110
  • AAT ATT GCC TCT CAC ATC TCG TCA ATC TCC GCG AGG ACT GGG GAC CCT 480 Asn lie Ala Ser His lie Ser Ser lie Ser Ala Arg Thr Gly Asp Pro 145 150 155 160
  • MOLECULE TYPE protein
  • GTA AAC CCT GCT CCG AAT ATT GCC TCT CAC ATC TCG TCA ATC TCC GCG 576 Val Asn Pro Ala Pro Asn He Ala Ser His He Ser Ser Ala 180 185 190

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

La présente invention se rapporte à des virus de la vaccine recombinés qui peuvent exprimer une pluralité d'épitopes immunogéniques du virus de l'hépatite B (HBV) comprenant au moins un épitope de l'antigène capsidique, au moins un épitope de l'antigène de surface, ou n'importe quelle combinaison de ceux-ci. Les virus préférés contenant plusieurs antigènes du HBV comprennent de façon nonexhaustive, une combinaison de l'un de S, MS, LS, et du capside pleine longueur, du capsideΔ8 (un mutant de délétion du capside), preS1-capsideΔ8, pre-S1-capside complet, capside-preS1*, capside-preS2, ou capside-S* (les astérisques indiquant la présence d'un fragment immunogénique de l'antigène précédent; les traits d'union indiquant une protéine de fusion). Comme illustré dans la figure, les épitopes de l'antigène capsidique et/ou de surface peuvent être exprimés par le même virus de recombinaison, sous le contrôle de différents promoteurs actifs dans le virus de la vaccine.
PCT/US1993/011474 1992-11-25 1993-11-24 Vaccins contre le virus de l'hepatite b WO1994012617A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56793/94A AU5679394A (en) 1992-11-25 1993-11-24 Hepatitis b virus vaccines

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US98221192A 1992-11-25 1992-11-25
US982,211 1992-11-25

Publications (1)

Publication Number Publication Date
WO1994012617A1 true WO1994012617A1 (fr) 1994-06-09

Family

ID=25528946

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/011474 WO1994012617A1 (fr) 1992-11-25 1993-11-24 Vaccins contre le virus de l'hepatite b

Country Status (2)

Country Link
AU (1) AU5679394A (fr)
WO (1) WO1994012617A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000028009A1 (fr) * 1998-11-11 2000-05-18 Melbourne Health Compositions biologiques, leurs constituants et leurs applications
WO2000032229A1 (fr) * 1998-12-02 2000-06-08 Centro De Ingenieria Genetica Y Biotecnologia (Cigb) Preparations renfermant des particules immunostimulantes de type virus administrees par voie muqueuse
CN1063756C (zh) * 1997-10-06 2001-03-28 中国科学院上海生物化学研究所 同时含有乙肝病毒和丙肝病毒核心抗原的双重抗原
WO2001049828A1 (fr) * 2000-01-06 2001-07-12 Institut National De La Sante Et De La Recherche Medicale (I.N.S.E.R.M.) Virus mute de l'hepatite b, ses constituants nucleiques et proteiques et leurs applications
CN102233136A (zh) * 2010-04-30 2011-11-09 北京凯因科技股份有限公司 一种用于治疗乙肝的重组质粒疫苗及其组合物
CN102233137A (zh) * 2010-04-30 2011-11-09 北京凯因科技股份有限公司 一种用于治疗乙型肝炎的重组质粒dna疫苗组合物
US8138318B2 (en) * 2007-09-13 2012-03-20 Abbott Laboratories Hepatitis B pre-S2 nucleic acid
EP3266464A3 (fr) * 2011-02-12 2018-03-14 Globeimmune, Inc. Thérapeutique à base de levure pour infection chronique par l'hépatite b
CN112521492A (zh) * 2020-12-18 2021-03-19 杭州贤至生物科技有限公司 乙肝表面抗原单克隆抗体的制备
US11278607B2 (en) 2016-01-08 2022-03-22 Geovax, Inc. Compositions and methods for generating an immune response to a tumor associated antigen
US11311612B2 (en) 2017-09-19 2022-04-26 Geovax, Inc. Compositions and methods for generating an immune response to treat or prevent malaria

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NATURE, Volume 311, issued August 1984, B. MOSS et al., "Live Recombinant Vaccinia Virus Protects Chimpanzees Against Hepatitis B", pages 67-69. *
VETERINARY PARASITOLOGY, Volume 29, issued 1988, D.E. HRUBY, "Present and Future Applications of Vaccinia Virus as a Vector", pages 281-292. *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1063756C (zh) * 1997-10-06 2001-03-28 中国科学院上海生物化学研究所 同时含有乙肝病毒和丙肝病毒核心抗原的双重抗原
WO2000028009A1 (fr) * 1998-11-11 2000-05-18 Melbourne Health Compositions biologiques, leurs constituants et leurs applications
WO2000032229A1 (fr) * 1998-12-02 2000-06-08 Centro De Ingenieria Genetica Y Biotecnologia (Cigb) Preparations renfermant des particules immunostimulantes de type virus administrees par voie muqueuse
US7374766B1 (en) 1998-12-02 2008-05-20 Centro De Ingenieria Genetic Y Biotechnologia Compositions containing virus-like particles as immunopotentiators administered through the mucosa
WO2001049828A1 (fr) * 2000-01-06 2001-07-12 Institut National De La Sante Et De La Recherche Medicale (I.N.S.E.R.M.) Virus mute de l'hepatite b, ses constituants nucleiques et proteiques et leurs applications
FR2803599A1 (fr) * 2000-01-06 2001-07-13 Inst Nat Sante Rech Med Nouveau virus mute de l'hepatite b, ses constituants nucleiques et proteiques et leurs applications
US8138318B2 (en) * 2007-09-13 2012-03-20 Abbott Laboratories Hepatitis B pre-S2 nucleic acid
CN102233137A (zh) * 2010-04-30 2011-11-09 北京凯因科技股份有限公司 一种用于治疗乙型肝炎的重组质粒dna疫苗组合物
CN102233136A (zh) * 2010-04-30 2011-11-09 北京凯因科技股份有限公司 一种用于治疗乙肝的重组质粒疫苗及其组合物
EP3266464A3 (fr) * 2011-02-12 2018-03-14 Globeimmune, Inc. Thérapeutique à base de levure pour infection chronique par l'hépatite b
US9943591B2 (en) 2011-02-12 2018-04-17 Globeimmune, Inc. Compositions and methods for the treatment or prevention of hepatitis B virus infection
AU2016256751B2 (en) * 2011-02-12 2018-06-14 Globeimmune, Inc. Yeast-based therapeutic for chronic hepatitis B infection
US10441650B2 (en) 2011-02-12 2019-10-15 Globeimmune, Inc. Compositions and methods for the treatment or prevention of hepatitis B virus infection
US11278607B2 (en) 2016-01-08 2022-03-22 Geovax, Inc. Compositions and methods for generating an immune response to a tumor associated antigen
US11413341B2 (en) 2016-01-08 2022-08-16 Geovax, Inc. Vaccinia viral vectors encoding chimeric virus like particles
US11311612B2 (en) 2017-09-19 2022-04-26 Geovax, Inc. Compositions and methods for generating an immune response to treat or prevent malaria
US11857611B2 (en) 2017-09-19 2024-01-02 Geovax, Inc. Compositions and methods for generating an immune response to treat or prevent malaria
CN112521492A (zh) * 2020-12-18 2021-03-19 杭州贤至生物科技有限公司 乙肝表面抗原单克隆抗体的制备
CN112521492B (zh) * 2020-12-18 2022-05-20 杭州贤至生物科技有限公司 乙肝表面抗原单克隆抗体的制备

Also Published As

Publication number Publication date
AU5679394A (en) 1994-06-22

Similar Documents

Publication Publication Date Title
US6309647B1 (en) Poxvirus—canine dispemper virus (CDV) or measles virus recombinants and compositions and methods employing the recombinants
US6007806A (en) Expression of a tumor-specific antigen by a recombinant vector virus and use thereof in preventive or curative treatment of the corresponding tumor
US6596279B1 (en) Immunodeficiency recombinant poxvirus
US5756102A (en) Poxvirus-canine distemper virus (CDV) recombinants and compositions and methods employing the recombinants
US4920213A (en) Method and compositions useful in preventing equine influenza
US5744133A (en) Expression of a tumor-specific antigen by a recombinant vector virus and use thereof in preventitive or curative treatment of the corresponding tumor
US5614404A (en) Self-assembled, defective, non-self-propagating lentivirus particles
US20030013076A1 (en) Parapoxvirus vectors
US6024953A (en) Vaccine against rabies and process for preparation thereof
PT752888E (pt) ''sequencias de nucleótidos e de aminoácidos de gb, gc e gd de herpesvírus canino e suas utilizações''
WO1992003537A1 (fr) Particules de virus hybrides a replication defectueuse et auto-assemblees
WO1991019803A1 (fr) Particules virales autoassemblees defectueuses qui ne se propagent pas d'elles-memes
US4631191A (en) Methods and compositions useful in preventing equine influenza
US6051410A (en) Self-assembled, defective, nonself-propagating viral particles
JPH01500161A (ja) Ａｉｄｓの原因ウィルスの糖蛋白質、該糖蛋白質の製造方法及びワクチン
WO1994012617A1 (fr) Vaccins contre le virus de l'hepatite b
US5858373A (en) Recombinant poxvirus-feline infectious peritionitis virus, compositions thereof and methods for making and using them
US5989561A (en) Recombinant poxvirus-calicivirus rabbit hemorrhagic disease virus (RHDV) compositions and uses
WO1996039177A9 (fr) Compositions a base de poxvirus-calicivirus de recombinaison [virus de la maladie hemorragique du lapin (rhdv)] et leurs utilisations
JPH02500327A (ja) マイコバクテリアに対する遺伝子操作ワクチン
CA2210294C (fr) Compositions immunogenes contenant des virus pox attenues exprimant des antigenes de htlv
US5830477A (en) Vaccine against rabies and process for preparation thereof
Van der Ryst et al. Study of the immunogenicity of different recombinant Mengo viruses expressing HIV1 and SIV epitopes
AU604791B2 (en) Viral vector and recombinant DNA coding, in particular, for the p25 protein of the virus that is a causal agent of aids, infected cell culture, protein obtained, vaccine and antibodies obtained
CA2153336C (fr) Immunotherapie par virus recombinant

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR BY CA CZ FI HU JP KR KZ LK LV MG MN MW NO NZ PL RO RU SD SK UA UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase