WO2000020038A1 - Procede de traitement du cancer de la prostate au moyen d'un vecteur adenoviral - Google Patents

Procede de traitement du cancer de la prostate au moyen d'un vecteur adenoviral Download PDF

Info

Publication number
WO2000020038A1
WO2000020038A1 PCT/US1999/020907 US9920907W WO0020038A1 WO 2000020038 A1 WO2000020038 A1 WO 2000020038A1 US 9920907 W US9920907 W US 9920907W WO 0020038 A1 WO0020038 A1 WO 0020038A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
prostate
region
nucleic acid
lacz
Prior art date
Application number
PCT/US1999/020907
Other languages
English (en)
Inventor
Mitchell S. Steiner
Original Assignee
Genotherapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genotherapeutics, Inc. filed Critical Genotherapeutics, Inc.
Priority to AU10912/00A priority Critical patent/AU1091200A/en
Publication of WO2000020038A1 publication Critical patent/WO2000020038A1/fr

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/47—Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/66—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid the modifying agent being a pre-targeting system involving a peptide or protein for targeting specific cells
    • A61K47/67—Enzyme prodrug therapy, e.g. gene directed enzyme drug therapy [GDEPT] or VDEPT
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • This invention provides a gene therapy method of inducing cellular cytotoxicity of a tumor cell, and treating a subj ect with cancer using an adenovirus expression vector having a ⁇ - galactosidase gene in combination with a prodrug conjugated to a toxic agent,
  • This invention provides for adenovirus expression vectors and pharmaceutical compositions.
  • Prostate cancer has increased in epidemic proportions over the past 5 years with a 500% rise in new cases and 50% increase in prostate cancer deaths. Deaths from prostate cancer will continue to increase every year by 3% because fewer men are dying from cardiovascular disease. To further compound the magnitude of this problem, the majority of men with newly diagnosed prostate cancer will have advanced prostate cancer (TNM stage ⁇ T 3 ) for which there is no cure and prognosis is dismal. Therefore, new approaches to combat advanced prostate cancer are greatly needed.
  • Gene therapy may be a novel way to treat prostate cancer by direct transfer of genetic material into patients' diseased cells for the purpose of therapy.
  • Adenoviral vectors that express a lacZ reporter gene have been used to determine the efficiency of gene transfer in numerous tissues and organs including ceivix, neuron, muscle, liver, lung, and brain. Comparison of delivery routes between intramuscular and i.v. injection for adenoviral gene transfer in murine skeletal and cardiac muscle has revealed that by intramuscular injection adenoviral infection was circumscribed to the point of injection with very limited diffusion of the virus to other organs. By i. v. injection, gene transfer as observed in many other organs such as lung, liver, intestine, heart, and skeletal muscle. Comparison of adenovirus ⁇ semination in various organs and tissues resulting from intracardiac and intratumoral (established subcutaneous lung tumors) injection was also studied in mice.
  • Intracardiac injection had evidence of viral transduction not only to the heart, but also to the liver and kidneys. Intratumoral injection resulted in the majority of virus seen in tumor with minimal transduction outside the tumor, ⁇ ntratumoral injection of adenoviruses carrying tumor suppressor genes showed an inhibitory effect on xenograft prostate tumors in mice.
  • i.v. i.a.
  • direct prostate (i.p.) injection routes for delivery of adenoviral vectors to the prostate are no published studies to date comparing the transduction efficiencies of i.v., i.a., and direct prostate (i.p.) injection routes for delivery of adenoviral vectors to the prostate.
  • viral-based vectors for gene therapy contain endogenous viral promoters that are tissue-nonspecific. Consequently, unintended expression of toxic therapeutic genes may theoretically occur in other normal tissues.
  • Viral vectors that contain prostate specific promoter elements may theoretically allow exclusive expression of a therapeutic gene in prostate tissues for regional and systemic gene therapy.
  • PSA promoter There are at least three putative prostate specific promoters: PSA promoter, PB promoter, and MMTV LTR.
  • PSA is a protease that is, for all practical purposes, exclusively expressed in prostate (Mulders et al., 1 90).
  • PS A is overproduced by prostate cancer and elevated serum PSA levels correlate with the volume of prostate cancer burden (Mulders et al., 1990; Oesterling, 1991; Jurincic et al, 1990). Circulating PSA-positive cells are also strongly associated with metastatic prostate cancer (Hamd eta/., 1992).
  • a 620 bp PSA promoter isolated from a prostate cancer patient recently demonstrated prostate-specific expression of the reporter gene using an expression vector (Pang et al, 1995), PB, a rat prostate protein, is also expressed selectively in prostate (Matuo etal, 1989).
  • the rat PB gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate (Greenberg et al, 1994).
  • Transgenic mice bearing PB promoter fused to simian virus 40 Large tumor antigen gene all consistently develop prostate adenocaroinoma (Greenberg et al, 1995).
  • the MMTV LTR has specificity for both breast and prostate tissues as dete ⁇ nined by studies in both cultured cells and transgenic mice (Tutrone et al, 1993; Matsui et al, 1990; Halter et al, 1 92).
  • Retroviruses carrying MMTV LTR-antisense c-myc effectively inhibit growth ofprostate cancer DU145 cells invivo (Steinereta ., 1997).
  • This invention provides a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an E 1 and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇ -ga ⁇ actosidase under the control of a Rous Sarcoma Virus promoter.
  • This invention provides a replication-deficient adenovirus type 5 expression vectorwhich comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇ -galactosidase under the control of a Probasin promoter.
  • This invention provides arepHcation-deficient adenovirus type 5 expression vectorwhich comprises an adenovirus genome having a deletion in an E 1 and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇ -galactosidase under the control of a Prostate Specific Antigen (PSA) promoter.
  • PSA Prostate Specific Antigen
  • This invention rovides a replication-deficient adenovirus type 5 expression vectorwhich comprises an adenovirus genome having a deletion in an E 1 and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇ -galactosidase under the control of a Mouse Mammary Tumor Virus promoter.
  • This inventio provides a pharmaceutical composition
  • a pharmaceutical composition comprising the replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a 038
  • This invention rovides apharmaceutical composition
  • apharmaceutical composition comprising the replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇ -galactosidase under the control of a Probasin and a suitable diluent or carrier.
  • This invention rovides a pharmaceutical composition
  • a pharmaceutical composition comprising the replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇ -galactosidase under the control of a Prostate Specific Antigen promoter and a suitable diluent or earner.
  • This invention provides apharmaceutical composition
  • apharmaceutical composition comprising the replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇ -galactosidase under the control of a Mouse Mammary Tumor Virus promoter and a suitable diluent or carrier.
  • This invention provides a method of inducing cellular cytotoxicity of a tumor cell, comprising the steps of introducing into the tumor cell a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇ -galactosidase under the control of a Rous Sarcoma Virus promoter; and a prodrug having an active site which is masked by ⁇ -galactosidase, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby inducing cellular cytotoxicity of the tumor cell.
  • a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a ⁇
  • This invention provides a method of inducing cellular cytotoxicity of a tumor cell, comprising the steps of introducing into the tumor cell a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ -galactosidase under the control of a Probasin promoter; and a prodrug having an active site which is masked by ⁇ -galactosidase, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby inducing cellular cytotoxicity of the tumor cell.
  • This invention provides a method of inducing cellular cytotoxicity of a tumor cell, comprising the steps of introducing into the tumor cell a replication-deficient adenovirus type 5 expression vectorwhich comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ -galactosidase under the control of a Prostate Specific Antigen promoter; and a prodrug having an active site which is masked by ⁇ - galactosidase, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby inducing cellular cytotoxicity of the tumor cell.
  • This invention provides a method of inducing cellular cytotoxicity of a tumor cell, comprising the steps of introducing into the tumor cell a replication-deficient adenovirus type 5 expression vectorwhich comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ -galactosidase under the control of a Mouse Mammary Tumor Virus promoter; and a prodrug having an active site which is masked by ⁇ - galactosidase, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby inducing cellular cytotoxicity of the tumor cell.
  • This invention provides a method of treating a subject with cancer, comprising the steps of administering to the subject a: 1) pharmaceutical composition comprising an effective 038
  • arqjlication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ -galactosidase under the control of a promoter and a suitable diluent or carrier; and 2) a phaimaceutical composition comprising an effective amount of a prodrug having an active site which is masked by ⁇ -galactosidase and a diluent or carrier, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby treating the subject with cancer,
  • This invention provides a method of treating a subject with cancer, comprising the steps of administering to the subject a: 1) pharmaceutical composition comprising an effective amount of a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ -galactosidase under the control of a promoter and a suitable diluent or carrier; and 2) a phaimaceutical composition comprising an effective amount of a prodrug having an active site which is masked by ⁇ -galactosidase and a diluent or carrier, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby treating the subject with cancer.
  • This invention provides a method of treating a subject with cancer, comprising the steps of administering to the subject a: 1) pharmaceutical composition comprising an effective amount of areplication-deficient adenovirus type 5 expression vector hich comprises an adenovirus genome having a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ -galactosidase under the control of any one or more of a Rous Sarcoma Virus promoter, Probasin promoter, Prostate Specific Antigen promoter, or Mouse Mammary Tumor Vims promoter, and a suitable diluent or carrier; and 2) a pharmaceutical composition comprising an effective amount of a prodrug having an active site which is masked by ⁇ - galactosidase and a diluent or carrier, whereby a functional ⁇ -galactosidase is expressed 038
  • Figure 2 ⁇ -galactosidase activity in dog prostate.
  • Cell extracts from dog prostate described in Figure 1 were isolated and evaluated for ⁇ -gal activity.
  • PCR analysis ofgenomic DNAfor detection of adenoviral vectors in various tissues were performed on genomic DNA using primers specific for adenoviral genome. A ⁇ ow shows a 860-bp signal band of the expected PCR product. Shown are results of PCR followed by 2% agarose gel electrophoresis from DNA isolated from control dog (A), or dog transduced with AdRSVlacZ by i.v. injection (B), i.a, injection (C), and i.p. injection (D).
  • PCR Southern for detection of adenoviral vectors in various tissues.
  • the PCR electrophoretic gel in Fig.3 was transferred to a Nylon membrane by Southern blot, and the blot was hybridized with 32 P-labeled 860-bp PCR product from control plasmid. Arrow shows the 860-bp PCR signal band.
  • FIGS 5A-5D PCR analysis ofgenomic DNA from various tissues for ⁇ -actin gene. PCR were performed on genomic DNA using primers specific for ⁇ -actin gene. Arrow shows a 314-bp signal band of the expected PCR product. Shown are results of PCR followed by 2% agarose gel electrophoresis from DNA isolated from control dog (A), or dog transduced with AdRSVlacZ by i.v. injection (B), i.a. injection (C), and i.p. injection (D).
  • Figure 7 ⁇ -galactosidase activity of canine prostates.
  • Cell extracts from control and adenoviral i.p, injected canine prostates were isolated and ⁇ - galactosidase activity was assayed.
  • Adenoviral DNA sequence PCR analysis DNA extracted from prostates and various other organs at necropsy were subjected to PCR using primers specific to adenoviral genome.
  • the expected PCR product was a 860 bp band (shown by arrow). Shown are the DNA-PCR gel of 0038
  • AdRSVlacZ AdPS AlacZ
  • B AdPS AlacZ
  • C AdMMTVlacZ
  • D AdPBlacZ
  • FIGs 9A-9D Ade ⁇ oviralDNAsequencePCRSouthern hybridization.
  • ThePCRgel in Fig.3 was transferred to a Nylon membrane by Southern blot and the blot was hybridized with 32 P-labeled probe which was the purified 860 bp PCR product from control adenoviral plasmid. Shown are the PCR Southern blots of dogs transduced i.p. by AdRSVlacZ (A), AdPS AlacZ (B), AdMMTVlacZ (C), and AdPBlacZ (D).
  • AdRSVlacZ AdPS AlacZ
  • B AdMMTVlacZ
  • D AdPBlacZ
  • RNA extracted from prostates and various other organs at necropsy were subjected to RT-PCR using primers specific to housekeeping gene ⁇ -actin gene. Shown are the
  • AdRSVlacZ AdPSAlacZ
  • B AdPSAlacZ
  • Q AdMMTVlacZ
  • D AdPBlacZ
  • the expected RT-PCR product was a 316 bp band (shown by arrow).
  • FIG. 13 Activity of various promoter in Ad-lacZ. PPC- 1 cells were transduced by various Ad-lacZ and incubated at 37°C for 50 h followed by X-gal staining. 20038
  • the percent of blue cells was determined by counting blue cell numbers and the average from 5 different microscopic field was obtained.
  • FIG. 14 ⁇ -galactosidase enzymatic activity from RS V promoter.
  • PPC- 1 cells were transduced by AdRSVlacZ and incubated at 37°C for 50 h, The cell extracts were harvested and the ⁇ -galactosidase activity was evaluated by a colorimetric ⁇ -gal assay.
  • FIG. 15 ⁇ -galactosidase enzymatic activity from different prostate-specific promoters.
  • PPC-1 cells were transduced by AdPSAlacZ, AdPBlacZ, AdMMTVlacZ and incubated at 37°C for 50 h.
  • the cell extracts were harvested and the ⁇ -galactosidase activity was evaluated by a colorimetric ⁇ - gal assay.
  • Xenograft tumors were established by subcutaneously injected cancer cells into flank of nude mice, When tumors reached about 50 mm 3 volume, Ad-lacZ was injected directly into tumors. The tumors were harvested in 72 hr and processed to cryosections. Shown are X-gal staining of tumor sections derived from prostate cancer cell DU145 (A, B, C), PPC-1 (D, E, F), or from bladder cancer cells RT4 (G, H, I), A, D, and G are tumors transduced by AdRSVlacZ (5x10 9 pfu). B, E and H are tumors transduced by AdPBlacZ
  • F and I are tumors transduced by AdPSAlacZ (lxlO 10 pfu)
  • C is control tumor from DU145 cells which was uninfected with virus.
  • Figures 17A-17C Comparison of in vivo activity of prostate-specific and RSV promoter.
  • PPC-1 xenograft tumors were established and transduced by Ad-lacZ as 0038
  • the tumors were harvested in 72 hr and processed to whole-mount tumor X-gal staining. Shown are X-gal staining of tumors transduced by lxlO 10 pfu AdPBlacZ (A), lxlO 9 pfu AdRSVlacZ (B), and 1 x 10 10 pfu AdRSVlacZ (C). Untreated control PPC- 1 tumor did not shown blue cells after X-gal staining (not shown).
  • FIGS 21A-21B A) Schematic of the Ad5MMTV ⁇ galactosidase vector] B) Nucleic acid sequence of Ad5MMTV ⁇ -galactosidase.
  • Suicide gene therapy is one of the most promising gene therapy approaches.
  • the therapeutic gene is introduced into the cancer cells without regard to the underlying genetic mutations.
  • the therapeutic gene encodes for an enzyme that has the ability to convert a nontoxic prodrug into a cancer killing drug which then destroys cancer cells.
  • This invention employed the LacZ gene as the prodrug enzyme suicide gene.
  • the LacZ encodes for the enzyme ⁇ -galactosidase which cleaves ⁇ -galactoside sugar residues.
  • Prodrugs may be synthesized where the active component of the drug is made inactive by the ⁇ -galactoside.
  • the ⁇ -galactosidase enzyme is capable of cleaving the ⁇ -galactoside 0038
  • adenoviral vector constructs containing the LacZ gene can efficiently transfer LacZ into a host of human cells and is capable of producing ⁇ -galactosidase.
  • the functional activity of the ⁇ - galactosidase enzyme was confirmed by numerous in vitro and in vivo assays. Two types of adenoviral vectors were produced: I) Tissue-nonspecific and 2)Tissue-specific (breast and prostate) adenoviral vectors containing the LacZ gene.
  • tissue specificity of these adenoviruses and the ability to produce ⁇ -galactosidase prodrug enzyme were also confirmed.
  • the four adenoviral constructs and their tissue specificity are as follows: 1) Ad5RSVLacZ - tissue nonspecific; 2) Ad5PBLacZ- prostate tissue specific; 3) Ad5PSALacZ- rostate tissue specific; 4) Ad5MMTVLacZ- prostate and breast specific.
  • This invention provides arepHcation-deficient adenovirus type 5 expression vectorwhich comprises an adenovirus genome having a deletion in the E 1 and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ - galactosidase under the control of a Rous Sarcoma Virus promoter.
  • This invention provides areplication-deficient adenovirus type 5 expression vectorwhich comprises an adenovirus genome having a deletion in the E 1 and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ - galactosidase under the control of a Probasin promoter.
  • This invention provides a replication-deficient adenovirus type 5 expression vector hich comprises an adenovirus genome having a deletion in the E 1 and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ - galactosidase under the control of a Prostate Specific Antigen (PSA) promoter. /20038
  • PSA Prostate Specific Antigen
  • This invention rovides arepHcation-deficient adenovirus type 5 expression vectorwhich comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coU ⁇ - galactosidase under the control of a Mouse Mammary Tumor Virus promoter.
  • This invention provides for ⁇ -galactosidase and any alleHc variants, analog, fragments, isoenzymes, mutants, and variants thereof and both sense and antisense strands which functionally acts when expressed by a vector so as to catalyze a prodrug, such as by example cephalosporin, conguated to a toxic agent to activate the prodrug into an agent toxictothecellsandtherebyinducingcellularcytotoxicityofthecell,
  • a prodrug such as by example cephalosporin
  • the ⁇ -galactosidase enzyme is encoded by the nucleic acid sequence is set forth in Figure 18B, 19B or20B.
  • the nucleic acid encoding the nucleic acid includes RNA, cDNA, genomic DNA, fragments, isoenzymes, variants, mutants, alleles, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemicaHy or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art.
  • Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, intemucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carba ates, etc.), charged linkages (e.g., ⁇ hosphorothioates,phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.).
  • uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carba ates, etc.
  • charged linkages e.g., ⁇ hosphorothioates,phosphorodithioates, etc.
  • pendent moieties
  • synthetic molecules thatmimic nucleotides in their abiHty to bind to a designated sequence via hydrogen bonding and other chemical interactions.
  • Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule, substantially homologous to primary structural sequence but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate unusual amino acids.
  • Thenucleic acid may bemodified. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, 0038
  • ubiquitination labeling, e.g., with radionucHdes, and various enzymatic modifications, as will be readily appreciated by those weU skilled in the art.
  • a variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as sup 32 P, Hgands which bind to labeled antiHgands (e.g. fashion antibodies), fluorophores, chemiluminescent agents, enzymes, and antiHgands which can serve as specific binding pair members for a labeled tigand.
  • the choice of label depends on the sensitivity required, ease of conjugation with the primer, stabiHty requirements, and available instrumentation.
  • Methods of labeling polypeptides are well known in the art, See, e.g., Sambrook et al., 1989 or Ausubel et al., 1992.
  • Mutations can be made in a nucleic acid such that a particular codon is changed to a codon which codes for a different amino acid but the tumor suppressor function is maintained. Such a mutation is generally made by making the fewest nucleotide changes possible.
  • a substitution mutation of this sort can be made to change an amino acid in the resulting protein in anon-conservative manner (i.e., by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to another grouping) or in a conservative manner (i.e., by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to the same grouping), Such a conservative change generally leads to less change in the structure and function of the resulting protein.
  • a non-conservative change is more likely to alter the structure, activity or function of the resulting protein.
  • Tie present invention should be considered to include sequences containing conservative changes which do not significantly alter the activity or binding characteristics of the resulting protein.
  • Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalaniue, tryptophan and methionine
  • Amino acids containing aromatic ring structures are phenylalanine, tryptophan, and tyrosine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagi ⁇ e, and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations will not be expected to affect apparent molecular weight as determined by polyaciylamide gel electrophoresis, or isoelectric point.
  • Synthetic DNA sequences allow convenient construction of genes which will express analogs or "muteins " .
  • a general method for site-specific incorporation of unnatural amino acids into proteins is described inNoren, et al. Science, 244:182-188 (April 1989). This method may be used to create analogs with unnatural amino acids.
  • Rous Sarcoma Virus promoter includes any any allelic variants, fragments, analog, isoenzymes, mutants, and variants thereof.
  • the Rous Sarcoma Virus promoter has the a nucleic acid sequence as set forth in Figure 18B.
  • the Probasin promoter includes any any allelic variants, fragments, analog, isoenzymes, mutants, and variants thereof. In another embodiment the Probasin promoter has the a nucleic acid sequence as set forth in Figure 19B.
  • the Prostate Specific Antigen (PSA) promoter includes any any allelic variants, fragments, analog, isoenzymes, mutants, and variants thereof. In another embodiment the Prostate Specific Antigen promoter has the a nucleic acid sequence as set forth in Figure 20B.
  • the Mouse Mammary Tumor Virus promoter includes any any allelic variants, fragments, analog, isoenzymes, mutants, and variants thereof. In another embodiment the Mouse Mammary Tumor Virus promoter has the a nucleic acid sequence as set forth in Figure 2 IB.
  • Rous Sarcoma Virus promoter has the following sequence: CGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTTAGG CGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCC TCAGGATATAGTAGTT CGC TITTGCATAGCCAGGGM3GAAATGTAGTCTTATGCAATACACTTGTAGTCTTGCAACATGGT AACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGG TGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACAGGTCTGACATGGA TTGGACGAACCACTGAATTCCGCATTGCAGAGATAATTGTATTTAAGTGCCTAGCTCGAT ACAATAAACG CCATTTGACCATTCACCACA TTGGTGTGCA CCTCC.
  • the vector may comprise a polyadenylation signal, such as an SV40 polyadenylation signal.
  • the vector may comprise a selectable marker. Examples of selectable markers include but are not limited to neomycin resistance or beta-lactamase.
  • Recombinant adenovirus Ad5RSV ⁇ -galactosidase was made as foUows : A 3.2 kb lacZ gene containing a nuclear localization signal at the 5 ' end was released from plasmid pPD1.27, a derivative of pPD16.43, by Hind HI and Dra I. After polishing the ends, it was blunt Hgated to a E 1 a-deleted, adenoviral shuttle plasmid vector which had been cut by EcoR V, so the lacZ gene was now under the control of RS V promoter.
  • the resultant adenoviral shuttle vector was cotransfected into 293 cells with pJMl 7, an adenoviral type 5 genome plasmid, by calcium phosphate method.
  • Cells were maintained in overlay of 1 ; 1 mixture of 2% Seaplaque agarose (FMC, Rockland, ME) and 2 x plaque mix (2 x MEM, 15%FBS,4mMglutamine, 1 x Penicillin/Streptomycin, and 0.25 ⁇ g mloffungizone,all from Gibco BRL, Gaithersburg, MD). Plaques appeared in 10 to 12 days. Individual plaques were screened by PCR using specific primers for RSV promoter and for lacZ gene. The PCR primers were 5'CGGGTCTGACATGGATTGGAC3' and 5 'TCTGGCCTTCCTGTAGCCAGC3 ' .
  • PB/SV40t is an expression vector containing a 456 bp 5 'upstream region of PB gene (Greenberg et al, 1994).
  • Ad5PBIacZ a 3.2 kb lacZ gene containing a nuclear localization signal at the 5 ' upstream was released from plasmid pPD 1.27, a derivative of pPD 16.43 (Fire and Dixon, 1990) by Hind HI and Dra I, after poHshing the ends, it was ligated to PB/S V40t which had been cut by EcoR V, so that lacZ was placed downstream of the 456 bp PB promoter.
  • the resultant plasmid was cut by Pst I and Apa I to release a PB-lacZ-poly A cassette, after polishing the ends, the cassette was subcloned into an El a and E3 deleted adenoviral type 5 shuttle vector pAvs ⁇ a whose endogenous RSV promoter had been removed by Ascl and Clal, to generate the resultant recombinant adenoviral shuttle vector pAvsPBlacZ.
  • a 650 bp 5' upstream region of PSA gene and a Cla I-truncated MMTV LTR were used as PSA promoter and MMTV LTR promoter.
  • Adenoviral shuttle vectors pAvsMMTVlacZ and pAvsPSAlacZ were generated by replacing PB promoter in pAvsPBlacZ with MMTV LTR promoter and PSA promoter, respectively.
  • pAvsPBlacZ was cut by Sal I, filled in by Klenow, then cut by Xba I, the lacZ shuttle vector backbone was Hgated to a 1.1 kb MMTV LTR promoter which was derived from pMAMneo (Stratagene, Lo Jolla, CA) by cut with Cla I, filled in by Klenow, then by Nhe
  • the resultant recombinant adenoviral shuttle vector was pAvsMMTVlacZ. A650bp
  • PSA PCR product was formed by PCR using plasmid containing 5' upstream sequence of PSA gene as template and two primers which were specific to the PSA 5' upstea region and also introduced two restriction sites, Sal I and Xba I, one at the end of each primer respectively.
  • the 650 bp fragment ofPSApromoter was purified andcutwithSal
  • Recombinant adenovirus Ad5PBlacZ, AdSMMTVlacZ and Ad5PSAlacZ were generated via in vivo recombination in 293 cellsbycotransfectionofpJM17, anadenoviralgenome plasmid and their corresponding shuttle vectors pAvsPBlacZ, pAvsMM VlacZ and pAvsPSAlacZ respectively.
  • Plasmid DNA were transfected into 293 cells by calcium phosphate method (Kingston, 1993) and ceUs were maintained in plaque overlay mixture (Graham and Prevec, 1991). Plaques were usually appeared in 10 to 12 days.
  • primers specific to transgene i.e., one primer specific forpromoter and the other primer specific forlacZ gene.
  • the primers specific for three promoters PB, PSA, and MMTV LTR were 5 ' GCTACTCTGCACCTTGTCAG3 ' , 5'GCTCCTGGGGGAGGCTCC3', and 5'GCGGAACGGACTCACCATAG3'.
  • the primer specific for lacZ was 5 ' TCTGGCCTTCCTGTAGCCAGC3 ' .
  • PCR was performed in a 50- ⁇ l volume containing 250 ng DNA, 2 mM MgCl j , 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris-HCl (pH 8.4), 2 ⁇ M each of the primers, and 2.5 units of Tag DNA polymerase (Gibco BRL, Gaithersburg, MD).
  • the reaction was carried out at 94°C for 5 min; then for 30 cycles at 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min; followed by at 72°C for 10 min.
  • Ad5R5 VlacZ in which lacZ gene was under the control of Rous Sarcoma virus (RSV) promoter, was generated.
  • the primer specific to RSV promoter was 5' CGGGTCTGACATGGATTGGACG3' .
  • the primer specific for lacZ was 5'TCTGGCCTTCCTGTAGCCAGC3 ⁇
  • adenovirus 15 cm plates with 293 cells were set up wich used 30 15 cm plates per production. When the cells are 70-80% confluent they are ready to be infected with adenovirus.
  • the infection media is D2 (DMEM with2% heat inactivated fetal calf serum).
  • l ⁇ l of adenovirus stock per 15 cm plate was used.
  • the virus is generally at a titre of 10 10 p.f. /ml while there are approximately 10 7 p.f.u./ plate. Therefore, theM.O.I.
  • D10 DMEM with 10% heat inactivated fetal calf serum, 2mM glutamine
  • the cells are ready to harvest when they show cytopathic effect (CPE has a rounded appearance) and start to detach from the plate.
  • CPE has a rounded appearance
  • the cells will also appear as "grape-like clusters". This rounding of cells begins after approximately 24 hours of infection and is fully developed after 36-48 hours, depending upon the initial amount of virus added, Within this time range, the cells should be harvested. If CPE is. evident before 24 hours, the CPE could be due to the effect of viral proteins.
  • Detach the cells by pipetting fluid and cells up and down, using a 25 ml pipet (collect all cells because virus is mostly intracellular) and collect in 50 ml disposable polypropylene tubes.
  • the cells are collected by centrifugation (table top centrifuge) at 1,500 ipm for 10 min at 4°C Resuspend the pelleted cells in a total of 5 ml of the supernatant for every 20 plates and transfer the resuspended cells to 2059 Falcon tubes. Treat the remaining supernatant with Clorox before discarding down the sink as it is a biohazard. Freeze/thaw the cells 5X in order to lyse the cells and release the virus, vortexing between each freeze thaw cycle.
  • ultra-clear S W 40 or SW41 tubes (Beckman) by soaking the tubes in 95% ETOH followed by sterile H 2 0 or PBS and remove all the Uquid.
  • the first ultracentrifugation will involve pelleting of the adenovirus onto a CsCl cushion.
  • the cushions are to be made as indicated below.
  • the different density CsCl solutions can be made using PBS. It is easier to use ultra-clear tubes for the remaining centrifugation steps, as it is easier to view the adenoviral band.
  • the CsCl cushions are made by placing the lower density CsCl solution (density of 1 ,25g/ml) in the centrifuge tube first, then the higher density and finally the viral lysate which sits on top.
  • the CsCl solutions are made in 10mMTRIS-HCL H7.4, lmMMgCl 2 or PBS as follows:
  • the density can be checked by weighing 1 ml of the CsCl solution.
  • the second ultracentrifugation step is a CsCl solution (density 1.33 g/ml).
  • CsCl solution density 1.33 g/ml
  • add 8 ml of CsCl solution density 1.33 g/ml
  • overlay with the solution (band of infectious virus in 1 ml) from the previous centrifugation step. Centrifuge as above except that the duration of time will be overnight. Balance carefully by weighing tubes.
  • 293 eeUsis ahumanembiyomckidneyceUline whichhasbeentransformedby DNAfrom adenovirus type 5; they can be obtained from ATCC (ATCC #crl573).
  • the cells are grown in D10 (DMEM 10% heat inactivated fetal calf serum, 2mM glutamine, 4.5 g/L glucose, 50 units/ml penicillin and 50 ⁇ g/ml streptomycin). 293 cells must be handled carefully as they are sensitive and quite fragile: Avoid drying - aspirate media only when ready to immediately proceed to infection.
  • nucleic acid refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”) in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
  • this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes.
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA ( ⁇ e. , the strand having a sequence homologous to the mRNA).
  • a "recombinant DNA” is a DNA that has undergone a molecular biological manipulation.
  • This invention provides for a replicable vector comprising the isolated nucleic acid molecule of the DNA virus.
  • the vector includes, but is not limited to ; a plasmid, cosmid, ⁇ phage or yeast artificial chromosome (YAC) which contains at least a portion of the isolated nucleic acid molecule.
  • insert and vector DNA can both be exposed to a restriction enzyme to create complementary ends on both molecules which base pair with each other and are then Hgated together withDNA ligase.
  • linkers can be Hgated to the insert DNA which correspond to a restriction site in the vector DNA, which is then digested with the restriction enzyme which cuts at that site.
  • Other means are also available and known to an ordinary skilled practitioner,
  • a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine-Dalgarno sequence and the start codon AUG.
  • a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome.
  • Such vectors may be obtained commercially or assembled from the sequences described by methods well- known in the art, for example the methods described above for constructing vectors in general.
  • Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This abiHty to act over a large distance had fittle precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activityareorganizedmuchlikepromoters, That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.
  • the term "vector” refers to viral expression systems, autonomous self-repUcating circular DNA (plasmids), and includes both expression and nonexpression plasmids.
  • a recombinant microorganism or cell culture is described as hosting an "expression vector," this includes both extracbromosomal circular DNA and DNA that has been incorporated into the host chromosome(s).
  • the vector may either be stably repHcated by the cells during mitosis as an autonomous structure, or is incorporated within the host's genome.
  • Expression vectors which can be used other than adenovirus include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or swinepox virus, pox virus, herpes simplex virus, baculovirus, adeno-associated virus, retrovirus, cytomegalovirus, mouse mammary tumor virus (MMTV), Moloney urine leukemia virus and plasmid and cosmid DNA vectors, to name but a few.
  • human or animal viruses such as vaccinia virus or swinepox virus, pox virus, herpes simplex virus, baculovirus, adeno-associated virus, retrovirus, cytomegalovirus, mouse mammary tumor virus (MMTV), Moloney urine leukemia virus and plasmid and cosmid DNA vectors, to name but a few.
  • Vectors are introduced into the desired host ceUs by methods known in the art, e.g. , ex vivo viral vectors, particularly retroviral vectors, in vivo viral vectors, particularly defective viral vectors or adeno-associated virus vectors, transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e.g. , U.S. Patent No. 5,580,859, which is incorporated by reference and Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J, Biol. Chem.
  • Such vectors include an attenuated or defective DNA virus, such as but not limited to herpes simplex virus (RSV), papiUomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like.
  • RSV herpes simplex virus
  • EBV Epstein Barr virus
  • AAV adeno-associated virus
  • Defective viruses which entirely or almost entirely lack viral genes, are preferred. Defective virus is not infective after introduction into a cell.
  • Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other ceUs. Thus, a solid tumor can be specifically targeted.
  • vectors include, but are not limited to, a defective herpes virus 1 (HSVl) vector (Kaplitt et al, 1991, Molec. Cell. Neurosci. 2:320-330), an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. (1992, J. Clin. Invest, 90:626-630), and a defective adeno-associated virus vector (Samulski et al., 1987, J. Virol. 61:3096-3101; Samulski et al., 1989, J. Virol. 63:3822-3828).
  • HSVl herpes virus 1
  • the gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann et al., 1983, Cell 33:153; Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S. Patent No. 4,980,289; Markowitz et al., 1988, J. Virol. 62:1120; Temin et al., U.S. Patent No. 5, 124,263 ; International Patent Publication No.
  • Retroviral vectors are especially attractive for transfecting sotid tumors, since the cells of the tumor are repUcating,
  • the vector can be introduced in vitro or in vivo by Hpofection,
  • Hposomes for encapsulation and transfection of nucleic acids in vitro.
  • Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al., 1987, Proc. Natl, Acad. Sci. U.S.A. 84:7413-7417; see Mackey, et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8027-8031)).
  • cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner and Ringold, 1989, Science 337:387- 388).
  • Hpofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages.
  • Molecular targeting of liposomes to specific ceUs, in this instance tumor ceUs, e.g., via tumor-specific cell surface receptors represents one area of benefit.
  • Lipids may be chemicaHy coupled to other molecules for the purpose of targeting (see Mackey, et. al., 1988, supra).
  • Targeted peptides e.g., hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to Hposomes chemically.
  • DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, mi ⁇ roinjection, transduction, ceU fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, U.S. Patent No. 5,580,859, the contents of which are hereby incorporated by reference and e.g. , Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624; Hartmut et al., Canadian Patent AppHcation No. 2,012,311, filed March 15, 1990).
  • plasmid refers to an autonomous circular DNAmolecule capable of repHcation in a cell, and includes both the expression andnonexpression types. Where arecombinant microorganism or ceU culture is described as hosting an "expression plasmid", this includes latent viral DNA integrated into me host chromosome(s). Where a plasmid is being maintained by a host ceU, the plasmid is either being stably repHcated by the ceUs during mitosis as an autonomous structure or is incorporated within the host's genome.
  • Substantial identity or “substantial sequence identity” mean that two sequences, when optimally afigned, such as by the programs GAP or BESTFIT using default gap which share at least 65-99 percent sequence identity, share at least 75 percent sequence identity, share at least 80 percent sequence identity, share at least 90 percent sequence identity, preferably at least 95 percent sequence identity, more preferably at least 99 percent sequence identity or more.
  • This invention contemplates a nucleic acid which has substantial sequence identity to a nucleic acid encoding ⁇ -galactosidase,
  • nucleic acid encoding refers to a nucleic acid molecule which directs the expression of a specific protein or peptide.
  • the nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein.
  • the nucleic acid molecule include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length protein. It being further understood that the sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell.
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a ceU and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the niinimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eukaiyotic promoters wiU often, but not always, contain "TATA" boxes and "CAT” boxes.
  • Prokaryotic promoters contain Shine-Dalgatno sequences in addition to the -10 and -35 consensus sequences.
  • An "expression control sequence” is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence.
  • a coding'sequence is "under the control” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
  • enhancers The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and continguous, often seeming to have a very similar modular organization.
  • Hst of viral promoters, ceUular enhancers and inducible enhancers that could be used in combination methods of treating a subject with cancer with the nucleic acid encoding a ⁇ -galactosidase which include but are not limited to the following: Prostate Specific Membrane Antigen.
  • Immunoglobulin Heavy Chain Immunoglobulin Light Chain, T-Cell Receptor, HLA DQ ⁇ and Dq ⁇ , ⁇ -Interferon, Interleukin-2, Interleukin- 2 Receptor, MHC Class II 5 ⁇ ' MHC Class ⁇ HLA-DR ⁇ , Actin, Muscle Creatine Kinase, Proalbiimiu (Transthyretin), Elastasel, MetaUothionein, CoUagenase, Albumin Gene, ⁇ -Fetoprotein, ⁇ -Globin, c-fos, c-Ha-ras, Insulin, Neural CeU Adhesion Molecule (NCAM), cd-antirypole, 2B (TH2B) Histone, Muse or Type I CoUagen, Glucose-Regulated Proteins (GRP94 and GRP78), Rat Growth Hormone, Human Serum Amyloid A (SAA), Troponin I (TN I), Platelet-Der
  • adenovirus vectors which are repHcation deficient, depend on a unique helper ceU line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins (Graham, et al. , 1977). Since the E3 region is dispensible from the adenovirus genome (Jones and Shenk, 1 78), the current adenovirus vectors, with the help of 293 ceUs, carry foreign DNA in either the El, the E3 or both regions (Grahm and Prevec. 1991). In nature, adenovirus can package approximately 105% of the wild-type genome (Ghosh-Choudhury, et al.
  • Helper ceU lines may be derived from human cells such as human embryonic kidney ceUs, muscle ceUs, hematopoietic cells or other human embryonic mesenchymal or epithelial ceUs.
  • the helper ceUs may be derived from the cells of other mammalian species that are permissive for human adenovirus.
  • ceUs include, e.g. , Vero cells or other monkey embryonic mesenchymal or epithelial ceUs.
  • the preferred helper ceU line is 293.
  • the adenovirus may be of any of the 42 different known serotypes or subgroups A-F, Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the method of the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is know, and it has historically been used for most constructions employing adenovirus as a vector.
  • a DNA sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence.
  • the term "operatively linked” includes having an appropriate start signal (e.g., ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.
  • This invention provides a method of inducing cellular cytotoxicity of a tumor ceU, comprising the steps of introducing into the tumor ceU a repHcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coH ⁇ -galactosidase under the control of a Rous Sarcoma Virus promoter; and a prodrug having an active site which is masked by ⁇ -galactosidase, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby inducing ceUular cytotoxicity of the tumor cell.
  • This invention provides a method of inducing cellular cytotoxicity of a tumor ceU, comprising the steps of introducing into the tumor cell a repHcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coli ⁇ -galactosidase under the control of a Probasin promoter; and a prodrug having an active site which is masked by ⁇ -galactosidase, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the ceUs, thereby inducing ceUular cytotoxicity of the tumor cell.
  • This invention provides a method of inducing ceUular cytotoxicity of a tumor cell, comprising the steps of introducing into the tumor cell arepHcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coU ⁇ -galactosidase under the control of a Prostate Specific Antigen promoter, and a prodrug having an active site which is masked by ⁇ - galactosidase, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby inducing cellular cytotoxicity of the tumor ceU.
  • This invention provides a method of inducing ceUular cytotoxicity of a tumor cell, comprising the steps of introducing into the tumor ceU a repHcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coH ⁇ -galactosidase under the control of a Mouse Mammary Tumor Virus promoter, and a prodrug having an active site which is masked by ⁇ - galactosidase, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the cells, thereby inducing cellular cytotoxicity of the tumor ceU.
  • tumor cell or “cancer cell” means a tissue that grows by ceUular proliferation more rapidly than normal, e.g., more rapidly than adjoining ceUs, or other ceUs in the tissue. Neoplastic ceUs continue to grow after growth stimuli cease, Generally, tumors represent or form a distinct mass of tissue.
  • the present invention relates to both types of tumors , but is particularly valuable in the treatment of cancers .
  • the tumor ceUs are selected from a group consisting of; melanoma; lymphoma; leukemia; and prostate, colorectal, pancreatic, breast, brain, or gastric carcinoma.
  • tumors include but are not limited to : include sarcomas and carcinomas such as, but not limited to: fibrosarcoma, myxosaxcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarco a, endotheliosarcoma, lymphangiosarcoma, lyraphangioendotheHosarcoma, synovioma, mesothelioma, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous ceU carcinoma, basal ceU carcinoma, adenocarcinoma
  • Prodrugs for use according to the present invention may thus be based on any compound showing a suitable chemotherapeutic effect.
  • chemotherapeutic agents are preferably anti-inflammatory, anti-viral or anti-cancer compounds, and more preferably cytotoxic compounds such as nitrogen mustard agents, antifolates, nucleoside analogs, the vinca alkaloids, the anthracyclines, the mimycins, the bleomycins, the cytotoxic nucieosides, the pteridine family of drugs, the podophyophyUotoxins, the sulfonylureas (as described in EP-A-0 222, 475) and low- molecular weight toxins such as the trichothecense and the colchicines.
  • cytotoxic compounds such as nitrogen mustard agents, antifolates, nucleoside analogs, the vinca alkaloids, the anthracyclines, the mimycins, the bleomycins, the cytotoxic nucieosides, the pter
  • doxorubicin particularly including doxorubicin, daunomycin, daunorubicin, aminopterin, methotrexate, taxol, methapterin, dichloromethotrexate, mitomycin C, porfiimoycin, 5-fiuorouracU, 6- mercaptopurme, cytosine arabinoside, podophyUotoxin, etoposide, melphalan, vinblastine, vincristine, desacetylvinblastine hydrazide, leurosidine, vindesine, leurosine, trochothecene and desacetylcolchicine, or phosphorodiamidate mustards,
  • inducing chemotoxicity means that the prodrug enzyme itself activates the prodrug into a cancer killing agent.
  • the ceU that made the prodrug enzyme and activated the prodrug into a toxic prodrug now dies, thus the combination prodrug enzyme and prodrug have induced chemotoxicity in a tumor cell that by itself would not be killed by either the prodrug enzyme or prodrug alone,
  • selective sensitivity means that only those ceUs that make the prodrug enzyme have the capability to activate the prodrug and are consequently sensitized to the prodrug.
  • selective kiUed means that only the ceUs that make the prodrug enzyme and their neighboring ceUs that are close enough to come into contact with the activated prodrug wiU be kiUed when the prodrug is activated and liberated locally. Cells that do not come into contact with the activated prodrug because they are not located in the vicinity of the cell that has the gene to make the prodrug enzyme wiU not be killed, thus the systemic effects of the activated prodrug are minimized.
  • the prodrug may comprises a daunomycin or phosphorodiamidate isoenzyme, mustard, or derivative thereof, congugated to a toxic agent.
  • aUeHc variants, analogs, fragments, isoenzymes, mutants, and variants of daunomycin or phosphorodiamidate are known to those skiUed in the art.
  • the "toxic agent” means any agent when introduced into a ceU kills the ceU or inducing the cell to die.
  • the agent may be 5-fluorouracil, methotrexate, adriamycin, or a chemotherapeutic agent.
  • This invention provides a method of treating a subject with cancer, comprising the steps of administering to the subject a: 1) pharmaceutical composition comprising an effective amount of a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coH ⁇ -galactosidase under the control of a promoter and a suitable diluent or carrier; and 2) a phaimaceutical composition comprising an effective amount of a prodrug having an active site which is masked by ⁇ -galactosidase and a diluent or carrier, whereby a functional ⁇ -galactosidase is expressed from the vector so as to activate the prodrug into an agent toxic to the ceUs, thereby treating the subject with cancer.
  • the promoter is a Rous Sarcoma Virus promoter, In another embodiment the promoter is a Mouse Mammary Tumor Virus. In another embodiment the promoter is a Probasin promoter. In another embodiment the promoter is a Prostate Specific Antigen promoter. In another embodiment the promoter is a Prostate Specific Membrane Antigen promoter.
  • the vector can be transcribed or introduced into the ceU in vitro by well-known methods, e.g., by injection (see, Kubo et al., 1988), or the vectors can be introduced directly into host cells by methods weU known in the art, which vary depending on the type of ceUular host, including electroporation; transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; Hpofection.
  • gene transfer may more easily be performed under ex vivo conditions.
  • Ex vivo gene tHerapy refers to the isolation of cells from an animal, the deHvery of a nucleic acid into the cells, in vitro, and then the return of the modified ceUs back into an saiimal. This may involve the surgical removal of tissue/organs from an animal or the primary culture of cells and tissues. Anderson et al., U.S. Pat. No. 5,399,346, and incorporated herein in its entirety, disclose ex vivo therapeutic methods.
  • plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein, and the resulting complex is bound to an adenovirus vector.
  • the trimolecular complex is then used to infect cells.
  • the adenovirus vector permits efficient binding, intemalization, and degradation of the endosome before the coupled DNA is damaged.
  • Liposome DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard Hposome preparations the gene transfer process is nonspecific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct in situ administration (Nabel, 1992).
  • Receptor-mediated gene transfer for example, is accomplished by the conjugation of DNA (usuaUy in the form ofcovalently closed supercoUed plasmid) to a protein Hgand vi polylysine.
  • Ligands are chosen on the basis of the presence of the corresponding Hgand receptors on the cell surface of the target cell/tissue type.
  • the vector may be administered in combination with other cytokines or growth factors include but are not limited to: IFN ⁇ or , IFN- ⁇ ; interleukin (IL) 1, IL-2, IL- 4, IL-6, IL-7, IL-12, tumor necrosis factor (TNF) , TNF- ⁇ , granulocyte colony stimulating factor (G-CSF), granulocyte/macrophage CSF (GM-CSF); accessory molecules, including members of the integrin superfamily and members of the Ig superfa ⁇ uly such as, but not limited to, LFA-1, LFA-3, CD22, and B7-1, B7-2, and ICAM-1 T cell costimulatory molecules.
  • IL interleukin
  • TNF tumor necrosis factor
  • G-CSF granulocyte colony stimulating factor
  • GM-CSF granulocyte/macrophage CSF
  • accessory molecules including members of the integrin superfamily and members of the Ig superfa ⁇ uly such as, but
  • the method of treating the subject further comprising the step of treating the subject with chemotherapy, radiation or chemopreventative therapies. It is contemplated by this invention that replacement therapy could be used similarly in conjunction with chemo- or radiotherapeutic intervention.
  • a "target" ceU with the expression vector and at least one DNA damaging agent In one embodiment the cell is contacted with a single composition or pharmacological formulation that includes both agents, or by contacting the ceU with two distinct compositions or formulations, at the same time, wherein one composition includes the vector and the other includes the DNA damaging agent.
  • treatment with the vector may precede or foUow the DNA damaging agent treatment by intervals ranging from minutes to weeks. Protocols and methods are known to those skiUed in the art.
  • DNA damaging agents or factors are known to those skilled in the art and means any chemical compound or treatment method that induces DNA damage when applied to a ceU. Such agents and factors include radiation and waves that induce DNA damage such as, gamma -irradiation, X-rays, UV-itradiation, microwaves, electronic emissions, and the like. A variety of chemical compounds, also described as "chemotherapeutic agents", function to induce DNA damage, all of which are intended to be of use in the combined treatment methods disclosed herein.
  • Chemotherapeutic agents contemplated to be of use include, e.g., adriamycin, 5-fluorouracil (5FU), etoposide (VP-16), camptothecin, actinomycin-D, mitomycin C, cisplatin (CDDP) and even hydrogen peroxide,
  • the invention also encompasses the use of a combination of one or more DNA damaging agents, whether radiation-based or actual compounds, such as the use of X-rays with cisplatin or the use of cisplatin with etoposide.
  • neoplastic or toxic agents include but are not limited: 5-fluoroura l, methotrexate and adriamycin which may be linked in each case to, for example, a cephalosporin (see WO-A94 01 137 and EP-A-0 382 411) or cephalosporin mustards (see EP-A-0 484 870).
  • a cephalosporin see WO-A94 01 137 and EP-A-0 382 4111
  • cephalosporin mustards see EP-A-0 484 870
  • the cephalosporin/toxic agent conjugate shows markedly reduced toxicity but can be converted to the active form by ⁇ -galactosidase thus making it suitable for use as a prodrug in GDEPT.
  • Other toxic agents can be linked to cephalosporins in a similar way.
  • the tumor ceUs may be contacted with the DNA damaging agent by a ⁇ _n____istering to the subject atherapeuticaUy effective amount of apharmaceutical composition comprising a DNA damaging compound such as, adriamycin, 5-fluorouracil, etoposide, camptothecin, actinomycin-D, mitomycin C, or more preferably, cisplatin.
  • the DNA damaging agent may be prepared and used as a combined therapeutic composition, or kit, by combining it with a ⁇ -galactosidase expression construct, as described above.
  • Agents that directly cross-link nucleic acids, specifically DNA are envisaged and are shown herein, to eventuate DNA damage leading to a synergistic antineoplastic combination.
  • Agents such as cisplatin, and other DNA alkylating may be used.
  • Cisplatin has been widely used to treat cancer, with efficacious doses used in clinical applications of 20 mg/m 2 for 5 days every three weeks for a total of three courses. Cisplatin is not absorbed orally and must therefore be delivered via injection intravenously, subcutaneously, intratumoraUy or intraperitoneally.
  • Agents that damage DNA also include compounds that interfere with DNA repHcation, mitosis and chromosomal segregation.
  • chemotherapeutic compounds include adriamycin, also known as doxorubicin, etoposide, verapamil, podophyUotoxin, and the like. Widely used in a clinical setting for the treatment of neoplasms, these compounds are administered through bolus injections intravenously at doses ranging from 25-75 mg m 2 at 21 day intervals for adriamycin, to 35-50 mg/m 2 for etoposide intravenously or double the intravenous dose orally.
  • the prodrug is cyclophospharoide, isoenzymes, analogs and derivatives thereof, In another embodiment the prodrug is ifosfamide, isoenzymes, variants, analogs and derivatives thereof.
  • nucleic acid precursors and subunits agents that disrupt the synthesis and fideUty of nucleic acid precursors and subunits also lead to DNA damage.
  • nucleic acid precursors have been developed.
  • agents that have undergone extensive testing and are readily available are particularly useful.
  • agents such as 5-fluorouracil (5-FU) are preferentially used by neoplastic tissue, making this agent particularly useful for targeting to neoplastic ceUs.
  • 5-FU is appHcable in a wide range of carriers, including topical, however intravenous administration with doses ranging from 3 to 15 mg kg/day being commonly used.
  • Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 weeks), to single doses of 2000 to 6000 roentgens.
  • Dosage ranges for radioisotopes vary widely, and depend on the haif-Hfe of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
  • This invention provides apharmaceutical composition
  • apharmaceutical composition comprising the repHcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coH ⁇ -galactosidase under the control of a Rous Sarcoma Virus promoter and a suitable diluent or carrier.
  • This invention provides a phaimaceutical composition
  • a phaimaceutical composition comprising the repHcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coH ⁇ -galactosidase under the control of a Probasin and a suitable diluent or carrier.
  • This invention provides apharmaceutical composition
  • apharmaceutical composition comprising the repHcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coH ⁇ -galactosidase under the control of a Prostate Specific Antigen promoter and a suitable diluent or carrier.
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the repHcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding an Escherichi coH ⁇ -galactosidase under the control of a Mouse Mammary Tumor Virus promoter and a suitable diluent or carrier.
  • pharmaceutical composition could mean therapeuticaUy effective amounts of polypepti.de products of the invention together with suitable diluents, preservatives, solubilizers, emulsifiers, adjuvant and or carriers.
  • compositions are Hquids or lyophilized or otherwise dried formulations and include diluents of various buffer content (e.g., Tris-HCl., acetate, phosphate), pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), solubilizing agents (e.g., glycerol, polyethylene glycerol), anti- oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thi erosal, benzyl alcohol, parabens), bull ⁇ ng substances or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to the protein,
  • buffer content e.g., Tris-HCl., acetate, phosphate
  • pH and ionic strength additive
  • compositions of the invention incorporate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral.
  • pharmaceutical composition is administered parenteraUy, intratumorally, paracanceraUy, transmucosaUy, transdermally, intramuscularly, intravenously, intradermaUy, subcutaneously, intraperitonealy, intraventricularly, intracraniaUy,
  • pharmaceutically acceptable carrier include, but are not limited to, 0.01-0.1M and preferably 0.05M phosphate buffer or 0.8% saline.
  • phaimaceuticaUy acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non- aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oU, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/ queous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, coUating agents, inert gases and the like.
  • adjuvant refers to a compound or mixture that enhances the immune response to an antigen.
  • An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator thatnon-specificaUy enhances the immune response (Hood et al., Immunology, Second Ed, 1984, Benjamin Cummings: Menlo Park, California, p.384).
  • a primary challenge with an antigen alone, in the absence of an adjuvant will fail to eUcit a humoral or ceUular immune response.
  • Adjuvant include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol.
  • the adjuvant is pharmaceutically acceptable,
  • Controlled or sustained release compositions include formulation in HpophiHc depots (e.g. fatty acids, waxes, oils).
  • particulate compositions coated with polymers e.g. poloxamers or poloxamines
  • the compound coupled to antibodies directed against tissue-specific receptors, Hgands or antigens or coupled to Hgands of tissue-specific receptors e.g. IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, antigens or coupled to Hgands of tissue-specific receptors.
  • Other embodiments of the compositions of the invention incorporate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral.
  • the sufficient amount may include but is not limited to from about 1 ⁇ g/kg to about 1000 mg/kg.
  • the amount may be 10 mg/kg.
  • the pharmaceuticaUy acceptable form of the composition includes a pharmaceutically acceptable carrier.
  • compositions which contain an active component are well understood in the art.
  • TypicaUy such compositions are prepared as an aerosol of the polypeptide deHvered to the nasopharynx or as injectables, either as liquid solutions or suspensions, however, soHd forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared,
  • the preparation can also be emulsified.
  • the active therapeutic ingredient is often mixed with excipients which are phaimaceuticaUy acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof.
  • the composition can contain minor amounts of auxiHary substances such as wetting or emulsifying agents, pH buffering agents which enhance the effectiveness of the active ingredient,
  • phrases “ PhaimaceuticaUy acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide or antibody molecule) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxaHc, tartaric, mandeUc, and the like.
  • Salts formed from the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylainine, 2-ethylamino ethanol, histid ⁇ ie, procaine, and the like.
  • inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides
  • organic bases as isopropylamine, trimethylainine, 2-ethylamino ethanol, histid ⁇ ie, procaine, and the like.
  • a composition comprising "A” (where "A” is a single protein, DNA molecule, vector, etc.) is substantiaUy free of "B” (where “B” comprises one or more contaminating proteins, DNA molecules, vectors, etc.) when at least about 75% by weight of the proteins, DNA, vectors (depending on the category of species to which A and B belong) in the composition is "A” .
  • "A” comprises at least about 90% by weight of the A+B species in the composition, most preferably at least about 99% by weight.
  • unit dose when used in reference to a therapeutic composition of the present invention refers to physicaUy discrete units suitable as unitary dosage for humans, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i. e. , carrier, or vehicle.
  • helper ceU lines may be derived from human cells such as human embryonic kidney ceUs, muscle ceUs, hematopoietic ceUs or other human embryonic mesenchymal or epithehal cells .
  • the helper ceUs may be derived from the cells of other mammalian species that are permissive for human adenovirus.
  • ceUs include, e.g. , Vero cells or other monkey embryonic mesenchymal or epithehal ceUs.
  • the preferred helper ceU line is 293.
  • the active compound can be delivered in a vesicle, in particular aliposome (see Langer, Science 249:1527-1533 (1990); Treat et al., iaLiposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid).
  • a vesicle in particular aliposome
  • the therapeutic compound can be deUvered in a controlled release system.
  • the polypeptide may be administered using intravenous infusion, an implantable osmotic pump, a transde ⁇ nal patch, Hposomes, or other modes of administration.
  • a pump may be used (see Langer, supra Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al,, N, Engl, J, Med. 321:574 (1989)).
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug ioavailability, Drug Product Design and Performance, Smolen and BaU (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy etal., Science 228:190 (1985); During etal., Ann. Neurol, 25:351 (1989); Howard et al., J. Neurosurg. 71:105 (1989)).
  • a controlled release system can be placed in proximity of the therapeutic target, i.e., the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of ControUed Release, supra, vol.2, pp. 115-138 (1984)).
  • a controUed release device is introduced into a subject in proximity of the site of inappropriate immune activation or a tumor. Other controUed release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).
  • compositions of the present invention are particularly suited to administration to a mammal, preferable a human subject.
  • a therapeuticaUy effective dosage of the active component is provided.
  • a therapeuticaUy effective dosage can be determined by the ordinary skiUed medical worker based on patient characteristics (age, weight, sex, condition, compUcations, other diseases, etc.), as is well known in the art. Furthermore, as further routine studies are conducted, more specific information will emerge regarding appropriate dosage levels for treatment of various conditions in various patients, and the ordinary skiUed worker, considering the therapeutic context, age and general health of the recipient, is able to ascertain proper dosing. Generally, for intravenous injection or infusion, dosage may be lower than for intraperitoneal, intramuscular, or other route of administration.
  • the dosing schedule may vary, depending on the circulation half-Hfe, and the formulation used.
  • the compositions are administered in a manner compatible with the dosage formulation in the therapeuticaUy effective amount.
  • Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are pecuHar to each individual.
  • suitable dosages may range from about 0.1 to 20, preferably about 0.5 to about 10, and more preferably one to several, miUigrams of active ingredient per kilogram body weight of individual per day and depend on the route of administration.
  • Suitable regimes for initial administration and booster shots are also variable, but are typified by an initial administration foUowed by repeated doses at one or more hour intervals by a subsequent injection or other administration.
  • continuous intravenous infusion sufficient to maintain concentrations of ten nanomolar to ten micromolar in the blood are contemplated.
  • the present invention provides akit comprising the aU the essential materials and reagents required for inhibiting tumor ceU proliferation, tx ⁇ ujsforming tumor cells or detecting tumor ceUs, may be assembled together in a kit.
  • This generaUy will comprise selected expression constructs. Also included may be various media for repHcation of the expression constructs and host cells for such repHcation.
  • kits will comprise distinct containers for each individual reagent.
  • the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • the expression construct may be formulated into apha ⁇ naceutically acceptable syringeable composition.
  • the container means may itself be an inhaleut, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be appHed to an infected 038
  • kits may also be provided in dried or lyophilized forms.
  • reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means.
  • kits of thepresentinvention also wiUtypicaUy include a eans for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained.
  • the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of an animal.
  • an instrument may be an i ⁇ halent, syringe, pipette, forceps, measured spoon, eye dropper or any such medicaUy approved delivery vehicle.
  • EXAMPLE 1 Delivery of adenoviral vectors containing LacZ prodrug enzyme for prostate gene therapy
  • a repHcation deficient recombinant adenoviral vector (AdRSVlacZ) expressing bacterial ⁇ -galactosidase (lacZ) under the control of Rous Sarcoma virus (RSV) promoter was used to determine as prodrug enzyme gene therapy, This study sought to determine which delivery route of this adenovirus RSV LacZ was best for the transduction of adenoviral vectors to the prostate.
  • adenoviral vectors were given 038
  • adenoviral vector resulted in a greater transduction rate and expression level of lacZ in the prostate than either i.v. or i.a. (inferior vesical/prostatic artery) injections,
  • i.p. (or intratumoral) injection appears to be the best route to deHver AdRSVLacZ to treat local regional prostate cancer by viral based gene therapy
  • the prodrug enzyme LacZ is also used for systemic therapy.
  • the resultant adenoviral shuttle vector was cotransfected into 293 cells with pJM17, 15 an adenoviral type 5 genome plasmid, bycalciumphosphatemethod.' 6 CeUs were maintained in overlay of 1:1 mixture of 2% Seaplaque agarose (FMC, Rockland, ME) and 2 x plaque mix (2 x MEM, 15% FBS, 4 mM glutamine, 1 x Penicillin/Streptomycin, and 0.25 ⁇ g/ml of fungizone, all from Gibco BRL, Gaithersburg, MD). Plaques appeared in 10 to 12 days, Individual plaques were screened by PCR using specific primers for RSV promoter and for lacZ gene. The PCR primers were 5 ' CGGGTCTGACATGGATTGGAC3 ' and 5'TCTGGCCTTCCTGTAGCCAGC3 '.
  • Ad5RSVlacZ Individual clone of recombinant Ad5RSVlacZ was courtesy of Genotherapeutics, Inc., Memphis, TN. Single viral clones were propagated in 293 cells,
  • the culture medium of the 293 cells exhibiting a cytopathic effect (CPE) was collected 038
  • adenovirus purification The adenovirus was concentrated by twice CsCI 2 gradient ultracentrifugation. Viral titer was determined by plaque assays in 293 ceUs, "
  • tissue samples were processed to cryosections and stained for in situ lacZ expression as previously described. 18 Briefly, tissue samples will be fixed in 4% formaldehydefor30mi ⁇ ,thenin30%sucroseinPBS at 4°C overnight. The samples will be then snap-frozen in Hquid nilxogen in O.C.T. medium (Tissue-Tek Sakura, Toirance, CA) and processed to cryosections by a Cryostat.
  • cryosections wiU be fixed in formalin for 30 sec, rinsed inPBS containing 0,04% NP-40 and 1 mMMgCl 2 three times, and then will be incubated at 37°C for 3 h in substrate solution of 1 mg/ml X-gal (Gibco BRL), 0.035 mM potassium fe ⁇ icyanide, 0.035 mM potassium ferrocyanide, 1 nM MgCl 2 , 0.01% sodium deoxycholate, and 0.02% NP-40.
  • ⁇ -gal assay Prostate tissue was homogenized in 100 ⁇ l per 50 mm 3 sample of 1 x lysis buffer ( ⁇ -gal Assay Kit, Invitrogen, Carlsbad, CA). After microcentrifugation at 14,000 rpm for 5 min at 4°C, the supernatant was collected. Protein concentration was determined by Coomassie Plus Protein Assay Reagent (Pierce, Rockford, IL). The ⁇ -gal assay was performed by using ⁇ -gal Assay Kit (Ihvitrogen) according to Manufacturer's protocol.
  • PCR Polymerase chain reaction
  • PCR was performed in a total volume of 50- ⁇ l containing 1 ⁇ g DNA, 2 mM MgCl-, 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris- HCI (pH 8.4), 2 ⁇ M each of the primers, and 2.5 units of Taq DNA polymerase (Gibco BRL).
  • the reaction was carried out at 94°C for 5 min; then for 30 cycles at 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min; foUowed by at 72°C for 10 min.
  • a control PCR was performed by using the same amount of DNA for ampHfication of house-keeping gene ⁇ -actin.
  • the primers specific for ⁇ -actin gene which resulted in a 314 bp signal band after PCR ampHfication were: Primer 1 was S ' T C C T GTGGCAT C CA C GAAACTS 1 and Primer 2 was 5'GAAGCATTTGCGGTGGACGAT3 ⁇ PCRwasperformedinatotalvolumeof50- ⁇ l containing 1 ⁇ g DNA, 4 mM MgCl 2 , 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris- HC1 (pH 8.4), 2 ⁇ M each of the primers, and 2.5 units of Taq DNA polymerase (Gibco BRL). The reaction was carried out at 94°C for 5 min; then for 30 cycles at 94°C for 1 min, 55°
  • Southern blot hybridization Standard Southern blot transfer of PCR products to Nylon membrane (Hybond-N , Amersham Life Science, Buckinghamshire, England) was performed. 19 The 860-bp PCR product from positive control plasmid was purified and used as a cDNA probe. The probe was labeled by ⁇ - 32 P-dCTP using random primer method (Prime-It ⁇ Kit, Stratagene, La JoUa, CA). The membrane was hybridized with the probe in Rapid-hyb buffer (Amersham Life Science) according to the Manufacturer's protocol. The membrane was exposed to a Kodak X-ray film between two intensifying screens at -80°C for autoradiography.
  • Prostate extracts were also isolated and subj ected to a colormetric ⁇ -gal assay to measure the level of ⁇ -gal enzymatic activity.
  • Fig.2 shows that i.p. injection resulted in a 7.5 fold and 2.4 fold higher ⁇ -gal activity than either i.v. or i.a., respectively.
  • Of interest is the relatively greater ⁇ -gal activity measured by X-gal staining than by ⁇ -gal activity assay.
  • i.p. inj ection resulted in greatest expression of ⁇ -gal among three different deHvery routes by both X-gal staining and ⁇ -gal assay.
  • the prostatic transduction rate and dissemination pattern of adenovirus in various tissues foUowing the different routes of viral administration DNA was isolated from various tissues and subjected to DNA-PCR analysis using primers specific for adenoviral genome. PCR analysis revealed that the prostate by i.p. injection had a intense 860-bp band (Fig.3D), while adenoviral PCR products ampHfied from prostate DNA taken from dogs subjected to i.v. and i.a. injections had no detectable band on PCR gel (Fig, 3B and 3C) demonstrating that i.p. injection was more better than the other two routes.
  • PCR Southern also showed a band in the DNA extracted from the bladder of control dog, which was notiryected with AdSRSVlacZ (Fig.4A).
  • AdSRSVlacZ AdSRSVlacZ
  • the intra-arterial approach was performed by cannulating the internal iHac artery and threading the catheter to the inferior vesical and prostatic arteries taking advantage ofthe end terminal arterial supply ofthe prostate, Unfortunately, the transduction rate was lower than that observed for intraprostatic injection. However, the amount of ⁇ -gal activity was only 2.4 fold different between the i.p. andi.a. injections demonstrating that the more minimaUy invasive intra- arterial approach may indeed be useful for gene therapy. Only by directly comparing the efficacy ofthe therapeutic gene between these two approaches wiU this hypothesis be confirmed.
  • the intraprostatic approach also had less dissemination ofthe adenovirus than either the intra-arterial or intravenous routes.
  • Other studies have shown that intravenous injection of adenovirus showed dissemination ofthe adenovirus primarily to the lung andUver. 12,22,23
  • adenoviral dissemination may be clinicaUy inconsequential as lacZ expression was not detectable in the organs that were affected by adenoviral spread.
  • the deHvery strategy of gene therapy may be another way to direct adenoviral vectors to intended organs and tissues.
  • adenovirus vectors can transfer through blood flow which may be important for the treatment of distant metastatic disease. If adenoviral vectors are under the control of tissue specific promoters, then systemic gene therapy may prove to be possible.
  • Quantin B Pemcaudet LD, Tajbakhsh S, and Mandel J-L. Adenovirus as an expression vector in muscle ceUs in vivo. Proc. Natl Acad. Sci. USA 1992;89:2581-2584.
  • Culver KW Methods for gene transfer and repair. In: Culver KW, ed. Gene
  • Wood M PeiTotte P, Onishi E, Wilson DL, Dinney C, Harper ME, PagHaro L.
  • transgene ⁇ -galactosidase (lacZ) by repHcation deficientEl and E3 deleted adenoviral type 5 vectors (Ad-lacZ) containing different prostate specific promoters were compared using an in v /o canine model,
  • the prostate tissue specific promoters were prostate specific antigen (PSA), probasin (PB), and mouse mammary tumor virus (MMTV LTR), which were separately fused to an E. coH lacZ gene.
  • lacZ lacZ in tissues was determined by X-gal staining, ⁇ -galactosidase ( ⁇ -gal) assay, andE.coli lacZ RT-PCR.
  • Ad5RSVlacZ control viral vector
  • prostate specific Ad-lacZ vectors only transcribed lacZ mRNA in the prostate and not in non- prostatic tissues .
  • these novel prostate specific adenoviral vectors each have equal in vivo LacZ expression exclusively in the prostate and may be potentially used for prostate cancer prodrug enzyme gene therapy.
  • This experiment tested a series of prostate specific adenoviruses to determine the degree of promoter specificity and activity in prostate tissues in vivo.
  • Four adenoviruses were evaluated which each contained a reporter gene, lacZ, but under the control of different promoters: a nonspecific promoter RSV and three different prostate-specific promoters, PSA, PB, and MMTV LTR.
  • Promoter activity and specificity of lacZ gene expression was evaluated in vivo foUowing i. ⁇ . injection into canine prostates, Prostate-specific Ad- lacZ vectors containing either PSA, PB, or MMTV LTR had expression ofthe lacZ mRNA and protein in the prostate in vivo.
  • adenoviral vector sequences were detected by PCR in other tissues, lacZ expression was only found in the prostate.
  • the development of novel prostate-specific adenoviruses using the strategy of tissue specific prostate promoters are useful for prostate cancer gene therapy.
  • PB/SV40t is an expression vector containing a 456 bp 5'upstream region of PB gene (Greenberg et al, 1994).
  • Ad5PBlacZ a 3.2 kb lacZ gene containing a nuclear localization signal at the 5 ' upstream was released from plasmid pPD 1.27, a derivative of ⁇ PD16.43 (Fire and Dixon, 1990) by Hind IH and Dra I, after poHshing the ends, it was Hgated to PB/SV40t which had been cut by EcoR V, so that lacZ was placed downstream ofthe 456 bp PB promoter.
  • the resultant plasmid was cut by Pst I and Apa 1 to release a PB-lacZ-poly A cassette, after poHshing the ends, the cassette was subcloned into an Ela and E3 deleted adenoviral type 5 shuttle vector pAvs ⁇ a whose endogenous RSV promoter had been removed by Ascl and Clal, to generate the resultant recombinant adenoviral shuttle vector pAvsPBlacZ.
  • a 650 bp 5' upstream region of PSA gene and a Clal-truncated MMTV LTR were used as PSA promoter and MMTV LTR promoter.
  • Adenoviral shuttle vectors pAvsMMTVlacZ and pAvsPSAlacZ were generated by replacing PB promoter in pAvsPBlacZ with MMTV LTR promoter and PSA promoter, respectively.
  • pAvsPBlacZ was cut by Sal filled in by Klenow, then cut by Xba I
  • the lacZ shuttle vector backbone was Hgated to a 1.1 kb MMTV LTR promoter which was derived from pMAMneo (Stratagene, Lo JoUa, CA) by cut with Cla I, filled in by Klenow, then by Nhe I.
  • the resultant recombinant adenoviral shuttle vector was pAvsMMTVlacZ.
  • A650bp PSA PCR product was fo ⁇ ned by PCR using plasmid containing 5' upstream sequence of PSA gene as template and two primers which were specific to the PSA 5' upsteam region and also introduced two restriction sites, Sal I and Xba I, one at the end of each primer respectively.
  • the 650bpfragmentofPSApromoter waspurifiedandcutwithSal I and Xba 1 , then Hgated to pAvsPBlacZ whose PB promoter was removed by Sal I and Xba I.
  • the resultant recombinant shuttle vector was pAvsPSAlacZ.
  • AU the structure of recombinant adenoviral shuttle vectors were confirmed by sequencing.
  • Recombinant adenovirus AdSPBlacZ, Ad5MMTVlacZ and Ad5PS AlacZ were generated via in vivo recombination in 293 cells by cotransfection of pJM17, an adenoviral genome plasmid and their corresponding shuttle vectors pAvsPBlacZ, pAvsMMTVlacZ and pAvsPSAlacZ respectively.
  • Plasmid DNA were transfected into 293 cells by calcium phosphate method (Kingston, 1993) and ceUs were maintained in plaque overlay mixture (Graham andPrevec, 1991), Plaques were usuaUy appeared in 10 to 12 days.
  • primers specific to transgene i.e., one primer specific for promoter and the other primer specific for lacZ gene.
  • the primers specific for three promoters PB,PSA, and MMTV LTR were 5'GCTACTCTGCACCTTGTCAG3', 5 3 GCTCCTGGGGGAGGCTCC3', and 5'GCGGAACGGACTCACCATAG3'.
  • the primer specific for lacZ was 5'TCTGGCCTTCCTGTAGCCAGC3 ' .
  • PCR was performed in a 50- ⁇ l volume containing 250 ng DNA, 2 mM MgCl 2 , 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris-HCl (pH 8.4), 2 ⁇ M each ofthe primers, and 2.5 units of Tag DNA polymerase (Gibco BRL, Gaithersburg, MD).
  • the reaction was carried out at 94°C for 5 min; then for 30 cycles at 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min; followed by at 72°C for 10 min.
  • Ad5RS VlacZ in which lacZ gene was under the control of Rous Sarcoma virus (RSV) promoter, was generated.
  • the primer specific to RSV promoter was 5' CGGGTCTGACATGGATTGGACG3' .
  • the primer specific for lacZ was 5'TCTGGCCTTCCTGTAGCCAGC3'.
  • ⁇ -galactosidase assay Prostate tissue was homogenized in 100 ⁇ l per 50 mm 3 sample of
  • I x lysis buffer ( ⁇ -gal Assay Kit, Invitrogen, Carlsbad, CA). After microcentrifugation at 14,000 rpm for 5 min at 4°C, the supernatant was collected. The protein concentration was determined by Coomassie Plus Protein Assay Reagent (Pierce, Rockford, EL). The colorimetric ⁇ -galactosidase assay was performed by using ⁇ -gal Assay Kit (Invitrogen) according to the Manufacturer's protocol.
  • PCR Polymerase chain reaction
  • PCR was performed in a50- ⁇ l volume containing 250 ng DNA, 2 mM MgCl 2 , 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris-HCl (pH 8.4), 2 ⁇ M each ofthe primers, and 2, 5 units ofTaq DNA polymerase (Gibco BRL).
  • the reaction was earned out at 94°C for 5 min; then for 30 cycles at 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min; followed by at 72°C for 10 min.
  • RT-PCR Reverse-trunscriptase polymerase chain reaction
  • PCR was performed in 50- ⁇ l total volume containing 5 to 10 ⁇ l above RT mixture, in a final concentration of 4 mM MgCl 2 , 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris-HCl (pH 8.4), 2 ⁇ M each ofthe primers, and 2.5 units of Taq DNA polymerase (Gibco BRL).
  • the reaction was carried out at 94°C for 4 min; then for 30 cycles at 94°C for 1 min, 60°C for 2 min, and 72°C for 2 min; followed by at 72°C for 10 min,
  • the primers specific to ⁇ -actin gene were 5'TCCTGTGGCATCCACGAAACT3' and 5'GAAGCATTTGCGGTGGACGAT3 ' which resulted a 314 bp PCR product.
  • RESULTS LacZ gene expression in prostate Prostate tissues obtained from control and adenoviral vector injected dogs were cryosectioned and stained with X-gal to determine the in situ expression of lacZ. Endogenous X-gal staining was undetectable (Fig.6A). Ad5RSVlacZ and all three prostate-specific Ad-lacZ had blue staining ceUs (lacZ expression) after intraprostatic (i.p.) injection (Fig.6B, 6C, and 6D).
  • Ad5RSVlacZ resulted in a higherpercentage of blue stained cells with greater blue color intensity than the prostate specific Ad-lacZ vectors (compare Fig.6B with 6C and 6D), Protein extracts were also isolated from canine prostates and subjected to colorimetric ⁇ -galactosidase assay to measure the lacZ enzymatic activity.
  • AdSRSVlacZ had the highest activity (4.87 ⁇ -gal units/per g protein) compared to Ad5PSAlacZ (2.86 ⁇ -gai units/per g protein), Ad5PBlacZ (2,29 ⁇ -gal units/per mg protein), and Ad5MMTVlacZ (1.86 ⁇ -gal units/per mg protein) (Fig. 7).
  • the relative differences in AdSRSVlacZ versus Ad5PSAlacZ, Ad5PBlacZ, _u ⁇ dAd5MMTVlacZ were lJ,2.1, and2.6 fold,res ⁇ ectively.
  • Detection of adenovirus in various tissues To determine whether adenovirus dissemination occurred foUowing i. ⁇ . inj ection, DNA was extracted from various canine tissues harvested at necropsy and subjected to PCR analysis for adenoviral sequences. More specificaUy, the PCR primers flanked an 860-bp sequence of adenoviral genome. Regardless ofthe promoter type, all adenoviral vector-injected prostates had an intense 860-bp signal band, coiifi ⁇ ning that the maj ority of adenovirus transduction occurred in the prostate itself.
  • Ad5RSVlacZ disseminated to the vas deferens (perhaps as a result of reflux from the ejaculatory ducts ofthe injected prostate) and external iHac artery.
  • Ad5PSAlacZ and Ad5MMTVlacZ were also detected in vas deferens as well as in bladder tissues. I.p.
  • RNA samples from various canine tissues were extracted from various canine tissues and subjected to RT-PCR analysis.
  • the primers used for RT-PCR were specific for E.coH lacZ and flanked a 1036-bp internal sequence of lacZ gene. Consistent with X-gal staining and ⁇ -gal assays, RT-PCR followedby gel electrophoresis showed a 1036 bp band was present in prostates foUowing i.p. adenoviral injection.
  • the integrity of RNA samples from various tissues was demonstrated by RT-PCR of housekeeping gene ⁇ -actin (Fig.
  • the RT-PCR gel was transferred to a Nylon membrane by Southern blot and the blot was hybridized with 3Z P-labeled probe which was thepurified 1036bp PCR product from controllacZ plasmid. Shown are the RT-PCR Southern of dogs transduced i.p, by AdRSVlacZ, AdPSAlacZ, AdMMTVlacZ, and AdPBlacZ.
  • the control viral vector AdSRSVlacZ had lacZ mRNA expression in all tissues where adenoviral vectors had disseminated. This was expected as RSV has nonspecific promoter activity.
  • tissue-specific regulatory sequences have been identified and may potentially be used in this manner (see reviews by MUler and VUe, 1995; Miller and Whelan, 1997).
  • cell-type-specific gene expression system have been developed using replication-deficient adenovirus and cell-type-specific promoters. Examples include expression of the transgene in recombinant adenovirus carried neural ceU-type-specific promoters is highly restricted in the neural ceUs (Hashimoto et l, 1996) and adenovirus carrying human factor VUI under the control of liver-specific promoter limited the expression of factor VUI to the liver (Connelly etal, 1996).
  • RepHcation deficient recombinant adenoviral vectors carrying lacZ reporter gene driven by three different prostate-specific promoters were investigated to determined the degree of in vivo tissue specificity and level of activity foUowing i.p. injection.
  • the three prostate-specific Ad-lacZ tested (PSA, PB, and MMTV LTR) expressed the lacZ gene only in the prostate and not in any ofthe other tissues where adenoviral vectors had disseminated, ⁇ a contrast
  • control adenoviral vector Ad5RSVlacZ expressed lacZ both in the prostate and in the tissues that contained disseminated adenoviral sequences.
  • the RSV promoter was stronger than the three prostate-specific promoters, demonstrating that PSA, PB , and MMTV LTR promoter activity was reduced in return for greater tissue specificity.
  • AdSRSVlacZ had a much higher level of lacZ expression than the prostate-specific Ad-lacZ vectors in vitro; prostate-specific Ad-lacZ required a 10-fold higher multipHcity of infection (moi) than AdSRSVlacZ to get similar levels of lacZ expression (Lu et al, 1 97).
  • moi multipHcity of infection
  • Tissues such as the vas deferens and bladder seems to be common sites for adenovirus dissemination foUowing i.p. injection. This may more likely represent direct extension of adenovirus rather than the viremia as retrograde urethral and ej aculatory ductal reflux may account for this unusual pathway of adenoviral dissemination foUowing i.p . inj ection.
  • the presence of virus in heart and Hver may due to the other factors such as a true viremia with transduction of those organs that receive a high percentage of cardiac output. Nevertheless, none ofthe organs that contained disseminated prostate- specific Ad-lacZ vectors had lacZ expression. In contrast, all organs with AdSRSVlacZ vectors had lacZ expression (Fig. 9 and Fig. 10). Consistently, the results of this study demonstrated that in vivo lacZ expression was essentiaUy confined to prostate tissue,
  • prostate-targeted adenoviral vectors containing either a PSA, PB, or MMTVLTRprostate-specificpromoter driving the LacZ prodrug enzyme gene were able to transduce and express lacZ specifically in prostate ⁇ « vivo by i.p, injection. Although adenoviral dissemination occulted, only prostate tissues expressed lacZ transgene. Activity ofthe LacZ prodrug enzyme gene was demonstrated.
  • the prodrug can be any drug whose active site is masked by ⁇ -galactoside.
  • the LacZ prodrug enzyme gene produces ⁇ -galactosidase which has the ability to cleave and activate these types of prodrugs.
  • An example ofthe prodrug may be found in Figure 12.
  • Prostate cancer gene therapy herpes simplex virus thymidine kinase gene transduction followed by ganciclovir in mouse and human prostate cancer models. Human Gene Ther. 7, 515-523.
  • FIRE A HARRISON S, andDIXOND, (1990).
  • HIMOTO M., ARUGA, J., HOSOYA, Y., KANEGAE, Y., SATTO, I., and ME OSHTBA, K. (1996).
  • the androgen-depende ⁇ t rat prostate protein, probasin is a heparin-binding protein that co-purifies with heparin-binding growth factor-1. In vitro Cell Dev. Biol. 25, 581-584.
  • Prostate specific antigen a critical assessment ofthe most useful tumor marker for adenocarcinoma ofthe prostate. J. Urol, 145, 907-
  • D-MEM Dulbecco's modifiedEagle medium
  • Gibco BRL Gibco BRL
  • RPMI 1640 medium was purchased from CeUgro (Herndon, VA).
  • Fetal bovine serum (FBS) was from Hyclone Laboratories (Logan, UT)
  • Human embryonic kidney 293 ceUs was purchased from ATCC (RockvUle, MD) and were grown in D-MEM with 10% heat inactivated FBS.
  • Dunning rat prostate cancer cell lines GandMATLyLu, andhumanprostatecancerceUHnesLNCaP,DU145,PPC-l andTSU- Pr were grown in RPMI 1640 medium with FBS.
  • Mouse breast carcinoma MCF-7 cells and human bladder cancer RT4 ceUs were grown in McCoy's 5a medium (CeUgro) with 10% FBS.
  • Mouse fabroblast 3 T3 ceUs were grown in D-MEM with 10%FBS.
  • AU cells were grown inmedium containing lOOunits/mlpenicUlin, 100 ⁇ g/ml streptomycin at 37°C in 5% C0 2 .
  • PB/SV40t is an expression vector containing a 456 bp 5 'upstream region of PB gene.
  • Ad5PBlacZ a 3.2 kb lacZ gene containing a nuclear localization signal at the 5 ' upstream wasreleasedfromplasmidpPD1.27, aderivative ofpPD16.43 26 by HindHI and Dra I, after poHshing the ends, it was Hgated to PB/S V40t which had been cut by EcoR V, so that lacZ was placed downstream ofthe 456 bp PB promoter.
  • the resultant plasmid was cut by Pst I and Apa I to release a PB-lacZ-poly A cassette, after polishing the ends, the cassette was Hgated to an El a and E3 deleted adenoviral shuttle vector, whose endogenous RSV promoter had been removed, to generate the resultant recombinant adenoviral shuttle vector pPBlacZ.
  • a 650 bp 5' upstream region of PSA gene and a Cla I-truncated MMTV promoter were used as PSA promoter and MMTV promoter.
  • Adenoviral shuttle vectors pMMTVlacZ and pPSAlacZ were generated by replacing PB promoter in pPBlacZ with MMTV promoter and PSA promoter, respectively.
  • pAvsPBlacZ was cut by Sal I, fiUed in by Klenow, then cut by Xba I
  • the lacZ shuttle vector backbone was Hgated to a 1.1 kb MMTV promoter which was derived from pMAMneo (Stratagene, Lo JoUa, CA) by cut with Cla I, fiUed in by Klenow, then by Nhe I.
  • the resultant recombinant adenoviral shuttle vector was pMMTVTacZ.
  • a 650 bp PSA PCR product was formed by PCR using plasmid conl- ⁇ ning 5 ' upstream sequence of PS A gene as template and two primers which were specific to the PSA 5' upsteam region and also introduced two restriction sites, Sal I and Xba I, one at the end of each primer respectively,
  • the 650 bp fragment of PSA promoter was purified and cut with Sal I and Xba 1, then Hgated to pPBlacZ whose PB promoter was removed by Sal I and Xba I.
  • the resultant recombinant shuttle vector was pPSAlacZ. All the structure of recombinant adenoviral shuttle vectors were confirmed by sequencing.
  • Recombinant adenovirus Ad5PBlacZ, AdSMMTVlacZ and Ad5PS AlacZ were generated vi i ⁇ vjvorecombinantionin293 cells by cotransfectionofpJM17, an adenoviral genome plasmid and their coresponding shuttle vectors pPBlacZ, pMMTVlacZ and pPSAlacZ respectively. Plasmid DNA were transfected into 293 cells by calcium phosphate method 21 and cells were maintained in plaque overlay mixture. 22 Plaques were usuaUy appeared in 10 to 12 days.
  • primers specific to transgene i.e., one primer specific for promoter and the other primer specific for lacZ gene
  • the primers specific for three promoters PB, PSA, and MMTV were j .GCTACTCTGCACCTTGTCAG 3 ., j .GCTCCTGGGGGAGGCTCC.,, and j .GCGGAACGGACTCACCATAG j ..
  • the primer specific for lacZ was 5 .TCTGGCCTTCCTGTAGCCAGC 3 ,.
  • PCRwasperformedin a50- ⁇ l volume containing 250 ng DNA, 2 mM MgCl 2 , 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris-HCl (pH 8.4), 2 ⁇ M each ofthe primers, and 2,5 units of Taq DNA polymerase (Gibco BRL, Gaithersburg, MD).
  • the reaction was carried out at 94°C for 5 win; then for 30 cycles at 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min; foUowed by at 72 ⁇ C for 10 min.
  • Ad5RSVlacZ in which lacZ gene was under the control of Rous Sarcoma virus (RSV) promoter, was generated.
  • Adenoviral preparation Individual clones of each adenovirus was obtained by twice plaque purification. Single viral clones were propagated in 293 cells. The culture medium o he 293 ceUs showing the completed cytopatbic effect was collected and adenovirus was purified and concentrated by twice CsCl2 gradient ultracentrifugation. The viral titers were determined by plaque assays in 293 cells, 22
  • Xenograft tumors were estabHshed by injecting 5 x 10 6 various cancer cells subcutaneously into the flank of each male Balb/c nu/nu athymic nude mice (Harlan Sprague Dawley, Inc., IndianapoHs, IN). When tumors reached the size about 3-mm diameter, 5 x 10 9 pfu adenoviruses were injected directly onto tumor site. The mice were euthanatized in 3 days and the tumors and other organs were harvested and sections were prepared.
  • X-gal staining Cultured ceUs expressing lacZ gene were fixed for 5 min at 4°C in 2% (v/v) formaldehyde and 0.2% (v/v) glutaraldehyde in PBS and rinsed three times with PBS. The staining reaction was performed on ceUs by incubating overnight at 37°C in lmg/ml X-gal (5-bromo-4-chloro-3-indolyl- ⁇ -D-galactopyranoside) (Gibco BRL, Gaithersburg, MD), 5 mM potassium feiricyanide, 5 mM potassium ferrocyanide, and 2 mM MgCl 2 inPBS,
  • tumors samples were fixed in 4% fo ⁇ naldehyde for 30 min, then in 30% sucrose in PBS at 4°C until the samples sank to the bottom ofthe vial.
  • the samples were then snap-frozen in Hquid nitrogen in O.C.T, medium (Tissue-Tek/Sakura, Toirance, CA) and processed to cryosections by a Cryostat.
  • the cryosections were fixed in fo ⁇ naHn for 30 sec then processed for X-gal siaining as described.
  • tumors were fixed in 4% formaldehyde for 30 min, washed with PBS three times and incubated overnight at 37°C in lmg/ml X-gal, 10 mM potassium ferricyanide, lOmM potassium feirocyanide, 0.01% sodium deoxycholate, 0,02% NP40, and 2 mM MgCl 2 in PBS.
  • the stained tumors were then post-fixed for 24 hr in 2,5% glutaraldehyde, 1% formaldehyde, and 0, 1 M sodium deoxycholate (pH 7,0) in PBS.
  • ⁇ -galact sidase assay CeUs were harvested and lyzed by three cycles of freezing and thawing in 0.25 M Tris-HCL, pH 8.0. After contrifugation at 12,000 rpm in a microcentrifuge for 10 min at 4°C, the supernatant was collected. The protein concentration was determined by Coomassie Plus Protein Assay Reagent (Pierce, Rockford, IL). The colorimetric ⁇ -galactosidase assay was performed by using ⁇ -gal Assay Kit (Invitrogen, Carlsbad, CA) according to manufacturer's protocol.
  • RESULTS Four replication-deficient adenoviruses containing lacZ under the control of RSV and three different prostate-specific promoters (PSA, PB, MMTV) were generated. The promoter activity and specificity among these three prostate-specific promoters and with RSV promoter were compared in prostate,non-prostate, and breast cancer cells both in vitro and in vivo.
  • Promoter activity in vitro To compare the promoter activity in vitro, human prostate cancer PPC-1 cells were transduced by these Ad-lacZ at different moi. The in situ lacZ expression wasdeterminedby X-gal staining. To maximize the promoter activity invitro, dihydrotestosterone (DHT) was added to the ceUs transduced by Ad5PSAlacZ and Ad5PBlacZ because both PSA and PB promoters have ARE; dexamethasone (De ⁇ ) was added to the cells transduced by Ad5MMTVlacZ because MMTV LTR contains GRE. The number of blue ceUs were evaulated as to scale the promoter activity. As shown in Fig.
  • DHT dihydrotestosterone
  • De ⁇ dexamethasone
  • Promoter specificity in vitro The specificity of these three prostate-specific promoters were also studied in vitro in various ceU lines. Prostate-specific Ad-lacZ were transduced to prostate and non-prostate ceUs and the lacZ trangene expression was determined by X- gal staining. To differentiate the potential involvement of endogenous hormone and glucocorticoid to the activation of promoter, the cells transduced by Ad5PS AlacZ and Ad5PBIacZ were treated with or without with DHT, and the cells transduced by Ad5MMTVlacZ were treated with or without with Dex.
  • MMTV promoter (Ad5MMTVlacZ) activated lacZ expression in all the cells in the presence of its inducer Dex (Table 1), which was not suprising because MMTV promoter is used as an inducible promoter in general.
  • MMTV promoter In the absence of Dex, MMTV promoter only activated lacZ expression in three out of seven prostate cell lines, and the presence of Dex increased the lacZ expression dramatically.
  • MMTV promoter was active in MCF-7 breast cancer ceUs even in the absence of Dex. Again, it was not too suprising since MMTV promoter is derived from mouse mammary tumor virus.
  • PB promoters Ad5PSAlacZ and Ad5PBlacZ, along with AdSRSVlacZ, were injected into the xenograft tumors derived from human prostate cancer cells DU145 and PPC-1, or from human bladder cancer ceUs RT4, In situ lacZ transgene expression was detected by X-gal staining of tumor sample cryosection 72 hr later. Untransduced control DU145 tumor (Fig. 16C) and PPC-1 tumor did not express endogenous lacZ after X-gal staining. While control virus Ad5RSVlacZ showed blue cells in tumors derived from all these three cell lines (Fig.
  • AdSPSAlacZ and Ad5PBlacZ can effectively transduce prostate ceUs both in vitro and in vivo, with a greater promoter specificity in vivo than m vitro.
  • Promoter activity in vivo To compare the promoter activity in vivo, X-gal staining of cryosection and whole-mount of human prostate xenograft tumor transduced by various Ad-lacZ were compared. Fig.6 showed the X-gal staining of he whole amount of tumors transduced by Ad5RSVlacZ or Ad5PBlacZ. The percentage of blue cell in tumor transduced by 1x1010 pfu Ad5PBlacZ is equal or less than that in tumor transduced by 1x109 pfu AdSRSVlacZ (compare Fig. l7A and 17B), indicating that prostate specific promoter had one log less activity compared to that of RSV promoter in vivo , as iUustrated in vitro.
  • MMTV-TGFalpha transgenic mice Cell 1990; 61: 1147-1155. 8.
  • Halter SA et al Distinctive patterns of hyperplasia in MMTV-TGF ⁇ transgenic mice: characterization of mammary gland and skin proHferations.
  • Prostate specific antigen a critical assessment ofthe most useful tumor marker for adenocarcinoma ofthe prostate, J Urol 1991 ; 145: 907-923.
  • Matuo Y et al The androgen-depende ⁇ t rat prostate protein, probasin, is a hep - n-bindingprotein that co-purifies withheparin-binding growth factor-1, In vitro CellDev Biol 1989; 25: 581-584.
  • Greenberg NM et al The rat probasin gene promoter directd hormonaUy and developmentaUy regulated expression of a heterologous gene specificall to the prostate in transgenic mice. Moi Endocrinol 1994; 8: 230-239, 20. Greenberg NM et l. Prostate cancer in a transgenic mouse. Proc Natl Acad

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Nanotechnology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Medical Informatics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé d'induction de la cytotoxicité cellulaire d'une cellule tumorale et de traitement d'un sujet cancéreux au moyen d'un vecteur d'expression d'adénovirus type 5 déficient en réplication, comprenant un génome adénoviral ayant une délétion dans les régions E1 et E3 du génome et une insertion dans la région d'un acide nucléique codant pour une β-galactosidase, sous contrôle d'un virus du sarcome de Rous, de probasine, d'un antigène spécifique de la prostate ou d'un promoteur de virus tumoral mammaire de la souris.
PCT/US1999/020907 1998-10-02 1999-10-01 Procede de traitement du cancer de la prostate au moyen d'un vecteur adenoviral WO2000020038A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU10912/00A AU1091200A (en) 1998-10-02 1999-10-01 Method of treating prostate cancer with an adenovirus vector

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US16573098A 1998-10-02 1998-10-02
US09/165,730 1998-10-02

Publications (1)

Publication Number Publication Date
WO2000020038A1 true WO2000020038A1 (fr) 2000-04-13

Family

ID=22600207

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/020907 WO2000020038A1 (fr) 1998-10-02 1999-10-01 Procede de traitement du cancer de la prostate au moyen d'un vecteur adenoviral

Country Status (2)

Country Link
AU (1) AU1091200A (fr)
WO (1) WO2000020038A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101261869B1 (ko) 2006-03-28 2013-05-07 동아쏘시오홀딩스 주식회사 이동성이 있는 분비가능한 동형삼중체 형성능을 가진 재조합 트레일을 코딩하는 유전자를 포함하는 유전자 전달체

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BRODY ET AL.: "Adenovirus-mediated in vivo gene transfer", ANNALS OF THE NEW YORK ACADEMY OF SCIENCES, vol. 716, 31 May 1994 (1994-05-31), pages 90 - 102, XP002926251 *
HYER ET AL.: "Adenovirus-mediated gene transfer of GFP (green fluorescent protein) to mouse and human prostate cells", CANCER GENE THERAPY, vol. 4, no. 6, 20 November 1997 (1997-11-20), pages S29 - S30, SEE ABSTRACT P-63, XP002926253 *
LU ET AL.: "Development of prostate-targeted adenoviruses for prostate cancer gene therapy", CANCER GENE THERAPY, vol. 4, no. 6, 20 November 1997 (1997-11-20), pages S29, SEE ABSTRACT P-62, XP002926249 *
SIDERS ET AL.: "Transcriptional targeting of recombinant adenoviruses to human and murine melanoma cells", CANCER RESEARCH, vol. 56, 15 December 1996 (1996-12-15), pages 5638 - 5646, XP002926252 *
STRATFORD-PERRICAUDET ET AL.: "Widespread long-term gene transfer to mouse skeletal muscles and heart", JOURNAL OF CLINICAL INVESTIGATION, vol. 90, August 1992 (1992-08-01), pages 626 - 630, XP002926250 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101261869B1 (ko) 2006-03-28 2013-05-07 동아쏘시오홀딩스 주식회사 이동성이 있는 분비가능한 동형삼중체 형성능을 가진 재조합 트레일을 코딩하는 유전자를 포함하는 유전자 전달체

Also Published As

Publication number Publication date
AU1091200A (en) 2000-04-26

Similar Documents

Publication Publication Date Title
Tolstoshey Gene therapy, concepts, current trials and future directions
Roth et al. Gene therapy for cancer: what have we done and where are we going?
JP4213201B2 (ja) 固型腫瘍、乳頭腫および疣贅の遺伝子治療
KR100795626B1 (ko) 도처에 있는 염색질 개방 요소(유씨오이)를 포함하는폴리뉴클레오티드
US7125549B2 (en) Methods and compositions for efficient gene transfer using transcomplementary vectors
US6806080B2 (en) Hybrid vectors for gene therapy
WO1998055639A2 (fr) Vecteurs adenoviraux recombinants comprenant une sequence d'epissage
US6989375B2 (en) Enhanced expression of transgenes
US7179646B2 (en) Gene expression using T cell factor responsive element
WO1995010623A1 (fr) Transfert selectif adenoviral de genes vers les cellules neointimales vasculaires
JP2006502726A (ja) 改善された免疫療法
EP0918875A1 (fr) Nouveau site interne d'entree des ribosomes et vecteur le contenant
EP1002120B1 (fr) Vecteurs adenoviraux chimeres
WO2000020038A1 (fr) Procede de traitement du cancer de la prostate au moyen d'un vecteur adenoviral
EP0935471B1 (fr) Phagocytes mononucleaires utilises dans l'apport de medicament therapeutique
AU2001270614B2 (en) Chimeric promoters for controlling expression in smooth muscle cells
Licht et al. Retroviral transfer of human MDR1 gene to hematopoietic cells: effects of drug selection and of transcript splicing on expression of encoded P-glycoprotein
AU2001270614A2 (en) Chimeric promoters for controlling expression in smooth muscle cells
WO2000020608A1 (fr) Procede de traitement du cancer de la prostate au moyen d'un vecteur d'expression adenoviral codant pour une enzyme de promedicament
Castro et al. Gene therapy strategies for intracranial tumours: glioma and pituitary adenomas
Ardelt et al. Molecular aspects of bladder cancer IV: gene therapy of bladder cancer
US6669935B1 (en) Delivery of therapeutic agents by gene therapy
TWI402342B (zh) 用於治療腫瘤之組成物及方法
US6132989A (en) Methods and compositions for enhanced stability of non-adenoviral DNA
WO2000014256A1 (fr) Therapie genique pour le traitement du cancer

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref country code: AU

Ref document number: 2000 10912

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase