WO2000018908A1

WO2000018908A1 - Use of specific hybrid promoters for controlling tissue expression

Info

Publication number: WO2000018908A1
Application number: PCT/FR1999/002265
Authority: WO
Inventors: Didier Branellec; Raphaël Darteil; Abderrahim Mahfoudi; Daniel Scherman
Original assignee: Aventis Pharma S.A.
Priority date: 1998-09-25
Filing date: 1999-09-23
Publication date: 2000-04-06
Also published as: HUP0105230A2; KR20010075338A; EP1115857A1; AU5632499A; AU775717B2; CA2343922A1; JP2002525109A; IL142107A0; CN1326506A; HUP0105230A3

Abstract

The invention concerns a hybrid promoter comprising: all or part of the enhancer region of a strong and ubiquitous promoter/enhancer; a promoter region enabling specific expression in smooth muscle cells, and all vector or cell containing said promoter, and their uses.

Description

USE OF SPECIFIC HYBRID PROMOTERS TO CONTROL TISSUE EXPRESSION

The present invention relates to the field of biology, and in particular to the field of regulation of gene expression. It describes in particular new constructions and new vectors allowing a targeted and strong expression of genes. The present invention can be used in many fields, and in particular for the production of recombinant proteins, for the creation of transgenic animal models, for the creation of cell lines, for the development of screening tests, or even in gene therapy. and cellular.

The ability to control and direct gene expression is a very important issue in the development of biotechnology. In vitro, it can make it possible to improve the conditions for the production of recombinant proteins, by using specific populations of cells. Still in vitro, it can allow the detection or the demonstration of the presence of specific populations of cells in a sample, or also to test the properties of a product or the regulation of a gene in a specific population of cells. The control of gene expression is also very important for ex vivo or in vivo therapeutic approaches, in which the possibility of selectively controlling the production of a therapeutic molecule is essential. In fact, depending on the applications, depending on the gene to be transferred, it is important to be able to target certain tissues or only certain parts of an organism in order to concentrate the therapeutic effect and limit dissemination and side effects.

Targeting the expression of a given nucleic acid can be achieved using different approaches. A first approach consists, for example, in using vectors or transfer agents having a specific cell specificity. However, the specificity conferred by this type of vector is generally quite coarse and does not allow targeting of precise populations of cells. Another approach is to use expression signals specific for certain cell types. In this regard, so-called "specific" promoters have been described in the literature, such as the promoter of genes coding for pyruvate kinase, villin, GFAP, the promoter of the intestinal fatty acid binding protein, the α-actin promoter of smooth muscle cells, the SM22 promoter or also the promoter of the human albumin gene for example. However, if these promoters have tissue specificity, they also have, in return, a relatively low potency. Thus, the vast majority of these promoters have activity levels which are well below those of so-called "strong" promoters, generally by a factor of between 10 and 100 at least. In addition, it is generally considered that the specificity of a promoter is inversely proportional to its strength and that, the more the strength is increased, the higher the level of non-specific activity.

It would therefore be particularly advantageous to be able to have promoters which are both specific for certain tissues and strong. The object of the present invention is precisely to provide new constructions allowing the strong and targeted expression of genes.

The invention describes in particular new chimeric promoters allowing a strong and specific gene expression of smooth muscle cells. The invention also describes vectors containing such promoters and their use for the transfer of genes into cells in vitro, ex vivo and in vivo. The constructs of the invention make it possible for the first time to combine opposite properties, namely high selectivity and high transcriptional activity. The present invention thus provides a particularly efficient means for targeting the expression of genes in smooth muscle cells, in vivo or in vitro, and for regulating this expression.

The invention is based more particularly on the construction of chimeric (or hybrid) promoters, comprising regions of origin and of different function. More particularly, a first object of the invention resides in a hybrid promoter comprising:

- all or part of the enhancer region of a strong and ubiquitous promoter / enhancer, and - a promoter region allowing specific expression in smooth muscle cells.

The association of enhancer regions and promoters has already been described in the prior art. Thus, it is known, for example, to couple the enhancer region of CMV with non-specific promoters such as the promoter of the chicken β-actin gene (WO96 / 13597) in order to increase their strength. However, such constructions have not been described or suggested for the purpose of attempting to obtain a strong and specific expression of smooth muscle cells. The invention is based in part on the selection and combination of specific "enhancer" elements and specific "promoter" elements. The invention is also based on the demonstration that this combination of elements makes it possible to obtain expression at high levels, without affecting the selectivity of the promoter for the target cells of smooth muscle. The invention therefore provides particularly advantageous constructions since they allow targeted production and with high levels of molecules in smooth muscle cells. In addition, the present application also shows that these constructs can be used both in vitro and in vivo.

In the hybrid promoters according to the invention, the enhancer region and the promoter region are associated in a functional manner, that is to say so that the enhancer region exerts a stimulating activity on the activity of the promoter region. Generally, these two regions are therefore genetically linked and are close enough to each other to allow the enhancer region to activate the promoter region. Preferably, the distance separating the enhancer region and the promoter region is less than 1 kb, more preferably less than 500 bp. In the particularly preferred constructions according to the invention, these two regions are spaced less than 400 bp, more preferably less than 200 bp. In addition, as the examples show, the respective orientation of the two regions has no significant influence on the activity of the hybrid promoters of the invention. Therefore, the enhancer region can be positioned in the same orientation or in the reverse orientation with respect to the direction of transcription of the promoter region. In a preferred embodiment, the enhancer region is chosen from the enhancer region of the immediate early cytomegalovirus gene (CMV-IE), the enhancer region of the red sarcoma virus LTR (LTR-RSV), the enhancer region SV40 virus, and the enhancer region of the EF1α gene. More preferably, in the hybrid promoters of the invention, the enhancer region is the enhancer region of the immediate early gene of the cytomegalovirus (CMV-IE), preferably of the human cytomegalovirus (hCMV-IE). A particular enhancer region consists for example of the fragment -522 to -63 of the hCMV-IE gene, or of any fragment comprising at least part of it and exhibiting enhancer activity.

As regards the promoter region, a region comprising all or part of the promoter of the gene coding for α-actin of smooth muscle cells (SMact) or of the SM22 gene is advantageously used for implementing the invention. The promoter of these genes has been described for its specific character of smooth muscle cells (see in particular Ueyama H. et al., Mol. Cell. Biol, 4 (1984) 1073-1078; Solway J. et al., J. Biol. Chem., 270 (1995) 13460-13469).

A first particularly advantageous variant of the present invention consists of a hybrid promoter comprising:

- all or part of the enhancer region of the immediate early gene of the human cytomegalovirus (hCMV-IE), and

- All or part of the promoter of the gene coding for α-actin of smooth muscle cells (SMact), preferably of the human Smact gene.

A second particularly advantageous variant of the present invention consists of a hybrid promoter comprising:

- All or part of the promoter of the SM22 gene, preferably of the mouse SM22 alpha gene.

Furthermore, in a particular embodiment of the invention, the promoter region used is a chimeric region comprising a basal promoter and a sequence conferring tissue specificity, said sequence being derived from the SMact promoter or from the SM22 promoter, or from a combination of the two. In this embodiment, the basal promoter can be a "minimal" promoter, that is to say comprising only the sequences essential to the activity of transcriptional promoter (for example a TATA box). This basal promoter can be the own basal promoter of the SMact or SM22 gene, or of heterologous origin (β-globin, HSV-TK, SV40 or EF1-α for example). The sequence conferring tissue specificity advantageously comprises part of the sequence of the SMact promoter (RT Shimizu et al. J. Biol. Chem. 270 (1995) 7634-7643) and / or of the SM22 promoter (L. Li et al. J Cell Biol. 132 (1996) 849-859; S. Kim et al. J. Clin. Invest. 100 (1997) 1006-1014; Kemp et al. Biochem. J. 310 (1995) 1037-1043). A particular type of hybrid promoter according to the invention therefore comprises:

- all or part of the enhancer region of a strong and ubiquitous promoter / enhancer,

- a basai promoter and,

- A sequence conferring tissue specificity comprising all or part of the SMact promoter and / or the SM22 promoter.

For the construction of the hybrid promoters of the invention, the techniques of molecular biology known to those skilled in the art can be used. Thus, the enhancer region and the promoter region (including the basal promoter and the sequence conferring tissue specificity) can be isolated by conventional techniques from nucleic acid libraries or from total cellular DNA, for example by amplification by means of specific probes. These fragments can also be synthesized artificially using the sequence information available in the prior art. When these fragments are obtained, they can be easily combined with one another by means of ligases and other restriction enzymes, to generate hybrid promoters of the invention. In addition, these fragments can be modified by digestion, mutation, insertion or addition of base pairs, either in order to facilitate their cloning, or in order to modify their functional properties. Furthermore, as indicated above, the fragments can be associated directly with one another or, on the contrary, spaced by base pairs having no significant influence on the activity of the hybrid promoter. The hybrid promoters of the invention thus have the capacity to express a nucleic acid of interest in a specific manner in smooth muscle cells. The "specific" character of the expression means that the promoter activity is significantly very higher in the smooth muscle cells. Although a non-specific expression can exist in other cells, the corresponding level of activity generally remains very low (negligible) compared to that observed in smooth muscle cells, generally at least a factor of 10 . The results presented in the examples show in this respect an expression differential which can reach a factor of 140, which testifies to the high selectivity of the promoters of the invention. In this regard, the results presented also show a high specificity with regard to smooth muscle cells since no expression was detected in the endothelial cells which are located in the vicinity, in the blood vessel, in particular the artery. The results presented in the examples also show that the strength of the promoters of the invention is much greater than that of specific non-hybrid promoters, the differential being able to exceed a factor of 100. These elements therefore illustrate the advantageous and unexpected properties of hybrid promoters of the invention, in terms of strength and specificity, for the expression of nucleic acids of interest in smooth muscle cells.

In this regard, another subject of the invention relates to an expression cassette comprising a nucleic acid coding for an RNA or a polypeptide of interest, placed under the control of a hybrid promoter as defined above. Advantageously, the cassette of the invention further comprises a transcription termination signal, placed 3 'to the nucleic acid.

Taking into account the cell populations targeted by the cassettes of the invention, the nucleic acid can code, for example, for a protein chosen from: proteins involved in the cell cycle, such as for example p21 or any other kinase inhibitor protein cyclin-dependent (cdk), the retinoblastoma (Rb) gene product, GAX, GAS-1, GAS-3, GAS-6, Gadd 45, Gadd 153, cyclins A, B and D. apoptosis, such as for example p53, members of the family of apoptosis inducers such as Bas, Bcl-X _s , Bad or any other antagonist of Bcl ₂ and of Bcl-Xi. proteins capable of modifying the proliferation of smooth muscle cells, such as for example an intracellular antibody or an ScFv inhibiting the activity of proteins involved in cell proliferation, such as for example the Ras protein, mapkinase, or receptors for tyrosine kinase or growth factors. labeling proteins (LacZ, GFP, Luc, secreted alkaline phosphatase (SeAP), growth hormone (GH) etc) in order to carry out proliferation studies or diagnostic studies, proteins inducing angiogenesis, such as for example members of the VEGF family, members of the FGF family and more particularly FGF1, FGF2, FGF4, FGF5, angiogenin, EGF, TGFα, TGFβ, TNFα, Scatter Factor / HGF , members of the angiopoetins family, cytokines and in particular interleukins including IL-1, IL-2, IL-8, angiotensin-2, plasminogen activator (TPA), urokinase (uPA) , the molecules involved in the synthesis of active lipids (prostaglandins, Cox-1). transcription factors, such as for example natural or chimeric nuclear receptors, comprising a DNA binding domain, a ligand binding domain and a transcription activating or inhibiting domain, such as for example fusion proteins tetR-NLS-VP16, estrogen receptor fusion proteins, steroid hormone receptor fusion proteins, progesterone receptor fusion proteins, CID (Chemical Inducer of) proteins Dimerization) described by Rivera et al. (Rivera et al. (1996), A humanized

System for pharmacology control of gene expression, Nature Médecine, 2

: 1028-1032).

It is understood that the present invention is not limited to particular examples of proteins or RNA, but that it can be used by a person skilled in the art for the expression of any nucleic acid in smooth muscle cells, for example. simple usual experimental operations.

Another subject of the invention also relates to any vector comprising a hybrid promoter or a cassette as defined above. The vector of the invention can be for example a plasmid, a cosmid or any DNA not encapsulated by a virus, a phage, an artificial chromosome, a recombinant virus, etc. It is preferably a plasmid or a recombinant virus.

Among the plasmid type vectors, mention may be made of all the cloning and / or expression plasmids known to those skilled in the art and which generally have an origin of replication. Mention may also be made of new generation plasmids carrying origins of replication and / or improved markers as described for example in applications WO96 / 26270 and PCT / FR96 / 01414.

Among the vectors of the recombinant virus type, there may preferably be mentioned adenovirus viruses, retroviruses, herpes virus or recombinant adeno-associated viruses. The construction of this type of recombinant virus defective for replication has been widely described in the literature, as well as the infection properties of these vectors (see in particular S. Baeck and KL March (1998), Circul. Research vol. 82, pp 295-305), T. Shenk, BN Fields, DM Knipe, PM Howley et al (1996), Adenoviridae: the viruses and their replication (in virology). Pp 211-2148, EDS - Ravenspublishers / Philadelphia, P. Yeh and M. Perricaudet (1997), FASEB Vol. 11, pp 615-623.

A particularly preferred recombinant virus for the implementation of the invention is a defective recombinant adenovirus.

Adenoviruses are linear double-stranded DNA viruses around 36 (kilobases) kb in size. There are different serotypes, including the structure and properties vary somewhat, but have a comparable genetic organization. More particularly, the recombinant adenoviruses can be of human or animal origin. As regards adenoviruses of human origin, mention may preferably be made of those classified in group C, in particular adenoviruses of type 2 (Ad2), 5 (Ad5), 7 (Ad7) or 12 (Adl2). Among the various adenoviruses of animal origin, mention may preferably be made of adenoviruses of canine origin, and in particular all the strains of the adenovirus CAV2 [Manhattan strain or A26 / 61 (ATCC VR-800) for example]. Other adenoviruses of animal origin are cited in particular in application WO94 / 26914 incorporated herein by reference.

The adenovirus genome includes in particular a repeated inverted sequence (ITR) at each end, an encapsidation sequence (Psi), early genes and late genes. The main early genes are contained in the E1, E2, E3 and E4 regions. Among these, the genes contained in the El region in particular are necessary for viral propagation. The main late genes are contained in regions L1 to L5. The genome of the Ad5 adenovirus has been fully sequenced and is accessible on the database (see in particular Genebank M73260). Likewise, parts or even all of other adenoviral genomes (Ad2, Ad7, Ad 12, etc.) have also been sequenced.

For their use as recombinant vectors, various constructs derived from adenoviruses have been prepared, incorporating different therapeutic genes. In each of these constructions, the adenovirus was modified so as to render it incapable of replication in the infected cell. Thus, the constructions described in the prior art are deleted adenoviruses from the E1 region, essential for viral replication, at the level of which heterologous DNA sequences are inserted (Levrero et al, Gene 101 (1991) 195; Gosh -Choudhury et al., Gene 50 (1986) 161). Furthermore, to improve the properties of the vector, it has been proposed to create other deletions or modifications in the genome of the adenovirus. Thus, a thermosensitive point mutation was introduced into the mutant ts125, making it possible to inactivate the 72kDa DNA binding protein (DBP) (Van der Vliet et al., 1975). Other vectors include a deletion from another region essential for replication and / or viral propagation, the E4 region. The E4 region is in fact involved in the regulation of the expression of late genes, in the stability of late nuclear RNA, in the extinction of the expression of proteins of the host cell and in the efficiency of replication of l 'Viral DNA. Adenoviral vectors in which the E1 and E4 regions are deleted therefore have very reduced transcription background noise and expression of viral genes. Such vectors have been described by example in applications WO94 / 28152, WO95 / 02697, WO96 / 22378). In addition, vectors carrying a modification in the IVa2 gene have also been described (WO96 / 10088).

In a preferred embodiment of the invention, the recombinant adenovirus is a human adenovirus of group C. More preferably, it is an adenovirus Ad2 or Ad5.

Advantageously, the recombinant adenovirus used in the context of the invention comprises a deletion in the E1 region of its genome. Even more particularly, it includes a deletion of the Ela and Elb regions. As a specific example, mention may be made of deletions affecting nucleotides 454-3328; 382-3446 or 357-4020 (with reference to the Ad5 genome).

According to a preferred variant, the recombinant adenovirus used in the context of the invention further comprises a deletion in the E4 region of its genome. More particularly, the deletion in the E4 region affects all of the open phases. As a specific example, the deletions 33466-35535 or 33093-35535 can be cited. Other types of deletions in the E4 region are described in applications WO95 / 02697 and WO96 / 22378, incorporated herein by reference.

The expression cassette can be inserted at different sites of the recombinant genome. It can be inserted at the level of the E1, E3 or E4 region, replacing the deleted or surplus sequences. It can also be inserted at any other site, apart from the sequences necessary in cis for the production of viruses (ITR sequences and packaging sequence). Recombinant adenoviruses are produced in an packaging line, that is to say a cell line capable of complementing in trans one or more of the deficient functions in the recombinant adenoviral genome. Among the packaging lines known to those skilled in the art, mention may be made, for example, of line 293 in which a part of the adenovirus genome has been integrated. More specifically, line 293 is a human embryonic kidney cell line containing the left end (approximately 11-12%) of the genome of the adenovirus serotype 5 (Ad5), comprising the left ITR, the packaging region , the El region, including Ela and Elb, the region coding for the pIX protein and part of the region coding for the pIVa2 protein. This line is capable of trans-complementing recombinant adenoviruses defective for the E 1 region, that is to say devoid of all or part of the E1 region, and of producing viral stocks having high titers. This line is also capable of producing, at permissive temperature (32 ° C.), stocks of virus further comprising the thermosensitive E2 mutation. Other cell lines capable of complementing the E1 region have been described, based in particular on human lung carcinoma cells A549 (WO94 / 28152) or on human retinoblasts (Hum. Gen. Ther. (1996) 215). Furthermore, lines capable of trans-complementing several functions of the adenovirus have also been described. In particular, mention may be made of lines complementing the El and E4 regions (Yeh et al., J. Virol. Vol. 70 (1996) pp 559-565; Cancer Gen. Ther. 2 (1995) 322; Krougliak et al. , Hum. Gen. Ther. 6 (1995) 1575) and lines complementing the El and E2 regions (WO94 / 28152, WO95 / 02697, WO95 / 27071).

Recombinant adenoviruses are usually produced by the introduction of viral DNA into the packaging line, followed by lysis of the cells after approximately 2 or 3 days (the kinetics of the adenoviral cycle being 24 to 36 hours). For the implementation of the method, the viral DNA introduced may be the complete recombinant viral genome, optionally constructed in a bacterium (WO96 / 25506) or in a yeast (WO95 / 03400), transfected in the cells. It can also be a recombinant virus used to infect the packaging line. The viral DNA can also be introduced in the form of fragments each carrying a part of the recombinant viral genome and a zone of homology allowing, after introduction in the packaging cell, to reconstitute the recombinant viral genome by homologous recombination between the different fragments.

After the cell lysis, the recombinant viral particles are isolated by centrifugation in a cesium chloride gradient. An alternative method has been described in application FR96: 08164 incorporated herein by reference.

The invention also relates to a composition comprising a vector as defined above and a chemical or biochemical transfer agent. The term "chemical or biochemical transfer agent" is understood to mean any compound (i.e., other than a recombinant virus) facilitating the penetration of a nucleic acid into a cell. They can be cationic non-viral agents such as cationic lipids, peptides, polymers (Polyethylene Imine, Polylysine), nanoparticles; or non-cationic non-viral agents such as non-cationic liposomes, polymers or non-cationic nanoparticles. Such agents are well known to those skilled in the art.

The invention also relates to a composition comprising a recombinant virus as defined above and a physiologically acceptable vehicle.

The invention also relates to a pharmaceutical composition comprising a vector as described above. The pharmaceutical compositions of the invention can be formulated for topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc. administration.

Preferably, the pharmaceutical composition contains pharmaceutically acceptable vehicles for an injectable formulation, in particular for an intravascular injection or in the tissues of smooth muscle. They can be in particular saline solutions (monosodium phosphate, disodium, sodium chloride, potassium, calcium or magnesium, etc., or mixtures of such salts), sterile, isotonic, or dry compositions, in particular lyophilized, which, through addition according to the case of sterilized water or physiological saline, allow the constitution of injectable solutes. Other excipients can be used such as for example a hydrogel. This hydrogel can be prepared from any biocompatible and non-cytotoxic polymer (homo or hetero). Such polymers have for example been described in application WO93 / 08845. Some of them, such as in particular those obtained from ethylene oxide and / or propylene, are commercial. The use of a hydrogel is particularly advantageous for the transfer of nucleic acids into the vascular walls, and in particular into the smooth muscle cells of the vascular walls. The doses used for the injection can be adapted according to different parameters, and in particular according to the mode of administration used, the aim pursued (labeling, pathology, screening, etc.), the gene to be expressed, or even the duration of the expression sought. In general, the recombinant viruses according to the invention are formulated and administered in the form of doses of between 10 ^ and 10 ^ pfu, and preferably 10 ^ to 10θ pfu. The term pfu ("plaque forming unit") corresponds to the infectious power of a viral solution, and is determined by infection of an appropriate cell culture, and measurement of the number of plaques of infected cells. The techniques for determining the pfu titer of a viral solution are well documented in the literature. For in vitro or ex vivo use, the cassettes, vectors or compositions of the invention can be incubated at conventional doses in the presence of the selected cell populations. These incubations can be carried out on culture dishes, flasks, fermenters, or any other device chosen.

Furthermore, the invention also relates to any cell modified by a cassette or a vector (in particular an adenovirus) as described above. The term “modified” cell is understood to mean any cell containing a construct according to the invention. These cells can be used for the production of recombinant proteins in vitro. They can also be intended for implantation in an organism, according to the methodology described in application WO95 / 14785. These cells are preferably human smooth muscle cells. The invention also relates to the use of a hybrid promoter as defined above for the specific expression of a nucleic acid in smooth muscle cells, in vitro, ex vivo or in vivo.

The invention also relates to the use of a hybrid promoter as defined above for the preparation of a composition intended for the expression of a nucleic acid in smooth muscle cells in vivo and not in endothelial cells which are in the vicinity in the artery.

Because of their specific character of smooth muscle cells, the constructs according to the invention can also be used for the creation of animal models of vascular pathologies or for carrying out labeling studies or in methods of detecting or screening for presence of smooth muscle cells in samples.

The present invention also relates to a method for producing recombinant proteins comprising the introduction into a cell population of a vector as defined above, the culture of said recombinant cell population, and the recovery of said protein produced. Advantageously, for the implementation of the method of the invention, smooth muscle cells are used. These can be established lines or primary cultures.

The present application will be described in more detail with the aid of the following examples, which should be considered as illustrative and not limiting.

LEGEND OF FIGURES

Table I: Relative activities of hybrid promoters (hSMα-actin) evaluated in transient transfections in vitro in rabbit smooth muscle cells in primary culture (rabbit SMC), in ECV304 cells, in C2C12 myoblasts, in HeLa cells, in NIH 3T3 cells, in TU182 carcinoma cells, as well as in renal 293 cells. The relative activity of each promoter is expressed as a percentage of luciferase activity obtained with the plasmid pCMV-leadTK. Enh-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X according to its normal orientation. HnE-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X in the opposite orientation.

Table II: Relative activities of hybrid promoters (mSM22) evaluated in transient transfections in vitro in rabbit smooth muscle cells in primary culture (rabbit SMC), in ECV304 cells, in C2C12 myoblasts, in HeLa cells, in cells NIH 3T3, in TU182 carcinoma cells, as well as in renal cells 293. The relative activity of each promoter is expressed as a percentage of the luciferase activity obtained with the plasmid pCMV-leadTK. Enh-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X according to its normal orientation. HnE-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X in the opposite orientation.

Figure 1: Schematic representations of the plasmids whose expression cassette contains the hybrid promoter hSMα-actin.

Figure 2: Schematic representations of the plasmids whose expression cassette contains the hybrid promoter mSM22α.

Figure 3: Activities of hybrid promoters evaluated in transient transfections in vitro in rabbit smooth muscle cells in primary culture (rabbit SMC), in endothelial cells derived from human umbilical cord carcinoma (ECV304), in myoblasts of mice (C2C12) as well as in epithelial cells from a carcinoma of the human cervix (HeLa). The relative activity of each promoter is expressed as a percentage of the luciferase activity obtained with the plasmid pCMV-leadTK. Enh-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X according to its normal orientation. hnE-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X in the opposite orientation. Figure 4: Activities of hybrid promoters evaluated in transient transfections in vitro in mouse embryonic fibroblasts (NIH 3T3), in cells derived from a human ENT carcinoma (TU182), as well as in transformed human embryonic renal cells (293) . The relative activity of each promoter is expressed as a percentage of the luciferase activity obtained with the plasmid pCMV-leadTK. Enh-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X according to its normal orientation. hnE-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X in the opposite orientation.

Figure 5: Activities of hybrid promoters evaluated in gene transfer in vivo in the cranial tibial muscle of C57BL6 mice. The relative activity of each promoter is expressed as a percentage of the luciferase activity obtained with the plasmid pCMV-leadTK.

MATERIALS AND METHODS

The methods conventionally used in molecular biology such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in cesium chloride gradient, electrophoresis on agarose gels, purification of DNA fragments by electroelution, precipitation of plasmid DNA in a saline medium with ethanol or isopropanol, the transformation in Escherichia coli are well known to those skilled in the art and are abundantly described in the literature (Sambrook et al. "Molecular Cloning, a Laboratory Manual ", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989).

The plasmid pGL3 -Basic, used for cloning the different promoter regions, is of commercial origin (Promega Corporation). The plasmids pCMVβ (Clontech Laboratories Inc.) and pUC18 (Boehringer Mannheim) are also of commercial origin. The enzymatic amplification of DNA fragments by the PCR technique (Polymerase Chain Amplification) can be carried out using a DNA thermal cycler ^τ (Perkin Elmer Cetus) according to the manufacturer's recommendations.

The electroporation of plasmid DNA in Escherichia coli cells can be carried out using an electroporator (Bio-Rad) according to the manufacturer's recommendations.

Verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. (Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467) using the kit distributed by Applied Biosystems according to the manufacturer's recommendations.

EXAMPLES

EXAMPLE 1 Construction of hybrid promoters and expression plasmids containing them.

1.1. HSMα-actin hybrid promoters.

. PhSMact plasmid. The high molecular weight genomic DNA was prepared according to the method described by Sambrook et al. ("Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989) from a primary culture of human aortic smooth muscle cells (Clonetics).

This DNA was used as a template for a first amplification by PCR using the following primers:

- Primer 6417 (5 'GATGGTCCCTACTTATGCTGCTA 3') (SEQ ID 1) starting at position -1034 (promoter region) of the human specific smooth muscle α-actin gene (Ueyama H. et al., Mol. Cell. Biol, 4 (1984) 1073-1078. Access Genbank D00618). - Primer 6418 (5 'CTTCCATCATACCAAACTACATA 3') (SEQ ID 2) at position 1974 of the sequence D00618 located inside the first intron of the hSMact gene. The reaction mixture comprises 1 mg of genomic DNA, 10 pmol of each of the two primers (6417 and 6418), 100 mM of each deoxyribonucleotide (dATP, dCTP, dGTP, dTTP), 2 mM MgC12 and 5 units of Taq DNA polymerase ( PerkinElmer). The reaction volume is made up to 50 ml adjusted to the optimal concentration of the ACP buffer recommended by Perkin Elmer.

The PCR amplification is carried out in Micoamp ™ tubes (Perkin Elmer) using a PTC-100 ™ thermocycler (MJ Research, Inc.). This amplification consists of a denaturation step at 95 ° C for 2 min followed by 30 cycles including a denaturation step of 15 sec at 95 ° C, a hybridization step of 30 sec at 60 ° C and an extension step 1 min at 72 ° C. These thirty cycles are followed by an additional extension of 5 min then the ACP reactions are stored at 10 ° C.

A microliter of this reaction was taken from this first reaction and then diluted in 10 ml of water. Then 1 ml of this dilution was used to make a second PCR under the same conditions as the first (above) but with a different pair of primers:

Primer 6453 (5 'CTGCTAAATTGctcgagGACAAATTAGACAAA 3 ^* ) (SEQ ID 3), this primer introduces an Xhol site (lowercase underlined) upstream of the hSMact promoter (position -680).

- Primer 6456 (5 'CCCTGACAaagcttGGCTGGGCTGCTCCACTGG 3') (SEQ ID 4), this primer introduces a HindIII site in position +30 of hSMact.

After analysis on an agarose gel and then purification, the DNA fragment amplified by PCR is digested for 3 hours at 37 ° C. with Xhol and HindIII and then cloned into the vector pGL3-Basic (Promega) previously digested with these same enzymes. restriction, to generate the plasmid phSMact (Figure 1).

. Plasmids pXL3130 and pXL3131. A DNA fragment corresponding to the enhancer region of the promoter of the human cytomegalovirus IE gene (hCMV-IE) between the positions -522 and -63 relative to the site of initiation of the transcription, was amplified by PCR using the plasmid pCMVβ as template and the oligonucleotides 8557 (5 'ATC GAC GCG TGC CCG TTA CAT AAC TTA CGG 3') (SEQ ID 5) and 8558 (5 'ATC GAC GCG TCC GCT CGA GCG TCA ATG GGG CGG AGT TG 3 ') (SEQ ID 6) as primers. This fragment was digested with MluI and then was cloned into the plasmid phSMact previously digested with MluI and treated with alkaline phosphatase. Depending on the direction of insertion of the fragment, two different plasmids were obtained: pXL3130 and pXL3131. The schematic representations of these plasmids are gathered in the figure (Figure 1). These plasmids comprise, in the form of an Mlul-Nçol fragment, a hybrid promoter consisting of the enhancer of the promoter of the hCMV-IE gene and of the promoter of the hSMα-actin gene.

1.2. Hybrid mSM22 promoters.

. PmSM22 plasmid. The high molecular weight genomic DNA was prepared according to the method described by Sambrook et al. ("Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989) from a liver of Balbc mice.

This DNA was used as a template for PCR amplification using the following primers:

- Primer 6517:

(5 'CCAGGCTGCActcgagACTAGTTCCCACCAACTCGA 3') (SEQ ID 7), this primer introduces an Xhol site (lowercase underlined) in position -436 of the promoter of the mouse SM22 alpha gene (Solway J. et al., J. Biol. Chem., 270 (1995) 13460-13469; Access Genbank L41161).

- Primer 6518:

(5 'TCGTTTGaagçttGGAAGGAGAGTAGCTTCGGTGTC 3 ") (SEQ ID 8), this primer introduces a HindIII site at position +43 of mSM22 alpha.

A reaction mixture comprising 1 mg of mouse genomic DNA, and 10 pmol of each of the two primers (6517 and 6518) was prepared with the same reagents as for hSMact and at the same concentrations, followed by PCR amplification carried out under the same conditions (see example 1.1.).

After analysis on an agarose gel and then purification, the DNA fragment amplified by PCR is digested for 3 hours at 37 ° C. with Xhol and HindIII then cloned into the vector pGL3-Basic (Promega) previously digested with these same enzymes. restriction. The resulting plasmid was designated pmSM22 (Figure 2).

. Plasmid pXL3152 and pXL3153. A DNA fragment corresponding to the enhancer region of the promoter of the hCMV-IE gene between the positions -522 and -63 relative to the transcription initiation site, was amplified by PCR using the plasmid pCMVβ as template and oligonucleotides 8557 (5 'ATC GAC GCG TGC CCG TTA CAT AAC TTA CGG 3') and 8558 (5 'ATC GAC GCG TCC GCT CGA GCG TCA ATG GGG CGG AGT TG 3') (SEQ ID 6) as primers. This fragment was digested with MluI and then was cloned into the plasmid pmSM22 previously digested with MluI and treated with alkaline phosphatase. Depending on the direction of insertion of the fragment, two different plasmids were obtained: pXL3152 and pXL3153. The schematic representations of these plasmids are collated in FIG. 2. These plasmids comprise, in the form of an Mlul-Nçol fragment, a hybrid promoter consisting of the enhancer of the promoter of the hCMV-IE gene and of the promoter of the mSM22 gene.

1.3. PCMV-leadTK control plasmid.

The expression vector pCGN previously described by Tanaka et al. (Cell, 60 (1990) 375-386) contains the CMV promoter (-522 / + 72) fused to the "leader" of the HSV tk gene (+ 51 / + 101) upstream of a sequence coding for the epitope hemagglutinin. Plasmid pCGN (10 ng) was used as a template for PCR amplification. The PCR reaction and the amplification were carried out under the same conditions as those used for hSMact and mSM22 (Examples 1.1 and 1.2). The primers that have been used are as follows: - Primer 6718 (5 'CCCGTTACATAACTTACGGTAAATGGCCCG 3') (SEQ ID 9), this primer hybridizes with the CMV promoter in position -522 (8 nucleotides downstream of the EcoRI site of pCGN).

- Primer 6719 (5 'gGGACGCGCTTCTACAAGGCGCTGGCCGAA 3') (SEQ ID 10), this primer hybridizes to position 101 of the "leader" tk. The first nucleotide G in bold is intended to restore the Ncol site of pGL3-Basic as will be explained below.

The PCR fragment thus obtained is purified and then phosphorylated using the polynucleotide kinase from phage T4 (New England Biolabs). In parallel, the vector pGL3-Basic (Promega) was linearized with purified NcoL then treated with Klenow DNA polymerase (Boehringer Manheim) in order to fill the Ncol site. This vector is then dephosphorylated using alkaline phosphatase (Boehringer Manheim) and then used for the insertion of the phosphorylated PCR fragment. Thus, the guanosine (G) of primer 6719 makes it possible to restore the Ncol site only when the CMV-leader tk fragment is oriented with the 5 ′ part (primer 6718, position -522 of CMV) downstream of the HindIII site of pGL3 -Basic and its 3 ′ end (primer 6719, leader tk) is ligated to the Ncol site of pGL3-Basic (first luciferase ATG). The plasmid thus obtained is designated pCMV-leadTK.

EXAMPLE 2 Specificity of hybrid promoters in vitro.

This example illustrates the tissue specificity properties of the hybrid promoters of the invention in vitro.

2.1. Cell cultures.

Rabbit smooth muscle cells (SMC) are cultured in DMEM ™ medium (Life Technologies Inc.) supplemented with 20%) of fetal calf serum (SVF). ECV304 cells are cultured in 199 ™ medium (Life Technologies Inc.) supplemented with 10%> of FCS. C2C12 myoblasts, HeLa cells, NIH 3T3 cells and TU 182 cells are cultured in DMEM ™ medium supplemented with 10% of SVF. The 293 cells are cultured in MEM ™ medium (Life Technologies Inc.) supplemented with pyruvate, non-essential amino acids and 10% FCS. All the cultures are carried out in an oven at 37 ° C., in a humid atmosphere and under a partial pressure of CO ₂ of 5%.

2.2. In vitro transfections.

The transfections are carried out in 24-well plates and each transfection is carried out three times. Twenty four hours before transfection, the cells are seeded: (i) at 5 × 10 ⁴ cells per well for rabbit smooth muscle cells, cells ECV304, NIH 3T3 and HeLa, (ii) at 10 ⁵ cells per well for cells TU182, (iii) at 3 x 10 ⁴ cells per well for C2C12 cells, and (iv) at 2 x 10 ⁵ cells per well for 293 cells.

For each well, 500 ng of plasmid DNA (250 ng of plasmid of interest and 250 ng of pUC18) are mixed with the cationic lipid RPR120535 B (WO 97/18185) at the rate of 6 nmol of lipid per μg of DNA in DMEM ™ medium (20 μl final) comprising 150 mM NaCl and 50 mM bicarbonate. After 20 minutes at room temperature, the 20 μl of the DNA / lipid mixture are brought into contact with the cells, in the absence of FCS, for 2 hours. The culture medium is then supplemented with SVF so as to obtain the percentage of SVF required for the culture of each cell type.

Forty-eight hours after transfection, the culture medium is removed and the cells are rinsed twice with PBS (Life Technologies Inc.). The luciferase activity is then determined using the Luciferase Assay System ™ kit (Promega Corporation) according to the supplier's recommendations.

2.3. Specific activities of hybrid promoters.

The relative luciferase activities of the hybrid promoters (relative to the pCMV-lead TK promoter) measured in vitro in seven different cell types are collated in FIGS. 3 and 4, as well as in Tables I and IL results show that for the promoters hSMact (Table I) and mSM22 (Table II), the relative activity is a value which well accounts for the specificity of these promoters for smooth muscle cells; specificity which has already been described in the literature (Skalli et al., J. Histochem. Cytochem., 37 (1989) 315-321; Shimizu et al., J. Biol. Chem., 270 (1995) 76 1-7643 ; Li et al., J. Cell Biol, 132 (1996) 849-859). Indeed, the relative activity in rabbit SMC is at least 5 times greater than that observed in other cell types: (i) from 5 to 20 times greater for the hSMact promoter (Table I), and (ii) 5 to 25 times higher for the mSM22 promoter (Table II).

The results presented in Tables I and II clearly show that, in smooth muscle cells, the activity of the four hybrid promoters according to the invention (Enh-hSMact, hnE-hSMact, Enh-mSM22, and hnE-mSM22) is comparable , in terms of strength, to that of the CMV promoter. On the other hand, the relative activity of each of these promoters, in another cell type, is at least 10 times lower for the hSMact hybrid promoters, and at least 4 times lower for the mSM22 hybrid promoters, than that observed in the smooth muscle cells: (i) from 10 to 140 times for the hSMact hybrid promoters, and (ii) from 4 to 55 times for the mSM22 hybrid promoters. These hybrid promoters therefore retain the same tissue specificity as that observed for the specific promoters hSMact and mSM22.

These results further show that the orientation of the enhancer region in the hybrid promoters of the invention has no significant influence on their activity.

The four hybrid promoters therefore possess, in vitro, an activity in smooth muscle cells as important as that of the CMV promoter (which is reputed to be a strong promoter), while retaining a tissue specificity comparable to, or even superior to, that of the promoters. hSMact and mSM22.

EXAMPLE 3 Specificity of hybrid promoters in vivo.

This example illustrates the tissue specificity properties of the hybrid promoters of the invention in vivo. 3.1. Gene transfer in skeletal muscle.

The various plasmids were injected, intramuscularly, into the cranial tibial muscle of female C57BL6 mice aged 5 weeks. Each plasmid, diluted in a NaCl solution at 150 mM final, is injected at a rate of 10 μg per muscle. Three days after injection, the muscles are removed in 2 ml of Cell Culture Lysis Reagent ™ buffer (Promega Corporation), and ground using a Diax homogenizer (Heidolph). The ground material is then centrifuged for 15 minutes at 4000 g, then the luciferase activity is evaluated using the Luciferase Assay System ™ kit (Promega Corporation) according to the recommendations of the supplier.

3.2. Activities of hybrid promoters in skeletal muscle in vivo.

The relative activities of the two specific promoters (hSMact and mSM22) as well as those of two of the hybrid promoters of the invention (Enh-hSMact and Enh- mSM22) were also evaluated in vivo after transfer of naked DNA into the cranial tibial muscle of mice. The results collated in FIG. 5 show that the activity of the Enh-hSMact promoter is 100 times lower than that of the CMV promoter. Similarly, the activity of the Enh-mSM22 promoter is 17 times lower than that of the CMV promoter. Thus, the tissue specificity observed in vitro, and in particular in the C2C12 cells which constitute the model closest to that used in vivo, is therefore preserved in vivo.

EXAMPLE 4 Construction of recombinant adenoviruses expressing the GAX protein under the control of specific hybrid promoters.

The purpose of this example is to describe an adenoviral vector carrying the gene coding for the protein GAX operatively linked to the hybrid promoter of the invention composed of the enhancer CMV and of the promoter SMα-actin (enh-hSMact). The human gax gene comprises 912 base pairs and codes for a transcription factor of 303 amino acids involved in stopping cell growth (growth-arrest-specific homeobox) and having a role in the proliferation of human smooth muscle cells. This homeodomain gene was originally isolated from the aorta and is expressed in particular in adult cardiovascular tissue (Gorski et al. 1993).

The sequence of the human gax gene was cloned from a skeletal muscle cDNA library by PCR (Polymerase Chain Reaction) using as a primer a sequence derived from the human gax gene and published by Walsh et al. (Genomics (1994), 24, p535). The sequence was then cloned into the expression vector pXL3297. This plasmid is derived from the Bluescript plasmid (Stratagene) containing the human CMV IE enhancer / promoter (-522 / + 72) (Cell (1985), 41, p521) and the poly A of SV 40 (2538-2759) (GenBank locus SV4CG).

The construction uses the plasmid pXL3130 described in Example 1 (Figure 1) in which the promoter SMα-actin had been previously introduced. Plasmid pXL3297 is an expression vector containing the human gax gene. It was digested with the enzymes HindIII and Avril in order to introduce the human gax gene into the previous plasmid pXL3282 also digested with the enzymes HindIII and Avril to give the plasmid pXL 3300. As shown in Figure 6, in which the different stages of the construction of the plasmids described above are detailed, the final plasmid, pXL3310 comprises an expression cassette consisting of the enhancer CMV-IE, the SMα-actin promoter (pSMA), associated according to the invention and operationally linked to the gene encoding the human GAX protein as well as the poly A termination signal of SV40.

The expression cassette for the human gax gene is then introduced into a recombinant human adenovirus of serotype 5 (Ad5) deleted from the El and E3 regions by co-transfection and homologous recombination between the plasmid carrying the expression cassette for the gax gene and adenovirus, in packaging cells. These cells are preferably line 293. The production of a stock of adenovirus containing the expression cassette for the human gax gene results from the lysis of the cells. packaging 2 or 3 days after infection and isolation of the recombinant viral particles by cesium chloride gradient centrifugation.

The viral particles are then used to study the expression of the human gax gene under the control of the promoter of the invention in smooth muscle cells.

The expression of the GAX protein is checked 24 hours after infection of the smooth muscle primary cells by immunofluorescence or by western blot using the anti-rabbit polyclonal antibodies.

The expression of messenger RNAs is analyzed 24 hours after infection of the smooth muscle cells by dot blot and northern blot using an oligonucleotide whose sequence is present in the gax gene.

The analysis of the biological activity of the adenovirus coding for the gax gene is carried out as follows:

Smooth muscle cells in the exponential growth phase are infected with an adenovirus containing the gene coding for the GAX protein under the control of the enh-hSMact promoter in the absence and in the presence of 125 ng of lipofectin (48-well plates). The adenoviruses (in variable dilutions) and the lipofectamine are incubated for 30 minutes at room temperature in a medium deprived of serum. The mixture or the virus alone is brought into contact with the cells for one hour at 37 ° C. At the end of the infection period, the medium containing the virus is removed and the cells are incubated in DMEM medium containing 0.5% of FCS. In the 24 hours following the infection, the culture medium is replaced by a growth medium for half of the cultures and the incubation is continued for 48 hours to allow the cells to enter the S phase. For the other half of the cultures , a weakly mitogenic medium is added to keep the cells in quiescence. Viable cells are counted 72 hours after infection using the Alamar protocol. TABLE I

TABLE II

Claims

1. Hybrid promoter comprising: - all or part of the enhancer region of a strong and ubiquitous promoter / enhancer, and

- a promoter region allowing specific expression in smooth muscle cells.

2. Hybrid promoter according to claim 1, characterized in that the enhancer region is chosen from the enhancer region of the immediate early cytomegalovirus gene (CMV-IE), the enhancer region of the red sarcoma virus LTR (LTR-RSV), the enhancer region of the SV40 virus, and the enhancer region of the EF gene.

3. Hybrid promoter according to claim 2 characterized in that the enhancer region is the enhancer region of the immediate early gene of cytomegalovirus (CMV-IE), preferably of human cytomegalovirus (hCMV-IE).

4. Hybrid promoter according to claim 1 characterized in that the promoter region comprises all or part of the promoter of the gene coding for α-actin of smooth muscle cells (SMact) or of the SM22 gene.

5. Hybrid promoter comprising:

- all or part of the promoter of the gene coding for α-actin of smooth muscle cells (SMact).

6. Hybrid promoter comprising:

- all or part of the promoter of the SM22 gene.

7. Hybrid promoter according to claim 1, characterized in that the promoter region comprises a basal promoter and a sequence conferring tissue specificity, said sequence being derived from the SMact promoter and / or from the SM22 promoter.

8. Expression cassette comprising a nucleic acid coding for an RNA or a polypeptide of interest, placed under the control of a hybrid promoter according to one of claims 1 to 7.

9. Cassette according to claim 8 characterized in that it further comprises a transcription termination signal.

10. Cassette according to claim 8 or 9 characterized in that the nucleic acid codes for a protein chosen from proteins involved in the cell cycle, proteins inducing apoptosis, proteins capable of modifying the proliferation of smooth muscle cells, proteins inducing angiogenesis and transcription factors.

1 1. Vector comprising a hybrid promoter according to claim 1 or a cassette according to claim 8.

12. Vector according to claim 11 characterized in that it is a plasmid, a cosmid or any DNA not encapsidated by a virus.

13. Vector according to claim 1 1 characterized in that it is a recombinant virus, preferably derived from an adenovirus, a retrovirus, a herpes virus or an adeno virus -associated.

14. Composition comprising a vector according to claim 12 and a chemical or biochemical transfer agent.

15. Composition comprising a recombinant virus according to claim 13 and a physiologically acceptable vehicle.

16. Cell modified by a cassette according to claim 8 or a vector according to claim 11.

17. Use of a hybrid promoter according to one of claims 1 to 7 for the preparation of a composition intended for the selective expression of a nucleic acid in smooth muscle cells.

18. Use of a hybrid promoter according to one of claims 1 to 7 for the preparation of a composition intended for the expression of a nucleic acid in smooth muscle cells and not in endothelial cells which are in the vicinity of the blood vessel.