CA2343922A1 - Use of specific hybrid promoters for controlling tissue expression - Google Patents

Abstract

The invention concerns a hybrid promoter comprising: all or part of the enhancer region of a strong and ubiquitous promoter/enhancer; a promoter region enabling specific expression in smooth muscle cells, and all vector or cell containing said promoter, and their uses.

Description

USE OF SPECIFIC HYBRID PROMOTERS
TO CONTROL THE TISSUE EXPRESSION
The present invention relates to the field of biology, and in particular the domain of regulation of gene expression. She describes in particular new constructions and new vectors allowing expression targeted and strong in genes. The present invention can be used in many areas, and in especially for the production of recombinant proteins, for the creation of transgenic animal models, for the creation of cell lines, for setting at the point of screening tests, or in gene and cell therapy.
The ability to control and direct gene expression is a very important issue in the development of biotechnologies. In vitro, it can improve the conditions for the production of recombinant proteins, in using particular populations of cells. Always in vitro, it can allow detection or highlighting of the presence of populations specific cells in a sample, or also to test for properties of a product or regulation of a gene in a specific population of cells.
The control of gene expression is also very important for approaches ex vivo or in vivo therapeutics, in which the ability to control selectively the production of a therapeutic molecule is essential. In effect, depending on the applications, depending on the gene to be transferred, it is important to ability to target certain tissues or only parts of an organism in order to focus effect therapeutic and to limit the spread and side effects.
Targeting the expression of a given nucleic acid can be achieved according to different approaches. A first approach consists for example in using of vectors or transfer agents with cell specificity given.
However, the specificity conferred by this type of vector is generally enough coarse and does not allow targeting of specific populations of cells. A
other approach is to use specific expression signals from certain types cellular. In this regard, so-called "specific" promoters have been described in the literature, such as the promoter of genes coding for pyruvate kinase, villine,

2 GFAP, the promoter of the intestinal fatty acid binding protein, the factin promoter has smooth muscle cells, the SM22 promoter or still the promoter of the human albumin gene for example. However, if these promoters have tissue specificity, they also have, in counterpart, a relatively low power. So the vast majority of these promoters possesses activity levels that are well below those of so-called promoters "strong", generally by a factor of between 10 and 100 at least. In addition, it is generally considered that the specificity of a promoter is inversely proportional to its strength and that the more the strength is increased, the higher the level of activity non-specific is important.
It would therefore be particularly advantageous to be able to have promoters which are both specific to certain fabrics and strong. The object of the present invention is precisely to provide new constructions allowing strong and targeted expression of genes.
The invention describes in particular new chimeric promoters allowing a strong and specific expression of genes in cells smooth muscles.
The invention also describes vectors containing such promoters and their use for transfer; genes in cells in vitro, ex vivo and in vivo. The constructions of the invention allow for the first time to combine opposite properties, namely high selectivity and activity transcriptional high. The present invention thus offers a particularly effective means for targeting gene expression in smooth muscle cells, in vivo Yes N
in vitro, and for the regulation of this expression.
The invention is based more particularly on the construction of promoters chimeric (or hybrid), comprising regions of origin and of function different. More particularly, a first object of (invention resides in a hybrid promoter including - all or part of the enhancer region of a strong promoter / enhancer and ubiquitous, and

3 - a promoter region allowing specific expression in cells smooth muscles.
The association of enhancer regions and promoters has already been described in prior art. Thus, it is known for example to couple the region enhancer CMV with non-specific promoters such as the gene promoter actin-~ 3 chicken (W096 / 135! ~ 7) to increase their strength. However, such constructions have not been described or suggested for the purpose of attempting to get a strong and specific expression of smooth muscle cells. The invention rest in part on the selection and the combination of specific enhancers and specific "promoter" elements. The invention is also based on the implementation in evidence that this combination of elements provides an expression for of high levels, without affecting promoter selectivity for cells targets of smooth muscle. The invention therefore provides constructions particularly advantageous since they allow targeted production and with levels important molecules in smooth muscle cells. In addition, the present request also shows that these constructions can be used too well in in vitro than in vivo.
In the hybrid promoters according to the invention, the enhancer region and the promoter region are functionally associated, i.e.
so the region enhancer exerts a stimulating activity on the activity of the region promoter.
Generally, these two regions are therefore genetically linked and are enough close to each other to allow the enhancer region to activate the region promoter. Preferably, the distance between the enhancer region and the region promoter is less than 1 kb, more preferably less than 500 bp.
In the particularly preferred constructions according to the invention, these two regions are spaced less than 400 bp, more preferably less than 200 bp. In outraged, as the examples show, the respective orientation of the two regions has not of significant influence on the activity of hybrid promoters of the invention. From this done, the enhancer region can be positioned in the same orientation or in the reverse orientation with respect to the direction of transcription of the region promoter.

4 In a preferred embodiment, the enhancer region is chosen from the enhancer region of the immediate early cytomegalovirus gene (CMV-IE), the red sarcoma virus LTR enhancer region (LTR-RSV), the region enhancer SV40 virus, and the enhancer region of the EF 1a gene. More preferably, in the hybrid promoters of the invention, the enhancer region is the enhancer region of the gene immediate early cytomegalovirus (CMV-IE), preferably cytomegalovirus human (hCMV-IE). A particular enhancer region is constituted for example of fragment -522 to -b3 of Irene hCMV-IE, or of any fragment comprising at least part of it and having an enhancer activity.
As regards the promoter region, advantageously used for the implementation work of the invention a region comprising all or part of the promoter of the uncomfortable encoding smooth muscle cell actin-a (SMact) or the SM22 gene.
The promoter of these genes has been described for its cell specificity of smooth muscle (see in particular Ueyama H. et al., Mol. Cell. Biol., 4 (1984) 1078; Solway J. et al., J: Biol. Chem., 270 (1995) 13460-13469).
A first particularly advantageous variant of the present invention consists of a hybrid promoter comprising:
- all or part of the enhancer region of the immediate early gene of human cytomegalovirus (hCMV-IE), and - all or part of the promoter of the gene coding for cell actin-a smooth muscle (SMact), preferably from the human Smact gene.
A second particularly advantageous variant of the present invention consists of a hybrid promoter comprising:
- all or part of the enhancer region of the immediate early gene of human cytomegalovirus (: hCMV-IE), and - all or part of the promoter of the SM22 gene, preferably of the SM22 gene mouse alpha.
Furthermore, in a particular embodiment of the invention, the region promoter used is a chimeric region comprising a basal promoter and a sequence conferring tissue specificity, said sequence being derived from SMact promoter or SM22 promoter, or a combination of both. In this

5 embodiment, the basal promoter can be a "minimal" promoter, that is to say comprising only the sequences essential for promoter activity transcriptional (for example a TATA box). This basal promoter may be the own basal promoter of the SMact or SM22 gene, or of heterologous origin ((3-globin, HSV-TK, SV4 (1 or EF1-a for example). The sequence conferring the tissue specificity advantageously comprises part of the sequence of the SMact promoter (RT Shimizu et al. J. Biol. Chem. 270 (1995) 7634-7643) and or the promoter SM22 (LI, i et al. J. Cell. Biol. 132 (1996) 849-859; S. Kim and al. J.
Clin. Invest. 100 (1997) 1006-1014; Kemp et al. Biochem. J. 310 (1995) 1037-1043).
A particular type of hybrid promoter according to the invention therefore comprises all or part of the enhancer region of a strong promoter / enhancer and ubiquitous, - a basal promoter and, - a sequence conferring tissue specificity comprising all or part of SMact promoter and / or the SM22 promoter.
For the construction of the hybrid promoters of the invention, the techniques of molecular biology as those skilled in the art can be artwork.
Thus, the enhancer region and the promoter region (including the basal promoter and the tissue specificity sequence) can be isolated by techniques conventional from nucleic acid libraries or from DNA
cellular total, for example by amplification using specific probes. These fragments can also be artificially synthesized using the information from sequences available in the prior art. When these fragments are obtained they can be easily combined with one another using ligases and other enzymes of restriction, to generate hybrid promoters of the invention. In addition, these fragments can be modified by digestion, mutation, insertion or addition of base pairs, either for the purpose of facilitating their cloning, or for the purpose to modify their functional properties. In addition, as indicated above, the fragments can be associated directly with each other or on the contrary spaced by pairs of bases having no significant influence on the activity of the promoter hybrid.

6 The hybrid promoters of the invention thus have the capacity to express a nucleic acid of specific interest in cells muscular smooth. The "specific" character of the expression means that the activity of promoter is significantly much higher in smooth muscle cells. Well that non-specific expression may exist in other cells, the level of activity corresponding generally remains very low (negligible) compared to that observed in smooth muscle cells, usually 10-fold lower than less.
The results presented in the examples show in this respect a differential up to a factor of 140, which testifies to the selectivity important promoters of the invention. In this regard, the results presented also show strong specificity with respect to muscle cells smooth since no expression was detected in the endothelial cells which is found nearby, in the blood vessel, including the artery. The results presented in the examples also show that the strength of the promoters of the invention is far superior to that of specific promoters not hybrids, the differential that can exceed a factor of 100. These elements therefore illustrate the advantageous and unexpected properties of the hybrid promoters of the invention, in term of strength and specificity, for the expression of nucleic acids of interest in smooth muscle cells.
In this regard, another object of the invention relates to an expression cassette comprising a nucleic acid encoding an RNA or a polypeptide of interest, placed under the control of a hybrid promoter as defined above.
Advantageously, the cassette of the invention also comprises a signal transcription termination, placed 3 'from the nucleic acid.
Given the cell populations targeted by the cassettes the invention, the nucleic acid can code for example for a protein chosen among - proteins involved in the cell cycle, such than for example p21 or any other kinase inhibitor protein cyclin-dependent (cdk), the product of the retinoblastoma (Rb) gene, GAX, GAS-1, GAS-3, GAS-6, Gadd 45, Gadd 153, cyclins A, B and D.
- proteins inducing fapoptosis, such as by example p53, members of the apoptosis inducer family such as Bas, Bcl-XS, Bad or any other antagonist of Bcl2 and Bcl-X ~.
- proteins capable of modifying the proliferation of smooth muscle cells, such as for example an antibody intracellular or an ScFv inhibiting the activity of proteins involved in cell proliferation, such as the Ras protein, the map-kinase, or tyrosine kinase or factor receptors growth.
- labeling proteins (LacZ, GFP, Luc, Secreted alkaline phosphatase (SeAP), growth hormone (GH) etc) for the purpose dc; carry out proliferation studies or studies of diagnostic, - proteins inducing angiogenesis, such as by example VEGF family members, family members FGF and more particularly FGF1, FGF2, FGF4, FGFS, angiogenin, fEGF, TGFa, TGF (3, TNFa, Scatter Factor / HGF, members of the family of angiopoetins, cytokines and in particular interleukins including II, -l, IL-2, IL-8, angiotensin-2, the activator of plasminogen (TPA), urokinase (uPA), the molecules involved in synthesis of active lipids (prostaglandins, Cox-1).
- transcription factors, such as for example natural or chimeric nuclear receptors, comprising a domain of DNA binding, a ligand binding domain and an activator domain or transcription inhibitor, such as for example proteins fusion tetR-NLS-VP16, fusion proteins derived from receptors for estrogens, the fusion proteins derived from hormone receptors steroid, fusion proteins derived from receptors for progesterones, proteins from the CID system {Chemical Inducer of Dimer ~ ization) described by Rivera et al. (Rivera et al. (1996), A humanized system for pharmacology control of gene expression, Nature Medecine, 2 1028-1032).
It is understood that the present invention is not limited to examples proteins or RNA, but that it can be used by humans of profession for the expression of any nucleic acid in muscle cells smooth, by simple usual experimental operations.
Another subject of the invention also relates to any vector comprising a hybrid promoter or a cassette as defined above. Vector the invention may for example be a plasmid, a cosmid or any DNA not encapsulated by a virus, phage, artificial chromosome, recombinant virus, etc. he it's about preferably a plasmid or a recombinant virus.
Among the plasmid type vectors, mention may be made of all the plasmids of cloning and / or expression known to those skilled in the art and which comprise generally an origin of replication. Mention may also be made of plasmids of new generations bearing origins of replication and / or markers improved as described for example in applications W096 / 26270 and PCT / FR96 / 01414.
Among the vectors of the recombinant virus type, there may be mentioned preferentially adenovirus, retrovirus, herpes virus or adeno-associated viruses recombinants. The construction of this type of recombinant virus defective for the replication has been widely described in the literature, as have properties infection of these vectors (see in particular S. Baeck and KL March (1998), Circul.
Research vol. 82, pp 295-305), T. Shenk, BN Fields, DM Knipe, PM Howley et al (1996), Adenoviridae: the viruses and their replication (in virology). Pp 211-2148, EDS - Ravenspublishers / Philadelphia, P. Yeh and M. Perricaudet (1997), FASEB
Flight.
1 l, pp 615-623.
A particularly preferred recombinant virus for the implementation of the invention is a defective recombinant adenovirus.
Adenoviruses are linear double-stranded DNA viruses with a size of 36 (kilobases) kb approximately. There are different serotypes, whose structure and the properties vary somewhat, but have a genetic organization comparable. More particularly, the recombinant adenoviruses can be of human or animal origin. Regarding adenoviruses of human origin, we can preferentially cite those classified in group C, in particular the adenovirus type 2 (Ad2), S (Ad5), 7 (Ad7) or 12 (Adl2). Among the different adenovirus of animal origin, mention may preferably be made of adenoviruses of origin canine, and in particular all the CAV2 adenovirus strains [Manhattan strain or A26 / 61 (ATCC VR-800) for example]. Other adenoviruses of animal origin are cited in particular in application W094 / 26914 incorporated herein by reference.
The genome of adenoviruses includes in particular a reverse sequence repeated (ITR) at each end, an encapsidation sequence (Psi), Genoa early and late genes. The main early genes are contained in the regions E1, E2, E3 and E4. Among these, the genes contained in the E1 region in particular are necessary for viral spread. The main genes late are contained in regions L1 to L5. The genome of the Ad5 adenovirus has been entirely sequenced and accessible on database (see in particular Genebank M73260).
Likewise parts, even all of other adenoviral genomes (Ad2, Ad7, Adl2, etc.) were also sequenced.
For their use as recombinant vectors, different constructions adenovirus derivatives were prepared, incorporating different genes therapeutic. In each of these constructions, the adenovirus has been modified of so as to make it incapable of replication in the infected cell. So, the constructions described in the prior art are adenoviruses deleted from the El region, essential for viral replication, at the level of which the sequences heterologous DNA (Levrero et al., Gene 01 (1991) 195; Gosh-Choudhury and al., Gene 50 (1986) 161). Furthermore, to improve the properties of the vector, he was proposed to create other deletions or modifications in the genome of Adenovirus.
Thus, a point-sensitive temperature mutation was introduced into the mutant ts 125, to inactivate the DNA binding protein 72kDa (DBP) (Van der Vliet et al., 1975). Other vectors include a deletion from another region essential for replication and / or viral propagation, the E4 region. The E4 region east indeed involved in the regulation of late gene expression, in stability late nuclear RNA, in the extinction of protein expression the host cell and in the efficiency of viral DNA replication. Of vectors adenovirals in which the regions E 1 and E4 are deleted therefore have a noise of transcription background and very reduced viral gene expression. Of such vectors have been described by example in applications W094 / 28152, W095 / 02697, W096 / 22378). In addition, vectors carrying a modification at the level of the gene IVa2 have also been described (W096 / 10088).
In a preferred embodiment of the invention, fadenovirus recombinant is a group C human adenovirus.
preferential it is an Adenovirus Ad ?. or AdS.
Advantageously, the recombinant adenovirus used in the context of the invention includes one; deletion in the EI region of its genome. Again more in particular, it includes a deletion of the regions E 1 a and E 1 b. As example precise, mention may be made of deletions affecting nucleotides 454-3328; 382-3446 or 357-4020 (with reference to the Ad5 genome).
According to a preferred variant, the recombinant adenovirus used in the framework of the invention further comprises a deletion in the E4 region of its genome. More specifically, the deletion in the E4 region affects all of the open phases. One can cite as a specific example the deletions 33466-35535 or 33093-35535. Other types of deletions in the E4 region are described in the applications W095 / 02697 and W096 / 22378, incorporated herein by reference.
The expression cassette can be inserted at different sites in the genome recombinant. It can be inserted at the El, E3 or E4 region, in replacement of deleted or surplus sequences. It can also be inserted at any other site, apart from the sequences necessary in cis for production viruses (ITR sequences and packaging sequence).

Recombinant adenoviruses are produced in an packaging line, that is to say a cell line capable of complementing in trans one or many deficient functions in the recombinant adenoviral genome. From bloodlines packaging known to those skilled in the art, there may be mentioned for example the line 293 in which part of the adenovirus genome has been integrated. More specifically, line 293 is a human embryonic cell line you're welcome containing the left end (about 11-12%) of the adenovirus genome serotype 5 (Ad5), comprising left fITR, the packaging region, the region E 1, including E 1 a and E 1 b, the region coding for the protein pIX and part of the region coding for the pIVa2 protein. This line is capable of trans-complementing adenoviruses recombinants defective for the El region, that is to say devoid of all or part of region E 1, and to produce viral stocks having high titers. This lineage is also capable of producing, at permissive temperature (32 ° C), virus stocks further comprising the thermosensitive E2 mutation. Other lines cell phones capable of complementing the region E 1 have been described, based in particular on of A549 human lung carcinoma cells (W094 / 28152) or on human retinoblasts (Hum. Gen. Ther. (1996) 215). In addition, bloodlines able to trans-complement several functions of the adenovirus have also been described. In particular, mention may be made of lines complementing the regions E 1 and E4 (Yeh et al., J. Virol. Vol "70 (1996) pp 559-565; Cancer Gen. Ther. 2 (1995) 322;
Krougliak et al., Hum. Gen. Ther. 6 (1995) 1575) and complementary lines the regions E1 and E2 (W094 / 28152, W095 / 02697, W095 / 27071).
Recombinant adenoviruses are usually produced by the introduction of viral DNA in the packaging line, followed by cell lysis after about 2 or 3 days (the kinetics of the adenoviral cycle being from 24 to 36 hours). For implementing the method, the viral DNA introduced may be the viral genome complete recombinant, possibly built in a bacteria (W096 / 25506) or in a yeast (WO95 / 03400), transfected into the cells. He can also act a recombinant virus used to infect the packaging line. DNA
viral may also be introduced in the form of fragments each carrying a part of the recombinant viral genome and a zone of homology allowing, after introduction in the packaging cell, to reconstitute the recombinant viral genome through homologous recombination between the different fragments.
After cell lysis, the recombinant viral particles are isolated through cesium chloride gradient centrifugation. An alternative method has summer described in request FR96: $ 4,164 incorporated herein by reference.
The invention also relates to a composition comprising a vector such as defined above and a chemical or biochemical transfer agent. We means by the term "chemical or biochemical transfer agent" any compound (ie, other than recombinant virus) facilitating the penetration of a nucleic acid into a cell. he may be cationic non-viral agents such as cationic lipids, peptides, polymers (Polyethylene Imine, Polylysine), nanoparticles;
or non-cationic non-viral agents such as non-cationic liposomes, non-cationic polymers or nanoparticles. Such agents are good known to the skilled person.
The invention also relates to a composition comprising a virus.
recombinant as defined above and a physiologically vehicle acceptable.
The invention also relates to a pharmaceutical composition comprising a vector as described above. The pharmaceutical compositions of the invention can be formulated for topical, oral administration, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc.
Preferably, the pharmaceutical composition contains vehicles pharmaceutically acceptable for an injectable formulation, in particular for intravascular or smooth muscle injection. He can act in particular saline solutions (monosodium phosphate, disodium, chloride of sodium, potassium, calcium or magnesium, etc., or mixtures of such salts), sterile, isotonic, or dry compositions, in particular lyophilized, which, through WO 00/18908 PCT / FR99 / 022b5 addition according to the case of sterilized water or physiological saline, allow the constitution of injectable solutions. Other excipients can be used such as for example a hydrogel. This hydrogel can be made from any polymer (homo or hetero) bio-compatible and non-cytotoxic. Such polymers have by example have been described in application W093 / 08845. Some of them, like especially those obtained from ethylene oxide and / or propylene are commercial. The use of a hydrogel is particularly advantageous for the transfer of nucleic acids into the vascular walls, and in particular in the smooth muscle cells of the vascular walls. The doses used for the injection can be adapted according to different parameters, and in particular function the mode of administration used, the aim pursued (labeling, pathology, screening, etc), of the gene to be expressed, or also of the duration of the expression sought.
Of a in general, the recombinant viruses according to the invention are formulated and administered as doses between 104 and 1014 pfu, and preference 106 to 1010 pfu. The term pfu ("plaque forming unit") corresponds to the power infectious with a viral solution, and is determined by infection of a culture cellular appropriate, and measuring the number of ranges of infected cells. The techniques of determination of the pfu titer of a viral solution are well documented in the literature. For in vitro or ex vivo use, cassettes, vectors or compositions of the invention can be incubated at conventional doses in presence selected cell populations. These incubations can be carried out on the culture dishes, flasks, fermenters, or any other device selected.
Furthermore, the invention also relates to any cell modified by a cassette or a vector (in particular an adenovirus) as described above. We "modified" cell means any cell containing a construction according to the invention. These cells can be used for the production of protein recombinant in vitro. They can also be intended for a location in an organism, according to the methodology described in application W095 / 14785.
These cells are preferably human smooth muscle cells.

The invention also relates to the use of a hybrid promoter such as defined above for the specific expression of a nucleic acid in cells smooth muscles, in vitro, ex vivo or in vivo.
The invention also relates to the use of a hybrid promoter as defined above for the preparation of a composition intended for the expression of a acid nucleic acid in smooth muscle cells in vivo and not in cells endothelial which are located in the vicinity in the artery.
Due to their specific character of smooth muscle cells, constructions according to the invention can also be used for the creation of models animals with vascular pathologies or for carrying out tagging studies or in methods of detecting or screening for the presence of cells smooth muscles in samples.
The present invention also relates to a process for the production of recombinant proteins including introduction into a population cellular of a vector as defined above, the culture of said population cellular recombinant, and recovering said protein produced. Advantageously, for implementing the process of the invention, cells are used smooth muscles.
These can be established lines or primary cultures.
The present application will be described in more detail using the examples which follow, which should be considered as illustrative and not limiting.
LEGEND OF FIGURES
Table I: Relative activities of hybrid promoters (hSMa-actin) evaluated in transient transfections in vitro in muscle cells smooth of rabbit in primary culture (SMC rabbit), in ECV304 cells, in myoblasts C2C 12, in HeLa cells, in NIH 3T3 cells, in TIJ182 carcinoma cells, as well as in kidney cells 293.
The activity relative of each promoter is expressed as a percentage of activity luciferase obtained with the plasmid pCMV-leadTK. Enh-X: the enhancer sequence of hCMV-IE
is cloned upstream of promoter X according to its normal orientation. HnE-X: the hCMV-IE enhancer sequence is cloned upstream of promoter X according to the opposite orientation.
Table II: Relative activities of hybrid promoters (mSM22) evaluated in transient transfections in vitro in smooth muscle cells of rabbit in primary culture (SMC rabbit), in ECV304 cells, in myoblasts C2C12, in HeLa cells, in NIH 3T3 cells, in cells of TU182 carcinoma, as well as in kidney cells 293. Relative activity of each promoter is expressed as a percentage of the luciferase activity obtained with the plasmid pCMV-leadTK. Enh-X: the enhancer sequence of hCMV-IE is cloned in upstream of promoter X according to its normal orientation. HnE-X: the sequence enhancer of hCMV-IE is cloned upstream of promoter X in the opposite orientation.
Figure 1: Schematic representations of plasmids including the cassette expression contains the hSMa-actin hybrid promoter.
Figure 2: Schematic representations of plasmids including the cassette of expression contains the hybrid promoter mSM22a.
Figure 3: Activities of hybrid promoters evaluated in transfections in vitro transients in cultured rabbit smooth muscle cells primary (Rabbit SMC), in endothelial cells from carcinoma of cord human umbilical (ECV304), in mouse myoblasts (C2C12) as well as in epithelial cells from carcinoma of the human cervix (HeLa).
The relative activity of each promoter is expressed as a percentage of the activity luciferase obtained with the plasmid pCMV-leadTK. Enh-X: the enhancer sequence of hCMV-IE is cloned upstream of promoter X according to its normal orientation. hnE-X
the enhancer sequence of hCMV-IE is cloned upstream of promoter X according to the opposite orientation.

Figure 4: Activities of hybrid promoters evaluated in transfections transient in vitro in mouse embryonic fibroblasts (NIH 3T3), in cells from a human ENT carcinoma (TU182), as well as in cells transformed human embryonic kidneys (293). The relative activity of each promoter is expressed as a percentage of the luciferase activity obtained with the plasmid pCMV-leadTK. Enh-X: the enhancer sequence of hCMV-IE is cloned in upstream of promoter X according to its normal orientation. hnE-X: the sequence enhancer of hCMV-IE is cloned upstream of promoter X in the opposite orientation.
Figure 5: Activities of hybrid promoters evaluated in gene transfer vivo in the cranial tibial muscle of C57BL6 mice. The relative activity of each promoter is expressed as a percentage of the luciferase activity obtained with the plasmid pCMV-leadTK.
MATERIALS AND METHODS
The methods conventionally used in molecular biology such as preparative plasmid DNA extractions, DNA centrifugation piasmidic in cesium chloride gradient, electrophoresis on agarose gels, purification of DNA fragments by electroelution, precipitation of plasmid DNA into middle saline with fethanol or fisopropanol, transformation into Escherichia coli are good known to humans; art and are extensively described in the literature (Sambrook et al. "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989).
The plasmid pGL3-Basic, used for cloning the different regions promoters, is of commercial origin (Promega Corporation). Plasmids pCMV (3 (Clontech Laboratories Inc.) and pUCl8 (Boehringer Mannheim) are also of commercial origin.

Enzymatic amplification of DNA fragments by the PCR technique (Chain Amplification by Polymerase) can be performed using a DNA
thermal cyclerT ~ (Perkin Filmer Cetus) according to the manufacturer's recommendations.
The electroporation of plasmid DNA in Escherichia coli cells can be carried out using an electroporator (Bio-Rad) according to the recommendations from maker.
Verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. (Proc. Natl. Acad. Sci. USA, 74 (1977) 5467) using the kit distributed by Applied Biosystems according to recommendations from the manufacturer.
EXAMPLES
EXAMPLE 1 Construction of hybrid promoters and plasmids of expression containing them.
1.1. HSMa-active hybrid promoters.
. PhSMact plasmid. High molecular weight genomic DNA has been prepared according to the method described by Sambrook et al. ("Molecular Cloning, a Laboratory Manual ", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989) from a primary culture of aortic smooth muscle cells human (Clonetics).
This DNA was used as a template for a first amplification by PCR using the following primers - Primer 6417 (5 'GATGGTCCCTACTTATGCTGCTA 3') (SEQ ID 1) starting at position -1034 (promoter region) of the a-active gene for muscular human specific smooth ((Jeyama H. et al., Mol. Cell. Biol., 4 (1984) 1073-1078.
Access Genbank D00618).

$ 1 - Primer 6418 (S 'CTTCCATCATACCAAACTACATA 3') (SEQ ID 2) in position 1974 of sequence D00618 located inside the first intron of hSMact gene. The reaction mixture comprises 1 mg of genomic DNA, 10 pmol of each of the two primers (6417 and 6418), 100 mM of each deoxyribonucleotide (dA'CP, dCTP, dGTP, dTTP), 2 mM MgCl2 and 5 units of Taq DNA polymerase (PerkinE; lmer). The reaction volume is completed to 50 ml adjusted to the optimal concentration of ACP buffer recommended by Perkin Elmer.
The ACP amplification is carried out in MicoampTM tubes (Perkin Elmer) at using a PTC-100TM thermal cycler (MJ Research, Inc.). This amplification consists of a denaturation step at 95 ° C for 2 min followed by 30 cycles including a 15 sec denaturation step at 95 ° C, a step 30 hybridization dry at 60 ° C and an extension step of 1 min at 72 ° C. These thirty cycles are followed an additional extension of 5 min then the ACP reactions are kept at 10 ° C.
One microliter of this reaction was taken from this first reaction and then diluted in 10 ml of water. Then 1 ml of this dilution was used to make a second PCA under the same conditions as the first (above) but with a different bait couple - Primer 6453 (: S 'CTGCTAAATTGctc ~ agGACAAATTAGACAAA 3') (SEQ ID 3), this primer introduces an XhoI site (lowercase underlined) in upstream of hSMact promoter (position -680).
- Primer 6456 (5 'CCCTGACAaagcttGGCTGGGCTGCTCCACTGG 3') (SEQ ID 4), this primer introduces a HindIII site at position +30 of hSMact.
After analysis on an agarose gel then purification, the DNA fragment amplified by PCR is digested for 3 hours at 37 ° C. with Xhol and HindIII
then cloned in the vector pGL3-Basic (Proméga) previously digested with these same enzymes restriction, to generate the plasmid phSMact (Figure 1).
. Plasmids pXL3130 and pXL3131. A DNA fragment corresponding to the enhancer region of the human cytomegalovirus IE gene promoter (hCMV-IE) between positions -522 and -b3 relative to the initiation site of the transcription, was amplified by PCR using the plasmid pCMV (3 as matrix and oligonucleotides 8557 (5 'ATC GAC GCG TGC CCG TTA CAT AAC TTA
CGG 3 ') (SEQ ID 5) and 8558 (5' ATC GAC GCG TCC GCT CGA GCG TCA ATG
GGG CGG AGT TG 3 ') (SEQ ID 6) as primers. This fragment was digested by MIuI then was cloned into the plasmid phSMact previously digested with MIuI
and treated with alkaline phosphatase. According to the direction of insertion of fragment two different plasmids were obtained: nXL3130 and nXT. ~ t ~ tt .PC
rPmrPePntatinnc Schematic of these plasmids are gathered in the figure (Figure 1). These plasmids comprise, in the form of a MIuI-NcoI fragment, a hybrid promoter consisting of fenhancer of the promoter of the hCMV-IE gene and of the promoter of the gene hSMa-actin.
1.2. Hybrid mSM22 promoters.
PmSM22 plasmid. High molecular weight genomic DNA has been prepared according to the method described by Sambrook et al. {"Molecular Cloning, a Laboratory Manual ", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989) from a Balbc mouse liver.
This DNA was used as a template for PCR amplification using the following primers - Primer 6517 (5 'CCAGGCTGCAct, Çg ~ ACTAGTTCCCACCAACTCGA 3') (SEQ ID 7), this primer introduces an XhoI site (lowercase underlined) at position -436 of promoter of the mouse SM22 alpha gene (Solway J. et al., J. Biol. Chem., (1995) 13460-13469; Access Genbank L41161).
- Primer 6518 (5 'TCGTTTGaa ~ cttGGAAGGAGAGTAGCTTCGGTGTC 3') (SEQ ID 8), this primer introduces a HindIII site at position +43 of mSM22 alpha.
A reaction mixture comprising 1 mg of mouse genomic DNA, and 10 pmoles of each of the two primers (6517 and 6518) was prepared with the same reagents as for hSMact and at the same concentrations, followed by amplification PCA performed under the same conditions (see example 1.1.).
After analysis on an agarose gel then purification, the DNA fragment amplified by PCR is digested for 3 hours at 37 ° C. with XhoI and HindIII
then cloned in the vector pGL3-Basic (Proméga) previously digested with these same enzymes restriction. The resulting plasmid was designated pmSM22 (Figure 2).
. Plasmid pXL3I52 and pXL3153. A DNA fragment corresponding to the enhancer region of the hCMV-IE gene promoter between positions -522 and -63 compared to the transcription initiation site, was amplified by ACP in using the plasmid pCM: V ~ i as matrix and the oligonucleotides 8557 (5 ′
ATC
GAC GCG TGC CCG TTA CAT AAC TTA CGG 3 ') (SEQ ID 5) and 8558 (5' ATC
GAC GCG TCC GCT CCïA GCG TCA ATG GGG CGG AGT TG 3 ') (SEQ ID 6) as primers. This fragment was digested with MIuI and then was cloned into the plasmid pmSM22 previously digested with MIuI and treated with alkaline phosphatase.
According to direction of insertion of the fragment two different plasmids were obtained:
pXL3152 and pXL3153. Schematic representations of these plasmids are collected in FIG. 2. These plasmids comprise, in the form of a MIuI-NcoI fragment, a hybrid promoter consisting of the enhancer of the promoter of the hCMV-IE gene and of the promoter of the mSM22 gene.
1.3. PCMV-leadTK control plasmid.
The expression vector pCGN previously described by Tanaka et al. (Cell, b0 (1990) 375-386) contains the CMV promoter (-522 / + 72) fused to the "leader"
of HSV tk gene (+ 51 / + 101) upstream of a coding sequence for hemagglutinin. Plasmid pCGN (10 ng) was used as a template for a ACP amplification. The ACP reaction as well as the amplification have been carried out in the same conditions as those used for hSMact and mSM22 (examples 1.1 and 1.2). The primers that were used are as follows - Primer 6718 (S 'CCCGTTACATAACTTACGGTAAATGGCCCG 3') (SEQ ID 9), this primer hybridizes with the CMV promoter in position -522 (8 nucleotides downstream of the EçoRI site of pCGN).
- Primer 6719 (5 'gGGACGCGCTTCTACAAGGCGCTGGCCGAA 3') (SEQ ID 10), this primer hybridizes to position 101 of the "leader" tk. The first nucleotides G in bold is intended to restore the NcoI site of pGL3-Basic as will be explained below.
The PCR fragment thus obtained is purified and then phosphorylated using the phage T4 polynucleotide kinase (New England Biolabs). At the same time, the vector pGL3-Basic (Proméga) was linearized with NcoI, purified and then treated with Klenow DNA polymerase (Boehringer Manheim) to fill the NcoI site. This vector East then dephosphorylated using alkaline phosphatase (Boehringer Manheim) then used for the insertion of the phosphorylated PCR fragment. Guanosine (G) of primer 6719 makes it possible to restore the NcoI site only when the fragment CMV-leader tk is oriented with the 5 'part (primer 6718, position -522 of the CMV) in downstream of the HindIII site of pGL3-Basic and its 3 'end (primer 6719, leader tk) is ligated to the NcoI site of pGL3-Basic (first luciferase ATG). The plasmid thus obtained is designated pC; MV-leadTK.
EXAMPLE 2 Specificity of hybrid promoters in vitro.
This example illustrates the tissue specificity properties of promoters hybrids of the invention in vitro.
2.1. Cell cultures.
Smooth muscle cells (SMC) of rabbits are cultured in medium DMEMTM (Life Technologies Inc.) supplemented with 20% fetal calf serum (SVF). ECV304 cells are cultured in 199TM medium (Life Technologies Inc.) supplemented with 10% of SVF. C2C12 myoblasts, HeLa cells, NIH 3T3 cells as well as TU 182 cells are cultured in DMEMTM medium supplemented with 10% of SVF. 293 cells are cultured in MEMTM medium (Life Technologies Inc.) supplemented with pyruvate, non-amino acids essential and 10% of SVF. '' All cultures are carried out in an oven 37 ° C, in humid atmosphere and under a partial COZ pressure of 5%.
2.2. In vitro transfections.
The transfections are carried out in 24-well plates and each transfection East performed three times. Twenty four hours before transfection, the cells are seeded: (i) at 5x104 cells per well for muscle cells smooth of rabbit, ECV304, NIH 3T3 and HeLa cells, (ü) at 105 cells per well for the TU182 cells, (iii) at 3x104 cells per well for C2C12 cells, and (iv) to 2x 1 OS cells per well for 293 cells.
For each well, 500 ng of plasmid DNA (250 ng of plasmid of interest and 250 ng of pUCl8) are mixed with the cationic lipid RPR120535 B (WO 97/18185) at a rate of 6 nmol of lipid per pg of DNA in DMEMTM medium (20 μl final) comprising 150 mM NaCl and SO mM bicarbonate. After 20 minutes at room temperature, the 20 μl of the DNA / lipid mixture are brought into contact with the cells, in the absence of SVF, for 2 hours. The culture medium is then supplemented in SVF so as to obtain the percentage of SVF required for the culture of each cell type.
Forty-eight hours after transfection, the culture medium is removed and the cells are rinsed twice with PBS (Life Technologies Inc.).
The activity luciferase is then determined using the Luciferase Assay SystemTM kit (Promega Corporation) as recommended by the supplier.
2.3. Specific activities of hybrid promoters.
The relative luciferase activities of hybrid promoters (compared to promoter pCMV-lead TIC) measured in vitro in seven cell types different, are gathered in Figures 3 and 4, as well as in Tables I and II.
The results show that for the promoters hSMact (Table I) and mSM22 (Board II), the relative activity is a value which gives a good account of the specificity of these promoters for smooth muscle cells; specificity that has already been described in literature (Skalli et al, J. Histochem. Cytochem., 37 (1989) 315-321;
Shimizu and coll., J. Biol. Chem., 270 (1995) 7631-7643; Li et al., J. Cell Biol., 132 (1996) 849-859). Indeed, the relative activity in rabbit SMC is at least 5 times superior to those observed in other cell types: (i) from 5 to 20 times superior for the hSMact promoter (Table I), and (ü) from 5 to 25 times greater for the promoter mSM22 (Table II).
The results presented in Tables I and II clearly show that, in smooth muscle cells, the activity of the four hybrid promoters according to the invention (Enh-hSMact, hnE-hSMact, Enh-mSM22, and hnE-mSM22) is comparable, in terms of strength, to that of the CMV promoter. On the other hand, the activity relative of each of these promoters, in another cell type, is at minus 10 times lower for hSMact hybrid promoters, and at least 4 times lower for hybrid promoters mSM22, than that observed in cells smooth muscles: (i) from 10 to 140 times for the hSMact hybrid promoters, and you) from 4 to 55 times for the mSM22 hybrid promoters. These hybrid promoters therefore retain the same tissue specificity as that observed for promoters specific hSMact and mSM22.
These results further show that the orientation of the enhancer region in the hybrid promoters of the invention has no significant influence on their activity.
The four hybrid promoters therefore have, in vitro, activity in smooth muscle cells as large as that of the CMV promoter (which East reputed to be a strong promoter), while retaining a specificity tissue comparable or even superior to that of the hSMact and mSM22 promoters.
EXAMPLE 3 Specificity of hybrid promoters in vivo.
This example illustrates the tissue specificity properties of promoters hybrids of the invention in vivo.

3.1. Gene transfer in skeletal muscle.
The different plasmids were injected, intramuscularly, into the muscle cranial tibial of C57BL6 female mice 5 weeks old. Each plasmid, diluted in a Na solution (: 1 to 150 mM final, is injected at a rate of 10 pg per muscular.
Three days after injection, the muscles are taken in 2 ml of buffer Cell Culture Lysis ReagentrM (Promega Corporation), and ground using a Diax homogenizer (Heidolph). The ground material is then centrifuged for 15 minutes to 4000 g, then the luciferase activity is evaluated using the Luciferase kit Assay SystemTM
(Promega Corporation) as recommended by the supplier.
3.2. Activities of hybrid promoters in skeletal muscle in vivo.
The relative activities of the two specific promoters (hSMact and mSM22) as well as those of two of the hybrid promoters of the invention (Enh-hSMact and Enh-mSM22) were also evaluated in vivo after transfer of naked DNA into the muscular cranial tibial of mouse. The results collected in Figure 5 show than the activity of the promoter Enh-hSMact is 100 times lower than that of promoter CMV. Similarly, the activity of the promoter Enh-mSM22 is 17 times lower than that from the CMV promoter. Thus, the tissue specificity observed in vitro, and especially in C2C 12 cells which are the closest model to that used in vivo, is therefore stored in vivo.
EXAMPLE 4 Construction of Recombinant Adenoviruses Expressing the GAX protein under the control of specific hybrid promoters.
The purpose of this example is to describe an adenoviral vector carrying the gene encoding the GAX protein operably linked to the hybrid promoter of the invention composed of the CMV enhancer and the SMa-actin promoter (enh-hSMact).

The human gax gene has 912 base pairs and codes for a factor of transcription of 303 amino acids involved in growth arrest cellular (growth-arrest-specific homeobox) and having a role on the proliferation of cells smooth human muscles. This home domain domain was originally isolated of the aorta and is expressed especially in cardiovascular tissue adults (Gorski and al. 1993).
The human gax gene sequence has been cloned from a library of skeletal muscle cDNA by PCR (Polymerase Chain Reaction) using as a primer a sequence derived from the human gax gene and published by Walsh and al.
(Genomics (1994), 24, p535). The sequence was then cloned into the vector expression pXL3297. This plasmid is derived from the Bluescript plasmid (Stratagene) containing fenhancer / human CMV IE promoter (-522 / + 72) (Cell (1985), 41, p521) and SV 40 poly (2538-2759) (GenBank locus SV4CG).
The construction uses the plasmid pXL3130 described in Example 1 (Figure 1 ) into which the SMa-actin promoter had been previously introduced. The plasmid pXL3297 is an expression vector containing the human gax gene. He was digested by the enzymes HindIII and AvrII in order to introduce the human gax gene into the previous plasmid pXL3282 also digested with the enzymes HindIII and AvrII
for give the plasmid pXL 3300. As shown in Figure 6, in which the different steps in the construction of the plasmids described above are detailed, the final plasmid, pXL3310 comprises an expression cassette made up of the CMV-IE enhancer, the SMa-actin promoter (pSMA), associated according to the invention and operationally linked to the gene encoding the human GAX protein as well as the SV40 poly A termination signal.
The cassette for expression of the human gax gene is then introduced into a recombinant human adenovirus serotype 5 (Ad5) deleted from regions E1 and E3 through co-transfection and homologous recombination between the plasmid carrying the cassette expression of the gax and fadenovirus gene, in packaging cells. These cells are preferably line 293. The production of a stock of adenovirus containing the human gax gene expression cassette, resulting from cell lysis packaging 2 or 3 days after infection and isolation of particles viral recombinant by centrifugation in cesium chloride gradient.
The viral particles are then used to study the expression of the uncomfortable human gax under the control of the promoter of the invention in cells smooth muscles The expression of the GAX protein is checked 24 hours after infection of the smooth muscle primary cells by immunofluorescence or western blot in using rabbit anti-gax polyclonal antibodies.
The expression of messenger RNAs is analyzed 24 hours after infection of the smooth muscle cells by dot blot and northern blot using a oligonucleotide whose sequence is present in the gax gene.
Analysis of the biological activity of fadenovirus encoding the gax gene is performed as follows Smooth muscle cells in the exponential growth phase are infected with an adenovirus containing the gene coding for the GAX protein under the control of the enh-hSMact promoter in the absence and in the presence of 125 ng of lipofectin (48-well plates). Adenoviruses (in varying dilutions) and the lipofectamine are incubated for 30 minutes at room temperature in a medium deprived of serum. The mixture or the virus alone is brought into contact with cells for one hour at 37 ° C. At the end of the infection period, the environment containing the virus is removed and cells are incubated in DMEM medium containing 0.5%
of SVF. Within 24 hours (infection the culture medium is replaced by a growth medium for half of the cultures and (incubation is continued hours to allow cells to enter phase S. For the other half of cultures, a weak mitogenic medium is added to maintain the cells in quiescence. Viable cells are counted 72 hours after infection by using the Alamar protocol.

c ~~ - ~ _ o0 M '~ "~ f ~ O
+ I + I + t ~. ~
, 'y ~,' ~ ~ oo ~ ~ + I -H
L1 l ~~~ f N 00 M ~
VS
.ir "

NOT
R ~ O ~ N '~
OOO
a t / ~ 'f' ~ .f.pH -H -j. ~ O
'~ t MN
f3 ~ v and O
VS .

; ba ~ '' r O 0 0 +
L ~ + ~ _ ~ - ~ + ~
~., ~ ~ ~~ M ~ ii i ~
'r C / ~
OO p O ~

b OO
OO ~ ~ OO

OOOO ~ OO

V
at.

b ,.
, ~ OOO
p "VVVVV
~ VV
at '~' ~! M
OR "~ ~ N
~ ~ ' w V xx H
z M ~ M
M .-, O ~ "
~ N ~ O
iI ~ ~ ~
W _ + ~ ~ ii N 00 MG ~ V ~ MO ~ O
~ ~ ~ N

N d ~ ~ 1 ~ .- ~~ N
,., M ~ ~. ~ ~ T O
Vi .-. ", -, p M p ii - ~ + ~. ~ ii i., , 00 ~ ~ Ov o0 01 Ov ~ N
NOT

.-. ~, O
OOOOO
a "O
M ~ N ~ MOO
NOOOOOO

~ r xx H
.. ~ ~ gg ~

U
ar, .r b ...

VVVVVVV

b ea H

VS

CieC N ~ HN
M ~ a M ~ M
z LIST OF SEQUENCES
<110> RHONE-POULENC RORER
<120> Use of specific hybrid promoters for control tissue expression.
<130> PCT request sequence listing <140>
<141>
<150> FR9812000 <151> 1998-09-25 <160> 10 <170> PatentIn Ver. 2.1 <210> 1 <21 1> 23 <212> DNA
<213> Artificial sequence <220>
<223> Description of the sequence artificial: oligonucleotide <220>
<221> feature bet <222> (1) .. (23) <400> 1 gatggtccct acttatgctg cta 23 <210> 2 <211> 23 <21 2> DNA
<213> Artificial sequence <220>
<223> Description of the sequence artificial: oligonuc: leotide <220>
<221> feature bet <222> (1) .. (23) <400> 2 cttccatcat accaaactac ata 23 <210> 3 <21 1> 32 <212> DNA
<213> Artificial sequence <220>
<223> Description of the sequence artificial: oligonuc: Léotide <220>
<221> misc_feature <222> (1). (32) <400> 3 ctgctaaatt gctcgaggac aaattagaca aa 32 <210> 4 <211> 33 <212> DNA
<213> Artificial sequence <220>
<223> Description of the sequence artificial: oligonucl.éotide <220>
<221> misc_feature <222> (1) .. (33) <400> 4 ccctgacaaa gcttggctgg gctgctccac tgg 33 <210> 5 <21 1> 30 <212> DNA
<213> Artificial sequence <220>
<223> Description of the sequence artificial: oligonucleotide <220>
<221> misc feature <222> (1) __ (30) <900> 5 atcgacgcgt gcccgttaca taacttacgg 30 <210> 6 <211> 38 <212> DNA
<213> Artificial sequence <220>
<223> Description of the sequence artificial: oligonucleotide <220>
<221> misc feature <222> (1) .. (38) <400> 6 atcgacgcgt ccgctcgagc gtcaatgggg cggagttg 3g <210> 7 <211> 36 <21 2> DNA
<213> Artificial sequence <220>
<223> Description of the sequence artificial: oligonucl_êotide <220>
<221> misc feature <222> (1) .. (36) <400> 7 ccaggctgca ctcgagacta gttcccacca actcga 36 <210> 8 <21 1> 36 <212> DNA
<213> Artificial sequence <220>

<223> Description of the sequence artificial: oligonucleotide <220>
<221> misc feature <222> (1) .. (36) <400> 8 tcgtttgaag cttggaagga gagtagcttc ggtgtc <210> 9 <211> 30 <21 2> DNA
<213> Artificial sequence <220>
<223> Description of the sequence artificial: oligonucleotide <220>
<221> misc feature <222> (1) .. (30) <400> 9 cccgttacat aacttacggt aaatç ~ gcccg 30 <210> 10 <211> 30 <21 2> DNA
<213> Artificial sequence <220>
<221> feature bet <222> (1) .. (23) <220>
<223> Description of the sequence artificial: oligonucleotide <220>
<221> feature bet <222> (1). . ( 30) <400> 10 gggacgcgct tctacaaggc gctggccgaa

Claims (18)

1. Hybrid promoter including:
- all or part of the enhancer region of a strong promoter/enhancer and ubiquitous, and - a promoter region allowing the specific expression in the smooth muscle cells. 2. Hybrid promoter according to claim 1 characterized in that the enhancer region is selected from the immediate early gene enhancer region cytomegalovirus (CMV-IE), the enhancer region of the sarcoma virus LTR
of rous (LTR-RSV), the enhancer region of the SV40 virus, and the enhancer region of EF1.alpha. gene. 3. Hybrid promoter according to claim 2 characterized in that the enhancer region is the enhancer region of the immediate early gene of the cytomegalovirus (CMV-IE), preferably human cytomegalovirus (hCMV-IE). 4. Hybrid promoter according to claim 1 characterized in that the promoter region comprises all or part of the promoter of the gene coding for actin-.alpha. of smooth muscle cells (SMact) or the SM22 gene. 5. Hybrid promoter including:
- all or part of the enhancer region of the immediate early gene of the human cytomegalovirus (hCMV-IE), and - All or part of the promoter of the gene encoding actin-.alpha. of smooth muscle cells (SMact). 6. Hybrid promoter including:
- all or part of the enhancer region of the immediate early gene of the human cytomegalovirus (hCMV-IE), and - all or part of the SM22 gene promoter. 7. Hybrid promoter according to claim 1, characterized in that the promoter region comprises a basal promoter and a sequence conferring the tissue specificity, said sequence being derived from the SMact promoter and/or from SM22 promoter. 8. Expression cassette comprising a nucleic acid encoding a RNA or a polypeptide of interest, placed under the control of a hybrid promoter according to one of claims 1 to 7. 9. Cassette according to claim 8 characterized in that it comprises in besides a transcription termination signal. 10. Cassette according to claim 8 or 9 characterized in that the acid nucleus encodes a protein chosen from the proteins involved in the cell cycle, proteins inducing apoptosis, proteins capable of of alter the proliferation of smooth muscle cells, proteins inducing angiogenesis and transcription factors. 11. Vector comprising a hybrid promoter according to claim 1 or a cassette according to claim 8. 12. Vector according to claim 11, characterized in that it is a plasmid, a cosmid or any DNA not encapsidated by a virus. 13. Vector according to claim 11, characterized in that it is a recombinant virus, preferably derived from an adenovirus, a retrovirus, a herpes virus or an adeno-associated virus. 14. Composition comprising a vector according to claim 12 and a chemical or biochemical transfer agent. 15. Composition comprising a recombinant virus according to claim 13 and a physiologically acceptable carrier. 16. Cell modified by a cassette according to claim 8 or a vector according to claim 11. 17. Use of a hybrid promoter according to one of claims 1 to 7 for the preparation of a composition intended for the selective expression of a acid nucleus in smooth muscle cells. 18. Use of a hybrid promoter according to one of claims 1 to 7 for the preparation of a composition for the expression of an acid nucleus in smooth muscle cells and not in cells endothelial cells near the blood vessel.