FR2786198A1 - New nucleic acid for regulating gene expression, particularly expression of tyrosine hydroxylase for treatment of Parkinson's disease, includes the gene and tetracycline transactivator - Google Patents

Abstract

Nucleic acid (I) comprises: (i) first region (R1) encoding the transactivator (tTA) of the tetracycline-regulated system, controlled by a moderate promoter; and (ii) second region (R2) comprising a nucleic acid of interest (II) under control of a promoter sensitive to tTA. R1 and R2 are arranged in the same transcriptional orientation. Independent claims are also included for the following: (1) vector containing (I); (2) cell containing (I) or the vector of (a); and (3) composition comprising cells of (b).

Description

<Desc / Clms Page number 1>

 The present invention relates to novel compositions and methods for controlling expression of nucleic acids in cells.

The invention is more particularly suitable for controlling the expression of nucleic acids in nerve cells, in vitro and in vivo.

 Controlling the expression of nucleic acids in cells has major appeal in all areas of biotechnology. Thus, in vitro or ex vivo, it makes it possible to improve the conditions for expression of recombinant proteins, the study of the function or regulation of genes, the production of viral particles, the preparation of cells intended to be implanted in vivo , etc. In vivo, it can improve the properties of animal models, study more precisely the bioavailability or toxicity of compounds or the function of genes, or even more effectively control the production of compounds for therapeutic or vaccine purposes. , for example. The compositions and methods of the invention can be used in all these fields of biotechnology.

 Different approaches have been described in the prior art in an attempt to control the expression of genes. This concerns in particular the use of transcriptional vectors or promoters having tissue specificity. However, the systems described do not always exhibit the levels of specificity expected, in particular in vivo, and they do not allow temporal control of the expression.

 A complex system, using on the one hand the tTA transactivator controlled by tetracycline and on the other hand a sensitive tTA promoter has been described by Gossen et al. (PNAS 89 (1992) 5547; Science 268 (1995) 1766). Although offering advantages in terms of temporal regulation of expression, this system, as described so far, still has certain drawbacks which limit its applications. These disadvantages include cell toxicity, observed expression leaks, the need to use two vectors, etc.

<Desc / Clms Page number 2>

 The present invention now provides a new regulated expression system having improved stability, specificity and workability compared to prior art systems.

 A first aspect of the invention therefore relates to gene constructions comprising elements, the particular nature and arrangement of which allow close control of gene expression to be ensured.

 Another aspect of the invention relates to vectors incorporating these genetic constructs, and in particular viral vectors.

 Another aspect of the invention therefore relates to cells genetically modified by the genetic constructs or vectors of the invention, compositions comprising them, and their use for the production of products of interest in vitro, ex vivo or in vivo .

 Another aspect of the invention relates to methods and compositions for the regulated expression of a nucleic acid in cells in vitro, ex vivo or in vivo, more particularly in nerve cells. Another aspect of the invention also relates to a method for the transfer and the regulated expression of a nucleic acid in vivo comprising the implantation (or the graft) in vivo of cells (in particular of nervous progenitors) genetically modified by constructions or vectors of the invention.

 The present invention more particularly describes a new regulated expression system, based on the use of tTA, and having improved properties. This system is particularly effective in an adenoviral context, and allows efficient and regulated expression in vitro and in vivo, particularly in the nervous system.

<Desc / Clms Page number 3>

 A first object of the invention relates more particularly to a nucleic acid characterized in that it comprises: a) a first region comprising a nucleic acid coding for the tTA transactivator of the regulatory system with tetracycline, under the control of a moderate promoter , and, b) a second region comprising a nucleic acid of interest under the control of a sensitive tTA promoter, and in that the two regions a) and b) are arranged in the same transcriptional orientation.

 More preferably, the nucleic acid according to the invention further comprises a third region c), disposed between the two regions a) and b), limiting the transcriptional interference between regions a) and b).

 The present invention results in fact from the demonstration of the advantageous properties of such constructions, in particular for the control of gene expression in vivo, in particular in nerve cells. The invention also shows that the advantageous properties of these constructions result, in part, in the choice and arrangement of the different genetic elements between them.

 Thus, in the region a) of the nucleic acids of the invention, the promoter used to control the expression of the tTA transactivator gene is a moderate promoter. The term "moderate promoter" designates, within the meaning of the invention, a promoter whose activity level is considered to be medium by a person skilled in the art, that is to say lower than that of strong promoters. More particularly, a moderate promoter within the meaning of the invention is a non-viral promoter allowing expression at physiological levels.

<Desc / Clms Page number 4>

 Thus, unlike the systems previously described (Gossen et al., PNAS 89 (1992) 5547) in which the promoter used is a strong viral promoter (hCMV in particular), the constructs of the invention allow the constitutive synthesis of the tTA transactivator, to non-toxic levels for mammalian cells. The Applicants have now shown that maintaining moderate levels of tTA in cells makes it possible to obtain much finer and more precise regulation of gene expression, in particular in nerve cells.

 More preferably, the promoter used is a cellular promoter, that is to say a promoter originating from a gene expressed in a cell. Advantageously, it is a promoter originating from (or derived from) a cell derived from an organism of the same species as the cells into which the genetic construction is intended to be introduced. Thus, when the constructs of the invention are intended for the introduction of nucleic acids into animals, the moderate cellular promoter used is preferably derived from a cell of an animal of the same species, or from a related species or close. Of course, it is possible to use promoters derived from different organisms, for example a murine promoter for expression in humans, as soon as the promoter used is functional.

 Even more preferably, the promoter used is a constitutive moderate cellular promoter. The present application indeed shows that the best properties of the system of the invention are obtained when the promoter used is constitutive, that is to say ensures the presence and the maintenance of stable levels of tTA in the cells.

 Specific examples of constitutive moderate cellular promoters suitable for the present invention are in particular ubiquitous promoters such as the promoter of the domestic gene ("housekeeping") of 3-phosphoglycerate kinase (PGK), of

<Desc / Clms Page number 5>

dihydrofolate reductase (DHFR) or elongation factor 1 [alpha] (EF1a). Other moderate cellular promoters which can be used in the context of the invention are tissue-specific promoters, such as for example the promoter of the GFAP genes ("Glial Specific Fibrillary Acidic
Protein "), specific for glia, NSE (" Neuron Specific Enolase "), specific for neurons, -actin, 0-globin, MHCa (" Myosis Heavy Chain a "), specific for heart muscle, or compound promoters, for example of the NRSE-PGK type.

Moderate promoters within the meaning of the invention are therefore advantageously cellular promoters, ensuring a constitutive, ubiquitous or localized expression to certain tissues or cell types, preferably making it possible to obtain physiological levels of expression. The use of the PGK promoter (or of variants) represents a preferred embodiment of the invention. Thus, the examples presented below show that the use of this promoter makes it possible to maintain in vivo the expression of the nucleic acid of interest at least one month after the introduction of the construct. Thus, no decrease in the number of cells expressing the nucleic acid of interest was observed during this period. This stability of expression represents one of the important advantages of the present invention in comparison with the systems of the prior art. Thus, in transplants of progenitor nerve cells infected with an adenovirus encoding b-galactosidase under the control of a strong promoter (promoter of the RSV virus LTR), a clear decrease in expression levels is observed less than one months after the transplant. This therefore illustrates the advantageous properties of the invention, in terms of stability, linked, unexpectedly, to the use of a moderate promoter to direct the expression of the tTA gene.

 Another important characteristic of the constructions according to the invention resides in the arrangement of the two regions a) and b). So these

<Desc / Clms Page number 6>

 two regions are advantageously (i) arranged in the same transcriptional orientation and (ii) separated by a region c) limiting transcriptional interference.

 The present application shows first of all that, in order to obtain a better efficiency of the system of the invention (that is to say better control of expression), it is particularly advantageous to position the two cassettes a) and b) in the same transcriptional orientation. These results are rather surprising since better control of expression has often been observed when two cassettes are positioned in reverse orientation. In the context of the present invention, on the contrary, no leak seems to occur, even in an adenoviral context, when the cassettes are in the same orientation, whereas such leaks had been reported for a construction in anti-parallel orientation ( Kojima et al., Biochem.Biophys.Res.Commun 238 (1997) 569).

 On the other hand, to further improve the properties of the constructions of the invention, it is particularly advantageous to introduce, between the regions a) and b) mentioned above, a third region c) limiting the transcriptional interference between a) and B). The expression "transcriptional interference" designates any influence or effect of the promoter of region a) on the transcription of nucleic acid b), and vice versa. More specifically, the term "transcriptional interference" denotes the difference that may exist between the expression of region b) on the one hand in an isolated context and on the other hand functionally linked to region a). Such a region c) preferably comprises a transcriptional terminator, preferably the UMS sequence. The UMS ("Upstream Mouse Sequence") sequence is a genomic sequence which has been identified upstream of the murine c-mos gene (McGeady et al., Dna 5 (1986) 289). This sequence behaves like a

<Desc / Clms Page number 7>

 transcriptional terminator. The present invention now shows that these sequences can be advantageously used for the efficient control of the expression of genes in vivo, in particular in the nervous system, more specifically in an adenoviral context.

 The system of the invention therefore relies on the presence, in the same nucleic acid, of two cassettes (regions), one expressing, under controllable conditions, a transcriptional factor capable of activating expression, in the second cassette of a nucleic acid of interest. In this second cassette (region b)), it is therefore important to choose a transcriptional promoter which is suitable for the gene construction of the invention. Thus, in region b), the promoter used is a promoter sensitive to the tTA transactivator, that is to say whose activity is increased in the presence of said transactivator. From a structural point of view, it is therefore a promoter comprising, in its sequence or at a functional distance from it, at least one site for binding of the factor tTA (Gossen et al., 1992). This binding site, or operating region (Op or tetOp) may for example have the sequence shown in FIG. 6 or a functional variant thereof. A variant can correspond, for example, to a genetically modified sequence, by mutation, deletion or addition of one or more base pairs, and retaining the capacity to bind the tTA transactivator. Preferably, the modifications relate to less than 10% of the sequence presented in FIG. 6. In addition, the Op sequence may be present, in region b), in one or more copies, for example from 1 to 10 copies, preferably of 3 to 10, even more preferably 3 to 8 copies. In a particular mode of implementation, the promoter used in b) comprises 7 operating sequences. Even more preferably, in order to ensure significant control of the expression of the nucleic acid of interest, it is strongly recommended that the promoter used in b) have a very low, or even zero, basal activity. Therefore, an activity of this promoter is observed only in the presence of tTA,

<Desc / Clms Page number 8>

 and the regulation is therefore very tight. Advantageously, the promoter used in b) is therefore a minimal promoter sensitive to the tTA transactivator. The minimal character designates a promoter whose basal activity is very weak, or even zero. Such a promoter generally comprises the minimum elements essential to the function of transcriptional promoter (TATA box for example) and is devoid of the other regions naturally involved in the strength of the promoter or its regulation, for example. Such promoters can be prepared from different types of promoters, by deletion and / or addition of elements ("silencer"). A preferred promoter in b) is a functional promoter in mammalian cells, essentially inactive in the absence of tTA, and stimulated in the presence of the tTA transactivator. The term "essentially inactive" designates the absence of expression product (polypeptide) detectable by conventional techniques, and in particular by enzymatic assay or by immunohistochemistry, microdevalysis or even HPLC techniques. This term does not exclude the presence of mRNA detectable by PCR or other very sensitive detection techniques, but the level of concentration of which remains practically insignificant.

 The promoter used in b) can be of nature, of origin and have varied properties. The choice of promoter used in fact depends on the desired use and the gene of interest, in particular. Thus, the promoter can come from a strong or weak promoter, ubiquitous or specific for tissues / cells, or even specific for physiological or physiopathological states (activity dependent on the state of cell differentiation or certain stages of the cell cycle) , for example. The promoter can be of eukaryotic, prokaryotic, viral, animal, plant, artificial or human origin, etc. Particular examples of promoters are the promoter of the immediate early genes CMV, TK, GH, EF1-a, APO, etc. or artificial promoters. For use in the present invention, these promoters are preferably rendered

<Desc / Clms Page number 9>

 "minimum", that is to say dependent on the presence of tTA. For this, the original promoters can be digested by enzymes and tested for their activity, preferably after functional coupling with one or more Op sequences. The number of tetOp sequences, as well as their distance from the chosen promoter, can be adapted by a person skilled in the art so that the expression of said promoter is strictly tTA dependent. Preferably, the promoter used in b) is a minimal promoter of the immediate early cytomegalovirus (CMV) gene, preferably human CMV (hCMV), as described in Corti et al (Neuroreport 7 (1996) 1655), incorporated into the present by reference.

 The present invention can be used for the expression of nucleic acids of various interest, depending on the applications sought.

Thus, in region b), the nucleic acid of interest is advantageously a nucleic acid coding for a protein or a polypeptide of interest. Among the products of interest within the meaning of the present invention, there may be mentioned more particularly enzymes, blood derivatives, hormones such as growth hormone, cytokines, lymphokines: interleukins, interferons, TNF, etc. (French patent n 92 03120), growth factors, for example angiogenic factors such as VEGF or FGF, neurotransmitters or their precursors or synthetic enzymes (Tyrosine hydroxylase: TH), trophic factors, in particular neurotrophic for treatment of neurodegenerative diseases, trauma that damaged the nervous system, or retinal degenerations: BDNF, CNTF, NGF, IGF, GMF aFGF, NT3, NT5, HARP / pleiotrophin, or bone growth factors, hematopoietic factors, etc. , dystrophin or a minidystrophin (French patent n 91 11947), the genes coding for factors involved in coagulation: factors VII, VIII, IX, the suicide genes (thymidine kinase, cytosine deaminase), the proteins involved in the cell cycle like p21, or other kinase inhibiting proteins

<Desc / Clms Page number 10>

 dependent, Rb, Gas-1, Gas-6, Gas-3, Gad 45, Gad 153, cyclins A, B, D, or the protein GAX limiting the proliferation of cells in smooth muscles (treatment of restenosis) , proteins inducing apoptosis or other tumor suppressors such as p53, Bax, BclX-s, Bad or any other antagonist of Bcl2 and BcIX-1, the genes of hemoglobin or of other protein transporters, genes corresponding to the proteins involved in lipid metabolism, of the apolipoprotein type chosen from the apolipoproteins AI, A-II, A-IV, B, CI, C-II, C-III, D, E, F, G, H, J and apo (a), metabolism enzymes such as lipoprotein lipase, hepatic lipase, lecithin cholesterol acyltransferase, 7 alpha cholesterol hydroxylase, phosphatidyl acid phosphatase, or lipid transfer proteins such as protein transfer of cholesterol esters and the phospholipid transfer protein, a HDL binding protein or a receptor chosen from LDL receptors, chylomicrons-remnants receptors and scavenger receptors, etc.

 Among the products of interest, it is important to highlight the antibodies, the variable fragments of single chain antibody (ScFv) or any other fragment of antibody having recognition capabilities for its use in immunotherapy, for example for the treatment of diseases. infectious, tumors (anti-RAS, anti-p53 or antiGAP antibody), autoimmune diseases such as multiple sclerosis (antiidiotype antibody).

 Other proteins of interest are, without limitation, soluble receptors, such as for example the soluble CD4 receptor or the soluble TNF receptor for anti-HIV therapy, the soluble acetylcholine receptor for the treatment of myasthenia gravis; enzyme peptides or inhibitors, or peptides agonists or antagonists of receptors or adhesion proteins such as for example for

<Desc / Clms Page number 11>

 treatment of asthma, thrombosis and restenosis: artificial, chimeric or truncated proteins. Among the hormones of essential interest, there may be mentioned insulin in the case of diabetes, growth hormone and calcitonin.

 The nucleic acid can also be an antisense gene or sequence, the expression of which in the target cell makes it possible to control the expression of genes or the transcription of cellular mRNAs. Such sequences can, for example, be transcribed in the target cell into RNA complementary to cellular mRNAs and thus block their translation into protein, according to the technique described in European Patent No. 140,308. The therapeutic genes also include the sequences coding for ribozymes, which are capable of selectively destroying target RNAs (European Patent No. 321,201).

 The nucleic acid can also contain one or more genes coding for an antigenic peptide capable of generating an immune response in humans or animals. In this particular mode of implementation, the invention therefore makes it possible to produce either vaccines or immunotherapeutic treatments applied to humans or animals, in particular against microorganisms, viruses or cancers. These may in particular be antigenic peptides specific for the Epstein Barr virus, the HIV virus, the hepatitis B virus (European patent N 185 573), the pseudo-rabies virus, the "syncitia forming virus" , other viruses or tumor-specific antigens such as the MAGE proteins (European Patent No. 259,212).

 The nucleic acid can also code for a product that is toxic to cells, in particular conditional toxicity (i.e., thymidine kinase, cytosine deaminase, etc.).

<Desc / Clms Page number 12>

 Other genes of interest have been described in particular by Mc Kusick, V.A. Mendelian (Inheritance in man, catalogs of autosomal dominant, autosomal recessive, and X-linked phenotypes, Eighth edition.

John Hopkins University Press (1988)), and in Standbury, J. B. et al. (The metabolic basis of inherited disease, Fifth edition. McGraw-Hill (1983)). The genes of interest cover the proteins involved in the metabolism of amino acids, lipids and other constituents of the cell.

 On the other hand, region b) can also comprise, at 3 ′ of the nucleic acid of interest, a transcriptional terminator. Finally, the nucleic acid can comprise several coding regions, possibly separated by an IRES, allowing the production of several products of interest.

 The constructs according to the invention being particularly suitable for regulating expression in the nervous system, the nucleic acids of interest more particularly encode neurotransmitters or their precursors or synthetic enzymes (Tyrosine hydroxylase: TH), trophic factors, in particular neurotrophics for the treatment of neurodegenerative diseases, traumas having damaged the nervous system, or retinal degenerations.

 In a particular embodiment, the invention relates to a nucleic acid characterized in that it comprises: a) a first region comprising a nucleic acid coding for the transactivator of the regulatory system by tetracycline (tTA) under the control of the promoter of the PGK gene, and, b) a second region comprising a nucleic acid of interest, in particular coding for human tyrosine hydroxylase, under the control of the

<Desc / Clms Page number 13>

 minimal CMV promoter modified to include 1 to 10, preferably 3 to 8, in particular 7 tetOp sequences. c) a third region comprising a UMS sequence, and in that the two regions a) and b) are arranged in the same transcriptional orientation.

 The nucleic acid of the invention can be DNA as well as RNA. It may more particularly be genomic DNA (gDNA) or complementary DNA (cDNA). The nucleic acids of the invention can be prepared according to techniques well known to those skilled in the art, involving for example the synthesis of nucleic acids, screening of libraries, ligation, enzymatic cleavages, amplification, cloning , etc. as illustrated in the examples (see Maniatis et al.). Thus, the different regions a), b) and c) can be prepared separately, then assembled functionally, that is to say in the same transcriptional orientation. The space between regions a) and b) can be variable without affecting the effectiveness of the constructions of the invention. Thus, these regions can be separated from 0 to 3000 bp for example, more generally from 0 to 1000 bp, advantageously less than 500 bp. This distance between regions a) and b) is generally determined by the length of region c) (when it is present) and by the cloning capacity of the vector used. It can be easily adapted by a person skilled in the art. The nucleic acids of the invention can comprise elements of varied origin, in particular originating from prokaryotic, eukaryotic (animal, plant, viral, etc.), synthetic or semisynthetic nucleic acids.

 The present invention also relates to any vector comprising a nucleic acid as defined above. It can be any vector known to a person skilled in the art, such as for example a plasmid,

<Desc / Clms Page number 14>

 cosmid, phage, YAC, HAC, transposon, episome, virus, etc. A preferred type of vector according to the invention is represented by viral vectors, such as for example adenoviruses, AAVs, herpes virus, vaccinia virus, or also certain retroviruses (in particular lentiviruses). It is even more preferably a virus having a tropism for nerve cells, in particular nerve cell progenitors. In this regard, a particularly preferred vector in the context of the present invention is an adenovirus.

 The adenoviruses used for the implementation of the present invention are advantageously defective recombinant adenoviruses, that is to say those whose genome comprises a heterologous nucleic acid and which are incapable of autonomous replication in cells. More preferably, the adenoviruses of the invention are defective for all or part of the E1 and E3 regions at least.

 They may also be defective 3rd generation recombinant adenoviruses, that is to say defective for the E1 and E4 regions, in whole or in part, and possibly for the E3 region.

 Particular variants of the invention consist of the use of adenoviruses carrying deletions affecting all or a functional part of the following regions: -E1, E4 and E3, - E1, E4 and E2, - E1, E4, E2 and E3, - the above regions as well as all or part of the genes coding for the late functions of the adenovirus (L1 to L5), or, - all of the viral coding regions.

<Desc / Clms Page number 15>

 The genomic structure of adenoviruses has been widely described in the literature. In this regard, the genome of the Ad5 adenovirus has been fully sequenced and is accessible on a database (see in particular GeneBandk M73260). Likewise, parts or even all of other adenoviral genomes (Ad2, Ad7, Ad12, canine adenovirus CAV-2, etc.) have also been sequenced. In addition, the construction of defective recombinant adenoviruses has also been described in the literature. Thus, applications WO 94/28152, WO 95/02697 and WO 96/22378 for example, describe different deletions in the regions E1 and E4. Likewise, application WO 96/10088 describes vectors carrying a modification at the level of the Iva2 gene, application WO 94/26914 describes adenoviruses of animal origin, application WO 95/29993 describes deletions relating to the E2 region of adenovirus.

 Advantageously, the recombinant adenovirus used in the context of the invention comprises a deletion in the E1 region of its genome affecting the E1a and E1b regions. As a specific example, mention may be made of deletions affecting nucleotides 454-3328; 382-3446 or 357-4020 (with reference to the Ad5 genome).

 On the other hand, the deletion in the E4 region preferentially affects all of the open phases, such as for example deletions 33466-35535 or 33093-35535 or only part of the E4 region (ORF6 or ORF3 for example), as described in applications W095 / 02697 and W096 / 22378, incorporated herein by reference.

 Concerning adenoviruses lacking in addition late functions ("minimum" vector) or all coding regions ("gutless" vector), their construction has been described for example by Parks et al.

PNAS 93 (1996) p. 13565 and Lieber et al., J. Virol. 70 (1996) p. 8944.

<Desc / Clms Page number 16>

 The nucleic acids of the invention can be inserted at different sites in the recombinant adenoviral genome. They can be inserted at the E1, E3 or E4 region, replacing the deleted or surplus sequences. They can also be inserted at any other site, apart from the sequences necessary in cis for the production of the viruses (ITR sequences and packaging sequence).

 Furthermore, the recombinant adenoviruses can be of human or animal origin. As regards adenoviruses of human origin, mention may preferably be made of those classified in group C, in particular adenoviruses of type 2 (Ad2), 5 (Ad5); or adenovirus 7 (Ad7) or 12 (Ad12). Among the various adenoviruses of animal origin, mention may preferably be made of adenoviruses of canine origin, and in particular all the strains of the adenovirus CAV2 [Manhattan strain or A26 / 61 (ATCC VR- 800) for example]. Other adenoviruses of animal origin are cited in particular in application WO94 / 26914 incorporated herein by reference.

 Recombinant adenoviruses are produced in an packaging line, that is to say a cell line capable of complementing in trans one or more of the deficient functions in the recombinant adenoviral genome. Among the packaging lines known to those skilled in the art, mention may be made, for example, of line 293 in which a part of the adenovirus genome has been integrated. More specifically, line 293 is a human embryonic kidney cell line containing the left end (approximately 11-12%) of the genome of the adenovirus serotype 5 (Ad5), comprising the left ITR, the packaging region , the E1 region, including E1a and E1b, the region coding for the protein pIX and part of the region coding for the protein plVa2. This line is capable of trans-complementing recombinant adenoviruses defective for the E1 region, that is to say devoid of all or

<Desc / Clms Page number 17>

 part of the E1 region, and produce viral stocks with high titers. This line is also capable of producing, at permissive temperature (32 C), stocks of virus further comprising the thermosensitive E2 mutation. Other cell lines capable of complementing the E1 region have been described, based in particular on human lung carcinoma cells A549 (WO94 / 28152) or on human retinoblasts (Hum. Gen. Ther. (1996) 215). Furthermore, lines capable of trans-complementing several functions of the adenovirus have also been described. In particular, there may be mentioned lines complementing the E1 and E4 regions (Yeh et al., J. Virol. Vol. 70 (1996) pp 559-565; Cancer Gen. Ther. 2 (1995) 322; Krougliak et al. , Hum. Gen.

Ther. 6 (1995) 1575) and lines complementing regions E1 and E2 (W094 / 28152, W095 / 02697, W095 / 27071) or lines derived therefrom usable for producing minimum adenoviruses, in particular because they express in addition a site-specific recombinase activity involved in the construction of such viruses.

 Recombinant adenoviruses are usually produced by the introduction of viral DNA into the packaging line, followed by lysis of the cells after approximately 2 or 3 days (the kinetics of the adenoviral cycle being 24 to 36 hours). For the implementation of the method, the viral DNA introduced can be the complete recombinant viral genome, optionally constructed in a bacterium (WO96 / 25506) or in a yeast (WO95 / 03400), transfected in the cells. It can also be a recombinant virus used to infect the packaging line. The viral DNA can also be introduced in the form of fragments each carrying a part of the recombinant viral genome and a zone of homology making it possible, after introduction into the packaging cell, to reconstitute the recombinant viral genome by homologous recombination between the different fragments .

<Desc / Clms Page number 18>

 After the lysis of the cells, the recombinant viral particles can be isolated by any known technique such as centrifugation in a cesium chloride gradient or chromatography. An alternative method has been described in particular in application FR 9608164 incorporated herein by reference.

 Another subject of the invention relates to a composition comprising a vector as defined above, preferably a defective recombinant adenovirus as defined above. In this embodiment, the compositions according to the invention can comprise variable amounts of recombinant adenoviruses, easily adaptable by a person skilled in the art according to the applications envisaged (in vitro, ex vivo or in vivo, for example). Generally, the compositions comprise of the order of 105 to 1015 p. v. of recombinant adenovirus, preferably from 107 to 1012 p.v. The term p. v. corresponds to the number of viral particles present in the compositions.

 The vectors and compositions of the invention can be used either directly in vitro or in vivo for the transfer and the regulated expression of nucleic acids in cells, or also for the introduction of nucleic acids into cells for the purpose of their implantation (or transplant) in vivo.

 Another subject of the invention relates to any cell comprising a nucleic acid or a vector as defined above. Preferably, it is a mammalian cell, preferably human. In a particularly preferred embodiment, it is a nerve cell, in particular a progenitor nerve cell. One such population of cells is, for example, the human nerve progenitor cell as described by Buc et al. (Neurobiol.Dis. 2 (1995) 37).

<Desc / Clms Page number 19>

 In this regard, a particular embodiment of the invention comprises a nerve cell genetically modified by a recombinant adenovirus comprising a nucleic acid as defined above.

 The invention also relates to any composition comprising cells as described above.

 The invention also relates to the use of a nucleic acid or of a vector or of a composition as described above, for the preparation of a composition intended for expressing a nucleic acid of interest in vivo.

 The invention also relates to the use of a nucleic acid or of a vector or of a composition as described above, for the preparation of a composition intended for expressing a nucleic acid of interest in the nervous system. in vivo.

 In a particular embodiment, the invention relates to a method for the regulated expression of nucleic acids in the nervous system comprising the implantation, in the nervous system of a subject, of a cell as defined above, and control of expression by administration on tetracycline or a tetracycline analog.

 The compositions of the invention can be in different forms, such as solutions, gels, powder, etc. They are generally in the form of solutions, preferably sterile, such as for example saline solutions (monosodium phosphate, disodium, sodium chloride, potassium, calcium or magnesium, etc., or mixtures of such salts), isotonic, or dry compositions , in particular freeze-dried, which, by addition as appropriate of sterilized water or physiological saline, allow the constitution of solutes. Other excipients can be used such as for example a hydrogel. This hydrogel can be prepared from any bio- (hetero or hetero) polymer.

<Desc / Clms Page number 20>

 compatible and non-cytotoxic. Such polymers have for example been described in application WO93 / 08845. In addition, the compositions according to the invention can be packaged in any type of suitable device, such as a vial, tube, vial, pouch, syringe, balloon, etc.

 As indicated above, the compositions of the invention can be used in vitro, ex vivo or in vivo.

 For in vitro or ex vivo use, the cells can be simply incubated, in any suitable device (plate, box, pocket, etc.) in the presence of a vector composition as described above.

For this type of application, the compositions comprising adenoviruses can be used at multiplicities of infection (MOI) of between 10 and 5000 p.v. per cell, for example, preferably between 100 and 2000.

 For use in vivo, the compositions of the invention can be formulated for topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, intratumoral, etc. administration. In this application, in particular for cellular compositions, the compositions used advantageously comprise from 104 to 106 cells, more preferably from 105 to 106 cells. In addition, the implanted compositions preferably comprise cells with high density (approximately 105 to 106 by NI). The results presented in the examples indeed show that the use of high density cells promotes the taking of the graft and the survival of the grafted cells. On the other hand, to further promote the survival of grafts in vivo, it is also possible to administer, simultaneously or prior (or even later), one or more compounds / immunosuppressive treatment (Neuroscience 78 (1997) 685).

<Desc / Clms Page number 21>

 In this regard, the invention also relates to a method for the transfer of a nucleic acid in vivo comprising the administration of a composition as described above. The invention can be used for example in animals, for the creation of pathological models, or the study of gene regulation, or also in humans, in studies of labeling, of bioavailability, or for purposes medical.

 For regulating expression, the compositions of the invention advantageously comprise tetracycline or any tetracycline analog capable of acting on the activity of the tTA transactivator. Such an analog is constituted for example by doxycycline (Kistner et al., PNAS 93 (1996) 10933). Other analogs which can be used in the present invention have been described for example by Alvarez et al. (Gene Ther. 4 (1997) 993), incorporated herein by reference. The doses of analogs can be easily adapted by a person skilled in the art depending on the analog and the constructions used. As an indication, doses of 0.1 ng / ml of doxycycline are sufficient in vitro to completely block the expression of the nucleic acid in the constructions of the invention.

 The present invention is particularly suitable for the treatment (i.e., partial or complete reduction) of neurodegenerative diseases such as in particular Parkinson's disease (PD). PD is a disease characterized by the progressive loss of dopaminergic neurons in the substantia nigra. Treatment with L-DOPA is done to try to control the symptoms of the disease, but its effectiveness decreases with the progression of the disease. The present application offers an advantageous alternative for the treatment of this pathology, by the introduction of a gene (Tyrosine hydroxylase, TH), involved in the synthesis of dopamine in vivo. Experiments carried out by long-term pharmacological treatment with dopaminergic compounds have shown that these treatments induce a generalized unregulated effect,

<Desc / Clms Page number 22>

 leading in most cases to very annoying fluctuations in the response of motor neurons. The present invention is particularly suitable for this type of situation since it allows fine and local control of the synthesis of L-DOPA, which are essential for obtaining a motor response physiologically reproducing the complex mechanisms of dopaminergic stimulation.

 The present application will be described in more detail with the aid of the following examples, which should be considered as illustrative and not limiting.

LEGEND TO THE FIGURES Figure 1: of the genome structure of an adenovirus comprising a nucleic acid according to the invention. Reverse inverted terminal sequences (ITR) and packaging sequence (#) are indicated. pIX represents the sequence coding for the adenoviral protein IX.

Figure 2: Panel (a): Infection of human nerve progenitor with AdPGK adenovirus. tet.hTH-1 at different MONTHS. Values shown are means of four experiments.

 Panels (b) and (c): In vitro production of TH in human nerve progenitors, measured by immunocytochemistry seven days after ME infection = 140. Panel (b) without treatment, panel (c) after treatment in the presence of doxycycline (10ng / ml) immediately after infection and until day 7. The enlargements are 360 (panel (b)) and 220 (panel (c)).

 Figure 3: disappearance (a) and resumption (b) of hTH activity in cultures infected with the AdPGK adenovirus. tet.hTH1 (ME = 40) after addition (a) or withdrawal (b) of doxycycline (5ng / ml) on day 0 (5.5

<Desc / Clms Page number 23>

 days after infection). The hTH activity in the cultures not treated on day 0 was determined as 100%. (c) Effect of different doses of doxycycline on the expression of hTH determined on day 11 after infection.

 Values are means of at least 4 experiments.

 Figure 4: TH immunoreactivity in intrastriatal grafts of human nerve progenitors infected with the AdPGK adenovirus. tet.hTH-1 (ME = 40) measured by anti-TH immunohistochemistry on cryostated sections of brains of 15 μm (a) untreated animals and (b) an animal treated daily with doxycycline. The violet labeling (a) (b) reveals the presence of human cells hybridizing with the digoxygenin-labeled aluminum probe following incubation with an anti-digoxygenin antibody coupled to alkaline phosphatase and subsequent staining with a specific substrate. Magnification 110.

Figure 5: TH immunoreactivity in grafts of human nervous progenitors infected with the AdPGK adenovirus. tet.hTH1 (MOI = 40) measured by anti-TH immunohistochemistry and in situ hybridization using a sulfur-labeled HTH-1 specific antisense oligonucleotide 35 on sections of cryostatic brains 15 m from (a) an untreated animal and (b) an animal treated daily with doxycycline. The cuts were countermarked with cresyl violet. Magnification 450.

 Figure 6: Sequence of the tTA (A) gene; the UMS sequence (B); of the sequence Op (C) and of the minimal promoter CMV (D).

EXAMPLES # - Materials and Methods 1. Construction of the AdPGK adenovirus. Tet. HTH-1.

A DNA fragment comprising the sequence coding for the transactivator of the tetracycline regulatory system (tTA) and for the promoter

<Desc / Clms Page number 24>

minimum of human cytomegalovirus (PhCMV) was excised from the plasmid pUMS-luc (Corti et al. Neuroreport 7 (1996) 1655) by digestion with the enzymes Xhol and Scal and inserted into the shuttle plasmid pCMVluclX (supplied by MC Geoffroy) digested with Bglll / Clal enzymes. The vector ptetIX was thus obtained. A Bglll / Hindlll fragment containing the cDNA of human tyrosine hydroxylase 1 (hTH-1) (Grima B. et al. Nature
1987, 326: 707-711) followed by the SV40 virus polyadenylation signal was inserted between the ClaI and EcoRV sites of the vector ptetIX, thus generating the vector ptetlXhTH-1. The immediate early promoter of human cytomegalovirus (phCMV) controlling the expression of tTA in the vector ptetIXhTH has been replaced by the ubiquitous promoter of the phosphoglycerate kinase gene (PGK) (Adra et al., Gene 1987; 60-65) . An Xhol / SplI fragment containing the PGK promoter was ligated between the Spel and SplI sites of the vector ptetlXhTH-1 to generate the plasmid pPGKtetIXhTH-1. For homologous recombinations (Stratford et al. J. Clin. Invest. (1992) 626) the vector pPGKtetlXhTH-1 was linearized with Xmnl and cotransfected with the large Clcl fragment of the Adpgal adenovirus in line 293 transcomplementing the E1 region . The recombinant adenovirus AdPGK.tet.hTH-1 was purified twice by plate assay.

A viral stock was obtained by amplification on 293 cells, purification on a cesium chloride gradient and then on a Sephadex column.

The viral titer determined by plate titration on 293 cells is 3.5x10 'pfu / ml.

2. Generation and culture of human nerve progenitor cells.

Primary cultures of human embryonic brains were obtained and propagated in vitro in a serum-free medium supplemented with basic FGF as described previously (Buc et al., Neurobiol. 10 (1995) 37).

<Desc / Clms Page number 25>

3. Infection of human nerve progenitor cells.

For the in vitro studies, the cells were seeded on 12-well tissue culture plates at a density of 6 to 7 × 10 5 cells per well and incubated with the virus at the multiplicity of infections (MOI) chosen in 400 l d '' a defined medium devoid of serum (DS-FM). After 6 hours the supernatants are removed and replaced by an equivalent volume of DSFM. At different times after infection, the cells are harvested and centrifuged (4000 RPM, 5 min) and the pellets are frozen at -80 ° C. for the enzymatic tests (Reinhardt et al., Life sciences, (1986) 21-85) .

For the transplants, the cells were seeded on 6 cm diameter tissue culture plates at a density of 5 × 10 6 cells per plate and incubated with the AdPGK virus. tet.hTH-1 at an MOI of 40 pfu per cell for 6 hours. The day after infection, the cells were harvested as described above (Sabaté et al., Nature Genetics, 9 (1995) 256), resuspended in DS-FM medium at a density of 4x105 cells per l and stored on ice during all transplant operations.

4. Intracerebral lesions and grafts.

Five to six weeks before intracerebral transplants, 6hydroxydopamine (6-OHDA) was injected stereotaxically into the ascending left mesostriatal dopaminergic pathway of adult Sprague-Dawley rat (Chaarles-River), as previously described (Horellou et al. , Neuron 5 (1990), 393). Sixteen rats were implanted under anesthesia with 800 μl per kg of a mixture in a 1: 1 ketamine (UVA) and Rompun (Bayer) ratio. One l of cell suspension was injected using a 10 l Hamilton syringe into each of the two sites of the injured striatum at the following stereotaxic coordinates: + 0.7 anterior

<Desc / Clms Page number 26>

 bregma (AB), + 2.5 lateral to the central line (LM), 5 ventral on the dural surface (V) and +1.5 AB, -2.5 LM, 5V (starting bar fixed at 0). The animals were injected daily with 10 mg per kg of cyclosporine.

5. In situ hybridization and immunohystochemistry Four weeks after implantation, the animals were perfused as described above (Sabaté et al. Cited above). The brains were recovered, fixed in 4% of pfa, stored in PBS medium, 20% of sucrose. Subsequently, 15 µm sections were obtained.

Human cells were detected by hybridization using a human-specific aluminum primer labeled with digoxigenin-tagged nucleotides (5'-XTTgCAgTgAgCCgAgATCgCgCC-3 '). After an initial denaturation step (20 minutes in 95% formamide, 0.1 × SSC at 75, with stirring), sections were treated as described above (Dumas et al., J. Chem. Neuroanat. 5 (1992 ) 11). Human TH-1 RNA was detected in the grafts by in situ hybridization with a sulfur-labeled oligonucleotide directed against exon 1 of human TH (5'-TgCCTgCTTggCgTCCAgCTCAgACA-3 '). The hybridization conditions are identical to those described by Lanièce et al. (J. Neurochem. 66 (1996) 1819). For immunohistochemistry, the sections were treated according to standard techniques.

II - Results 1. Generation of an adenovirus encoding human TH-1 under the control of a regulatory system according to the invention (AdPGK.tet.hTH-1).

To obtain regulated expression of the hTH-1 transgene from a single adenoviral vector, the tetacycline tet-off negative regulatory system initially based on the use of two vectors was modified. The tTA transactivator sensitive to tetracycline and human TH-1 cDNA

<Desc / Clms Page number 27>

 were inserted into an Ad5 adenovirus backbone deleted for the E1 and E3 regions. In the vector AdPGK.tet.hTH-1, the expression of tTA is under the control of the ubiquitous promoter of the murine phosphoglycerate kinase (PGK) gene, while the transcription of human TH is controlled by a minimal promoter sensitive to tTA (the CMV promoter). The UMS sequence was inserted between the tTA and the CMV promoter to limit the transcriptional interference between the two transcription units.

2. Infection of human nerve progenitors with AdPGK.tet.hTH-1: regulated expression in vitro.

To determine whether the AdPGK.tet.hTH-1 adenovirus could lead to a synthesis of active TH in human nerve progenitors, cells were infected with different multiplicities of infection (Figure 2a). The results obtained show that the TH activity in the infected cells increases as a function of the dose of vectors used, which demonstrates that the adenovirus AdPGK.tet.hTH-1 is functional.

The possibility of controlling the expression of the hTH-1 gene with doxycycline has been studied in cells infected with adenovirus. When the antibiotic was added (10ng / ml) to the culture medium immediately after infection, no TH activity could be demonstrated at any time, even at the highest dose of virus. In addition, no cell with TH immunoreactivity was identified (Figure 2b and 2c).

The possibility that the expression of the gene could also be subsequently stopped in cells already expressing the transgene was then tested. For this, doxycycline was added to the culture medium 5.5 days after infection, when the TH activity was already detectable in the cells. The results obtained show that the enzymatic activity gradually decreases and almost completely disappears 5.5 days after the addition of doxycycline (FIG. 3a). Thus, the transcription of the TH-1 gene in the

<Desc / Clms Page number 28>

 conditions of the invention in human nerve progenitors can be downregulated very effectively.

To test whether it is possible to induce a transgene activity again, the TH activity was followed after removal of the doxycycline from the culture medium of the infected cells (FIG. 3d). The results obtained show that the TH activity gradually increases in the cells, which indicates that the inhibition of the transgene to doxycycline is reversible.

To determine the minimum dose of antibiotic required to inhibit gene expression, the cells were then incubated with varying concentrations of doxycycline immediately after infection (Figure 3c). A concentration of 0.1 ng / ml is sufficient to prevent the appearance of TH activity while the dose of 0.01 ng / ml TH activity can be detected.

3. Transplantation into the brain of human nervous progenitors infected with the adenovirus AdPGKtet.hTH-1: control of expression in vivo.

This example demonstrates the capacity of the system of the invention and in particular of the human nerve progenitor cells infected with the adenovirus to mediate expression of human TH in vivo, and also the capacity of the system of the invention to regulate this expression in vivo in particular by doxycycline. The cells were infected with the AdPGK adenovirus. tet.hTH-1 then implanted in the striatum of rats having suffered a unilateral lesion of the dopaminergic pathway caused by the injection of the toxin 6-OHDA. To facilitate taking the transplant, a large number of cells (8x105) suspended at high density (4x105 / l) were grafted to each animal. After the transplant, the animals were either untreated (n = 8) or treated (n = 8) daily with the

<Desc / Clms Page number 29>

 doxycycline (1 mg / ml in water). Four weeks after the transplant, the rats were sacrificed and the brains analyzed for expression of TH.

 All the brains tested contain viable grafts of human cells as demonstrated by in situ hybridization with an oligonucleotide probe directed against the repeated human specific aluminum sequence (FIG. 4a). No difference in the size or appearance of the grafts was observed between the treated animals and the animals not treated with doxycycline.

Transplants in untreated animals show significant TH immunoreactivity (Figure 4a). The number of cells expressing TH in grafts was thus estimated between 5 and 10%. A similar percentage of cells that have been re-cultured after grafting in a serum-free medium for six days also exhibit TH immunoreactivity. These results clearly show the expression of the gene in vivo, under the same conditions as in vitro.

In contrast, no TH immunoreactive cell was detected in any of the grafted animals that received doxycycline (Figure 4b). As a result, doxycycline effectively inhibits the appearance of an amount of TH detectable by immunohistochemistry in transplants.

To establish whether the effect of doxycycline reflects tight control of gene expression at the transcriptional level, in situ hybridization was carried out on sections using an oligonucleotide specific for the TH-1 messenger RNA. Transplants in untreated animals have been marked very significantly. The labeling was co-located with the immunoreactive cells (FIG. 5a). On the other hand, no specific labeling was detected in the grafts of the treated animals (FIG. 5b).

<Desc / Clms Page number 30>

In conclusion, it can be said that doxycycline effectively inhibits transcription of the transgene in the system of the invention in an adenoviral context introduced by grafted human nervous progenitors.

<Desc / Clms Page number 31>

SEQUENCE LIST (1) GENERAL INFORMATION: (i) DEPOSITOR: (A) NAME: RHONE-POULENC RORER SA (B) STREET: avenue Raymond Aron (C) CITY: (E) COUNTRY: (F) POSTAL CODE: (H ) FAX: (ii) TITLE OF THE INVENTION: New system for regulating the expression of a transgene (iii) NUMBER OF SEQUENCES: (iv) FORM DECEPTED BY COMPUTER: (A) TYPE OF MEDIUM: disk (B) COMPUTER: Compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: PatentIn Release # 1.0, Version # 1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 2502 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: (D) CONFIGURATION: (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETIC: NO (iv) ANTI -SENSE: (ix) CHARACTERISTIC: (A) NAME / KEY: - tTA (A) (B) LOCATION: 1..1040 (ix) CHARACTERISTIC: (A) NAME / KEY: - UMS (B) (B) LOCATION : 1041..2069 (ix) CHARACTERISTICS: (A) NAME / KEY: - OP (C) (B) LOCATION: 2069..2362 (ix) CHARACTERISTICS: (A) NAME / KEY: - OP (B ) LOCATION: 2070..2110

<Desc / Clms Page number 32>

(ix) CHARACTERISTICS: (A) NAME / KEY: - minimum promoter CMV (D) (B) LOCATION: 2363..2502 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1:
CTCGAGGAGC TCGAATTCAT ATGTCTAGAT TAGATAAAAG TAAAGTGATT AACAGCGCAT 60 TAGAGCTGCT TAATGAGGTC GGAATCGAAG GTTTAACAAC CCGTAAACTC GCCCAGAAGC 120 TAGGTGTAGA GCAGCCTACA TTGTATTGGC ATGTAAAAAA TAAGCGGGCT TTGCTCGACG 180 CCTTAGCCAT TGAGATGTTA GATAGGCACC ATACTCACTT TTGCCCTTTA GAAGGGGAAA 240 GCTGGCAAGA TTTTTTACGT AATAACGCTA AAAGTTTTAG ATGTGCTTTA CTAAGTCATC 300 GCGATGGAGC AAAAGTACAT TTAGGTACAC GGCCTACAGA AAAACAGTAT GAAACTCTCG 360 AAAATCAATT AGCCTTTTTA TGCCAACAAG GTTTTTCACT AGAGAATGCA TTATATGCAC 420 TCAGCGCTGT GGGGCATTTT ACTTTAGGTT GCGTATTGGA AGATCAAGAG CATCAAGTCG 480 CTAAAGAAGA AAGGGAAACA CCTACTACTG ATAGTATGCC GCCATTATTA CGACAAGCTA 540 TCGAATTATT TGATCACCAA GGTGCAGAGC CAGCCTTCTT ATTCGGCCTT GAATTGATCA 600 TATGCGGATT AGAAAAACAA CTTAAATGTG AAAGTGGGTC CGCGTACAGC CGCGCGCGTA 660 CGAAAAACAA TTACGGGTCT ACCATCGAGG GCCTGCTCGA TCTCCCGGAC GACGACGCCC 720 CCGAAGAGGC GGGGCTGGCG GCTCCGCGCC TGTCCTTTCT CCCCGCGGGA CACACGCGCA 780 GACTGTCGAC GGCCCCCCCG ACCGATGTCA GCCTGGGGGA CGAGCTCCAC TTAGACGGCG 840 AGGACGTGGC GATGGCGCAT GCCGACGCGC TAGACGATTT CGATCTGGAC ATGTTGGGGG 900 ACGGGGATTC CCCGGGTCCG GGATTTACCC CCCACGACTC CGCCCCCTAC GGCGCTCTGG 960 ATATGGCCGA CTTCGAGTTT GAGCAGATGT TTACCGATGC CCTTGGAATT GACGAGTACG 1020 GTGGGTAGGG GGCGCGAGGA TCTCAGATTT GTGCATACAC AGTGACTCAT ACTTTCACCA 1080 ATACTTTGCA TTTTGGATAA ATACTAGACA ACTTTAGAAG TGAATTATTT ATGAGGTTGT 1140 CTTAAAATTA AAAATTACAA AGTAATAAAT CACATTGTAA TGTATTTTGT GTGATACCCA 1200 GAGGTTTAAG GCAACCTATT ACTCTTATGC TCCTGAAGTC CACAATTCAC AGTCCTGAAC 1260 TATAATCTTA TCTTTGTGAT TGCTGAGCAA ATTTGCAGTA TAATTTCAGT GCTTTTAAAT 1320 TTTGTCCTGC TTACTATTTT CCTTTTTTAT TTGGGTTTGA TATGCGTGCA CAGAATGGGG 1380 CTTCTATTAA AATATTCCAT GGCTTACATT TTTAATGTTT TGTTCTCTTA ATATGTTCAA 1440

<Desc / Clms Page number 33>

 AGCTACTCAA CTTTTATTCC CGAAAAATGT TTACTTTAAT TATTCTAATT TCTTACATAA 1500 AGCATTGAGG TGCTAACAAT TATATACTAT GTACAAGATG GCAGACTAAA TCATATCATA 1560 CCATCAAGTA GAAACCTGGA GTTTGGTGAA CTTTGAGTTG TTTATATGTC TCTCCTTTAT 1620 TGTCTTCTCA AAACCTGTGA TTCTGAAGTC AAAGGGACAC AGCTGTCACA TGAAAAGTGA 1680 TCACTTATCA CCTGTATGCG TAAAACACCT TACCAAGCAG CTAAGAGGAG TAACTCCTAG 1740 CCACTTTGAG AAACGTTTTT GAATAAACAG AGCAAGGCTC TTCCCCATTC TCCCAGAGAT 1800 ATAGCATAAA ACTGAGCGCA TTTTTATAAA ACAAAAAAGG AGGAATGTGT GGTTTGATGG 1860 CCAGACCCTG AATTTGAGTT CAGCATCTGC TTTTCCATAT TATAGATGGG TACCAGTGAT 1920 TCTGAGCCAT GTCTATTTCT CCTGACTTTT CCTCTGTTTT CCCACGCTTG CTGATATTTA 1980 CAGCCGTGGT CATCACAATC ACCTTTGTTC CTTTCTTCCT TCCTCCAACT CTGCATTAAA 2040 TTCCAGGAAC TTGCTTTCTG TGAAGTCTGA GTTTACCACT CCCTATCAGT GATAGAGAAA 2100 AGTGAAAGTC GAGTTTACCA CTCCCTATCA GTGATAGAGA AAAGTGAAAG TCGAGTTTAC 2160 CACTCCCTAT CAGTGATAGA GAAAAGTGAA AGTCGAGTTT ACCACTCCCT ATCAGTGATA 2220 GAGAAAAGTG AAAGTCGAGT TTACCACTCC CTATCAGTGA TAGAGAAAAG TGAAAGTCGA 2280 GTTTAC CACT CCCTATCAGT GATAGAGAAA AGTGAAAGTC GAGTTTACCA CTCCCTATCA 2340 GTGATAGAGA AAAGTGAAAG TCGAGCTCGG TACCCGGGTC GAGTAGGCGT GTACGGTGGGGGGATGATGAGGATGCCGCTAGGATCC

Claims (18)

 CLAIMS 1. Nucleic acid characterized in that it comprises: a) a first region comprising a nucleic acid coding for the transactivator of the regulatory system by tetracyline (tTA) under the control of a moderate promoter, and, b) a second region comprising a nucleic acid of interest under the control of a promoter sensitive to tTA, and in that the two regions a) and b) are arranged in the same transcriptional orientation. 2. Nucleic acid according to claim 1, characterized in that it further comprises a third region c), disposed between the two regions a) and b), limiting transcriptional interference between regions a) and b). 3. Nucleic acid according to claim 2, characterized in that region c) comprises a transcriptional terminator, preferably a UMS sequence. 4. Nucleic acid according to any one of the preceding claims, characterized in that, in region a), the moderate promoter is a cellular promoter, preferably constitutive of the specific tissue. 5. Nucleic acid according to claim 4, characterized in that the moderate cellular promoter is chosen from the promoter of the PGK, DHFR, EF1a, p-actin, p-globin and MHCa genes. <Desc / Clms Page number 35>  6. Nucleic acid according to any one of the preceding claims, characterized in that, in region b), the nucleic acid of interest is a nucleic acid coding for a protein or a polypeptide of interest. 7. Nucleic acid according to claim 6, characterized in that the protein or the polypeptide of interest are chosen from neurotransmitters or their synthetic precursors or enzymes and trophic factors. 8. Nucleic acid according to any one of the preceding claims, characterized in that, in region b), the promoter is a promoter functional in mammalian cells. 9. Nucleic acid characterized in that it comprises: a) a first region comprising a nucleic acid coding for the transactivator of the tetracycline regulatory system (tTA) under the control of the promoter of the PGK gene, and, b) a second region comprising a nucleic acid coding for human tyrosine hydroxylase under the control of a minimal CMV promoter, modified so as to contain 1 to 10 tetOp sequences, c) a third region comprising the UMS sequence, and in that the two regions a) and b) are arranged in the same transcriptional orientation. 10. Vector comprising a nucleic acid according to any one of claims 1 to 9. 11. Vector according to claim 10 characterized in that it is a viral vector, preferably an adenovirus. <Desc / Clms Page number 36>  12. A cell comprising a nucleic acid according to any one of claims 1 to 9 or a vector according to claim 10. 13. Cell according to claim 12 characterized in that it is a mammalian cell, preferably human. at 14. Cell according to claim 13 characterized in that it is a nerve cell. 15. Nerve cell genetically modified by a recombinant adenovirus comprising a nucleic acid according to claim 9. 16. Composition comprising cells according to one of claims 12 to 15. 17. Use of a nucleic acid according to one of claims 1 to 9 or of a vector according to claim 10 or of a composition according to claim 16, for the preparation of a composition intended for expressing a nucleic acid d interest in vivo. 18. Use of a nucleic acid according to one of claims 1 to 9 or of a vector according to claim 10 or of a composition according to claim 16, for the preparation of a composition intended for expressing a nucleic acid d interest in the nervous system in vivo.