EP0750674A1 - RECOMBINANT ADENOVIRUSES FOR GLIAL MATURATION FACTOR BETA (GMF-$g(b)) - Google Patents

Abstract

Recombinant adenoviruses comprising a heterologous DNA sequence coding for glial maturation factor beta (GMF-β), preparation thereof, and uses thereof, in particular for treating and/or preventing degenerative neurological diseases or central nervous system tumours.

Description

ADENOVIRUS RECO BINANXS FOR THE MAXURAXION FACTOR OF XYPE BEXA GLIAL CELLS (GMF-β)

The present invention relates to recombinant vectors of viral origin and their use for the treatment and / or prevention of neurodegenerative diseases. More particularly, it relates to recombinant adenoviruses comprising a DNA sequence coding for the maturation factor of glial cells beta type (GMF-β, "glial maturation factor"). The invention also relates to the preparation of these vectors, the pharmaceutical compositions containing them and their therapeutic use, in particular in gene therapy.

Neurodegenerative diseases account for a large share of health spending in Western countries, a share that continues to increase following the aging of the population. These diseases include Alzheimer's disease, Parkinson's disease, Huntington's chorea, amyotrophic lateral sclerosis, etc. The pathological signs and etiology of these diseases are very varied, but all result from a progressive loss of neuronal cells in the central nervous system, sometimes within very localized structures like the substantia nigra in Parkinson's disease. Although some palliative pharmacological treatments are already available, their effects are relatively limited. The present invention describes a novel therapeutic approach, which is particularly advantageous for the treatment of these diseases. More particularly, the present invention describes vectors making it possible to directly promote the survival of the neuronal cells involved in these pathologies, by efficient and localized expression of certain trophic factors.

Trophic factors are a class of molecules with properties that stimulate neuritic growth or the survival of nerve cells. The first factor with neurotrophic properties, NGF ("Nerve Growth Factor"), was characterized some forty years ago (for review, see Levi- Montalcini and Angelleti, Physiol. Rev. 48 (1968) 534) . It is only recently that other neurotrophic factors have been identified, such as in particular the brain-derived neurotrophic factor (BDNF) (Thoenen, Trends in NeuroSci. 14 (1991) 165), CNTF, etc. The Applicant is more particularly interested in a trophic factor designated factor of maturation of glial cells, having certain advantageous properties. GMF-β is a trophic factor isolated primarily from from the bovine brain (Lim et al., PNAS 86 (1989) 3901). GMF-β has a molecular weight of 17 kD, and is mainly synthesized in astrocytes, although a presence at the level of neurons has been detected recently (Zaheer et al., J. Neurochem. 60 (1993) 914). Unlike most trophic factors, GMF-β is present mainly in the cytosol of cells, and only a small percentage is secreted and exposed outside the cells, on the plasma membrane. GMF-β stimulates the growth of neurites in the classic dorsal root lymph node test (DRG). Furthermore, it is able to promote the differentiation of certain cell lines such as gliomas (C6) or neuroblastomas (N18) (Kaplan et al., J. Neurochem. 57 (1991) 483). This activity results in an antiproliferative effect on said tumor lines, activity which does not exist vis-à-vis normal cells (Lim et al., Cell Regulat. 1 (1990) 741).

GMF-β therefore have certain particularly interesting properties in vitro. However, the therapeutic application of GMF-β faces various obstacles. In particular, the lack of bioavailability of GMF-β limits any therapeutic use. Furthermore, there are no effective means for delivering GMF-β in a sustainable and localized manner to certain desired regions of the body. Finally, it is essential that the GMF-β delivered is active and can exert a therapeutic activity in vivo.

The present invention provides a particularly advantageous solution to these problems. The present invention resides in fact in the development of vectors which are particularly effective for delivering in vivo and in a localized manner, therapeutically active amounts of GMF-β. In copending application No. PCT / EP93 / 02519, it has been shown that adenoviruses can be used for the transfer of genes in vivo into the nervous system. The present invention relates to new constructions, which are particularly suitable and effective for the transfer of a specific gene into the nervous system. More particularly, the present invention relates to a recombinant adenovirus comprising a DNA sequence coding for the maturation factor of glial cells (GMF-β), its preparation, and its use for the treatment and / or prevention of neurodegenerative diseases or of certain tumors, especially central tumors.

The Applicant has now shown that it is possible to construct recombinant adenoviruses containing a sequence coding for GMF-β, to administer these recombinant adenoviruses in vivo, and that this administration allows stable and localized expression of therapeutically active amounts of GMF-β in vivo, and in particular in the nervous system, and without cytopathological effect. The particularly advantageous properties of the vectors of the invention derive in particular from the construction used (defective adenovirus, deleted from certain viral regions), from the promoter used for the expression of the sequence coding for GMF-β (viral or tissue-specific promoter preferably), and methods of administration of said vector, allowing efficient expression and in appropriate tissues of GMF-β. The present invention thus provides viral vectors usable directly in gene therapy, particularly suitable and effective for directing the expression of GMF-β in vivo. The present invention thus offers a particularly advantageous new approach for the treatment and / or prevention of neurodegenerative diseases or central tumors.

A first object of the invention therefore resides in a defective recombinant adenovirus comprising a DNA sequence coding for the β type glial cell maturation factor (GMF-β) or a derivative thereof.

The invention also relates to the use of such a defective recombinant adenovirus for the preparation of a pharmaceutical composition intended for the treatment or prevention of neurodegenerative diseases.

The β-type glial cell maturation factor (GMF-β) produced in the context of the present invention can be human GMF-β or an animal GMF-β. In particular, the DNA sequence coding for human GMF-β has been cloned and sequenced (Kaplan et al., J. Neurochem. 57 (1991) 483). Prior to their incorporation into an adenovirus vector according to the invention, these sequences are advantageously modified, for example by site-directed mutagenesis, in particular for the insertion of appropriate restriction sites. The sequences described in the prior art are in fact not constructed for use according to the invention, and prior adaptations may prove to be necessary, in order to obtain important expressions (see example 1.2.). In the context of the present invention, it is preferred to use a DNA sequence coding for the maturation factor of glial cells of the human β type (hGMF-β). Furthermore, as indicated above, it is also possible to use a construct coding for a derivative of GMF-β, in particular a derivative of human GMF-β. Such a derivative comprises for example any sequence obtained by mutation, deletion and / or addition with respect to the native sequence, and coding for a product retaining at least one of the biological properties of GMF-β (trophic and / or differentiating and / or antiproliferative effect of tumor cells). These modifications can be carried out by techniques known to a person skilled in the art (see general molecular biology techniques below and example 2). The biological activity of the derivatives thus obtained can then be easily determined, as indicated in particular in Example 3. The derivatives within the meaning of the invention can also be obtained by hybridization from nucleic acid libraries, using as probe the native sequence or a fragment thereof.

These derivatives are in particular molecules having a greater affinity for their binding sites, sequences allowing improved expression in vivo, molecules exhibiting greater resistance to proteases, molecules having greater therapeutic efficacy or lesser side effects, or possibly new biological properties.

Among the preferred derivatives, mention may be made more particularly of natural variants, molecules in which one or more residues have been substituted, derivatives obtained by deletion of regions having little or no effect on the interaction with the binding sites considered or expressing an undesirable activity, and the derivatives comprising, relative to the native sequence, additional residues, such as for example a secretion signal and / or a junction peptide. In a particularly advantageous manner, the sequence of the present invention contains a secretion signal making it possible to direct the GMF-β synthesized in the secretory pathways of the infected cells, so that the GMF-β synthesized is released in the extracellular compartments and could activate its receptors. The secretion signal used can be any heterologous or even artificial secretion signal. Advantageously, it is an active secretion signal in human cells, in particular nerve cells. Preferably, use is made of the secretion signal of a cytokine, and in particular of human fibroblast interferon, which allows high secretion levels of GMFβ.

The DNA sequence coding for the glial cell maturation factor used in the context of the present invention can be a cDNA, a genomic DNA (gDNA), or a hybrid construct consisting, for example, of a cDNA into which would be inserted one or more several introns. They can also be synthetic or semi-synthetic sequences. Particularly advantageously, we use cDNA or gDNA. In particular, the use of a gDNA can allow better expression in human cells.

In a first embodiment of the invention, the adenovirus therefore comprises a cDNA sequence coding for the maturation factor for glial cells (GMF-β). In another preferred embodiment of the invention, the adenovirus comprises a gDNA sequence coding for the maturation factor for glial cells (GMF-β). Advantageously, the DNA sequence codes for GMF-β preceded by a secretion signal and, preferably, by the efficient secretion signal in human nerve cells.

Advantageously, the sequence coding for GMF-β is placed under the control of signals allowing its expression in nerve cells. Preferably, these are heterologous expression signals, that is to say signals different from those naturally responsible for the expression of GMF-β. They may in particular be sequences responsible for the expression of other proteins, or synthetic sequences. In particular, they may be promoter sequences of eukaryotic or viral genes. For example, they may be promoter sequences originating from the genome of the cell which it is desired to infect. Likewise, they may be promoter sequences originating from the genome of a virus, including the adenovirus used. In this regard, mention may be made, for example, of promoters El A, MLP, CMV, LTR-RSV, etc. In addition, these expression sequences can be modified by adding activation, regulation sequences or allowing tissue-specific expression. It may in fact be particularly advantageous to use expression signals which are active specifically or mainly in nerve cells, so that the DNA sequence is only expressed and produces its effect when the virus has actually infected a nerve cell. In this regard, mention may be made, for example, of promoters of neuron-specific enolase, of GFAP, etc.

In a first particular embodiment, the invention relates to a defective recombinant adenovirus comprising a cDNA sequence coding for the maturation factor of human β-type glial cells (hGMF-β) under the control of the LTR-RSV promoter.

In another particular embodiment, the invention relates to a defective recombinant adenovirus comprising a gDNA sequence coding for the maturation factor of human β-type glial cells (hGMF-β) under the control of the LTR-RSV promoter. The Applicant has indeed shown that the LTR promoter of the sore coma virus (RSV) allows a lasting and significant expression of GMF-β in the cells of the nervous system, in particular central.

Still in a preferred embodiment, the invention relates to a defective recombinant adenovirus comprising a DNA sequence coding for the maturation factor of human β-type glial cells (hGMF-β) under the control of a promoter allowing predominant expression in the the nervous system.

A particularly preferred embodiment of the present invention resides in a defective recombinant adenovirus comprising the ITR sequences, a sequence allowing encapsidation, a DNA sequence coding for the maturation factor of human β-type glial cells (hGMF- β) or a derivative thereof under the control of a promoter allowing a majority expression in the nervous system, and in which the El gene and at least one of the E2, E4, L1-L5 genes is non-functional. The defective adenoviruses according to the invention are adenoviruses incapable of replicating autonomously in the target cell. Generally, the genome of the defective adenoviruses used in the context of the present invention is therefore devoid of at least the sequences necessary for the replication of said virus in the infected cell. These regions can be either eliminated (in whole or in part), or made non-functional, or substituted by other sequences and in particular by the DNA sequence coding for GMF-β.

Preferably, the defective virus of the invention conserves the sequences of its genome which are necessary for the packaging of the viral particles. Even more preferably, as indicated above, the genome of the defective recombinant virus according to the invention comprises the ITR sequences, a sequence allowing the packaging, the non-functional E1 gene and at least one of the E2, E4, L1-L5 genes. nonfunctional.

There are different serotypes of adenovirus, the structure and properties of which vary somewhat. Among these serotypes, it is preferred to use, within the framework of the present invention, human adenoviruses of type 2 or 5 (Ad 2 or Ad 5) or adenoviruses of animal origin (see application FR 93 05954). Among the adenoviruses of animal origin which can be used in the context of the present invention, mention may be made of adenoviruses of canine, bovine, rnurine origin (example: Mavl, Beard et al., Virology 75 (1990) 81), ovine, porcine , avian or even simian (example: after-sales service). Preferably, the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus [Manhattan strain or A26 / 61 (ATCC VR- 800) for example]. Preferably, in the context of the invention, adenoviruses of human or canine or mixed origin are used.

The defective recombinant adenoviruses according to the invention can be prepared by any technique known to those skilled in the art (Levrero et al., Gene 101 (1991) 195, EP 185 573; Graham, EMBO J. 3 (1984) 2917). In particular, they can be prepared by homologous recombination between an adenovirus and a plasmid carrying, inter alia, the DNA sequence coding for GMF-β. Homologous recombination occurs after co-transfection of said adenovirus and plasmid in an appropriate cell line. The cell line used must preferably (i) be transformable by said elements, and (ii), contain the sequences capable of complementing the part of the genome of the defective adenovirus, preferably in integrated form to avoid the risks of recombination. As an example of a line, mention may be made of the human embryonic kidney line 293 (Graham et al., J. Gen. Virol. 36 (1977) 59) which contains in particular, integrated into its genome, the left part of the genome an Ad5 adenovirus (12%). Strategies for constructing vectors derived from adenoviruses have also been described in applications No. FR 93 05954 and FR 93 08596 which are incorporated herein by reference. Then, the adenoviruses which have multiplied are recovered and purified according to conventional techniques of molecular biology, as illustrated in the examples.

As indicated above, the present invention also relates to any use of an adenovirus as described above for the preparation of a pharmaceutical composition intended for the treatment and / or prevention of neurodegenerative diseases. More particularly, it relates to any use of these adenoviruses for the preparation of a pharmaceutical composition intended for the treatment and / or prevention of Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, epilepsy and vascular dementia. It also relates to the use of these adenoviruses for the treatment of tumors of the nervous system, in particular central. In particular, mention may be made of medulloblastomas, neuroblastomas, gliomas, etc.

The present invention also relates to a pharmaceutical composition comprising one or more defective recombinant adenoviruses as described above. These pharmaceutical compositions can be formulated for topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc. administration. Preferably, the pharmaceutical compositions of the invention contain a pharmaceutically acceptable vehicle for an injectable formulation, especially for direct injection into the nervous system of the patient. They may in particular be sterile, isotonic solutions, or dry compositions, in particular lyophilized, which, by addition as appropriate of sterilized water or physiological saline, allow the constitution of injectable solutes. Direct injection into the patient's nervous system is advantageous because it allows the therapeutic effect to be concentrated in the affected tissues. The direct injection into the central nervous system of the patient is advantageously carried out by means of a stereotaxic injection device. The use of such a device makes it possible to target with great precision the injection site.

In this regard, the invention also relates to a method of treatment of neurodegenerative diseases comprising the administration to a patient of a recombinant adenovirus as defined above. More particularly, the invention relates to a method of treatment of neurodegenerative diseases comprising stereotaxic administration of a recombinant adenovirus as defined above.

The doses of defective recombinant adenovirus used for the injection can be adapted according to different parameters, and in particular according to the mode of administration used, the pathology concerned or even the duration of the treatment sought. In general, the recombinant adenoviruses according to the invention are formulated and administered in the form of doses of between 10 ⁴ and 10 ¹⁴ pfu / ml, and preferably 10 ⁶ to 10 ¹⁰ pfu / ml. The term pfu ("plaque forming unit") corresponds to the infectious power of a virus solution, and is determined by infection of an appropriate cell culture, then measurement, generally after 48 hours, of the number of plaques of infected cells. The techniques for determining the pfu titer of a viral solution are well documented in the literature.

Another subject of the invention relates to any mammalian cell infected with one or more defective recombinant adenoviruses as described above. More particularly, the invention relates to any population of human cells infected with these adenoviruses. They can in particular be fibroblasts, myoblasts, hepatocytes, keratinocytes, endothelial cells, glial cells, etc.

The cells according to the invention can come from primary cultures. These can be removed by any technique known to those skilled in the art, and then put in culture under conditions allowing their proliferation. As regards more particularly fibroblasts, these can be easily obtained from biopsies, for example according to the technique described by Ham [Methods Cell.Biol. 21a (1980) 255]. These cells can be used directly for infection by adenoviruses, or stored, for example by freezing, for the establishment of autologous libraries, for later use. The cells according to the invention can also be secondary cultures, obtained for example from pre-established banks.

The cells in culture are then infected with recombinant adenoviruses, to give them the capacity to produce GMF-β. The infection is carried out in vitro according to techniques known to those skilled in the art. In particular, according to the type of cells used and the number of copies of virus per cell desired, a person skilled in the art can adapt the multiplicity of infection and possibly the number of infection cycles carried out. It is understood that these steps must be carried out under conditions of appropriate sterility when the cells are intended for administration in vivo. The doses of recombinant adenovirus used for the infection of the cells can be adapted by a person skilled in the art according to the aim sought. The conditions described above for administration in vivo can be applied to infection in vitro.

Another subject of the invention relates to an implant comprising mammalian cells infected with one or more defective recombinant adenoviruses as described above, and an extracellular matrix. Preferably, the implants according to the invention comprise 10 --- to 10 ^ cells. More preferably, they include 10 ° to 10 °.

More particularly, in the implants of the invention, the extracellular matrix comprises a gelling compound and optionally a support allowing the anchoring of the cells.

For the preparation of the implants according to the invention, different types of gelling agents can be used. The gelling agents are used for the inclusion of cells in a matrix having the constitution of a gel, and to promote the anchoring of the cells on the support, if necessary. Different cell adhesion agents can therefore be used as gelling agents, such as in particular collagen, gelatin, glycosaminoglycans, fibronectin, lectins, etc. Preferably, one uses in the part of the present invention of collagen. It can be collagen of human, bovine or murine origin. More preferably, type I collagen is used.

As indicated above, the compositions according to the invention advantageously comprise a support allowing the anchoring of the cells. The term anchoring designates any form of biological and / or chemical and / or physical interaction resulting in the adhesion and / or fixing of the cells on the support. Furthermore, the cells can either cover the support used, or penetrate inside this support, or both. It is preferred to use within the framework of the invention a solid, non-toxic and / or biocompatible support. In particular, polytetrafluoroethylene (PTFE) fibers or a support of biological origin can be used.

The implants according to the invention can be implanted at different sites in the body. In particular, the implantation can be carried out in the peritoneal cavity, in the subcutaneous tissue (suprapubic region, iliac or inguinal fossa, etc.), in an organ, a muscle, a tumor, the central nervous system , or under a mucous membrane. The implants according to the invention are particularly advantageous in that they make it possible to control the release of the therapeutic product in the organism: This is first of all determined by the multiplicity of infection and by the number of cells implanted . Then, the release can be controlled either by the removal of the implant, which definitively stops the treatment, or by the use of regulable expression systems, making it possible to induce or repress the expression of the therapeutic genes.

The present invention thus provides a very effective means for the treatment or prevention of neurodegenerative diseases and tumors of the nervous system, in particular central. It is particularly suitable for the treatment of Alzheimer's, Parkinson's, Huntington's, ALS and medulloblastomas, neuroblastomas or glio es. The adenoviral vectors according to the invention also have significant advantages, linked in particular to their very high efficiency of infection of nerve cells, making it possible to carry out infections from small volumes of viral suspension. In addition, infection with the adenoviruses of the invention is very localized at the injection site, which avoids the risks of dissemination to neighboring brain structures.

In addition, this treatment can concern both humans and any animal such as sheep, cattle, domestic animals (dogs, cats, etc.), horses, fish, etc. The present invention will be more fully described with the aid of the following examples, which should be considered as illustrative and not limiting.

Legend to figures

Figure 1: Representation of the vector pXL2244 Figure 2: Representation of the vector pSh-Ad-GMF-β

General molecular biology techniques

Methods conventionally used in molecular biology such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in cesium chloride gradient, electrophoresis on agarose or acrylamide gels, purification of DNA fragments by electroelution, the extraction of proteins with phenol or phenol-chloroform, the precipitation of DNA in a saline medium with ethanol or isopropanol, the transformation in Escherichia coli, etc. are well known in the art. skilled in the art and are abundantly described in the literature [Maniatis

T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982; Ausubel F.M. et al. (eds), "Current Protocols in

Molecular Biology ", John Wiley & Sons, New York, 1987].

The plasmids of the pBR322, pUC type and the phages of the Ml 3 series are of commercial origin (Bethesda Research Laboratories).

For the ligations, the DNA fragments can be separated according to their size by electrophoresis in agarose or acrylamide gels, extracted with phenol or with a phenol / chloroform mixture, precipitated with ethanol and then incubated in the presence of the DNA ligase from phage T4 (Biolabs) according to the supplier's recommendations.

The filling of the protruding 5 ′ ends can be carried out by the Klenow fragment of DNA Polymerase I of E. coli (Biolabs) according to the supplier's specifications. The destruction of the protruding 3 ′ ends is carried out in the presence of the DNA polymerase of phage T4 (Biolabs) used according to the manufacturer's recommendations. The destruction of the protruding 5 ′ ends is carried out by gentle treatment with nuclease SI.

Mutagenesis directed in vitro by synthetic oligodeoxynucleotides can be carried out according to the method developed by Taylor et al. [Nucleic Acids Res. 2 (1985) 8749-8764] using the kit distributed by Amersham.

Enzymatic amplification of DNA fragments by the so-called PCR technique [Polymerase-catalyzed “Chain Reaction, Saiki RK et al., Science 220 (1985) 1350- 1354; Mullis KB and Faloona FA, Meth. Enzym. 55 (1987) 335-350] can be performed using a "DNA thermal cycler" (Perkin El er Cetus) according to the manufacturer's specifications.

Verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467] using the kit distributed by Amersham.

Examples

Example 1: Construction of the vector pSh-Ad-GMF-β.

This example describes the construction of a vector comprising a DNA sequence coding for GMF-β under the control of a promoter constituted by the LTR of the sore coma virus (LTR-RSV).

1.1. Starting vector (pXL2244): The plasmid pXL2244 contains the ApoAI cDNA under the control of the RSV virus LTR promoter, as well as sequences of the Ad5 adenovirus (FIG. 1). It was constructed by insertion of a Clal-EcoRV fragment containing the cDNA coding for preproApoAI into the vector pLTR RSV-βgal (Stratford-Perricaudet et al., J. Clin. Invest. 90 (1992) 626) by the same enzymes.

1.2. Construction of a DNA sequence coding for human GMF-β

To allow the construction of vectors according to the invention, the cDNA sequence coding for human GMF-β present in the plasmid pET-3a-hGMF-β (Kaplan et al., J. Neurochem. 57 (1991) 483) has been changed in different ways.

In a first construction, this sequence was modified by the PCR technique, using the following oligonucleotides as primer:

Oligonucleotide 5 ': 5'-GCGATCGATAAAATGAGTGAGTCTTTG-3' (SEQ ID n ° 1) Oligonucleotide 3 ': 5'-GCGGTACCTTCACATTAGTGAAAAAATCC-3' (SEQ ID n ° 2)

The amplification steps make it possible to introduce appropriate restriction sites on either side of the coding sequence. More precisely, these steps allow the incorporation of a ClaI site at the 5 ′ end (sequence underlined in single in the 5 ′ oligonucleotide, which indicates its position relative to the start codon underlined in double) and of a site Kpnl at the 3 'end (underlined in single in the 3' oligonucleotide).

The PCR fragment thus obtained was cloned into the vector pCRII (Invitrogen).

The resulting vector was designated pCR-hGMF-β. The sites created allow the insertion of the sequence under conditions of expression in the vectors of the invention. Us also make it possible to insert, during the reading phase, other specific sequences, and in particular a promoter region and / or a secretion sequence (cf. example 2).

1.3. Construction of the vector pSh-Ad-GMF-β

This example describes the construction of the vector pSh-Ad-GMF-β containing, under control of the LTR of the RSV virus, the sequence coding for human GMF-β as well as sequences of the adenovirus Ad5 allowing recombination in vivo.

The vector pCR-hGMF-β was digested with the enzymes Clal and Kpnl, and the resulting 0.5 kb fragment containing the coding sequence for GMF-β was then isolated and purified by electrophoresis on an agarose gel LMP ("Low Melting Point"). In parallel, the vector pXL2244 was digested with the same restriction enzymes Clal and Kpnl, then precipitated after inactivation of the latter. The resulting linear vector, previously isolated and purified by electrophoresis on an agarose gel, and the 0.5 kb fragment were then ligated to generate the vector pSh-Ad-GMF-β (Figure 2). The entire nucleotide sequence of the GMF-β insert was verified by dideoxynucleotide sequencing.

Example 2: Construction of the vector pSh-Ad-INF / GMF-β.

This example describes the construction of a second vector comprising, under the control of a promoter constituted by the LTR of the roux sarcoma virus (LTR-RSV), a cDNA sequence coding for GMF-β preceded by a secretion sequence.

2.1. Insertion of a secretion sequence: The cDNA sequence present in the plasmid pET-3a-hGMF-β was modified by insertion, at the 5 ′ end and in phase of the coding sequence of GMF-β, of the secretion sequence of interferon from human fibroblasts. The introduction of this sequence is particularly advantageous since it allows the extracellular release of the GMF-β synthesized by the cells infected with the vectors of the invention. The secretion sequence used has been artificially synthesized on the basis of the sequence published by Taniguchi et al. (Gene 10 (1980) 11). More specifically, the secretion sequence synthesized comprises the sequence of the following 63 bp (SEQ ID No. 3):

ATG ACC AAC AAG TGT CTC CTC CAA ATT GCT CTC CTG TTG TGC Met Thr Asn Lys Cys Leu Leu Gin Ile Ala Leu Leu Leu Cys TTC TCC ACT ACA GCT CTT TCC Phe Ser Thr Thr Ala Leu Ser

This sequence was inserted upstream of the coding sequence of GMFβ by gene amplification by the PCR technique on the plasmid pET-3a-hGMF-β, using the following two oligonucleotides:

Oligonucleotide 5 ': 5'-GCGAT_ ^ ATGAGAT_2ACCAACAAGTGTCTCCTC CAAATTGCTCTCCTGTTGTGCTTCTCCACTACAGCTCTTTCCATGAGTGAGT CTTTGGTT-3' (SEQ ID n ° 4) Oligonucleotide 3 ': 5'-GCACAGTAC

2.2. Construction of the vector pSh-Ad-INF / GMF-β

This example describes the construction of the vector pSh-Ad-INF / GMF-β containing the sequence coding for GMF-β preceded by the secretion sequence of human fibroblast interferon, under the control of the RSV virus LTR, as well as Ad5 adenovirus sequences allowing in vivo recombination.

The sequence constructed in 2.1. was digested with the enzymes Clal and Kpnl, and the resulting 0.6 kb fragment, containing the coding sequence for GMF-β preceded by the secretion sequence of human fibroblast interferon, was then isolated and purified by electrophoresis on an LMP ("Low Melting Point") agarose gel. In parallel, the vector pXL2244 (Example 1.1.) Was digested with the same restriction enzymes Clal and Kpnl, then precipitated after inactivation of the latter. The resulting linear vector, previously isolated and purified by electrophoresis on an agarose gel, and the 0.6 kb fragment were then ligated to generate the vector pSh-Ad-INF / GMF-β.

Example 3. Functionality of the vectors pSh-Ad-GMF-β and pSh-Ad-INF / GMF-β

The capacity of the vectors pSh-Ad-GMF-β and pSh-Ad-INF / GMF-β to express on cell culture a biologically active form of GMF-β has been demonstrated by transient transfection of COS1 cells. For this, the cells (2.106 cells per 10 cm diameter dish) were transfected (8 μg of vector) in the presence of

Transfectam. After 48 hours, the presence of GMF-β has been demonstrated by immunodetection using the monoclonal antibody G2-09 in the culture supernatant of the transfected cells as well as intracellularly.

Example 4. Construction of Recombinant Adenoviruses Containing a Sequence Coding for GMF-β

4.1. Construction of the Ad-GMF-β adenovirus

The vector pSh-Ad-GMF-β was linearized and cotransfected with a deficient adenoviral vector, in helper cells (line 293) providing in trans the functions coded by the El (E1A and E1B) regions of adenovirus.

More specifically, the adenovirus Ad-GMF-β was obtained by homologous recombination in vivo between the mutant adenovirus Ad-dll324 (Thimmappaya et al., Cell 31 (1982) 543) and the vector pSh-Ad-GMF-β , according to the following protocol: the plasmid pSh-Ad-GMF-β and the adenovirus Ad-dll324, linearized by the enzyme Clal, were co-transfected in line 293 in the presence of calcium phosphate, to allow recombination counterpart. The recombinant adenoviruses thus generated were selected by plaque purification. After isolation, the DNA of the recombinant adenovirus was amplified in the cell line 293, which leads to a culture supernatant containing the unpurified recombinant defective adenovirus having a titre of approximately 10 ¹⁰ pfu / ml.

The viral particles are then purified by centrifugation on a cesium chloride gradient according to known techniques (see in particular Graham et al., Virology 52 (1973) 456). The Ad-GMF-β adenovirus can be stored at -80 ° C in 20% glycerol.

4.2. Construction of the Ad-INF / GMF-β adenovirus

The Ad-INF / GMF-β adenovirus was constructed according to the same protocol as the Ad-GMF-β adenovirus, but using the vector pSh-Ad-INF / GMF-β as a starting vector.

Example 5. Functionality of the Ad-GMF-β Adenovirus

The capacity of the Ad-GMF-β adenovirus to infect cells in culture and to express in the culture medium a biologically active form of GMF-β has been demonstrated by infection of human 293 and rat PC12 lines. The presence of GMF-β active in the culture supernatant was then determined under the same conditions as in Example 3.

These studies show that the adenovirus expresses a biologically active form of GMF-β in cell culture.

EXAMPLE 6 In Vivo Transfer of the GMF-β Gene by a Recombinant Adenovirus to Rats with a Fimbria-Fornix Lesion

This example describes the transfer of the GMF-β gene in vivo using an adenoviral vector according to the invention. It shows on an animal model of the fimbria- fornix lesion, that the vectors of the invention make it possible to induce the expression in vivo of therapeutic quantities of GMF-β.

On rats previously anesthetized, the septo-hippocampal pathway (fimbria- fornix) was cut in the left hemisphere. This mechanical injury was performed using a retractable surgical knife. The stereotaxic coordinates used for this purpose are, relative to the bregma: AP: -1.7; ML: +1.5; V: -5.5 to -0.5.

The recombinant GMF-β adenovirus was injected immediately after the lesion, in the median nucleus of the septum and in the dorsal part of the deafferated hippocampus

(hippocampus on the side of the lesion). More particularly, the adenovirus injected is the adenovirus Ad-GMF-β prepared in Example 4.1., Used in purified form (3.5 ÎO * - pfu / μl), in a saline phosphate solution (PBS).

The injections are carried out using a cannula (outside diameter 280 μm) connected to a pump. The injection speed is fixed at 0.5 μl / min, after which the cannula remains in place for an additional 4 minutes before being reassembled. The injection volumes into the hippocampus and the septum are 3 μl and 2 μl respectively.

The concentration of adenovirus injected is 3.5. 10 ° pfu / μl.

For injection into the hippocampus, the stereotaxic coordinates are as follows: AP = -4; ML = 3.5; V = -3, l (the AP and ML coordinates are determined relative to the bregma, the V coordinate relative to the surface of the cranial bone at the bregma level. For injection into the septum, the stereotaxic coordinates are as follows: AP = 1; ML = 1; V = -6 (the AP and ML coordinates are determined relative to the bregma, the V coordinate relative to the surface of the cranial bone at the bregma level. In this condition, the cannula has an angle of 9 degrees relative to vertical (in the medio-lateral direction) in order to avoid the median venous sinus.

The therapeutic effects of the administration of the adenovirus according to the invention have been demonstrated by three types of analysis: a histological and immunohistochemical analysis, a quantitative analysis and a behavioral analysis.

Histological and immunohistochemical analysis

The mechanical lesion of the fimbria-fornix induces a loss of cholinergic neurons (revealed in immunohistology by an anti-choline acetyl transferase antibody, ChAT) in the median septum, as well as cholinergic denervation in the hippocampus (detected in histochemistry by activity acetyl choline esterase, AChE).

Histological analysis of the injected brains is carried out 3 weeks after the intracerebral injection of the adenovirus Ad-GMF-β. For this, the animals are sacrificed, under anesthesia, by intracardiac perfusion of 4% paraformaldehyde. After removal, post-fixation and cryoprotection, the brain is cut in a cryomat according to the coronal plane: serial coronal cuts of 30 μm thickness are made over the entire length of the median septum and at the anterior, median and posterior levels of the seahorse. For the median septum, sections spaced 180 μm apart (1 section out of 6) are stained with cresyl violet (to assess neuronal density) and immunolabeled with an anti-ChAT antibody (Biochem) (to identify cholinergic neurons). The immunohistochemical method is that of streptavidin-biotin peroxidase revealed by DAB. For the hippocampus, sections spaced 180 μm apart are stained using the histochemical method for AChE (acetyl choline esterase) in order to detect detecting cholinergic innervation. The sections are mounted on glass slides.

Quantitative analysis

The number of cholinergic neurons (ChAT positive) in the median septum is the parameter for evaluating the effects of the adenovirus Ad-GMF-β. The counting is carried out on a sample (1 cut out of 6 over the entire length of the median septum). For each section, the positive CHAT neurons are counted separately from the 2 sides of the septum. The cumulative results for all cuts are expressed by the ratio of the number of positive ChAT neurons on the injured side to the number of positive ChAT neurons on the uninjured side.

Behavioral analysis

It is known that a bilateral lesion of the septo-hippocampal pathway leads to memory deficits. The protective functional effects of the injection of adenovirus Ad-GMF-β on this type of lesion were highlighted by analysis of the memory performance of animals during 2 behavioral tests: the Morris pool test (memory of visuospatial reference) and the TMTT test ("tw o-trials memory task"; "short-term memory of a new environment").

^' Example 7: In Vivo Transfer of the GMF-β Gene by a Recombinant Adenovirus to Rats with a Nigro-Striated Pathway Lesion

This example describes the transfer of the GMF-β gene in vivo using an adenoviral vector according to the invention. It shows on an animal model of the lesion of the nigro-striated pathway, that the vectors of the invention make it possible to induce the expression in vivo of therapeutic quantities of GMF-β. In rats previously anesthetized, the nigro-striated pathway was injured at the level of the median mesencephalic bundle (MFB) by injection of the toxin 6-hydroxy dopamine (6OH-DA). This chemical injury by injection was unilateral, according to the following stereotaxic coordinates: AP: 0 and -1; ML: +1.6; V: -8.6 and -9 (the AP and ML coordinates are determined relative to the bregma, the V coordinate relative to the dura mater). The incisor bar is fixed at the +5 mm level.

The recombinant GMF-β adenovirus was injected immediately after the lesion, into the substantia nigra and the striatum, on the side of the lesion. More particularly, the adenovirus injected is the adenovirus Ad-GMF-β prepared in Example 4.1., Used in purified form (3.5 10 ° pfu / μl), in a phosphate saline solution (PBS).

The injections were carried out using a cannula (outside diameter 280 μm) connected to a pump. The injection speed is fixed at 0.5 μl / n_in, after which the cannula remains in place for an additional 4 minutes before being reassembled. The injection volumes into the striatum and the substantia nigra are 2x3 μl and 2 μl respectively. The concentration of adenovirus injected is 3.5. 10 * - * pfu / μl.

For the injection into the dark substance, the stereotaxic coordinates are the following: AP = -5.8; ML = + 2; V = -7.5 (the AP and ML coordinates are determined relative to the bregma, the V coordinate relative to the dura mater).

For injections into the striatum, the stereotaxic coordinates are as follows: AP = + 0.5 and -0.5; ML = 3; V = -5.5 (the AP and ML coordinates are determined relative to the bregma, the V coordinate relative to the dura mater).

The therapeutic effects of the administration of the adenovirus according to the invention have been demonstrated by three types of analysis: a histological and immunohistochemical analysis, a quantitative analysis and a behavioral analysis. Histological and immunohistochemical analysis

The chemical lesion of the nigro-striated pathway induces neuronal loss in the substantia nigra as well as dopaminergic denervation in the striatum (revealed in immunohistology by an anti-tyrosine hydroxylase antibody, TΗ). The histological analysis of the injected brains is carried out 3 weeks after the intracerebral injection of the adenovirus Ad-GMF-β under the conditions described in Example 6. The serial coronal sections of 30 μm thickness are made in the substance black and the striatum. Slices spaced 180 μm apart (1 cut out of 6) are stained with cresyl violet (to assess neuronal density) and immunolabeled with an anti-tyrosine hydroxylase (TH) antibody (to detect dopaminergic neurons in black matter and their innervation in the striatum).

Quantitative analysis

The number of dopaminergic neurons (TH positive) in the substantia nigra is the parameter for evaluating the effects of the adenovirus Ad-GMF-β. The counting is carried out on a sample (1 section out of 6 over the entire length of the black substance). For each section, TH positive neurons are counted separately from the 2 sides of the substantia nigra. The cumulative results for all sections are expressed in proportion: number of positive TH neurons on the injured side compared to the number of positive TH neurons on the uninjured side.

Behavioral analysis

The protective functional effects of the injection of adenovirus Ad-GMF-β on the lesion of the nigro-striated pathway were demonstrated by analysis of the sensorimotor performance of animals during 2 behavioral tests: the rotation induced by dopaminergic agonists (apomorphine, amphetamine and levodopa), and the grip test ("paw-reaching").

EXAMPLE 8 In Vivo Transfer of the GMF-β Gene by a Recombinant Adenovirus to Rats with a Puncture Pathway Lesion

This example describes the transfer of the GMF-β gene in vivo using an adenoviral vector according to the invention. It shows on an animal model of the perforating pathway lesion, that the vectors of the invention make it possible to induce the expression in vivo of therapeutic amounts of GMF-β. On rats previously anesthetized, the entorhino-hippocampal route

(perforating route) was cut unilaterally using a surgical knife. The stereotaxic coordinates used for this purpose are, with respect to the lambda; AP:

+0.75; ML: +4.1 to 6.6; V: -7.7 (determined V coordinate. Relative to the dura mater).

The recombinant GMF-β adenovirus is injected immediately after the lesion, either at the level of the lesion, or at the level of the hippocampus and the entorhinal cortex. More particularly, the adenovirus injected is the adenovirus Ad-GMF-β prepared in Example 4.1., Used in purified form (3.5 10 "pfu / μl), in a saline phosphate solution (PBS).

The injections were carried out using a cannula (outside diameter 280 μm) connected to a pump. The injection speed is fixed at 0.5 μl / min, after which the cannula remains in place for an additional 4 minutes before being reassembled. The injection volumes into the hippocampus, the entorhinal cortex and the site of lesion of the perforating tract are 3 μl, 2 μl and 2 μl respectively. The concentration of adenovirus injected is 3.5. 10 ° pfu / μl.

The therapeutic effects of the administration of the adenovirus according to the invention can be demonstrated by a behavioral analysis under the conditions of Example 6.

SEQUENCE LIST ..

(1) GENERAL INFORMATION:

(i) DEPOSITOR:

(A) NAME: RHONE-POULENC RORER S.A.

(B) STREET: 20, avenue Raymond ARON

(C) CITY: ANTONY (E) COUNTRY: FRANCE

(F) POSTAL CODE: 92165

(ii) TITLE OF THE INVENTION: Recombinant viruses, preparation and use in gene therapy

(iii) NUMBER OF SEQUENCES: 5

(iv) FORM READABLE BY COMPUTER: (A) TYPE OF SUPPORT: Tape (B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS / MS-DOS

(D) SOFTWARE: Patentin Release # 1.0, Version # 1.25 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1.

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETIC: NO (iii) ANTI-SENSE: NO

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: GCGATCGATA AAATGAGTGA GTCTTTG 27

(2) INFORMATION FOR SEQ ID NO: 2:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETIC: NO (iii) ANTI-SENSE: NO

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: GCGGTACCTT CACATTAGTG AAAAAATCC 29

.2. INFORMATION FOR SEQ ID NO: 3:

(i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 63 base pairs (B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: double (D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETIC: NO (iϋ) ANTI-SENSE: NO

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: -

ATG ACC AAC AAG TGT CTC CTC CAA ATT GCT CTC CTG TTG TGC TTC TCC 48 Met Thr Asn Lys Cys Leu Leu Gin Ile Ala Leu Leu Leu Cys Phe Ser 1 5 10 15

ACT ACA GCT CTT TCC 63

Thr Thr Ala Leu Ser 20 (2) INFORMATION FOR SEQ ID NO: 4:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 93 base pairs

(B) TYPE: nucleic acid (C) NUMBER OF STRANDS: simple

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETIC: NO (iii) ANTI-SENSE: NO

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4. GCGATCGATG AGATGACCAA CAAGTGTCTC CTCCAAATTG CTCTCCTGTT GTGCTTCTCC 60 ACTACAGCTC TTTCCATGAG TGAGTCTTTG GTT 93

(2) INFORMATION FOR SEQ ID NO: 5:

(i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: cDNA (ϋi) HYPOTHETIC: NO (iii) ANTI-SENSE: NO

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: GCGGTACCTT CACATTAGTG AAAAAATCC 29

Claims

1. Defective recombinant adenovirus comprising a DNA sequence coding for the β type glial cell maturation factor (GMF-β) or a derivative thereof.

2. Adenovirus according to claim 1 characterized in that the DNA sequence contains, in 5 ′ and in the reading phase of the sequence coding for GMF-β, a secretion sequence.

3. Adenovirus according to claim 2 characterized in that the secretion sequence is chosen from functional secretion sequences in nerve cells, preferably originating from a cytokine.

4. Adenovirus according to claims 1 to 3 characterized in that the DNA sequence is a cDNA sequence.

5. Adenovirus according to claims 1 to 3 characterized in that the DNA sequence is a gDNA sequence.

6. Adenovirus according to one of claims 1 to 5 characterized in that the DNA sequence codes for human GMF-β.

7. Adenovirus according to one of claims 1 to 6 characterized in that the DNA sequence is placed under the control of signals allowing its expression in nerve cells.

8. Adenovirus according to claim 7 characterized in that the expression signals are chosen from viral promoters, preferably from E1A, MLP, CMV and LTR-RSV promoters.

9. Defective recombinant adenovirus comprising a cDNA sequence coding for human GMF-β preceded by a secretory sequence, under the control of the LTR-RSV promoter.

10. Defective recombinant adenovirus comprising a gDNA sequence coding for human GMF-β preceded by a secretory sequence, under the control of the LTR-RSV promoter.

11. Defective recombinant adenovirus comprising a DNA sequence coding for human GMF-β or a derivative thereof under the control of a promoter allowing predominant expression in nerve cells.

12. Defective recombinant adenovirus according to claim 11 characterized in that the promoter is chosen from the promoter of the specific neuron enolase and the promoter of GFAP.

13. Adenovirus according to one of claims 1 to 12 characterized in that it lacks the regions of its genome which are necessary for its replication in the target cell.

14. Adenovirus according to claim 13 characterized in that it comprises the

ITR and a sequence allowing the encapsidation, and in which the E1 gene and at least one of the E2, E4, L1-L5 genes are non-functional.

15. Adenovirus according to claim 13 or 14 characterized in that it is a human adenovirus type Ad 2 or Ad 5 or canine type CAV-2.

16. Use of an adenovirus according to one of claims 1 to 15 for the preparation of a pharmaceutical composition intended for the treatment and / or prevention of neurodegenerative diseases.

17. Use according to claim 16 for the preparation of a pharmaceutical composition intended for the treatment and / or prevention of Parkinson's, Alzheimer's, Huntington's or ALS disease.

18. Use of an adenovirus according to one of claims 1 to 15 for the preparation of a pharmaceutical composition intended for the treatment and / or prevention of tumors of the nervous system, preferably central.

19. Pharmaceutical composition comprising one or more defective recombinant adenoviruses according to one of claims 1 to 15.

20. Pharmaceutical composition according to claim 19 characterized in that it is in injectable form.

21. Pharmaceutical composition according to claim 19 or 20 characterized in that it comprises between 10 ⁴ and 10 ¹⁴ pfu / ml, and preferably 10 ⁶ to 10 ¹⁰ pfu / ml defective recombinant adenoviruses.

22. A mammalian cell infected with one or more defective recombinant adenoviruses according to one of claims 1 to 15.

23. Cell according to claim 22 characterized in that it is a human cell, preferably chosen from fibroblasts, yoblasts, hepatocytes, endothelial cells, glial cells and keratynocytes.

24. Implant comprising infected cells according to claims 22 to 23 and an extracellular matrix.

25. Implant according to claim 24 characterized in that the extracellular matrix comprises a gelling compound preferably chosen from collagen, gelatin, glucosaminoglycans, fibronectin and lectins.

26. Implant according to claims 24 or 25 characterized in that the extracellular matrix also comprises a support allowing the anchoring of the infected cells.

27. Implant according to claim 26 characterized in that the support preferably consists of polytetrafluoroethylene fibers.