WO2000012046A2 - Acides nucleiques et polypeptides pkdl; methodes diagnostiques et therapeutiques - Google Patents

Acides nucleiques et polypeptides pkdl; methodes diagnostiques et therapeutiques Download PDF

Info

Publication number
WO2000012046A2
WO2000012046A2 PCT/US1999/019962 US9919962W WO0012046A2 WO 2000012046 A2 WO2000012046 A2 WO 2000012046A2 US 9919962 W US9919962 W US 9919962W WO 0012046 A2 WO0012046 A2 WO 0012046A2
Authority
WO
WIPO (PCT)
Prior art keywords
pkdl
nucleic acid
polypeptide
polycystin
gene
Prior art date
Application number
PCT/US1999/019962
Other languages
English (en)
Other versions
WO2000012046A3 (fr
Inventor
Jing Zhou
Hideki Nomura
Original Assignee
Brigham & Women's Hospital, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Brigham & Women's Hospital, Inc. filed Critical Brigham & Women's Hospital, Inc.
Priority to AU57974/99A priority Critical patent/AU5797499A/en
Publication of WO2000012046A2 publication Critical patent/WO2000012046A2/fr
Publication of WO2000012046A3 publication Critical patent/WO2000012046A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • ADPKD Autosomal dominant polycystic kidney disease
  • Polycystin-1 and polycystin-2 are the respective gene products of PKD1 and PKD2, mutations in which account for approximately 95% of cases of ADPKD.
  • Polycystin-1 encodes a 4,303 amino acid plasma membrane protein with a large extracellular ⁇ -terminal domain which contains leucine-rich repeats, a C-type lectin domain, and an LDL-A like domain, all three of which are involved in cell-cell or cell-matrix interactions in other proteins. These domains are followed by 16 repeats of the so-called PKD domain, and by an REJ (receptor for egg jelly in sea urchin sperm)-like domain. Polycystin-1 has seven to eleven transmembrane domains. The short cytoplasmic tail (197 amino acids) of polycystin-1 contains a coiled-coil domain, which appears to interact with other proteins containing similar structures.
  • Polycystin-2 is a 968 amino acid protein with approximately 46% sequence similarity to each domain of the pore-forming ⁇ l subunits of Ca 2+ and other cation channels and, like these channel subunits, it is predicted to have six transmembrane domains.
  • Polycystin-2 has a putative Ca 2+ binding structure (EF-hand) in its C-terminal cytoplasmic domain.
  • Polycystin-2 interacts biochemically with polycystin-1 and with itself (Qian et al., Nat. Genet., 16:179-183, 1997; Tsiokas et al., Proc. Natl Acad. Sci. U.S.A., 94:6965-6970, 1997).
  • PKDl- and PKD2-linked ADPKD are generally similar, raising the likelihood that the gene products function in the same or parallel biological pathways.
  • cystic diseases e.g., dominantly transmitted glomerulocystic kidney disease of post-infantile onset, and isolated polycystic liver disease
  • cystic diseases e.g., dominantly transmitted glomerulocystic kidney disease of post-infantile onset, and isolated polycystic liver disease
  • the invention features a substantially pure PKDL polypeptide.
  • the polypeptide includes an amino acid sequence substantially identical to the amino acid sequence of PKDL (SEQ ID NO: 2), PKDL ⁇ 5, PKDL ⁇ 456, or PKDL ⁇ l 5 or the polypeptide that includes the amino acid sequence of PKDL (SEQ ID NO: 2), PKDL ⁇ 5, PKDL ⁇ 456, or PKDL ⁇ l 5.
  • the polypeptide is derived from a mammal, preferably from a human.
  • the invention features a substantially pure nucleic acid sequence comprising a sequence encoding a PKDL polypeptide.
  • the nucleic acid encodes a mammalian, preferably a human, PKDL polypeptide.
  • the nucleic acid encodes a polypeptide comprising an amino sequence substantially identical to the amino acid sequence of PKDL (SEQ ID NO: 2), PKDL ⁇ 5, PKDL ⁇ 456, or PKDL ⁇ 15, or the nucleic acid encodes a polypeptide comprising the amino acid sequence of PKDL (SEQ ID NO: 2), PKDL ⁇ 5, PKDL ⁇ 456, or PKDL ⁇ l 5.
  • the nucleic acid includes a nucleotide sequence substantially identical to the nucleotide sequence of PKDL (SEQ ID NO: 1), PKDL ⁇ 5, PKDL ⁇ 456, or PKDL ⁇ 15 and the nucleic acid is DNA.
  • the invention features a probe or primer that hybridizes to a PKDL nucleic acid, wherein the probe or primer does not hybridize under high stringency conditions to a PKDl or PKD2 nucleic acid.
  • the probe or primer does not hybridize under high stringency conditions to polymorphic marker D10S603 (SEQ ID NO: 25).
  • the invention features a PKDL antisense nucleic acid.
  • the PKDL antisense nucleic acid specifically binds a mutated PKDL nucleic acid.
  • the PKDL antisense nucleic acid does not contain a sequence that is complementary to the sequence of D10S603 (SEQ ID NO: 25).
  • the invention features a vector comprising a PKDL nucleic acid of the invention.
  • the vector is a gene therapy vector.
  • the invention features a cell which includes a PKDL vector of the invention.
  • the invention features a non-human transgenic animal that includes a PKDL DNA of the invention.
  • the non-human transgenic animal is a mouse.
  • the invention features a non-human knockout animal having a knockout mutation in one or both alleles encoding a PKDL polypeptide.
  • the invention features a cell from such non-human knockout animals.
  • the invention features a probe or primer for analyzing the PKDL nucleic acid of an animal.
  • the probe or primer includes a sequence complementary to at least 50% of at least 60 consecutive nucleotides of a nucleic acid encoding the amino-terminal 100 amino acids of a PKDL polypeptide or the carboxy-terminal 125 amino acids of a PKDL polypeptide, and the probe or primer is sufficient to allow nucleic acid hybridization to at least a portion of a PKDL nucleic acid under high stringency conditions.
  • the invention features a probe or primer for analyzing the PKDL nucleic acid of an animal.
  • the probe or primer comprises a sequence complementary to at least 90% of at least 18 consecutive nucleotides of a nucleic acid encoding the amino-terminal 100 amino acids of a PKDL polypeptide or the carboxy-terminal 125 amino acids of a PKDL polypeptide, and the probe or primer is sufficient to allow nucleic acid hybridization to at least a portion of a PKDL nucleic acid under high stringency conditions.
  • the invention features an antibody that specifically binds a PKDL polypeptide.
  • the antibody specifically binds a PKDL polypeptide having the amino acid sequence of PKDL (SEQ ID NO: 2), PKDL ⁇ 5, PKDL ⁇ 456, or PKDL ⁇ 15, the antibody specifically binds the amino-terminal 100 amino acids of a PKDL polypeptide (SEQ ID NO: 8), or the antibody specifically binds the carboxy- terminal 125 amino acids of a PKDL polypeptide (SEQ ID NO: 9).
  • the invention features a method of detecting the presence of a PKDL polypeptide in a sample, involving contacting the sample with an antibody that specifically binds a PKDL polypeptide and assaying for binding of the antibody to the polypeptide.
  • the invention features a method of detecting the presence of a mutant PKDL polypeptide in a sample, involving contacting the sample with an antibody that specifically binds a mutant PKDL polypeptide and assaying for binding of the antibody to the mutant polypeptide.
  • the invention features a method of diagnosing an increased likelihood of developing a PKDL-related disease or condition, involving analyzing the nucleic acid of a test subject to determine whether the test subject contains a mutation in a PKDL gene, wherein the presence of a mutation is an indication that the test subject has an increased likelihood of developing a PKDL-related disease.
  • the method includes the step of using nucleic acid primers specific for the PKDL gene, wherein the primers are used for nucleic acid amplification by the polymerase chain reaction.
  • the method may further involve the step of sequencing PKDL nucleic acid from the test subject.
  • the nucleic acid is genomic DNA, cDNA, or mRNA;
  • the test subject is a mammal, preferably, a human;
  • the analyzing is carried out by restriction fragment length polymorphism (RFLP) analysis; and the disease or condition is a cystic disease or a neurological disease.
  • RFLP restriction fragment length polymorphism
  • the invention features a kit for the analysis of a PKDL nucleic acid, including nucleic acid probes for analyzing the nucleic acid of a test subject.
  • the invention features a kit for the analysis of a PKDL nucleic acid or protein, including antibodies for analyzing the PKDL protein of a test subject.
  • the invention features a method for preventing or ameliorating the effect of a PKDL deficiency, involving administering, to a subject having a PKDL deficiency, an expression vector that includes a nucleic acid encoding a functional PKDL polypeptide, wherein the nucleic acid encoding the PKDL polypeptide is operably linked to a promoter and the PKDL polypeptide is sufficient to prevent or ameliorate the effect of the PKDL deficiency.
  • the invention features a method for preventing or ameliorating the effect of a PKDL deficiency, involving administering a functional PKDL polypeptide to a subject having a PKDL deficiency, wherein the PKDL polypeptide is sufficient to prevent or ameliorate the effect of the PKDL deficiency.
  • the invention features a method for identifying a compound that modulates PKDL biological activity.
  • the method includes: a) providing a sample comprising a PKDL polypeptide; b) contacting the sample with a test compound; and c) measuring Ca 2+ -regulated cation channel activity in the sample, wherein an increase in the activity relative to a sample not exposed to the compound indicates a compound that increases PKDL biological activity, and a decrease in the activity relative to a sample not exposed to the compound indicates a compound that decreases the PKDL biological activity.
  • PKDL PKDL protein
  • PKDL polypeptide polycystin-L
  • PCL PCL
  • PKDL protein polypeptide, or fragment thereof, that has at least 45%, preferably at least 55%-70%, more preferably at least 85%-99%, and most preferably 100% amino acid identity to either the amino-terminal 100 amino acids (SEQ ID NO: 8) or the carboxy-terminal 125 amino acids (SEQ ID NO: 9) of the human PKDL polypeptide shown in Fig. 1 or 2 (SEQ ID NO: 2). It is understood that polypeptide products from splice variants of PKDL gene sequences are also included in this definition.
  • a PKDL polypeptide contains a "polycystin motif sequence (LGV/PPRL/IRQL/VK/RN/LR/QN/E; SEQ ID NO: 21 ) shown in Fig. 2.
  • Preferred polycystin motifs are: LGVPRLRQLKNRN (SEQ ID NO: 22); LGVPRIRQLRVRN (SEQ ID NO: 23); and LGPPRLRQVRLQE (SEQ ID NO: 24).
  • PKDL nucleic acid is meant is meant a nucleic acid, such as genomic DNA, cDNA, or mRNA, that encodes PKDL, a PKDL protein, PKDL polypeptide, or portion thereof, as defined above.
  • sequence identity is meant that a polypeptide or nucleic acid sequence possesses the same amino acid or nucleotide residue at a given position, compared to a reference polypeptide or nucleic acid sequence to which the first sequence is aligned. Sequence identity is typically measured using sequence analysis software with the default parameters specified therein, such as the introduction of gaps to achieve an optimal alignment (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705).
  • substantially identical is meant a polypeptide or nucleic acid exhibiting, over its entire length, at least 51%, preferably at least 55%, 60%, or 65%, and most preferably 75%, 85%, 90%, or 95% identity to a reference amino acid or nucleic acid sequence.
  • the length of comparison sequences is at least 16 amino acids, preferably at least 20 amino acids, more preferably at least 25 amino acids, and most preferably at least 35 amino acids.
  • the length of comparison sequences is at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably at least 110 nucleotides.
  • analyzing or is meant subjecting a PKDL nucleic acid or PKDL polypeptide to a test procedure that allows the determination of whether a PKDL gene is wild-type or mutated. For example, one could analyze the PKDL genes of an animal by amplifying genomic DNA using the polymerase chain reaction, and then determining the DNA sequence of the amplified DNA.
  • probe or “primer” is meant a single-stranded DNA or RNA molecule of defined nucleotide sequence that can base-pair to a second DNA or RNA molecule (the “target") that contains a complementary nucleotide sequence.
  • target a second DNA or RNA molecule that contains a complementary nucleotide sequence.
  • the stability of the resulting hybrid depends upon the extent of the base pairing that occurs.
  • the extent of base-pairing is affected by parameters such as the degree of complementarity between the probe and target molecules and the degree of stringency of the hybridization conditions.
  • the degree of hybridization stringency is affected by parameters such as temperature, salt concentration, and the concentration of organic molecules such as formamide, and is determined by methods known to one skilled in the art.
  • Probes or primers specific for PKDL nucleic acid preferably will have greater than 50% sequence identity, more preferably at least 55-75% sequence identity, still more preferably at least 75-85% sequence identity, yet more preferably at least 85- 99% sequence identity, and most preferably 100% sequence identity to a nucleic acid sequence consisting of at least 16 consecutive nucleotides (more preferably, at least 18, 22, 35, 50, 75, or 100 nucleotides) that are complementary to a PKDL exon and/or intron sequence. Probes may be detectably-labelled, either radioactively, or non-radioactively, by methods well- known to those skilled in the art.
  • Probes are used for methods involving nucleic acid hybridization, such as nucleic acid sequencing, nucleic acid amplification by the polymerase chain reaction, single stranded conformational polymo ⁇ hism (SSCP) analysis, restriction fragment polymo ⁇ hism (RFLP) analysis, Southern hybridization, Northern hybridization, in situ hybridization, and electrophoretic mobility shift assay (EMS A).
  • nucleic acid hybridization such as nucleic acid sequencing, nucleic acid amplification by the polymerase chain reaction, single stranded conformational polymo ⁇ hism (SSCP) analysis, restriction fragment polymo ⁇ hism (RFLP) analysis, Southern hybridization, Northern hybridization, in situ hybridization, and electrophoretic mobility shift assay (EMS A).
  • detectably-labeled any means for marking and identifying the presence of a molecule, e.g., an oligonucleotide probe or primer, a gene or fragment thereof, a cDNA molecule, or an antibody.
  • Methods for detectably-labeling a molecule are well known in the art and include, without limitation, radioactive labeling (e.g., with an isotope such as 32 P or 35 S) and nonradioactive labeling (e.g., with a fluorescent label such as fluorescein).
  • substantially pure polypeptide is meant a polypeptide (or a fragment thereof) that has been separated from the components that naturally accompany it.
  • the polypeptide is substantially pure when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.
  • the polypeptide is a PKDL polypeptide that is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, pure.
  • a substantially pure PKDL polypeptide may be obtained, for example, by extraction from a natural source (e.g., a kidney cell), by expression of a recombinant nucleic acid encoding a PKDL polypeptide, or by chemically synthesizing the polypeptide. Purity can be measured by any appropriate method, e.g., by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
  • a protein is substantially free of naturally associated components when it is separated from those contaminants which accompany it in its natural state.
  • a protein which is chemically synthesized or produced in a cellular system different from the cell from which it naturally originates will be substantially free from its naturally associated components.
  • substantially pure polypeptides not only includes those derived from eukaryotic organisms but also those synthesized in E. coli or other prokaryotes.
  • specifically binds is meant an antibody that recognizes and binds a PKDL polypeptide but that does not substantially recognize and bind other molecules (e.g., other polypeptides) in a sample, e.g., a biological sample, that naturally includes that protein.
  • high stringency conditions conditions that allow hybridization comparable with the hybridization that occurs using a DNA probe of at least 500 nucleotides in length, in a buffer containing 0.5 M NaHP0 4 , pH 7.2, 7% SDS, 1 mM EDTA, and 1 % BSA (fraction V), at a temperature of 65°C, or a buffer containing 48% formamide, 4.8X SSC, 0.2 M Tris-Cl, pH 7.6, IX Denhardt's solution, 10% dextran sulfate, and 0.1% SDS, at a temperature of 42°C (these are typical conditions for high stringency Northern or Southern hybridizations).
  • High stringency hybridization is also relied upon for the success of numerous techniques routinely performed by molecular biologists, such as high stringency PCR, DNA sequencing, single strand conformational polymo ⁇ hism analysis, and in situ hybridization. In contrast to Northern and Southern hybridizations, these techniques are usually performed with relatively short probes (e.g., usually 16 nucleotides or longer for PCR or sequencing, and 40 nucleotides or longer for in situ hybridization).
  • the high stringency conditions used in these techniques are well known to those skilled in the art of molecular biology, and may be found, for example, in Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1998, hereby inco ⁇ orated by reference.
  • transgene any piece of DNA that is inserted by artifice into a cell, and becomes part of the genome of the organism which develops from that cell.
  • a transgene may include a gene which is partly or entirely heterologous (i.e., foreign) to the transgenic organism, or may represent a gene homologous to an endogenous gene of the organism.
  • transgenic is meant any cell that includes a DNA sequence that is inserted by artifice into a cell and becomes part of the genome of the organism that develops from that cell.
  • the transgenic organisms are generally transgenic mammals (e.g., mice, rats, and goats) and the DNA (transgene) is inserted by artifice into the nuclear genome.
  • knockout mutation is meant an artificially-induced alteration in the nucleic acid sequence (created via recombinant DNA technology or deliberate exposure to a mutagen) that reduces the biological activity of the polypeptide normally encoded therefrom by at least 80% relative to the unmutated gene.
  • the mutation may, without limitation, be an insertion, deletion, frameshift mutation, or a missense mutation.
  • a knockout animal is a mammal, preferably a mouse, containing a knockout mutation as defined above.
  • transformation means any method for introducing foreign molecules into a cell, e.g., a bacterial, yeast, fungal, algal, plant, insect, or animal cell.
  • Lipofection, DEAE-dextran- mediated transfection, microinjection, protoplast fusion, calcium phosphate precipitation, retroviral delivery, electroporation, and biolistic transformation are just a few of the methods known to those skilled in the art which may be used.
  • transformed cell means a cell (or a descendent of a cell) into which a DNA molecule encoding a polypeptide of the invention has been introduced, by means of recombinant DNA techniques.
  • promoter is meant a minimal sequence sufficient to direct transcription. If desired, constructs of the invention may also include those promoter elements that are sufficient to render promoter-dependent gene expression controllable in a cell type-specific, tissue-specific, or temporal- specific manner, or inducible by external signals or agents; such elements may be located in the 5' or 3' or intron sequence regions of the native gene.
  • operably linked is meant that a gene and one or more regulatory sequences are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequences.
  • PKDL antisense nucleic acid is meant a nucleic acid comprising a sequence of at least 16 consecutive nucleotides (more preferably, at least 20, 25, 50, 75, 100, 150, or 200 nucleotides) that is 95% (more preferably, 100%) complementary to at least 16 consecutive nucleotides (more preferably, at least 20, 25, 50, 75, 100, 150, or 200 nucleotides) of an exon and/or intron within the coding strand of a PKDL gene or mRNA.
  • a PKDL antisense nucleic acid is capable of preferentially lowering the level of a mutant PKDL polypeptide encoded by a mutant PKDL gene by at least 20%, more preferably by at least 20%-35%, 35%-55%, 55-75%, or 75%-100%.
  • missense mutation is meant the substitution of one purine or pyrimidine base (i.e. A, T, G, or C) by another within a nucleic acid sequence, such that the resulting new codon encodes an amino acid distinct from the amino acid originally encoded by the reference (e.g. wild-type) codon.
  • frameshift mutation is meant a mutation within a polynucleotide coding sequence, such as the insertion or deletion of at least one nucleotide, that alters the codon reading frame at and/or downstream from the mutation site. Such a mutation results either in the substitution of the encoded wild-type amino acid sequence by a novel amino acid sequence, or a premature termination of the encoded polypeptide due to the creation of a stop codon, or both.
  • sample is meant a tissue biopsy, cells, blood, serum, urine, stool, or other specimen obtained from a patient or test subject.
  • the sample is analyzed to detect a mutation in a PKDL gene, or expression levels of a PKDL gene, by methods that are known in the art. For example, methods such as sequencing, single-strand conformational polymo ⁇ hism (SSCP) analysis, or restriction fragment length polymo ⁇ hism (RFLP) analysis of PCR products derived from a patient sample may be used to detect a mutation in a PKDL gene; ELISA may be used to measure levels of PKDL polypeptide; and PCR may be used to measure the level of PKDL nucleic acid.
  • SSCP single-strand conformational polymo ⁇ hism
  • RFLP restriction fragment length polymo ⁇ hism
  • cystic disease is meant a disease associated with the abnormal formation of closed cavities or sacs lined by epithelial cells, especially those cavities or sacs containing liquid or semisolid material.
  • a patient suffering from a cystic disease for example, polycystic kidney disease, may display cysts in the kidneys, liver, pancreas, spleen, ovaries, or testis.
  • PKDL-related disease or "PKDL-related condition” is meant any disease or condition that results from inappropriately high or low expression of the PKDL gene, or any disease that results from a mutation in a PKDL gene that alters the biological activity of a PKDL polypeptide.
  • PKDL- related diseases and conditions may arise in any tissue in which PKDL is expressed during prenatal or post-natal life.
  • PKDL-related diseases and conditions may include congenital malformations and diseases of the kidneys, such as polycystic kidney disease, or a neurological disease, such as partial epilepsy, infantile-onset spinocerebellar ataxia (IOSCA), and urofacial syndrome (UFS).
  • IOSCA infantile-onset spinocerebellar ataxia
  • UFS urofacial syndrome
  • PKDL biological activity is meant the ability of a PKDL polypeptide to behave as a Ca 2+ -regulated cation channel, as described herein for a PKDL polypeptide having the amino acid sequence set forth in SEQ ID NO: 2.
  • a mutation that is involved in a PKDL-related disease or condition decreases the Ca 2+ -regulated cation activity by at least 20% (more preferably by at least 30%, 40%, 50-75%, or 75%-95%), relative to the Ca 2+ -regulated cation channel activity of a PKDL polypeptide having the amino acid sequence set forth in SEQ ID NO: 2.
  • PKDL biological activity may also be modulated (e.g., increased or decreased) by increasing or decreasing the levels of PKDL polypeptide (e.g., by modulating the rate of transcription or translation, or the rate of mRNA or protein turnover).
  • a compound that modulates PKDL biological activity modulates the Ca 2+ -regulated cation channel activity of a PKDL polypeptide by at least 20% (more preferably by at least 30%, 40%, 50-75%, or 75%-95%), relative to a PKDL polypeptide not exposed to the compound.
  • Figure 1 is a diagram showing the PKDL cDNA sequence (SEQ ID NO: 1
  • Figure 2 is a diagram showing the PKDL deduced amino acid sequence (SEQ ID NO: 2) and putative peptide motifs.
  • Figure 3 A is a diagram showing hydropathy plots of polycystin-L (Pc-L) and polycystin-2 (Pc-2).
  • Figure 3B is a diagram showing alignments of amino acid sequences from polycystin-L, polycystin-2, voltage-gated Ca 2+ channel ⁇ l subunits, and transient receptor potential-related channel 3 (t ⁇ c3).
  • Figure 4A is a diagram of a dot blot showing the expression pattern of the PKDL gene in various human adult and fetal tissues.
  • Figure 4B is a diagram of a Northern blot showing the expression pattern of the PKDL gene in human adult tissues.
  • Figure 4C is a diagram of a Northern blot showing the expression pattern of the PKDL gene in human fetal tissues.
  • Figure 5 A is an ideogram of human chromosome 10 showing the location of the human PKDL gene at 10q24.
  • Figure 5B is a diagram of a human metaphase spread showing the location of the human PKDL gene at 10q24.
  • Figure 6 is a diagram of a man-mouse map showing the PKDL locus.
  • Figure 7 is a diagram of a Southern blot showing that the mouse homologue of PKDL is deleted in Krd mice.
  • Figure 8(A-F) is a series of diagrams showing polycystin-L channel conductance in the resting state.
  • Figure 9(A-D) is a series of diagrams showing that polycystin-L conductance is stimulated by Ca 2+ .
  • Figure 10(A-B) is a series of diagrams showing that the activity of polycystin-L single channels is increased by Ca 2+ .
  • Figure 1 l(A-C) is a series of diagrams showing the effects of EGTA, divalent cations, and protons on polycystin-L-expressing Xenopus oocytes.
  • Figure 12 is a diagram showing the nucleotide sequence of all 16 exons and the flanking intron regions of the human PKDL gene.
  • Figure 13 is a diagram comparing the ex on arrangements of the human PKDL, PKD2, and PKDl genes.
  • Figure 14 is a schematic representation of the PKDL gene product that shows the relationship between the functional domains of the polypeptide and the exon structure of the gene.
  • Figure 15(A-B) is a diagram showing PKDL alternative splice products in an RT-PCR assay (15 A) and a schematic representation of the splice variants (15B).
  • PKDL human polycystic kidney disease-2-like
  • This gene encodes polycystin-L (PCL), a member of the polycystin family. Genes that encode the two previously known members of the family, polycystin- 1 and polycystin-2, are believed to form pore-forming subunits of ion channels. Polycystins-1 and -2 are known to be mutated in autosomal dominant polycystic kidney disease (ADPKD).
  • ADPKD autosomal dominant polycystic kidney disease
  • PCL bears significant homology to known pore-forming proteins.
  • PCL functions as a Ca + -modulated non- selective cation channel permeable to Na + , K + , and Ca 2+ .
  • deletion of a genetic locus containing the PKDL gene results in kidney and retinal defects in mice.
  • PKDL may be involved in retinal diseases and cystic diseases, such as ADPKD, dominantly transmitted glomerulocystic kidney disease of post- infantile onset, isolated polycystic liver disease, and Hajdu-Cheney syndrome/se ⁇ entile fibula syndrome.
  • ADPKD retinal diseases and cystic diseases
  • cystic diseases such as ADPKD, dominantly transmitted glomerulocystic kidney disease of post- infantile onset, isolated polycystic liver disease, and Hajdu-Cheney syndrome/se ⁇ entile fibula syndrome.
  • PKDL PKDL-associated chromosome 10q24
  • IOSCA infantile-onset spinocerebellar ataxia
  • UFS urofacial syndrome
  • a polymo ⁇ hic marker that is located within the PKDL gene associates with partial epilepsy, IOSCA, and UFS.
  • W27963 (SEQ ID NO: 3) and W28231 (SEQ ID NO: 4), we amplified an RT-PCR product from adult kidney and brain RNA.
  • the translated amino acid sequence of this RT-PCR product showed 67% homology and 46% identity to residues 670 to 779 of human polycystin-2.
  • 5MR1 Using 5MR1 as a probe, we screened a human retina library. Three clones, PKDL-6, PKDL-7, and PKDL-8, were obtained and sequenced.
  • the consensus 3,044 bp sequence (SEQ ID NO: 1) revealed an open reading frame of 2,415 bp, which encodes a protein of 805 amino acids (SEQ ID NO: 2) (Fig. 1).
  • the putative translation start site at cDNA position 384 (5'-TTCCCCATGA-3'; SEQ ID NO: 10) was not accompanied by a typical Kozak sequence. A single in-frame stop codon was found in the putative 5' untranslated region.
  • the open reading frame was followed by several in-frame stop codons, and the 3' untranslated region contains a consensus polyadenylation signal (5'-AATAAA-3') 10 nucleotides upstream from the poly- A tail.
  • Polycystin-L also has a putative Ca 2+ -binding structure or EF-hand (Fig. 2). Such structures generally consist of two helices and a loop between them (Marsden et al., Biochem. Cell Bio. 68:587-601, 1990). The C-terminal helix in the EF-hand of polycystin-L overlaps with the predicted coiled-coil region. Polycystin-L has a putative cAMP phosphorylation site in its C-terminus and several putative protein kinase C phosphorylation sites are in regions predicted to be cytoplasmic.
  • Polycystin-L showed significant homology to polycystin-2 (71% homologous, 50% identical). This homology is generally higher in predicted transmembrane segments and in the loops between transmembrane segments (Fig. 3B). Polycystin-L also showed a moderate similarity (similarity 45%, identity 22%) to polycystin-1 over residues 1 to 797. This similarity is slightly higher in transmembrane segments but there is one conserved positively charged short amino acid stretch in the first loop between transmembrane segments (Fig. 3B).
  • Polycystin-L like polycystin-2, shows homology (similarity -47%, identity -21% overall) to each of the four domains of various Ca 2+ channel ⁇ l subunits and other cation channels. Regions of homology are clustered in the last four transmembrane segments and the pore region of each domain of the Ca 2+ channel ⁇ l subunits (Fig. 3B). In polycystin-L and polycystin-2, the regions corresponding to this pore region include the last of the three relatively hydrophobic peaks. The first two-thirds of this region is predicted to form a helical structure that is characteristic of various cation channels.
  • RNA dot blot analyses using the 5'-most 1.5 kb of the PKDL coding sequence as a probe revealed highest expression of PKDL in adult human heart and kidney (Fig. 4A; Dot Al, whole brain; A2, amygdala; A3, caudate nucleus; A4, cerebellum; A5, cerebral cortex; A6, frontal lobe; A7, hippocampus; A8, medulla oblongata; Bl, occipital lobe; B2, putamen; B3, substantia nigra; B4, temporal lobe; B5, thalamus; B6, subthalamic nucleus; B7, spinal cord; Cl, heart; C2, aorta; C3, skeletal muscle; C4, colon; C5, bladder; C6, uterus; C7, prostate; C8, stomach; DI, testis; D2, ovary; D3, pancreas; D4, pituitary gland; D5, adrenal gland; D6, thyroid gland; D7
  • Northern blot analysis of PKDL expression showed the presence of 5 kb and 1.5 kb bands in fetal tissues including kidney, liver, and brain (Fig. 4C; human fetal tissues). This result suggests the presence of alternatively spliced forms. The abundance of the two splice variants is approximately 1 : 1 in fetal tissues. In adult tissues, however, the long transcript is detected only after prolonged autoradiography (Fig. 4B; human adult tissues). The temporal expression pattern of PKDL is similar to that of PKDl .
  • Fig. 5 A shows an ideogram of human chromosome 10 showing the map location of human PKDL (arrow).
  • Fig. 5B shows a photograph of human metaphase chromosomes counterstained with DAPI.
  • the two chromosomes are indicated by numbers. Arrows point to the site of hybridization of the digoxigenin-labeled human PKDL on both chromosomes 10 in band q24. Using the Stanford G3 radiation hybrid panel, we found that the PKDL gene has a distribution pattern identical to that of the polymo ⁇ hic marker D10S603 (lod score greater than 1,000). Linkage analysis of the PKDL locus using flanking markers D10S603, D10S198 and D10S192 gave negative lod scores in seven ADPKD families previously documented to be unlinked to PKDl and PKD2 loci (Table 1).
  • Fig. 6 shows a man-mouse map of the PKDL locus.
  • the human PKDL gene is located within a linkage group that is conserved on the distal portion of mouse chromosome 19 (DeBry et al, Genomics 33:337-351, 1996).
  • a 7 cM deletion of this region has been described in Krd mice (Keller et al., Genomics 23:309-320, 1994).
  • Pkdl genomic DNA from Fl animals obtained from a cross of strain C57BL/6J-Krd with strain SPRET/Ei.
  • Fig. 7 shows a Southern blot analysis of Krd mice. Genomic DNA from the indicated strains was digested with Tag I, transferred to a membrane, and probed with a 1.5 kb human PKDL cDNA probe. Strain C57BL/6J contains three hybridizing Taq I fragments of 5.5 kb, 5.0 kb, and 1.8 kb.
  • Strain C3H on which the Krd mutation originally arose, contains three hybridizing Taq I fragments of 5.5 kb, 5.0 kb, and 1.6 kb.
  • Strain SPRET/Ei contains two hybridizing fragments of 8 kb and 4.5 kb.
  • the (C57BL/6J-Krd X SPRET/Ei) Fl mouse inherited the hybridizing fragments contributed by the SPRET/Ei parent but did not inherit the fragments from C57BL/6J or C3H (Fig. 7). This result indicates that the mouse Pkdl locus is located within the region that is deleted by the Krd mutation.
  • polycystin-L and polycystin-2 both have putative EF-hand structures in their C-terminal cytoplasmic domains, suggesting that their functions are influenced by cytoplasmic Ca 2+ concentration. In several Ca 2+ channels binding of Ca 2+ to EF-hand structures inactivates the channels.
  • Polycystin-L and polycystin-2 show moderate but significant sequence similarity to Ca + and other cation channels, especially within their S3-S6 segments and the loop between the S5 and S6 segments.
  • the last two membrane-spanning segments of polycystin-L, polycystin-2, and Ca 2+ channel ⁇ l subunits share structural characteristics with the Streptomyces lividans K + channel (KcsA), whose structure has been determined by crystallography.
  • the common structural features include: the lining residues of the last membrane-spanning segments are mostly hydrophobic, except for the negatively charged acidic amino acid near the end of these segments; the loops between the last two membrane-spanning regions (pore regions) are mildly hydrophobic (Fig.
  • N-terminal cytoplasmic domain where it lacks a 100 amino acid segment present in the polycystin-2.
  • polycystin-L is strongly predicted to have a coiled-coil structure, which has the potential to tightly interact with molecules with a similar structure, like polycystin-1.
  • Lupas' algorithm also predicts a coiled-coil structure in polycystin-2; however, this result is not supported by Berger's algorithm.
  • Polycystin-L and polycystin-2 have three positively charged residues in S4, as opposed to the five to eight positively charged residues present in voltage-gated channels. Whereas the S4 region in voltage-gated Ca 2+ channels is considered to be a "voltage-sensor," it is not clear whether a membrane-spanning region with only three basic residues could act as a voltage-sensor.
  • Polycystin-L also has several putative phosphorylation sites: one cyclic nucleotide, two protein kinase C, and four casein kinase II phosphorylation sites with strong motif sequences in the C-terminal cytoplasmic domain. Two other putative protein kinase C phosphorylation sites are also found in the N-terminal cytoplasmic domain.
  • Phosphorylation of these motif sequences may be involved in the gating process of the channel.
  • the channel may be gated by a direct or indirect signal from associating proteins, e.g., polycystin-1.
  • polycystin-1 has domains which may be involved in cell-cell or cell-matrix interactions and is known to interact with polycystin-2, we hypothesized that the binding of ligand(s) to polycystin-1 may be associated with the gating of a "polycystin related channel.”
  • Sequence analysis and comparison to other channels support topological arrangement of six or seven membrane- spanning regions plus one pore region within polycystin-2 and polycystin-L.
  • the middle of the three relatively hydrophobic peaks which corresponds to S4 in ⁇ l subunits of cation channels, is likely to be another transmembrane segment. Whether the N-terminal peak (Sl/2) forms a membrane-spanning region is not clear.
  • One common feature of the polycystin-L/polycystin-2 structure, which is rarely observed in known ion channels, is that they both have relatively long extracellular loops between the first and the second putative transmembrane segments.
  • polycystin-2 and polycystin-L maintain a high level of homology with each other in this region. Moreover, this region contains a thirteen amino acid stretch with three to four basic residues that is conserved among polycystin-2, polycystin-L, and polycystin-1. The function of this "polycystin shared motif is not clear. Polycystin-L functions as a calcium-regulated cation channel
  • PCL Polycystin-L
  • polycystin-2 share similarities in sequence, domain organization, and/or membrane topology (Fig. 8A; putative membrane topology of PCL; P, circle, triangle, and square represent, respectively, the pore region, N-glycosylation, PKA-, and PKC-phosphorylation sites) with cation channels, e.g., the transient receptor potential (TRP) and voltage-gated Ca 2+ , Na + , and K + channel families. Therefore, we used a Xenopus laevis oocyte expression system to test whether PCL functions as a channel.
  • TRP transient receptor potential
  • Fig. 8C shows a comparison of currents obtained from the same oocyte in NaCl-containing solution and when 100 mM mannitol replaced 50 mM NaCl.
  • Fig. 8D shows ion-selectivity I-V curves obtained using cation-Cl-substituted solutions (2 mM KC1 was removed from all solutions). Inward currents were largely abolished by replacing external Na + with N-methyl-D-glucamine (NMDG).
  • NMDG N-methyl-D-glucamine
  • PCL exhibited similar permeabilities (P) to Na + , K + , and Rb + , lower permeability to Li + 1 :0.98:0.97:0.87), and very low permeabilities to large cations such as NMDG, tetraethylammonium, or choline (Fig. 8D).
  • Single-channel analysis of 102/127 cell-attached patches of PCL-injected oocytes, but not 50/50 H 2 0-i ⁇ jected oocytes or those expressing other membrane proteins (n 40), revealed a channel highly permeable to Na + and K + (Fig.
  • FIG. 9A shows 45 Ca uptake in oocytes pre-incubated in NaCl-containing solution for 10 minutes.
  • Non-radioactive Ca 2+ (5 mM) was added at time 0. "03" and "36" indicate the periods (in minutes) of 45 Ca incubation.
  • the bottom portion of Fig. 9B shows I-V curves obtained from the same oocyte before (point 1) or after (point 2) Ca 2+ addition.
  • PCL channel activity as being in the resting, activated, or desensitized state under the conditions corresponding to points 1, 2, and 3, respectively, in Fig. 9A.
  • the top panel of Fig. 10A shows single-channel currents recorded at -60 mV in a cell-attached patch before and after adding 5 mM Ca 2+ to the bath ("Na 0 " solution).
  • the pipette solution was "K140 o .”
  • the bottom panel of Fig. 10A shows expanded traces representing, respectively, the resting (1), activated (2 & 2'), and desensitized (3) states.
  • the resting potential of oocytes was assumed to be -30 mV. Patch-clamp experiments showed that elevating the bath Ca 2+ to 5 mM evoked pronounced, but transient, increases in PCL channel activity in cell-attached patches, although the single-channel conductance remained nearly unchanged.
  • Fig. 10B Direct activation of PCL channel activity by Ca 2+ f was demonstrated in inside-out patches (Fig. 10B).
  • Fig. 10B (top) shows representative traces at -50 mV in an inside-out patch before and after adding 1 ⁇ M Ca 2* .
  • the pipette solution was "Na 0 " and the intracellular solution was "K 0 " supplemented with 5 CaK 2 EGTA + H 2 K 2 EGTA to obtain 0.1 or 1 ⁇ M free Ca + .
  • Sustained high Ca 2* (1-10 ⁇ M) did not appear to prevent subsequent decreases in channel activity, though the time needed to reach this state varied.
  • oocytes were injected with 50 nl of 50 mM EGTA, a Ca 2+ chelator, at least 2 hours before experiments were initiated.
  • Fig. 11 A shows currents recorded at -50 mV with an EGTA-injected oocyte in choline-Cl-substituted or NaCl-containing solution; the external application of various divalent cations (5 mM) is indicated by gray bars, and the inset shows currents recorded with another oocyte in choline-Cl-substituted solution. Currents due to addition of 5 mM Ca 2+ 0 were much lower than without EGTA and could be repeatedly generated (Fig. 11 A vs.
  • Fig. 9A indicating that elevating Ca 2+ 0 alone did not trigger activation or desensitization of the PCL channel. It remains to be established whether Ca 2+ -induced activation and the ensuing desensitization of the channel result from effects of Ca 2+ j on the putative EF-hand within the C-terminus (Fig. 8A) or calmodulin, or from other mechanisms.
  • PCL is permeable to Ba + and Sr 2 " but barely permeable to Mg 2+ (Fig. 11 A).
  • Ba 2+ , Sr 2* , and Ca 2+ (80 mM) generated whole-cell inward currents comparable to those generated by 100 mM Na + in EGTA-injected oocytes.
  • the PCL single-channel inward conductance was 120 to 135 pS with 80 mM Ba 2+ , Sr 2"1" , or Ca 2+ .
  • its permeation to mono- and divalent cations is not additive, as divalent cations inhibited currents generated by Na + .
  • FIG. 1 IB shows I-V relations obtained using EGTA-injected oocytes expressing PCL, before or after Ca 2+ addition to choline-Cl-substituted or NaCl-containing solution.
  • the right panel of Fig. 1 IB shows 45 Ca 2+ (1 mM) uptake using H 2 0-injected or PCL-expressing oocytes, in NaCl-containing or choline-Cl-substituted solution.
  • Ca 2+ 0 inhibited Na + currents over a wide voltage range
  • Mg 2+ inhibited Na + currents, by reducing PCL channel open probability, only at negative potentials.
  • Na + inhibited Ca 2+ influx (Figs.
  • PCL channel activity appears not to be regulated by protein kinase A- (PKA) or protein kinase C- (PKC) dependent phosphorylation as neither cAMP, nor phorbol myristate acetate, significantly affected Ca 2+ entry.
  • PKA protein kinase A-
  • PKC protein kinase C-
  • PCL is a Ca 2+ -modulated, Ca 2+ -permeable, non-selective cation channel. Its ion selectivity, large single-channel conductance, and relatively long open time distinguish it from structurally-related channels of the TRP family, voltage-gated Ca 2+ and Na+ channels and from known endogenous cation channels in Xenopus oocytes, including the stretch-activated cation channel and hype ⁇ olarization-activated cation channel. It is unlikely that the unique channel activity observed in PCL-expressing oocytes results from upregulation or modulation of an endogenous channel, as actinomycin D had no effect on the activity.
  • PCL and polycystin-2 share structural features and it is likely that polycystin-2 also possesses channel properties. We hypothesize that alteration of these channels leads to the abnormal fluid secretion and cellular proliferation that are hallmarks of polycystic kidney disease.
  • the murine ortholog of PCL is eliminated by a large chromosomal deletion in Krd mice, which exhibit renal cysts and other defects (Nomura et al, J. Biol. Chem. 273:25967-25973, 1998).
  • Polycystins-1 and -2 bind each other, and it is possible that PCL also oligomerizes with another polycystin in vivo. Elucidating the channel properties of polycystins should provide novel therapeutic strategies for PKD.
  • PKDL autosomal recessive polycystic kidney disease
  • ARPKD autosomal recessive polycystic kidney disease
  • the PKDL locus may play a role, however, in unmapped human genetic cystic disorders such as dominantly transmitted glomerulocystic kidney disease (GCKD) of postinfantile onset (Sha ⁇ et al, J. Am. Soc. Nephrol.
  • the 7 cM Krd deletion is located between Tdt and Cypl 7 and includes the paired box gene Pax2.
  • Mice heterozygous for a null mutation of Pax2 frequently demonstrate reduction in kidney weight ranging from 10% to 100% of normal kidney weight. The reduced size is due mainly to calyceal and proximal ureteral diminution as well as cortical thinning with a reduced number of developing nephrons (Torres et al. Development 121 :4057-4065, 1995).
  • the phenotype of Krd/+ heterozygotes includes aplastic, hypoplastic and cystic kidneys, as well as reduced viability on strain C57BL/6J (Keller et al, Genomics 23:309-320, 1994).
  • Our Southern analysis demonstrates that the mouse ortholog of PKDL is deleted in Krd mice.
  • Partial epilepsy is localization-related epilepsy, in which seizure begins in a specific brain region.
  • IOSCA is a recessively inherited, progressive neurological disease.
  • the clinical symptoms of IOSCA include ataxia athetosis, hypotonia, hearing deficit, ophthalmoplegia, sensory neuropathy, female hypogonadism, and epilepsy as a late manifestation.
  • Linkage disequilibrium analysis suggested that D10S603 is one of the markers most tightly associated with the IOSCA gene.
  • UFS is a rare autosomal recessive disease characterized by congenital obstructive uropathy and abnormal facial expression. Linkage analysis has localized the UFS gene near D10S1726/D10S198 and within a 1-cM interval defined by D10S1433 and D10S603. In view of its channel properties, polycystin-L is an excellent candidate for neurological diseases.
  • the PKDL locus is a likely candidate for unmapped human genetic cystic disorders such as dominantly transmitted glomerulocystic kidney disease of postinfantile onset, isolated polycystic liver disease, and Hajdu-Cheney syndrome/se ⁇ entile fibula syndrome.
  • PAC genomic clone PAC346cl2 was used as a template for PCR amplification across introns 3 to 15. Intron 1 was amplified directly from human genomic DNA, and intron 2 sequence was obtained by inverse PCR of total human genomic DNA. Intron sizes were deduced from DNA sequences or the sizes of PCR products.
  • Fig. 12 shows the nucleotide sequence of all 16 exons and the flanking intron regions of the human PKDL gene (SEQ ID NO: 20). Introns are shown by lower case letters and exon sequences by capital letters with the derived amino acid sequences below the first base of each codon. Potential transmembrane segments are underlined within the amino acid sequence.
  • the two-headed arrow indicates the putative EF-hand; the dotted line indicates the putative coiled-coil region.
  • the first exon reported here contains the translation start site.
  • the translation stop codon in exon 16 is indicated by an asterisk, and the potential polyadenylation signals are also underlined.
  • the polymo ⁇ hic marker D10S603 previously shown to be linked to PKDL was found to be located at the boundary of intron 4 and exon 5 of PKDL.
  • exon/intron structures of the 5' portion of PKDL and PKD2 are very similar. Exons 2, 5, 6, 10, and 11 of PKDL are identical in size to those of PKD2, and exons 3, 4, 7, 8, 9, 12, 13, and 14 are very close in size to those of PKD2 (Hayashi et al, Genomics 44:131-136, 1997). Comparison of the exon structures of the human genes for PKDL, PKD2, and PKDl is shown in Fig. 13. The exons are indicated by boxes (to scale) and the introns are indicated by interconnecting lines (not to scale). The dotted vertical lines indicate the similarity of the intron positions between PKDL and PKD2.
  • polycystin-L differs from polycystin-2 most significantly in the N-terminal cytoplasmic domain, where it lacks a 100-amino acid segment.
  • Fig. 14 shows the correlation of exons with structural or functional domains in the PKDL gene product (exons are represented by alternating thick and thin lines).
  • the six predicted transmembrane spans are shown, the wavy line in exon 12 denotes the EF-hand, and the coiled-coil domain is indicated by an arrow.
  • the locations of the transmembrane domains of polycystin-L and polycystin-2 are very similar.
  • both proteins contain a relatively long extracellular loop between the first and the second putative transmembrane segments and share a high level of homology with each other in this region.
  • Our sequence analysis of the PKDL cDNA and genomic sequences revealed sequence variations at two positions.
  • polycystin-L may contain either a histidine or a glutamine at amino acid position 13 (encoded by CAC or CAA, respectively) and a either a valine or an isoleucine at amino acid position 393 (encoded by GTC and ATC, respectively).
  • the amino acid sequence encoded by the cDNA (shown in Fig. 1) contains his 13 and ile393, whereas the amino acid sequence encoded by the genomic DNA (shown in Fig. 12) contains gin 13 and val393.
  • PKDL transcript appears to be alternatively spliced (Nomura et al, J. Biol. Chem. 273:25967-25973, 1998; Wu et al, Genomics 54:564-568, 1998).
  • RT-PCR RNA extracted from human lymphocytes and HepG2 cells by using various primers derived from PKDL coding sequence.
  • Fig. 15A shows an RT-PCR of human lymphocyte RNA.
  • PCR with primers fl06 and rl08 (lane 2) generated three bands with sizes of 692 bp, 467 bp, and 332 bp, respectively.
  • PCR with primers fl 15 and rl 15 (lane 4) generated two bands with sizes of 472 bp and 387 bp, respectively.
  • Lanes 1 and 3 are reverse transcriptase negative controls.
  • "M” denotes a 1 kb DNA ladder (GIBCO BRL, Gaithersburg, MD).
  • Fig. 15B shows a schematic representation of the splicing variants. Boxes indicate exons, solid lines indicate introns, and the nucleotide sequences at the splicing junctions are indicated below.
  • the expected PCR product size based on the full length cDNA of PKDL is 692 bp.
  • Exon 5 is deleted from the 467 bp splice variant, which we have designated PKDL( ⁇ 5). Portions of exons 4 and 6, and the whole of exon 5, are deleted from the 332 bp splice variant, which we have designated PKDL( ⁇ 456).
  • the splicing of this transcript variant conforms neither to the GT-AG rule nor to the AT- AC rule.
  • primers fl 15 and rl 15 the expected PCR product size based on the full length cDNA of PKDL is 472 bp.
  • the 387 bp splice variant is designated PKDL( ⁇ 15) as it lacks exon 15.
  • PKDL( ⁇ 5) is predicted to encode a protein with a 75-amino acid in-frame deletion in its long extracellular loop region
  • PKDL( ⁇ 456) is predicted to encode a protein with a 120-amino acid in-frame deletion that eliminates the second and third transmembrane domains.
  • the absence of exon 15 in splice variant PKDL( ⁇ 15) results in a frameshift and a premature stop codon, thereby truncating the carboxy-terminal domain of the encoded polypeptide by 45 amino acids.
  • RT-PCR of RNA from the HepG2 cell line showed that PKDL also undergoes alternative splicing in this cell type, although the splice variant PKDL( ⁇ 456) was absent.
  • Overlapping expressed sequence tag (EST) sequences W27963 and W28231, derived from a retina cDNA library, were identified by their gene product homology to polycystin-2 (gb
  • the deduced amino acid sequences of W27963 and W28231 showed, respectively, 78% homology and 56% identity (over residues 649 to 749) and 65% homology and 39% identity (over residues 678 to 786 with a single three residue gap) to polycystin-2.
  • the two EST sequences shared 94% identity over 421 bp.
  • a 340 base pair (bp) fragment in the overlap region of both ESTs was amplified from human adult kidney and brain poly-A selected RNA by reverse transcription/polymerase chain reaction (RT-PCR) using primers 5'-TCTTCGTGCTCCTGAACATG-3' (SEQ ID NO: 11) and 5'-CCTGTCGCATTTTTCCTGTT-3' (SEQ ID NO: 12).
  • RT-PCR reverse transcription/polymerase chain reaction
  • RACE rapid amplification of cDNA ends
  • Primers were designed based on PKDL RT-PCR products. Nested amplification was performed according to the manufacturer's instructions.
  • the 5'-RACE product was labeled with 32 P-dCTP by random priming and used to screen a human retina cDNA library (Clontech, Palo Alto, CA). Hybridization was performed in a buffer containing 5X SSC, 50% formamide, 1% SDS, and 5X Denhardt's solution at 42 °C overnight. Filters were washed three times in buffer (O.lx SSC and 0.1% SDS) at 65°C. Positive signals were purified and inserts were subcloned into pBluescript II (Stratagene, La Jolla, CA) and sequenced.
  • Human adult and fetal RNA blots (Clontech, Palo Alto, CA) were hybridized with a probe labeled by random priming and consisting of the first 1.5 kb of the PKDL coding sequence in 5X SSC, 50% formamide, 1% SDS, 5X Denhardt's solution, at 42 °C, overnight. Filters were washed twice in 2X SSC, 0.1% SDS first at room temperature, then at 50 °C. Signals were visualized by autoradiography.
  • FISH Fluorescent in situ hybridization
  • a 1.7 kb human PKDL genomic fragment between cDNA positions 2,006 and 2,206 was PCR-amplified with exonic primers and subcloned into pCRII (Invitrogen, Carlsbad, CA).
  • pCRII Invitrogen, Carlsbad, CA.
  • One microgram of this vector was labeled with digoxigenin-11-dUTP as described previously (Zhao et al, Mol. Cell Bio. 15:4353-4363, 1995) and co-precipitated with 10 ⁇ g of Cot-1 DNA and resuspended in TE at 200 ⁇ g/ml.
  • Hybridization of metaphase chromosome preparations from peripheral blood lymphocytes of normal human males was performed with PKDL at 10 ⁇ g/ml in Hybrisol VI as previously described (Ney et al, Mol. Cell Biol. 13:5604-5612, 1993).
  • Digoxigenin-labeled probe was detected using reagents supplied in the Oncor Kit (Oncor, Gaithersburg, MD) according to the manufacturer's recommendations.
  • Metaphase chromosomes were counterstained with 4,6-diamidino-2-phenylindole-dihydrochloride (DAPI).
  • Map position of PKDL was determined by visual inspection of the fluorescent signal on the DAPI stained metaphase chromosomes using a Zeiss Axiophot microscope. Images were captured and printed using the Cyto Vision Imaging System (Applied Imaging, Pittsburgh, PA). Twenty-one metaphases were assessed for probe localization.
  • An intron between cDNA positions 2,042 and 2,043 was amplified with exonic primers and sequenced. A set of primers was designed to amplify part of this intron.
  • the Stanford G3 panel (Ariza et al, J. Med. Genet. 34:587- 589, 1997) was screened by PCR with this primer set. Data was processed at the Stanford Human Genome Center RH server.
  • Genethon polymo ⁇ hic marker, D10S603, which has the same distribution as PKDL by radiation hybrid mapping, and two flanking markers (D10S198-1.2 cM-D10S603-0.2 cM-D10S192) were selected to test for linkage to ADPKD in seven families previously shown to be unlinked to the PKDl and PKD2 loci. Genomic DNA from members of these families was used as templates for PCR. 32 P-dCTP-labeled PCR products were separated by polyacrylamide gel electrophoresis. Pair-wise affected-only linkage analysis was performed using the FASTLINK suite of programs. A fully-penetrant dominant model with a disease gene frequency of 0.0001 and equal allele frequencies was assumed. The data was calculated using two-point lod scores.
  • C57BL/6J (KeWe ⁇ et aL, Genomics 23:309-320, 1994). C57BL/6J-Krd mice were crossed with strain SPRET/Ei to generate heterozygous (C57BL/6J-Krd x SPRET/Ei) Fl mice, as previously described (Keller et al, Genomics 23:309- 320, 1994). Aliquots of genomic DNA (10 ⁇ g) were digested with restriction endonucleases, electrophoresed on agarose gels, and transferred to nylon filters (Zetaprobe GT, Bio-Rad Laboratories, Hercules, CA). A 5' 1.5 kb human PKDL cDNA probe was gel purified and radiolabeled as described above. Filters were hybridized and washed according to the manufacturer's instructions. Signals were visualized by autoradiography.
  • RNA of human PCL6 was synthesized by in vitro transcription from full-length cDNA in pTLN2 and injected (25-50 ng/oocyte) into Xenopus laevis oocytes prepared as described (Saadi et al. Kidney Int. 54:48-55, 1998). Equal volumes of H 2 0 were injected into control oocytes. Experiments were performed 1.54 days after injection.
  • Standard Barth's (or NaCl-containing) solution contained (in mM): 100 NaCl, 2 KC1, 1 MgCl 2 , 10 Hepes, pH 7.5.
  • 100 mM NaCl was replaced with equimolar amounts of other salts, the resulting solutions were named accordingly, e.g, Na-glutamate-substituted solution.
  • Na 0 ", “K 0 " and “K140 o” indicate, respectively, extracellular (or pipette, in cell-attached and inside-out modes) solutions (100 NaCl, 2 KC1, 10 Hepes, pH 7.5; 100 KC1, 10 Hepes, pH 7.5; and 105 K-glutamate, 30 K-fluoride, 5 KC1, 5 EGTA, 5 Hepes, pH 7.3).
  • Na j ", " and “NMDG ;” indicate, respectively, intracellular (or pipette, in outside-out mode) solutions (100 NaCl, 2 KC1, 10 Hepes, pH 7.5; 100 KC1, 10 Hepes, pH 7.5; and 100 NMDG-C1, 10 Hepes, pH 7.5).
  • Cl--free solution for oocyte pre-incubation contained: 80 Na-Hepes, 2 K-gluconate, 1 Mg-gluconate, 0.75 Ca-gluconate, and pH 7.5.
  • Genomic clone PAC346cl2 was obtained from the RPCI human
  • PI -derived artificial chromosome library PCR was performed with exonic primers on PAC346cl2 or human genomic DNA by using HotstarTaq DNA polymerase (Qiagen, Hilden, Germany), and the products were purified and sequenced directly using PCR primers on Applied Biosystems 377 automated DNA sequencers (Perkin-Elmer, Norwalk, CT).
  • RNA from human lymphocytes and a HepG2 cell line was isolated using the TRIzol protocol (GIBCO BRL/Life Technologies, Gaithersburg, MD) and treated with DNase.
  • cDNA templates for amplification were synthesized by reverse transcription of 5 ⁇ g total RNA using reverse transcriptase Superscript II (GIBCO BRL/Life Technologies) with Oligo-dT primers.
  • PCR was performed with two pairs of exonic primers (fl06: 5 ⁇ GCTAAAGGTCCGCAATGAC (SEQ ID NO: 16) and rl08: 5'GGCGAGGAACTCAAAGTCTG (SEQ ID NO: 17); fl 15: 5'GTCCCAGATTGATGCTGTAGGC (SEQ ID NO: 18) and rl 15: 5'TGATAGCCACCATGGAAACC (SEQ ID NO: 19)).
  • PCR primers fl06 and rl08 are located in exon 4 and exon 7, respectively.
  • PCR primers fl 15 and rl 15 are located in exon 14 and exon 16, respectively.
  • PKDL gene sequences may be analyzed by introducing such sequences into various cell types or using in vitro extracellular systems. The function of PKDL proteins may then be examined under different physiological conditions. Alternatively, cell lines may be produced which over-express the PKDL gene product, allowing purification of PKDL for biochemical characterization, large-scale production, antibody production, and patient therapy.
  • eukaryotic and prokaryotic expression systems may be generated in which PKDL gene sequences are introduced into a plasmid or other vector, which is then used to transform living cells. Constructs in which the PKDL cDNAs containing the entire open reading frames inserted in the correct orientation into an expression plasmid may be used for protein expression. Alternatively, portions of the PKDL gene sequences, including wild-type or mutant PKDL sequences, may be inserted. Prokaryotic and eukaryotic expression systems allow various important functional domains of the PKDL proteins to be recovered, if desired, as fusion proteins, and then used for binding, structural, and functional studies and also for the generation of appropriate antibodies. If PKDL protein expression induces terminal differentiation in some types of cells, it may be desirable to express the protein under the control of an inducible promoter in those cells.
  • Typical expression vectors contain promoters that direct the synthesis of large amounts of mRNA corresponding to the inserted PKDL nucleic acid in the plasmid-bearing cells. They may also include eukaryotic or prokaryotic origin of replication sequences allowing for their autonomous replication within the host organism, sequences that encode genetic traits that allow vector-containing cells to be selected for in the presence of otherwise toxic drugs, and sequences that increase the efficiency with which the synthesized mRNA is translated. Stable long-term vectors may be maintained as freely replicating entities by using regulatory elements of, for example, viruses (e.g, the OriP sequences from the Epstein Barr Virus genome).
  • viruses e.g, the OriP sequences from the Epstein Barr Virus genome
  • Cell lines may also be produced that have integrated the vector into the genomic DNA, and in this manner the gene product is produced on a continuous basis.
  • Expression of foreign sequences in bacteria such as Escherichia coli requires the insertion of the PKDL nucleic acid sequence into a bacterial expression vector.
  • Such plasmid vectors contain several elements required for the propagation of the plasmid in bacteria, and for expression of the DNA inserted into the plasmid. Propagation of only plasmid-bearing bacteria is achieved by introducing, into the plasmid, selectable marker-encoding sequences that allow plasmid-bearing bacteria to grow in the presence of otherwise toxic drugs.
  • the plasmid also contains a transcriptional promoter capable of producing large amounts of mRNA from the cloned gene. Such promoters may be (but are not necessarily) inducible promoters that initiate transcription upon induction.
  • the plasmid also preferably contains a polylinker to simplify insertion of the gene in the correct orientation within the vector.
  • the appropriate expression vectors containing a PKDL gene, or fragment, fusion, or mutant thereof, are constructed, they are introduced into an appropriate host cell by transformation techniques, including calcium phosphate transfection, DEAE-dextran transfection, electroporation, microinjection, protoplast fusion, and liposome-mediated transfection.
  • the host cells that are transfected with the vectors of this invention may include (but are not limited to) E. coli or other bacteria, yeast, fungi, insect cells (using, for example, baculoviral vectors for expression), or cells derived from mice, humans, or other animals.
  • Mammalian cells can also be used to express the PKDL protein using a vaccinia virus expression system described, for example, in Ausubel et al.
  • T7 late-promoter expression system In vitro expression of PKDL proteins, fusions, polypeptide fragments, or mutants encoded by cloned DNA is also possible using the T7 late-promoter expression system.
  • This system depends on the regulated expression of T7 RNA polymerase, an enzyme encoded in the DNA of bacteriophage T7.
  • the T7 RNA polymerase initiates transcription at a specific 23-bp promoter sequence called the T7 late promoter. Copies of the T7 late promoter are located at several sites on the T7 genome, but none is present in E. coli chromosomal DNA.
  • T7 RNA polymerase catalyzes transcription of viral genes but not of E. coli genes.
  • recombinant E. coli cells are first engineered to carry the gene encoding T7 RNA polymerase next to the lac promoter. In the presence of IPTG, these cells transcribe the T7 polymerase gene at a high rate and synthesize abundant amounts of T7 RNA polymerase. These cells are then transformed with plasmid vectors that carry a copy of the T7 late promoter protein. When IPTG is added to the culture medium containing these transformed E. coli cells, large amounts of T7 RNA polymerase are produced.
  • the polymerase then binds to the T7 late promoter on the plasmid expression vectors, catalyzing transcription of the inserted cDNA at a high rate. Since each E. coli cell contains many copies of the expression vector, large amounts of mRNA corresponding to the cloned cDNA can be produced in this system and the resulting protein can be radioactively labeled. Plasmid vectors containing late promoters and the corresponding RNA polymerases from related bacteriophages such as T3, T5, and SP6 may also be used for in vitro production of proteins from cloned DNA. E. coli can also be used for expression using an M13 phage such as mGPI-2.
  • vectors that contain phage lambda regulatory sequences or vectors that direct the expression of fusion proteins, for example, a maltose-binding protein fusion protein or a glutathione-S-transferase fusion protein, also may be used for expression in E. coli.
  • Eukaryotic expression systems are useful for obtaining appropriate post-translational modification of expressed proteins.
  • Transient transfection of a eukaryotic expression plasmid allows the transient production of PKDL by a transfected host cell.
  • PKDL proteins may also be produced by a stably- transfected mammalian cell line.
  • a number of vectors suitable for stable transfection of mammalian cells are available to the public (e.g, see Pouwels et al. Cloning Vectors: A Laboratory Manual, 1985, Supp. 1987), as are methods for constructing such cell lines (see e.g, Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1998).
  • cDNA encoding a PKDL protein, fusion, mutant, or polypeptide fragment is cloned into an expression vector that includes the dihydrofolate reductase (DHFR) gene.
  • Integration of the plasmid and, therefore, integration of the PKDL-encoding gene into the host cell chromosome is selected for by inclusion of 0.01-300 ⁇ M methotrexate in the cell culture medium (as described, Ausubel et al, supra). This dominant selection can be accomplished in most cell types.
  • Recombinant protein expression can be increased by DHFR-mediated amplification of the transfected gene. Methods for selecting cell lines bearing gene amplifications are described in F. Ausubel et al, supra.
  • DHFR-containing expression vectors are pCVSEII-DHFR and pAdD26SV(A) (described, for example, in Ausubel et al, supra).
  • the host cells described above or, preferably, a DHFR-deficient CHO cell line are among those most preferred for DHFR selection of a stably-transfected cell line or DHFR-mediated gene amplification.
  • Eukaryotic cell expression of PKDL proteins facilitates studies of the PKDL gene and gene products, including determination of proper expression and post-translational modifications for biological activity, identifying regulatory elements located in the 5', 3', and intron regions of PKDL genes and their roles in tissue regulation of PKDL protein expression. It also permits the production of large amounts of normal and mutant proteins for isolation and purification, and the use of cells expressing PKDL proteins as a functional assay system for antibodies generated against the protein. Eukaryotic cells expressing PKDL proteins may also be used to test the effectiveness of pharmacological agents on PKDL-associated diseases or as means by which to study PKDL proteins as components of a transcriptional activation system.
  • PKDL proteins, fusions, mutants, and polypeptide fragments in eukaryotic cells also enables the study of the function of the normal complete protein, specific portions of the protein, or of naturally occurring polymo ⁇ hisms and artificially-produced mutated proteins.
  • the PKDL DNA sequences can be altered using procedures known in the art, such as restriction endonuclease digestion, DNA polymerase fill-in, exonuclease deletion, terminal deoxynucleotide transferase extension, ligation of synthetic or cloned DNA sequences, and site-directed sequence alteration using specific oligonucleotides together with PCR.
  • Another preferred eukaryotic expression system is the baculovirus system using, for example, the vector pBacPAK9, which is available from Clontech (Palo Alto, CA). If desired, this system may be used in conjunction with other protein expression techniques, for example, the myc tag approach described by Evan et al. (Mol. Cell Biol. 5:3610-3616, 1985).
  • the recombinant protein can be isolated from the expressing cells by cell lysis followed by protein purification techniques, such as affinity chromatography.
  • an anti-PKDL antibody which may be produced by the methods described herein, can be attached to a column and used to isolate the recombinant PKDL proteins. Lysis and fractionation of PKDL protein-harboring cells prior to affinity chromatography may be performed by standard methods (see e.g, Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1998).
  • the recombinant protein can, if desired, be purified further by e.g, by high performance liquid chromatography (HPLC; e.g, see Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, Work and Burdon, Eds, Elsevier, 1980).
  • HPLC high performance liquid chromatography
  • Polypeptides of the invention can also be produced by chemical synthesis (e.g, by the methods described in Solid Phase Peptide Synthesis, 2nd ed, 1984, The Pierce Chemical Co, Rockford, IL). These general techniques of polypeptide expression and purification can also be used to produce and isolate useful PKDL polypeptide fragments or analogs, as described herein.
  • PKDL proteins may be produced in a prokaryotic host (e.g, E. coli) or in a eukaryotic host (e.g, S. cerevisiae, insect cells such as Sf9 cells, or mammalian cells such as COS-1, NIH 3T3, or HeLa cells). These cells are commercially available from, for example, the American Type Culture Collection, Rockville, MD (see also Ausubel et al, supra). The method of transformation and the choice of expression vehicle (e.g, expression vector) will depend on the host system selected.
  • Transformation and transfection methods are described, e.g, in Ausubel et al, supra, and expression vehicles may be chosen from those provided, e.g. in Pouwels et al. Cloning Vectors: A Laboratory Manual, 1985, Supp. 1987.
  • PKDL protein fragments that inco ⁇ orate various portions of PKDL proteins are useful in identifying the domains important for the biological activities of PKDL proteins. Methods for generating such fragments are well known in the art (see, for example, Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1998) using the nucleotide sequences provided herein.
  • a PKDL protein fragment may be generated by PCR amplifying the desired fragment using oligonucleotide primers designed based upon the PKDL nucleic acid sequences.
  • the oligonucleotide primers include unique restriction enzyme sites that facilitate insertion of the fragment into the cloning site of a mammalian expression vector. This vector may then be introduced into a mammalian cell by artifice by the various techniques known in the art and described herein, resulting in the production of a PKDL gene fragment.
  • PKDL polypeptide fragments will be useful in evaluating the portions of the protein involved in important biological activities, such as protein-protein interactions and pore formation. These fragments may be used alone, or as chimeric fusion proteins. PKDL polypeptide fragments may also be used to raise antibodies specific for various regions of PKDL. Preferred PKDL fragments include, without limitation, PKDL N-terminal amino acids 1-100 (SEQ ID NO: 8), C-terminal amino acids 681-805 (SEQ ID NO: 9), and fragments thereof. In addition, any other portion of the PKDL amino acid sequence may be used to generate antibodies, for example, the SI, Sl/2, S2, S3, S4, S5, S6, pore region, and polycystin motifs shown in Fig. 3.
  • PKDL proteins, fragments of PKDL proteins, or fusion proteins containing defined portions of PKDL proteins may be synthesized in bacteria by expression of corresponding DNA sequences in a suitable cloning vehicle. Fusion proteins are commonly used as a source of antigen for producing antibodies. Two widely used expression systems for E. coli are lacZ fusions using the pUR series of vectors and trpE fusions using the pATH vectors. The proteins can be purified, and then coupled to a carrier protein and mixed with Freund's adjuvant (to enhance stimulation of the antigenic response in an innoculated animal) and injected into rabbits or other laboratory animals. Alternatively, protein can be isolated from PKDL-expressing cultured cells.
  • the rabbits or other laboratory animals are then bled and the sera isolated.
  • the sera can be used directly or can be purified prior to use by various methods, including affinity chromatography employing reagents such as Protein A-Sepharose, antigen- Sepharose, and anti-mouse-Ig-Sepharose.
  • affinity chromatography employing reagents such as Protein A-Sepharose, antigen- Sepharose, and anti-mouse-Ig-Sepharose.
  • the sera can then be used to probe protein extracts from PKDL-expressing tissue electrophoretically fractionated on a polyacrylamide gel to identify PKDL proteins.
  • synthetic peptides can be made that correspond to the antigenic portions of the protein and used to innoculate the animals.
  • a PKDL coding sequence may be expressed as a C-terminal fusion with glutathione S-transferase (GST; Smith et al. Gene 67:31-40, 1988).
  • GST glutathione S-transferase
  • the fusion protein may be purified on glutathione- Sepharose beads, eluted with glutathione, and cleaved with thrombin (at the engineered cleavage site), and purified to the degree required to successfully immunize rabbits.
  • Primary immunizations may be carried out with Freund's complete adjuvant and subsequent immunizations performed with Freund's incomplete adjuvant.
  • Antibody titers are monitored by Western blot and immunoprecipitation analyses using the thrombm-cleaved PKDL fragment of the GST-PKDL fusion protein. Immune sera are affinity purified using CNBr- Sepharose-coupled PKDL protein. Antiserum specificity may be determined using a panel of unrelated GST fusion proteins.
  • monoclonal PKDL antibodies may also be produced by using, as an antigen, PKDL protein isolated from PKDL-expressing cultured cells or PKDL protein isolated from tissues.
  • the cell extracts, or recombinant protein extracts containing PKDL protein may, for example, be injected with Freund's adjuvant into mice.
  • the mouse spleens are removed, the tissues are disaggregated, and the spleen cells are suspended in phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the spleen cells serve as a source of lymphocytes, some of which are producing antibody of the appropriate specificity.
  • tissue culture wells in the presence of a selective agent such as hypoxanthine, aminopterine, and thymidine (HAT).
  • a selective agent such as hypoxanthine, aminopterine, and thymidine (HAT).
  • HAT thymidine
  • the wells are then screened by ELISA to identify those containing cells making antibody capable of binding a PKDL protein or polypeptide fragment or mutant thereof.
  • these wells are then re-plated and after a period of growth, these wells are again screened to identify antibody-producing cells.
  • Several cloning procedures are carried out until over 90% of the wells contain single clones that are positive for antibody production. From this procedure a stable line of clones that produce the antibody is established.
  • the monoclonal antibody can then be purified by affinity chromatography using Protein A Sepharose, ion-exchange chromatography, as well as variations and combinations of these techniques.
  • Truncated versions of monoclonal antibodies may also be produced by recombinant methods in which plasmids are generated that express the desired monoclonal antibody fragment(s) in a suitable host.
  • peptides corresponding to relatively unique hydrophilic regions of PKDL may be generated and coupled to keyhole limpet hemocyanin (KLH) through an introduced C-terminal lysine.
  • KLH keyhole limpet hemocyanin
  • Antiserum to each of these peptides is similarly affinity-purified on peptides conjugated to BSA, and specificity is tested by ELISA and Western blotting using peptide conjugates, and by Western blotting and immunoprecipitation using PKDL, for example, expressed as a GST fusion protein.
  • monoclonal antibodies may be prepared using the PKDL proteins described above and standard hybridoma technology (see, e.g, Kohler et al. Nature 256:495, 1975; Kohler et al, Eur. J. Immunol. 6:511, 1976;
  • Monoclonal and polyclonal antibodies that specifically recognize a PKDL protein (or fragments thereof), such as those described herein, are considered useful in the invention.
  • Antibodies that inhibit the activity of a PKDL described herein may be especially useful in preventing or slowing the development of a disease caused by inappropriate expression of a wild type or mutant PKDL.
  • Antibodies of the invention may be produced using PKDL amino acid sequences that do not reside within highly conserved regions, and that appear likely to be antigenic, as analyzed by criteria such as those provided by the Peptide Structure Program (Genetics Computer Group Sequence Analysis Package, Program Manual for the GCG Package, Version 7, 1991) using the algorithm of Jameson and Wolf (CABIOS 4:181, 1988).
  • fragments can be generated by standard techniques, e.g, by the PCR, and cloned into the pGEX expression vector (Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1998).
  • GST fusion proteins are expressed in E. coli and purified using a glutathione-agarose affinity matrix as described in Ausubel et al, supra).
  • the invention features various genetically engineered antibodies, humanized antibodies, and antibody fragments, including F(ab')2, Fab', Fab, Fv, and sFv fragments.
  • Antibodies can be humanized by methods known in the art, e.g, monoclonal antibodies with a desired binding specificity can be commercially humanized (Scotgene, Scotland; Oxford Molecular, Palo Alto, CA). Fully human antibodies, such as those expressed in transgenic animals, are also features of the invention (Green et al. Nature Genetics 7:13-21, 1994).
  • Ladner (U.S. Patent 4,946,778 and 4,704,692) describes methods for preparing single polypeptide chain antibodies.
  • Ward et al. (Nature 341 :544- 546, 1989) describe the preparation of heavy chain variable domains, which they term "single domain antibodies," which have high antigen-binding affinities.
  • McCafferty et al. (Nature 348:552-554, 1990) show that complete antibody V domains can be displayed on the surface of fd bacteriophage, that the phage bind specifically to antigen, and that rare phage (one in a million) can be isolated after affinity chromatography.
  • Boss et al. (U.S.
  • Patent 4,816,397 describe various methods for producing immunoglobulins, and immunologically functional fragments thereof, which include at least the variable domains of the heavy and light chain in a single host cell.
  • Cabilly et al. U.S. Patent 4,816,567) describe methods for preparing chimeric antibodies.
  • Antibodies to PKDL proteins may be used, as noted above, to detect PKDL proteins or to inhibit the biological activities of PKDL proteins.
  • nucleic acid encoding an antibody or portion of an antibody may be expressed within a cell to inhibit PKDL function.
  • the antibodies may be coupled to compounds for diagnostic and/or therapeutic uses, such as radionuclides and liposomes carrying therapeutic compounds.
  • Antibodies that specifically recognize extracellular domains of PKDL are useful for targeting such attached moieties to cells displaying such PKDL polypeptide domains at their surfaces. Detection of PKDL gene expression
  • RNA in situ hybridization techniques rely upon the hybridization of a specifically labeled nucleic acid probe to the cellular RNA in individual cells or tissues. Therefore, RNA in situ hybridization is a powerful approach for studying tissue- and temporal-specific gene expression. In this method, oligonucleotides, cloned DNA fragments, or antisense RNA transcripts of such cloned DNA fragments corresponding to unique portions of PKDL genes are used to detect specific mRNA species, e.g, in the tissues of mice at various developmental stages. Other gene expression detection techniques are known to those of skill in the art and may be employed for detection of PKDL gene expression.
  • DNA hybridization may be used to clone PKDL homologues in other species and PKDL-related genes in humans.
  • PKDL-related genes and homologues may be readily identified using low-stringency DNA hybridization or low- stringency PCR with human PKDL probes or primers. Degenerate primers encoding human PKDL or human PKDL-related amino acid sequences may be used to clone additional PKDL-related genes and homologues by RT-PCR.
  • PKDL polypeptides and nucleic acid sequences find diagnostic use in the detection or monitoring of diseases and conditions involving mutations in PKDL genes or inappropriate expression of PKDL genes.
  • mutations in PKDL that decrease PKDL biological activity may be correlated with diseases in humans, for example, cystic diseases or neurological diseases. Accordingly, a decrease or increase in the level of PKDL production may provide an indication of a deleterious or potentially deleterious condition.
  • Levels of PKDL expression may be assayed by any standard technique. PKDL expression in a biological sample (e.g, a blood or tissue sample) may be monitored by standard Northern blot analysis or by quantitative PCR (see, e.g, Ausubel et al.
  • a biological sample obtained from a patient may be analyzed for one or more mutations in PKDL nucleic acid sequences using a mismatch detection approach.
  • these techniques involve PCR amplification of nucleic acid from the patient sample, followed by identification of the mutation (i.e., mismatch) by either altered hybridization, aberrant electrophoretic gel migration, binding or cleavage mediated by mismatch binding proteins, or direct nucleic acid sequencing.
  • Any of these techniques may be used to facilitate mutant PKDL detection, and each is well known in the art; examples of particular techniques are described, without limitation, in Orita et al. (Proc. Natl. Acad. Sci. USA 86:2766-2770, 1989) and Sheffield et al. (Proc. Natl. Acad. Sci. USA 86:232-236, 1989).
  • Mismatch detection assays also provide an opportunity to diagnose a PKDL-mediated predisposition to a disease before the onset of symptoms. For example, a patient heterozygous for a PKDL mutation that suppresses PKDL biological activity or expression may show no clinical symptoms and yet possess a higher than normal probability of developing a cystic disease. Given this diagnosis, a patient may take precautions to minimize their exposure to adverse environmental factors and to carefully monitor their medical condition (for example, through frequent physical examinations). This type of PKDL diagnostic approach may also be used to detect PKDL mutations in prenatal screens.
  • the PKDL diagnostic assays described above may be carried out using any biological sample (for example, a blood or tissue sample) in which PKDL is normally expressed. Identification of a mutant PKDL gene may also be assayed using these sources for test samples.
  • a PKDL mutation particularly as part of a diagnosis for predisposition to a PKDL-associated disease, may be tested using a DNA sample from any cell, for example, by mismatch detection techniques.
  • the DNA sample is subjected to PCR amplification prior to analysis.
  • immunoassays are used to detect or monitor PKDL protein expression in a biological sample.
  • PKDL-specific polyclonal or monoclonal antibodies produced as described above may be used in any standard immunoassay format (e.g, ELISA, Western blot, or RIA) to measure PKDL polypeptide levels. These levels would be compared to wild-type PKDL levels. For example, a decrease in PKDL production may indicate a condition or a predisposition to a condition involving insufficient PKDL biological activity, such as a cystic disease. Examples of immunoassays are described, e.g, in Ausubel et al.
  • Immunohistochemical techniques may also be utilized for PKDL detection.
  • a tissue sample may be obtained from a patient, sectioned, and stained for the presence of PKDL using an anti- PKDL antibody and any standard detection system (e.g, one which includes a secondary antibody conjugated to horseradish peroxidase).
  • any standard detection system e.g, one which includes a secondary antibody conjugated to horseradish peroxidase.
  • a combined diagnostic method may be employed that includes an evaluation of PKDL protein production (for example, by immunological techniques or the protein truncation test (Hogerrorst et al. Nature Genetics 10:208-212, 1995)) and also includes a nucleic acid-based detection technique designed to identify more subtle PKDL mutations (for example, point mutations). As described above, a number of mismatch detection assays are available to those skilled in the art, and any preferred technique may be used. Mutations in PKDL may be detected that either result in loss of PKDL expression or loss of normal PKDL biological activity.
  • Therapies may be designed to circumvent or overcome a PKDL gene defect or inadequate or excessive PKDL gene expression, and thus modulate and possibly alleviate conditions involving defects in PKDL gene regulation or protein function.
  • therapies are preferably targeted to the affected or potentially affected organs.
  • Reagents that modulate PKDL biological activity may include, without limitation, full length PKDL polypeptides, or fragments thereof, PKDL mRNA or antisense RNA, or any compound which modulates PKDL biological activity, expression, or stability.
  • Treatment or prevention of diseases resulting from a mutated PKDL gene may be accomplished by replacing a mutant PKDL gene with a normal PKDL gene, by modulating the function the mutant protein, by delivering normal PKDL protein to the appropriate cells, or by altering the levels of normal or mutant protein. It is also be possible to modify the pathophysiologic pathway (e.g, a signal transduction pathway) in which the protein participates in order to correct the physiological defect.
  • pathophysiologic pathway e.g, a signal transduction pathway
  • PKDL protein-specific kinase
  • Delivery of the protein to the affected tissue can then be accomplished using appropriate packaging or administration systems.
  • small molecule analogs that act as PKDL agonists or antagonists maybe administered to produce a desired physiological effect.
  • Gene therapy is another therapeutic approach for preventing or ameliorating diseases caused by PKDL gene defects.
  • Nucleic acid encoding wild type PKDL may be delivered to cells that lack sufficient PKDL biological activity (e.g, cells carrying mutations in one or both PGDL genes). The nucleic acid must be delivered to those cells in a form in which it can be taken up and direct expression of sufficient protein to provide effective function.
  • PKDL mutations it may be possible slow the resulting disease and/or modulate PKDL activity by introducing another copy of the homologous gene bearing a second mutation in that gene or to alter the mutation, or to use another gene to block any negative effect.
  • Transducing retroviral, lentiviral, and human immunodeficiency viral (HIV) vectors can be used for somatic cell gene therapy especially because of their high efficiency of infection and stable integration and expression; see, e.g., Cayouette, M, and Gravel, C, (1997) Hum. Gene Therapy, 8:423-430; Kido, M, et al. (1996) Curr. Eye Res., 15:833-844; Bloomer, U, et al. (1997) J. Virol., 71 :6641-6649; Naldini, L, et al. (1996) Science 272:263-267; and Miyoshi, H, et al. (1997), Proc. Nat. Acad.
  • the full length PKDL gene, or portions thereof, can be cloned into a retroviral vector and driven from its endogenous promoter or from the retroviral long terminal repeat or from a promoter specific for the target cell type of interest (such as neurons).
  • Other viral vectors which can be used include adenovirus, adeno-associated virus, vaccinia virus, bovine papilloma virus, or a he ⁇ es virus such as Epstein-Barr Virus.
  • Gene transfer may also be achieved using non- viral means requiring infection in vitro. This would include calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes may also be potentially beneficial for delivery of DNA into a cell.
  • Transplantation of normal genes into the affected tissues of a patient may also be accomplished by transferring a normal PKDL gene into a cultivatable cell type ex vivo, after which the cells are injected into the targeted tissue(s).
  • Retroviral vectors, adenoviral vectors, adenovirus-associated viral vectors, or other viral vectors with the appropriate tropism for cells likely to be involved in PKDL-related diseases may be used as a gene transfer delivery system for a therapeutic PKDL gene construct.
  • Numerous vectors useful for this pu ⁇ ose are generally known (see, for example, Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis and Anderson, BioTechniques 6:608-614, 1988; Tolstoshev and Anderson, Curr. Opin. Biotech. 1 :55-61, 1990; Sha ⁇ , The Lancet 337: 1277-1278, 1991 ; Cornetta et al, Nucl. Acid Res.
  • Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al, N. Engl. J. Med 323: 370, 1990; Anderson et al, U.S. Patent No. 5,399,346).
  • Non- viral approaches may also be employed for the introduction of therapeutic DNA into cells predicted to be subject to diseases involving PKDL.
  • a PKDL nucleic acid or antisense nucleic acid may be introduced into a cell by lipofection (Feigner et al, Proc. Natl. Acad. Sci. USA 84: 7413, 1987; Ono et al, Neurosci. Lett. 117: 259, 1990; Brigham et al. Am. J. Med. Sci. 298:278, 1989; Staubinger et al, Meth. Enz. 101 :512, 1983), asialoorosomucoid-polylysine conjugation (Wu et al, J. Biol. Chem. 263: 14621, 1988; Wu et al, J. Biol. Chem. 264:16985, 1989), or, less preferably, micro-injection under surgical conditions (Wolff et al. Science 247:1465, 1990).
  • PKDL cDNA expression can be directed from any suitable promoter (e.g, the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element.
  • CMV human cytomegalovirus
  • SV40 simian virus 40
  • metallothionein promoters e.g., IL-12, IL-12, IL-12, IL-12, or metallothionein promoters
  • enhancers known to preferentially direct gene expression in specific cell types may be used to direct PKDL expression.
  • the enhancers used could include, without limitation, those that are characterized as tissue- or cell-specific enhancers.
  • a PKDL genomic clone is used as a therapeutic construct (such clones may be identified by hybridization with the PKDL cDNA described above), regulation may be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above.
  • Antisense-based strategies may be employed to explore PKDL gene function and as a basis for therapeutic drug design. The principle is based on the hypothesis that sequence-specific suppression of gene expression (via transcription or translation) may be achieved by intracellular hybridization between genomic DNA or mRNA and a complementary antisense species.
  • Antisense strategies may be delivered by a variety of approaches.
  • antisense oligonucleotides or antisense RNA may be directly administered (e.g, by intravenous injection) to a subject in a form that allows uptake into cells.
  • viral or plasmid vectors that encode antisense RNA (or RNA fragments) may be introduced into a cell in vivo or ex vivo.
  • Antisense effects can be induced by control (sense) sequences; however, the extent of phenotypic changes are highly variable. Phenotypic effects induced by antisense effects are based on changes in criteria such as protein levels, protein activity measurement, and target mRNA levels.
  • PKDL gene therapy may also be accomplished by direct administration of antisense PKDL mRNA to a cell that is expected to be adversely affected by the expression of wild-type or mutant PKDL.
  • the antisense PKDL mRNA may be produced and isolated by any standard technique, but is most readily produced by in vitro transcription using an antisense PKDL cDNA under the control of a high efficiency promoter (e.g, the T7 promoter).
  • Administration of antisense PKDL mRNA to cells can be carried out by any of the methods for direct nucleic acid administration described above.
  • An alternative strategy for inhibiting PKDL function using gene therapy involves intracellular expression of an anti-PKDL antibody or a portion of an anti-PKDL antibody.
  • the gene (or gene fragment) encoding a monoclonal antibody that specifically binds to PKDL and inhibits its biological activity may be placed under the transcriptional control of a tissue-specific gene regulatory sequence.
  • Another therapeutic approach within the invention involves administration of recombinant PKDL polypeptide, either directly to the site of a potential or actual disease-affected tissue (for example, by injection) or systemically (for example, by any conventional recombinant protein administration technique).
  • the dosage of PKDL depends on a number of factors, including the size and health of the individual patient, but, generally, between 0.1 mg and 100 mg inclusive are administered per day to an adult in any pharmaceutically acceptable formulation.
  • any of the above therapies may be administered before the occurrence of the disease phenotype.
  • compounds shown to modulate PKDL expression or PKDL biological activity may be administered to patients diagnosed with potential or actual diseases by any standard dosage and route of administration (see above).
  • gene therapy using an antisense PKDL mRNA expression construct may be undertaken to reverse or prevent the gene defect prior to the development of the disease.
  • the methods of the instant invention may be used to diagnose or treat the disorders described herein in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is treated or diagnosed, the PKDL polypeptide, nucleic acid, or antibody employed is preferably specific for that species. As ays for compounds that modulate PKDL biological activity
  • polycystin-L functions as a Ca 2+ -regulated cation channel.
  • compounds that modulate PKDL biological activity may be identified using any of the methods, described herein (or any analogous method known in the art), for measuring the Ca + -regulated cation channel activity of a PKDL polypeptide.
  • the Xenopus expression system described above may be used to determine whether the addition of a test compound increases or decreases the Ca 2+ -regulated cation channel activity of any (wild-type or mutant) PKDL polypeptide.
  • PKDL polypeptide might be useful for treating a PKDL-related disease, such as a cystic disease or a neurological disease.
  • a compound that increases the level of a mutant PKDL polypeptide with relatively low cation channel activity per unit molecule may be used to increase the overall biological activity of PKDL.
  • Levels of PKDL polypeptide may be modulated by modulating transcription, translation, or mRNA or protein turnover; such modulation may be detected using known methods for measuring mRNA and protein levels, e.g, RT-PCR and ELISA.
  • compounds that decrease the cation channel activity or level of a PKDL polypeptide may be readily identified using methods described herein or known in the art.
  • novel drugs for modulation of PKDL biological activity may be identified from large libraries of natural products or synthetic (or semi- synthetic) extracts or chemical libraries according to methods known in the art.
  • test extracts or compounds are not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds.
  • Synthetic compound libraries are commercially available, e.g, from Brandon Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, WI).
  • libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, FL), and PharmaMar, U.S.A. (Cambridge, MA).
  • PKDL biological activity When a crude extract is found to modulate (i.e., stimulate or inhibit) PKDL biological activity, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect.
  • the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having an activity that stimulates or inhibits PKDL biological activity.
  • the same assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogenous extracts are known in the art.
  • compounds shown to be useful agents for treatment are chemically modified according to methods known in the art. Compounds identified as being of therapeutic value may be subsequently analyzed using animal models for diseases in which it is desirable to increase or decrease PKDL biological activity.
  • PKDL polypeptides PKDL genes, or modulators of PKDL synthesis or function
  • a PKDL protein, gene, or modulator of PKDL may be administered within a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form.
  • Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer neutralizing PKDL antibodies or PKDL-inhibiting compounds (e.g, antisense PKDL or a PKDL dominant negative mutant) to patients suffering from a PKDL-related disease, such as a cystic disease or a neurological disease. Administration may begin before the patient is symptomatic.
  • administration may be parenteral, intravenous, intra- arterial, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol, by suppositories, or oral administration.
  • Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
  • Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
  • Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds.
  • PKDL modulatory compounds include ethylene- vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
  • Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
  • Characterization of PKDL genes provides information that allows PKDL knockout animal models to be developed by homologous recombination.
  • a PKDL knockout animal is a mammal, most preferably a mouse.
  • animal models of PKDL ove ⁇ roduction may be generated by integrating one or more PKDL sequences into the genome, according to standard transgenic techniques.
  • the effect of PKDL gene mutations e.g., dominant gene mutations
  • a replacement-type targeting vector which would be used to create a knockout model, can be constructed using an isogenic genomic clone, for example, from a mouse strain such as 129/Sv (Stratagene Inc, LaJolla, CA).
  • the targeting vector may be introduced into a suitably-derived line of embryonic stem (ES) cells by electroporation to generate ES cell lines that carry a profoundly truncated form of a PKDL gene.
  • ES embryonic stem
  • the targeted cell lines are injected into a mouse blastula-stage embryo. Heterozygous offspring may be interbred to homozygosity.
  • PKDL knockout mice provide a tool for studying the role of PKDL in embryonic development and in disease. Moreover, such mice provide the means, in vivo, for testing therapeutic compounds for amelioration of diseases or conditions involving a PKDL-dependent or PKDL-affected pathway.

Abstract

La présente invention concerne un nouveau gène, dit PKDL, et la protéine pour laquelle il code, à savoir la polycystine-L, nouveau membre de la famille des polycystines. Dans le cadre de cette invention, les fonctions de la polycystine-L sont représentées sous la forme d'un canal cationique à régulation calcium. L'invention concerne des acides nucléiques et des sondes PKDL, des polypeptides de la polycystine L et des anticorps de l'antipolycystine-L, des kits de détection des acides nucléiques PKDL et les protéines pour lesquelles ils codent, ainsi que des méthodes diagnostiques et thérapeutiques pour maladies et états pathologiques en rapport avec les acides nucléiques PKDL.
PCT/US1999/019962 1998-09-01 1999-08-31 Acides nucleiques et polypeptides pkdl; methodes diagnostiques et therapeutiques WO2000012046A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU57974/99A AU5797499A (en) 1998-09-01 1999-08-31 Pkdl nucleic acids, polypeptides, and diagnostic and therapeutic methods

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US9878598P 1998-09-01 1998-09-01
US60/098,785 1998-09-01

Publications (2)

Publication Number Publication Date
WO2000012046A2 true WO2000012046A2 (fr) 2000-03-09
WO2000012046A3 WO2000012046A3 (fr) 2000-06-22

Family

ID=22270882

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/019962 WO2000012046A2 (fr) 1998-09-01 1999-08-31 Acides nucleiques et polypeptides pkdl; methodes diagnostiques et therapeutiques

Country Status (2)

Country Link
AU (1) AU5797499A (fr)
WO (1) WO2000012046A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112195238A (zh) * 2020-11-18 2021-01-08 上海韦翰斯生物医药科技有限公司 一种扩增pkd1基因的引物组及试剂盒

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997044457A1 (fr) * 1996-05-24 1997-11-27 Genzyme Corporation Gene de la polykystose renale

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997044457A1 (fr) * 1996-05-24 1997-11-27 Genzyme Corporation Gene de la polykystose renale

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
AL-AWQATI Q.: 'Puzzling Polycystin' MOLECULAR MEDICINE vol. 2, no. 6, November 1996, pages 663 - 664, XP002927544 *
DATABASE GENEMBL ON EST ACCESSION NO. AF094827, 21 January 1999 WU ET AL.: 'Identification of PKD2L, a human PKD2-related gene: tissue-specific expression and mapping to chromosome 10q25' & GENOMICS vol. 54, no. 3, 1998, pages 564 - 568 *
Database GenEmbl on EST, Acc. No. AF092170, TSIOKAS et al., "Interactions of the gene products of PKD1 and PKD2 with the TRP channels", Gene sequence, direct submission, 28 February 1999. *
DATABASE SPTREMBL ON EST ACCESSION NO. 075972, 01 May 1999 WU ET AL.: 'Identification of PKD2L, a human PKD2-related gene: Tissue-specific expression and mapping to chromosome 10q25' & GENOMICS 1998, *
Database SPTREMBL on EST, Acc. No. 095814, TSIOKAS et al., "Interactions of the gene products of PKD1 and PKD2 with the TRP channels", Gene Sequence, direct submission, 01 May 1999. *
PALSSON R. ET AL.: 'Characterization and Cell Distribution of Polycystin, the Product of Autosomal Dominant Polycystic Kidney Disease Gene 1' MOLECULAR MEDICINE vol. 2, no. 6, November 1996, pages 702 - 711, XP002927543 *
SCHNEIDER M.C. ET AL.: 'A Gene Similar to PKD1 Maps to Chromosome 4q22: A Candidate Gene for PKD2' GENOMICS vol. 38, no. 1-4, 1996, pages 1 - 4, XP002927541 *
WU G. ET AL.: 'Identification of PKD2L, a Human PKD2-Related Gene: Tissue-Specific Expression and Mapping to Chromosome 10q25' GENOMICS vol. 54, 1998, pages 564 - 568, XP002927542 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112195238A (zh) * 2020-11-18 2021-01-08 上海韦翰斯生物医药科技有限公司 一种扩增pkd1基因的引物组及试剂盒

Also Published As

Publication number Publication date
AU5797499A (en) 2000-03-21
WO2000012046A3 (fr) 2000-06-22

Similar Documents

Publication Publication Date Title
US9475868B2 (en) Antibodies that specifically bind to DRG11-responsive (DRAGON) proteins
KR20010085315A (ko) 부정맥과 관련된 인간 ｍｉｎＫ 유전자 돌연변이
JP2002521065A (ja) Ｈｅｒｇ−長期ｑｔ症候群遺伝子中の突然変異およびそのゲノム構造
JP3449419B2 (ja) ＫＶＬＱＴ１をコードするＱＴ延長症候群遺伝子およびそのｍｉｎＫとの関連
WO1998007849A1 (fr) Gene suppresseur de tumeur madr2
US7339029B2 (en) Sperm-specific cation channel, CatSper2, and uses therefor
US8729248B2 (en) Sperm-specific cation channel, CATSPER2, and uses therefor
AU2002242116A1 (en) Methods for diagnosing and treating heart disease
WO2002062205A2 (fr) Methodes de diagnostic et de traitement des cardiopathies
US7611892B2 (en) Prostate-specific or testis-specific nucleic acid molecules, polypeptides, and diagnostic and therapeutic methods
JP2002521045A (ja) Ｋｖｌｑｔ１−ｑｔ延長症候群
WO2000012046A2 (fr) Acides nucleiques et polypeptides pkdl; methodes diagnostiques et therapeutiques
JP2004526435A (ja) 心疾患の診断および治療の方法
KR100508845B1 (ko) KVLQT1을 코딩하는 장기 QT증후군 유전자 및 KVLQT1과 minK의 결합체
AU2006200418B2 (en) Gridlock nucleic acid molecules, polypeptides, and diagnostic and therapeutic methods
US6558932B1 (en) Gridlock nucleic acid molecules, polypeptides, and diagnostic and therapeutic methods
KR19990076620A (ko) Kvlqt1을 코딩하는 장기 qt 증후군 유전자 및kvlqt1과 mink의 결합체
AU2002330177A1 (en) Methods for diagnosing and treating diseases and conditions of the heart or digestive system, and cancer
WO2003028537A2 (fr) Methodes de diagnostic et de traitement de maladies et d'etats pathologiques touchant le coeur ou le systeme digestif, ainsi que du cancer
CA2357987A1 (fr) Sequence genetique liee a des maladies osseuses
CA2437185A1 (fr) Proteine associee a timm8b

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase