WO2000009688A1

WO2000009688A1 - Novel gene and protein osbh encoded thereby

Info

Publication number: WO2000009688A1
Application number: PCT/JP1999/004353
Authority: WO
Inventors: Osamu Ohara; Takahiro Nagase; Nobuo Nomura; Kiyoshi Takayama; Hitoshi Toyoda; Makoto Yoshimoto
Original assignee: Kazusa Dna Research Institute Foundation; Taisho Pharmaceutical Co., Ltd.
Priority date: 1998-08-12
Filing date: 1999-08-11
Publication date: 2000-02-24
Also published as: AU5196799A; JP2000050878A

Abstract

To provide a novel protein having an activity of binding to oxysterol. A gene osbh which encodes a novel protein OSBH having an activity of binding to oxysterol is obtained by cloning from a human brain-derived cDNA library. By culturing a transformant constructed by using an expression vector containing the above gene, OSBH can be obtained. This protein is usable as an OS-binding protein in drugs or for developing drugs.

Description

Specification

Novel genes and proteins encoded by them〇 S BH technical field

TECHNICAL FIELD The present invention relates to a novel thigh-derived protein OS BH having oxasterol binding activity, and a gene o s b encoding the protein. Background art

The main cause of myocardial infarction or cerebral infarction is blockage of blood vessels due to the formation of atherosclerotic lesions in the arterial wall. In the early stages of atherosclerosis, denatured LDL (low-density lipoprotein) plays an important role. In other words, when normal LDL infiltrates into the subendothelium of the blood vessels and becomes oxidized or saccharified to form denatured LDL, monocytes infiltrate from the bloodstream, differentiate into macrophages, phagocytose these denatured LDL, and accumulate lipids in their cells So-called foaming. This foaming of macrophages triggers the onset of arteriosclerosis.

Denaturation by oxidation Various oxidized lipids are contained in LDL. In particular, oxesterol (hereinafter referred to as OS), in which cholesterol is oxidized, has various physiological activities and affects the progress of arteriosclerosis. OS induces apoptosis in macrophage ゃ vascular smooth muscle cells and forms unstable sclerotic foci. In addition, it activates acetyl CoA: Cholesterol acyltransferase (ACAT) to promote intracellular cholesterol accumulation and inhibit the release of cholesterol outside the cell.

OS cannot be present in a free state in cells due to its high lipophilicity, and expresses its physiological activity by binding to a special protein. As a protein having this binding activity, an S-binding protein (OxySteroI Binding Protein, hereinafter referred to as OSBP) has been reported.

However, this OSBP is not involved in the expression of all physiological activities possessed by OS, and there are many unclear points about the detailed function expression mechanism of OS, including the presence of OS-binding proteins other than OSBP. Therefore, a new molecule that is different from OS BP and has the ability to bind to OS and is involved in the expression of various physiological activities of 〇S has been identified. Thus, it is presumed that such a biomolecule can be used directly as a drug or indirectly used for searching for a drug compound.

An object of the present invention is to identify such a molecule and use it for the development of a medicine or the like. Disclosure of the invention

The present inventors have conducted intensive studies to ascertain a desired protein from genes expressed in the whole human brain. As a result, the existence of the novel protein OSBH (OxySterol Binding protein Homolog) and the gene encoding The osbh was successfully isolated, and the present invention was completed.

That is, the present invention relates to (a) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or (b) an amino acid in which one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 1. The present invention relates to a protein consisting of a sequence and having an OS binding activity. Furthermore, the present invention relates to (c) a gene comprising the DNA of SEQ ID NO: 2, or (d) a protein that hybridizes with the DNA of SEQ ID NO: 2 under stringent conditions and has an OS binding activity. It concerns the gene consisting of the encoding DNA.

Osbh, a gene of the present invention, can be isolated from a human brain-derived cDNA library as a cDNA fragment containing the gene. The cDNA library used by the present inventors was prepared based on mRNA extracted from human brain commercially available from Clonetech.

In the above cDNA library, as a method for identifying cDNA encoding a protein having OS-binding activity, a long-chain cDNA library according to the method of Ohara et al. (DNA Research, Vol. 4, p53, 1997) was used. The analysis of the comprehensive cDNA library used was used. 25,000 recombinants were randomly selected from the human brain-derived long-chain cDNA library prepared by the method of Ohara et al., And the 5'-side and 3'-side of the cDNA portion of 15,000 clones were selected. Determine the nucleotide sequence of the SBP side, and use the DNA analysis programs (BLAST and Fast A) for the clones that are already reported from the 5'-side sequence of all clones. To find out I can do it.

The presence of the protein-coding region (ORF, open reading frame) in the nucleotide sequence can be confirmed by a general-purpose method of analyzing the nucleotide sequence using a computer program. The present inventors convinced that the gene of interest was present in the cDNA sequence, found one ORF in the sequence by using a combi- nation, and identified this gene as 0 sbh, Was named OS BH. The OS BH of the present invention is a protein consisting of a total of 468 amino acid residues and having a molecular weight of about 50 kilodaltons (kDa).

o sbh is a gene consisting of 1407 base pair residues shown in SEQ ID NO: 2. Using this o s bh, a recombinant gene can be prepared by a general gene recombination technique using an appropriate host vector system. Suitable vectors include E. coli-derived plasmids (eg, pBR322, pUC118, etc.), Bacillus subtilis-derived plasmids (eg, pUB110, pC194, etc.), yeast-derived plasmids (eg, For example, PSH19 and others), and animal viruses such as bacteriophage II retrovirus and vaccinia virus can be used. Upon recombination, a translation initiation codon and a translation termination codon can be added using an appropriate synthetic DNA adapter. In order to further express the gene, an appropriate expression promoter is connected upstream of the gene. The promoter to be used may be appropriately selected depending on the host. For example, when the host is Escherichia coli, the T7 promoter, 1 ac promoter, trp promoter, λPL promoter, etc., and when the host is Bacillus, S S promoter, etc. When the host is a yeast, a promoter such as ΡΗΟ5 promoter, GAP promoter, ADH promoter, etc. can be used. When the host is an animal cell, a promoter derived from SV40, retrovirus promoter, etc. can be used, respectively.

It is also possible to express the gene as a fusion protein with another protein (eg, Daryuthion S-transferase, protein A, etc.). The fused OS BH expressed in this way can be excised using an appropriate protease (eg, thrombin or the like).

宿主 Escherichia spp. Various strains of Escherichia coli, various strains of Bacillus bacillus Baci 1 lus subti1is, various strains of Saccharomyces cerevisiae as yeast, C〇S-7 cells and CHO cells as animal cells can be used.

As a method for transforming a host cell using the above-described recombinant vector, a conventional method or a transformation method generally used for each host cell can be applied.

In the present invention, in addition to the DNA sequence shown in SEQ ID NO: 2, a DNA that hybridizes with the DNA and encodes a protein having ΔS binding activity is also within the scope of the present invention.

That is, in the full-length sequence of 0 sbh, the DNA sequence is partially modified by various artificial treatments, for example, site-directed mutagenesis, random mutation by treatment with a mutagen, mutation of a DNA fragment by restriction enzyme digestion 'deletion' ligation, etc. SEQ ID NO: 2 even if these DNA mutants are DNAs that hybridize with osbh under stringent conditions and encode a protein having OS binding activity. Irrespective of the differences from the DNA sequence, it is within the scope of the present invention.

The extent of the above-mentioned DNA mutation is within an allowable range as long as it has 90% or more homology with the DNA sequence of 0 sbh. The degree of hybridization with osbh can be determined under normal conditions, for example, when the probe is labeled with a DIG DNA Labeling kit (Bellinger's Mannheim Cat No. 1175033) at 32 ° C. Hybridize in EasyHyb solution (Boehringer's Mannheim Cat No. 1603558) and wash membrane in 0.5 XSSC solution at 50 (including 0.1% [w / v] SDS) In the Southern hybridization under the conditions (1 XSSC is 0.15 M NaC and 0.015 M sodium citrate), it is sufficient to hybridize to osbh.

In addition, a protein encoded by a mutant gene having high homology to 0 sbh as described above and having OS binding activity is also included in the scope of the present invention. That is, even if a mutant has one or more amino acids in the amino acid sequence of OS BH deleted, replaced or added, as long as the mutant is a protein having OS binding activity, the mutant is It is within the scope of the present invention.

The side chains of amino acids that are the constituents of proteins have odors such as hydrophobicity, charge, and size. However, there are some highly conservative relationships in the sense that they do not substantially affect the three-dimensional structure (also called three-dimensional structure) of the whole protein. It is known by actual measurement. For example, for substitution of amino acid residues, glycine (G 1 y) and proline (Pro), G 1 y and alanine (A la) or valine (V a 1), leucine (L e υ) and isoleucine ( I 1 e), glumic acid (G1u) and glutamine (Gin), aspartic acid (Asp) and asparagine (Asn), cysteine (Cys) and threonine (Thr), Thr And serine (Ser) or A1a, lysine (Lys) and arginine (Arg), and the like.

Therefore, even if it is a mutant protein due to substitution, insertion, deletion, etc. on the amino acid sequence of OS BH shown in SEQ ID NO: 1, the mutation is a highly conserved mutation in the three-dimensional structure of OS BH, If the mutant protein has a similar OS-binding activity to OS BH, these can be said to be within the scope of the present invention. The degree of the variation is acceptable if the homology with the amino acid sequence shown in SEQ ID NO: 1 is 90% or more. Industrial applicability

Since OS BH has OS binding activity, it is speculated that abnormal expression of os bh or dysfunction of OS BH has a significant effect on the progression of atherosclerosis.

Therefore, by using 0 sbh or OSBH for the purpose of treating atherosclerosis, a substance having a function similar to the function of OSBH, a substance promoting or inhibiting the function, or a gene It is possible to efficiently search for and evaluate substances that promote or suppress the expression.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail with reference to Examples, but it is needless to say that the present invention is not limited to these Examples. Unless otherwise specified, the experimental procedures used in the following Examples were performed using various standard laboratory manuals represented by Molecular Cloning 2nd. Ed. (Cold Spring Harbor Lab. Press, 1989), and instructions for using commercially available kits. Description, and restriction enzymes etc. It can be performed under the recommended conditions for commercial products.

Example 1 Cloning of o s bh

1) Construction of long-chain cDNA library derived from human brain

Oligonucleotides with Not I site (GACTAGTTCTAGATCGCGAGCGGCCGCCC (T) 1 ₅₎ was synthesized using a DNA synthesizer (ABI380B). Using this as a primer, double-stranded cDNA was synthesized using Superscript II reverse transcriptase kit (Gibco BRL) using human brain-derived mRNA (Clontech) as a type II. This double-stranded cDNA was ligated with an adapter having a Sail site (Takara Shuzo), digested with Notl, and purified by low melting agarose electrophoresis at a 1% concentration to purify a cDNA fragment of 3 kb or more.

The purified cDNA fragment was ligated with pBluescript IISK + plasmid treated with Sail-Notl restriction enzyme. Recombinant plasmid was introduced into E. coli ElectroMax DH1 OB strain (Gibco BRL) by electroporation.

Next, 25,000 recombinants were randomly selected from the library, the recombinant DNA was extracted, and the nucleotide sequence at the 5 'and 3' sides of the cDNA portion of 15,000 clones was determined. did. For sequencing, a DNA sequencer (ABI PRISM377) manufactured by PE Applied Biosystems and a reaction kit manufactured by PE Applied Biosystems were used.

2) Selection of clone containing o s b h sequence

When the sequence on the 5 'side of all clones determined in 1) was compared with the previously reported osbp using DNA analysis programs (BLAST and Fast A), the clone name H K05119 showed significant homology. Indicated.

3) Determination of nucleotide sequence of DNA fragment

For nucleotide sequence determination, a DNA sequencer manufactured by PE Applied Biosystems was used, and the die primer method was used. Most of the sequences were shotgun, and some of the nucleotide sequences were synthesized oligonucleotides based on the determined nucleotide sequences, and the entire nucleotide sequences of both strands were determined by the primer walking method. SEQ ID NO: 3 shows the entire nucleotide sequence of cDNA of the clone.

The cDNA contains an ORF encoding a protein (OS BH) consisting of 468 residues (SEQ ID NO: 3). Above the methionine residue which is the initiation codon of the protein Since a stop codon appeared in the same reading frame in the basin, it was confirmed that the amino acid sequence of the protein encoded by the cDNA fragment was the only one shown in SEQ ID NO: 3.

FIG. 1 shows the amino acid homology between the previously reported OS BP and the OS BH of the present invention. Both show a high degree of homology, and it is presumed that, in particular, residues 162 to 172 of OS BH are important regions shared by proteins binding to OS. Example 2 Confirmation of protein expression by osbh in vitro translation method After treating the plasmid containing 0 sbh prepared in Example 1 with RNaseA, RNaseA was removed with ADVAMAX beads (AGTC). Te, in vi t ro Toransure using ⁽³⁵ S) TNT T7 in presence Mechionin co upled reticulocyte sate system (Promega) - was performed Deployment. A part of the reaction solution was separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by BAS-2000 (Fuji Photo). As a result, as shown in FIG. 2, a major band was confirmed at a position of about 50 kDa.

Example 3 Construction of Animal Cell Expression Vector

1) Amplification of cDNA containing ORF

An oligonucleotide having a sequence upstream of the initiation codon of the protein of SEQ ID NO: 3 (SEQ ID NO: 11); and an oligonucleotide having a part downstream of the termination codon of the protein and a reverse complementary strand and sequence thereof (described below). Sequence-1 2) was synthesized using a DNA synthesizer (380B manufactured by ABI).

Sequence 1 15 '-GGCAGTGGAGGCTGGCTGCTGAAGG-3' Sequence 1 25 '-TCTGCTGTGACGAGGCTCACAATGG-3'

Recombinant cDNA containing SEQ ID NO: 3 isolated in Example 1 was designated as type III, oligonucleotides of sequence 11 and oligonucleotide 12 were used as primers, and Takara LA PCR Kit Ver. 2 and PCR were used. The following PCR operation was performed using a Thermal Cycler MP (both from Takara Shuzo).

cDNA 5 lOng)

10X PCR buffer (including 25mM Mg ⁺⁺ ) 5 1

2.5mM dNTP \ ι \ 10 / M array 1 1 2 1

IO M array 1 2 2 \

Water 27.5 1

LA Taq Ho. Limera-Se '0.5 / 1

Total 50 111

In the PCR cycle, after holding at 94 ° C for 2 minutes, react at 98 ° C for 20 seconds, cool to 68 ° C at a rate of 1 l ° C / 2 seconds, hold at 68 ° C for 3 minutes, Further, the holding at 72 ° C. for 10 minutes was repeated 30 times.

According to the above method, a DNA fragment (about 1.5 kb) having a part of SEQ ID NO: 3 was amplified.

2) Subcloning into an expression vector for animal cells

The DNA fragment amplified in 1) was fractionated by 1% agarose gel electrophoresis. After the gel was stained with ethidium, it was irradiated with ultraviolet light to cut out the gel containing the target band. Extraction and purification of the DNA fragment from the agarose gel was performed using GENECLEA NII Kit (manufactured by Bio101).

The extracted and purified DNA fragment was subcloned into an animal cell expression vector pTARGET (promega). The ligation solution was reacted for 1.5 hours at 16 ° C with the following composition using Evening DNA Ligation Kit Ver.2 (Takara Shuzo).

Extracted and purified DNA fragment 11 (50 ng)

pTARGET \ n \ (10ng)

Water 3 1

Ligation solution 5 u 1

10 1

Using the solution after the above reaction, Escherichia coli K12 strain DH5 was transformed. Transformants were treated with ampicillin (Amp) 50 g / m 1, 5-Bromo-4- Chloro-3- indolyl-3 -D-galactoside (X— gal) 40 gZml, lsopropyl-j3-D-Thio-Galac topyranoside (IPTG) Plated on LB agar medium containing 100 M and cultured overnight at 37 ^.

Colonies that appeared on the above plate were cultured in LB liquid medium containing 50 ^ g / m1 Amp. After inoculating 10 ml of the culture medium and culturing overnight at 37 ° C, the cells were collected by centrifugation, and the recombinant DNA was purified using QIAprep Spin Plasmid Miniprep Kit (Qiagen) to obtain pTARGETosbh. .

3) Determination of nucleotide sequence of introduced cDNA

The nucleotide sequence was determined using DNA sequencing (PRISM377, manufactured by ABI), using the Daiyuichi Mineichiyuichi method and the primer-walking method to determine the entire nucleotide sequence of both strands. Since this clone contained all the regions flanked by SEQ ID NOS: 1 and 12 in the sequence of SEQ ID NO: 3, it was confirmed that the target gene pTARGETosbh was cloned.

Example 4 Introduction into CHOk 1 cells and acquisition of stable transformants

PTARGETosbh obtained in Example 2 has a CMV promoter upstream of the 0 sbh fragment, and can introduce OSBH by introducing the recombinant DNA into animal cells.

CHOk 1 cells were cultured in a plastic Petri dish having a diameter of 60 mm. The medium used was HamF-12 (manufactured by Gibco, hereafter referred to as growth medium) containing 10% fetal calf serum (Dainippon Pharmaceutical), 50 units of Zm1 penicillin, and 50 / xg of Zm1 streptomycin. C, and cultured in 5% C0 ₂ presence. When the cell density reached 50%, the LIPOFECTAMINE reagent (manufactured by Gibco) containing pTARGETosbh obtained in Example 12 was overlaid on the cells, cultured for 6 hours, and replaced with the growth medium for 48 hours. Cultured. After dispersing the cells with triscine, the cell suspension was dispensed into a 60 mm diameter plastic dish and cultured for another 24 hours. After removing the medium, the medium was replaced with a growth medium containing G418 reagent (manufactured by Gibco; final concentration 500 g / m 1). G418 reagent (The medium supplemented with B was exchanged every three days and the cells were cultured for 2 weeks. When the colonies of cells became visible with the naked eye, three colonies were isolated using a stainless steel cup. For use as a control, only the pTARGET vector (promega) was introduced into CHO k1 cells in the same manner as described above, and stable transformants were isolated.

Each isolated transformant was cultured in a G418-supplemented medium (final concentration 500 g / ml) in a 6-well plate, and when the cell density reached 80% confluence again, the medium was removed. After washing, add totalR from the cells using Trizol (manufactured by Gibco). NA was purified. CDNA was synthesized from 2 μg of the total RNA type using Superscript reverse transcriptase (manufactured by Gibco).

A PCR reaction was carried out using the synthesized cDNA as a type III and the same oligonucleotides (sequence 11 and sequence 12) as in Example 2-1).

cDNA 1 (lOOng)

10 X PCR buffer (including 25 mM Mg ⁺⁺ ) 5 i 1

2.5mM dNTP 8 z 1

10 / zM sequence 1 1 2 / x 1

IO M array 1 2 2 1

Water 27.5 1

LA Taa $ ° Limera-Se '0.5 ^ 1

50 1

In the PCR cycle, after holding at 94 ° C for 2 minutes, react at 98 ° C for 20 seconds, cool to 68 ° C at a rate of 1 second for 2 seconds, hold at 68 ° C for 3 minutes, The holding was repeated 30 times at 70 for 10 minutes.

The amplified DNA fragment was fractionated by 1% agarose gel electrophoresis, stained with ethidium gel, and then irradiated with ultraviolet light to check whether the target band was amplified.

As a result, the target band was amplified only in CHO k1 cells into which pTARGETosbh had been introduced, and no amplification could be confirmed in CHO k1 cells into which the control vector had been introduced.

Example 5 Osbh Introduction Oxistrol Binding Activity of CH〇k1

The 〇S binding activities of the CH〇k1 cells transfected with osbh prepared in Example 3 and the CHOk1 cells transfected with the control vector were compared. The cytoplasmic fractions of CHOk 1 cells into which 1 × 10 ⁶ osbh had been introduced and CHOk 1 cells into which the control vector 1 had been introduced were prepared, and the respective proteins were adsorbed to the membrane. After washing the membrane with a suitable buffer containing bovine serum albumin, was further reacted for 20 minutes with buffer containing ⁽³ H) radiolabeled 2 5 _ hydroxy cholesterol or 7- Ketokoresu Terol (Amersham). Membrane After washing, the incorporated radioactivity was measured. As a result, CH〇k1 into which 0 sbh was introduced was statistically significantly higher in 0S binding activity than control cells. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows a comparison of amino acid sequence homology between OSBP and ΔS BH of the present invention.

Fig. 2 shows 505-? Of OS 81 ^ expressed by in vitro translation method using o s b h. Here are the results for 80 £.

Claims

The scope of the claims

The following protein (a) or (b):

(a) a protein consisting of the amino acid sequence of SEQ ID NO: 1;

(b) a protein consisting of an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 1, and having an oxistrol binding activity;

DNA of (a) or (b) below

(a) DNA comprising the nucleotide sequence of SEQ ID NO: 2

(b) a DNA that hybridizes with the DNA of SEQ ID NO: 2 under stringent conditions and encodes a protein having an oxistrol binding activity.