WO2000008157A2 - Genes humains transporteurs d'anions atnov - Google Patents

Genes humains transporteurs d'anions atnov Download PDF

Info

Publication number
WO2000008157A2
WO2000008157A2 PCT/US1999/017823 US9917823W WO0008157A2 WO 2000008157 A2 WO2000008157 A2 WO 2000008157A2 US 9917823 W US9917823 W US 9917823W WO 0008157 A2 WO0008157 A2 WO 0008157A2
Authority
WO
WIPO (PCT)
Prior art keywords
atnov
protein
nucleic acid
sequence
expression
Prior art date
Application number
PCT/US1999/017823
Other languages
English (en)
Other versions
WO2000008157A3 (fr
Inventor
Boris Laubert
Gizela Cardoso
Ping Hu
Andrew P. Miller
Alan J. Buckler
Original Assignee
Axys Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Axys Pharmaceuticals, Inc. filed Critical Axys Pharmaceuticals, Inc.
Priority to AU53406/99A priority Critical patent/AU5340699A/en
Priority to EP99939045A priority patent/EP1141282A2/fr
Publication of WO2000008157A2 publication Critical patent/WO2000008157A2/fr
Publication of WO2000008157A3 publication Critical patent/WO2000008157A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • Endo- and xenobiotics are typically cleared from mammals via the liver, the primary site of drug metabolizing enzymes.
  • Charged compounds either endogenously or exogenously derived, are taken up by hepatocytes across the basolateral membrane, appropriately metabolized by the liver enzymes, trafficked through the cell, and then excreted across the canalicular membrane into the bile. These four steps are important in determining a patient's response to pharmaceutical agents.
  • bile flow is a regulated, ATP-dependent process and depends on the coordinated action of a number of transporter proteins in the sinusoidal and canalicular domains of the hepatocyte. Dysfunction of any of these proteins leads to retention of substrates, with conjugated hyperbilirubinemia or cholestasis as a result.
  • transport proteins involved in bile formation have been identified, cloned, and functionally characterized.
  • the hepatocyte sinusoidal membrane contains transport proteins for the hepatic uptake of organic anions and cations and for the uptake of bile acids.
  • the Na+-independent organic anion transporter, OATP resides on the basolateral surface of hepatocytes and mediates the uptake of a large number of amphipathic substrates, such as bromosulfophaiein, bile acids, estrogen conjugates, neutral steroids, organic cations, cardiac glycosides, and peptidomimetic drugs.
  • the human organic anion transporter, OATP is expressed in multiple tissues, including brain, lung, liver, kidney, and testes, while a rat homolog of OATP is expressed only in liver and kidney (Bergwerk et al. (1996) Am. J. Phvsiol. 271: G231-G238).
  • a prostaglandin transporter, hPGT which shares significant homology with these organic anion transporters, is abundantly expressed (Lu et al. (1996) J. CIin. Invest. 98: 1142-1149).
  • Variations in transporter sequences may alter the kinetic properties of the protein. For example, inefficient clearance of substrates would result in an increased biological half- life, where drugs have an increased half-life and drug levels approach or reach toxic thresholds. Alternatively, over-efficient clearance of substrates could reduce the biological effectiveness of a drug.
  • the identification of novel genes within these pathways provides additional targets for pharmacogenetic analysis, as well as a more thorough understanding of the biological process of drug clearance.
  • ATnov3 Public EST sequences having sequence similarity with ATnov nucleic acids include: Genbank accessions nos. N49902 (ATnov2); N50005 (ATnov2); H62927 (ATnov3); H62893 (ATnov3); R29414 (ATnov3); AA382692 (ATnov3); T73863 (ATnov3); T74263 (ATnov3); T55488 (ATnov3).
  • ATnov nucleic acid compositions find use in identifying homologous or related genes; in producing compositions that modulate the expression or function of its encoded proteins; for gene therapy; mapping functional regions of the proteins; and in studying associated physiological pathways.
  • modulation of the gene activity in vivo is used for prophylactic and therapeutic purposes, such as treatment of anion transporter defects, identification of cell type based on expression, and the like.
  • Nucleic acid compositions encoding ATnov anion transporters are provided. They are used in identifying homologous or related genes; in producing compositions that modulate the expression or function of the encoded proteins; for gene therapy; mapping functional regions of the proteins; and in studying associated physiological pathways.
  • the ATnov gene products are members of the anion transporter gene family, and have high degrees of homology at the amino acid level with known anion transporters. CHARACTERIZATION OF ATNOV
  • a substrate is a chemical entity that is transported by an ATnov polypeptide, usually under normal physiological conditions.
  • Substrates can be either endogenous substrates, i.e. substrates normally found within the natural environment, such as bile salts, or exogenous, i.e. substrates that are not normally found within the natural environment.
  • Substrate screening assays are used to determine the kinetics of a ATnov protein or peptide fragment on a substrate.
  • Suitable assays are known in the art, including the use of primary or cultured cells, genetically modified cells (e.g., where DNA encoding the ATnov polymorphism to be studied is introduced into the cell within an artificial construct), cell-free systems, e.g. recombinantly produced enzymes in a suitable buffer, or in animals, including human clinical trials (see, e.g. (1995) Burchell et al. Life Sci. 57:1819-1831 , specifically incorporated herein by reference).
  • genetically modified cells e.g., where DNA encoding the ATnov polymorphism to be studied is introduced into the cell within an artificial construct
  • cell-free systems e.g. recombinantly produced enzymes in a suitable buffer
  • animals including human clinical trials (see, e.g. (1995) Burchell et al. Life Sci. 57:1819-1831 , specifically incorporated herein by reference).
  • Full length ion transporter cDNAs may be combined with proper vectors to form expression constructs of each individual transporter.
  • Functional analyses of expressed transporters can be performed in heterologous systems, or by expression in mammalian cell lines.
  • heterologous systems such as Xenopus oocytes
  • synthetic mRNA is made through in vitro transcription of each transporter construct.
  • mRNA is then injected into prepared oocytes and the cells allowed to express the transporter for several days.
  • Candidate substrates may be labeled to provide a means of following movement across the membrane.
  • the requirements of a transporter for ATP, Na + , etc. may be assessed. For an example of these techniques, see Kullak-Ublick et al. (1997) Gastroenterology 113(4): 1295-1305.
  • Heterologous or mammalian cell lines expressing the novel transporters can be used to characterize small molecules and drugs that interact with the transporter. The same experiments can be used to assay for novel compounds that interact with the expressed transporters.
  • ATnov is generically used to refer to any one of the provided nucleotide sequences as set forth in the SEQLIST.
  • sequences, including polymorphisms, of ATnov3.1 and ATnov3.2 are provided as SEQ ID NO:3 (ATnov3.1), SEQ ID NO:5 (ATnov3.1), SEQ ID NO:7 (ATnov3.2) and SEQ ID NO:9 (ATnov3.2).
  • the encoded polypeptides are provided as SEQ ID NO:4, 6, 8 and 10, respectively.
  • the polymorphic variants are set forth in the sequences listings.
  • nucleotide 487 includes a G or A polymorphism at nucleotide 487, resulting in an amino acid change of asp to asn.
  • C or T at nucleotide 670, which is silent with respect to the encoded polypeptide.
  • a frameshift variant is found in the poly T stretch between positions 1705 and 1710, where the sequence contains either 5T or 6T.
  • the 5T polymorphism results in a truncated polypeptide product of 542 amino acids (SEQ ID NO:4 and SEQ ID NO:8), while the 6T polymorphism encodes the full-length protein of 591 amino acids.
  • ATnovl SEQ ID NO:1
  • SEQ ID NO:2 ATnov2
  • ATnov gene shall be intended to mean the open reading frame encoding any of the provided ATnov polypeptides, introns, as well as adjacent 5' and 3' non-coding nucleotide sequences involved in the regulation of expression, up to about 20 kb beyond the coding region, but possibly further in either direction.
  • the gene may be introduced into an appropriate vector for extrachromosomal maintenance or for integration into a host genome.
  • Novel nucleic acid compositions of the invention of particular interest comprise a sequence set forth in SEQ ID NO:1 , 2, 3, 5, 7, 9 or an identifying sequence thereof.
  • An "identifying sequence” is a contiguous sequence of residues at least about 10 nt to about 20 nt in length, usually at least about 50 nt to about 100 nt in length, that uniquely identifies a nucleic acid sequence, e.g., exhibits less than 90%, usually less than about 80% to about 85% sequence identity to any contiguous nucleotide sequence of more than about 20 nt.
  • the subject novel nucleic acid compositions include full length cDNAs or mRNAs that encompass an identifying sequence of contiguous nucleotides from SEQ ID NO:1 , 2, 3, 5, 7, 9.
  • nucleic acids of the invention also include nucleic acids having sequence similarity or sequence identity.
  • Nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50°C and 10XSSC (0.9 M NaCI/0.09 M sodium citrate) and remain bound when subjected to washing at 55°C in 1XSSC.
  • Sequence identity can be determined by hybridization under stringent conditions, for example, at 50°C or higher and 0.1XSSC (9 mM NaCI/0.9 mM sodium citrate). Hybridization methods and conditions are well known in the art, see U.S. Patent No. 5,707,829.
  • Nucleic acids that are substantially identical to the provided nucleic acid sequences e.g.
  • allelic variants, genetically altered versions of the gene, etc. bind to the provided nucleic acid sequences (SEQ ID NO:1 , 2, 3, 5, 7, 9) under stringent hybridization conditions.
  • probes, particularly labeled probes of DNA sequences one can isolate homologous or related genes.
  • the source of homologous genes can be any species.
  • hybridization is performed using at least 15 contiguous nucleotides of SEQ ID NO:1 , 2, 3, 5, 7, 9.
  • the probe will preferentially hybridize with a nucleic acid or mRNA comprising the complementary sequence, allowing the identification and retrieval of the nucleic acids of the biological material that uniquely hybridize to the selected probe.
  • Probes of more than 15 nucleotides can be used, e.g. probes of from about 18 nucleotides to not more than about 100 nucleotides, but 15 nucleotides generally represents sufficient sequence for unique identification.
  • nucleic acids of the invention also include naturally occurring variants of the nucleotide sequences, e.g. degenerate variants, allelic variants, etc.
  • Variants of the nucleic acids of the invention are identified by hybridization of putative variants with nucleotide sequences disclosed herein, preferably by hybridization under stringent conditions For example, by using appropriate wash conditions, variants of the nucleic acids of the invention can be identified where the allelic variant exhibits at most about 25-30% base pair mismatches relative to the selected nucleic acid probe.
  • allelic variants contain 5-25% base pair mismatches, and can contain as little as even 2-5%, or 1-2% base pair mismatches, as well as a single base-pair mismatch.
  • the invention also encompasses homologs corresponding to the nucleic acids of SEQ ID NO:1 , 2, 3, 5, 7, 9, where the source of homologous genes can be any related species within the same genus or group.
  • homologs have substantial sequence similarity, e.g. at least 75% sequence identity, usually at least 90%, more usually at least 95% between nucleotide sequences.
  • Sequence similarity is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc.
  • a reference sequence will usually be at least about 18 contiguous nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared. Algorithms for sequence analysis are known in the art, such as BLAST, described in Altschul et al., J. Mol. Biol. (1990) 215:403-10.
  • variants of the invention have a sequence identity greater than at least about 65%, preferably at least about 75%, more preferably at least about 85%, and can be greater than at least about 90% or more as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular).
  • a preferred method of calculating percent identity is the Smith- Waterman algorithm, using the following.
  • Global DNA sequence identity must be greater than 65% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.
  • ATnov polymorphic sequences It has been found that specific sites in the ATnov gene sequence are polymorphic, i.e. within a population, more than one nucleotide (G, A, T, C) is found at a specific position. Polymorphisms may provide functional differences in the genetic sequence, through changes in the encoded polypeptide, changes in mRNA stability, binding of transcriptional and translation factors to the DNA or RNA, and the like.
  • the polymorphisms are also used as single nucleotide polymorphisms to detect association with, or genetic linkage to phenotypic variation in activity and expression of ATnov.
  • SNPs are generally biallelic systems, that is, there are two alleles that an individual may have for any particular marker. SNPs, found approximately every kilobase, offer the potential for generating very high density genetic maps, which will be extremely useful for developing haplotyping systems for genes or regions of interest, and because of the nature of SNPs, they may in fact be the polymorphisms associated with the disease phenotypes under study. The low mutation rate of SNPs also makes them excellent markers for studying complex genetic traits.
  • Single nucleotide polymorphisms are provided in the ATnov3 sequence listing The provided sequences also encompass the complementary sequence corresponding to any of the provided polymorphisms.
  • sequences flanking the polymorphic site are included in a probe for the region. It will be understood that there is no special significance to the length of non- polymorphic flanking sequence that is included, except to aid in positioning the polymorphism in the genomic sequence.
  • hybridization probes of the polymorphic sequences may be used where both forms are present, either in separate reactions, spatially separated on a solid phase matrix, or labeled such that they can be distinguished from each other.
  • Assays may utilize nucleic acids that hybridize to one or more of the described polymorphisms.
  • An array may include all or a subset of the ATnov3 polymorphisms.
  • One or both polymorphic forms may be present in the array.
  • Such an array will include at least 2 different polymorphic sequences, i.e. polymorphisms located at unique positions within the locus, and may include as many all of the provided polymorphisms.
  • Arrays of interest may further comprise sequences, including polymorphisms, of other genetic sequences, particularly other sequences of interest for pharmacogenetic screening.
  • the oligonucleotide sequence on the array will usually be at least about 12 nt in length, may be the length of the provided polymorphic sequences, or may extend into the flanking regions to generate fragments of 100 to 200 nt in length.
  • the subject nucleic acids can be cDNAs or genomic DNAs, as well as fragments thereof, particularly fragments that encode a biologically active gene product and/or are useful in the methods disclosed herein.
  • cDNA as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons and 3' and 5' non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns, when present, being removed by nuclear RNA splicing, to create a continuous open reading frame encoding a polypeptide of the invention.
  • a genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It can further include the 3' and 5' untranslated regions found in the mature mRNA. It can further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc., including about 1 kb, but possibly more, of flanking genomic DNA at either the 5' and 3' end of the transcribed region.
  • the genomic DNA can be isolated as a fragment of 100 kbp or smaller; and substantially free of flanking chromosomal sequence.
  • the genomic DNA flanking the coding region, either 3' and 5', or internal regulatory sequences as sometimes found in introns, contains sequences required for expression.
  • nucleic acid compositions of the subject invention can encode all or a part of the subject polypeptides. Double or single stranded fragments can be obtained from the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc.
  • Isolated nucleic acids and nucleic acid fragments of the invention comprise at least about 15 up to about 100 contiguous nucleotides, or up to the complete sequence provided in SEQ ID NO:1 , 2, 3, 5, 7 or 9. For the most part, fragments will be of at least 15 nt, usually at least 18 nt or 25 nt, and up to at least about 50 contiguous nt in length or more.
  • Probes specific to the nucleic acids of the invention can be generated using the nucleic acid sequences disclosed in SEQ ID NO:1 , 2, 3, 5, 7 or 9 and the fragments as described above.
  • the probes can be synthesized chemically or can be generated from longer nucleic acids using restriction enzymes.
  • the probes can be labeled, for example, with a radioactive, biotinylated, or fluorescent tag.
  • probes are designed based upon an identifying sequence of a nucleic acid of one of SEQ ID NO:1 , 2, 3, 5, 7 or 9.
  • probes are designed based on a contiguous sequence of one of the subject nucleic acids that remain unmasked following application of a masking program for masking low complexity (e.g., XBLAST) to the sequence., i.e. one would select an unmasked region, as indicated by the nucleic acids outside the poly-n stretches of the masked sequence produced by the masking program.
  • a masking program for masking low complexity e.g., XBLAST
  • nucleic acids of the subject invention are isolated and obtained in substantial purity, generally as other than an intact chromosome.
  • the nucleic acids either as DNA or RNA, will be obtained substantially free of other naturally-occurring nucleic acid sequences, generally being at least about 50%, usually at least about 90% pure and are typically "recombinant", e.g., flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.
  • the nucleic acids of the invention can be provided as a linear molecule or within a circular molecule. They can be provided within autonomously replicating molecules (vectors) or within molecules without replication sequences. They can be regulated by their own or by other regulatory sequences, as is known in the art.
  • nucleic acids of the invention can be introduced into suitable host cells using a variety of techniques which are available in the art, such as transferrin polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome-mediated DNA transfer, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, gene gun, calcium phosphate-mediated transfection, and the like.
  • the subject nucleic acid compositions can be used to, for example, produce polypeptides, as probes for the detection of mRNA of the invention in biological samples (e.g., extracts of cells) to generate additional copies of the nucleic acids, to generate ribozymes or antisense oligonucleotides, and as single stranded DNA probes or as triple- strand forming oligonucleotides.
  • the probes described herein can be used to, for example, determine the presence or absence of the nucleic acid sequences as shown in SEQ ID NO:1 , 2, 3, 5, 7 or 9 or variants thereof in a sample.
  • the sequence of the 5' flanking region may be utilized for promoter elements, including enhancer binding sites, that provide for developmental regulation in tissues where ATnov genes are expressed.
  • tissue specific expression is useful for determining the pattern of expression, and for providing promoters that mimic the native pattern of expression.
  • Naturally occurring polymorphisms in the promoter regions are useful for determining natural variations in expression, particularly those that may be associated with disease.
  • mutations may be introduced into the promoter regions to determine the effect of altering expression in experimentally defined systems.
  • Methods for the identification of specific DNA motifs involved in the binding of transcriptional factors are known in the art, e.g. sequence similarity to known binding motifs, gel retardation studies, etc. For examples, see Blackwell et al. (1995) Mol Med 1 : 194-205; Mortlock et al. (1996) Genome Res. 6: 327-33; and Joulin and Richard-Foy (1995) Eur J Biochem 232: 620-626.
  • the regulatory sequences may be used to identify cis acting sequences required for transcriptional or translational regulation of ATnov expression, especially in different tissues or stages of development, and to identify cis acting sequences and trans acting factors that regulate or mediate ATnov expression.
  • Such transcription or translational control regions may be operably linked to a ATnov gene in order to promote expression of wild type or altered ATnov or other proteins of interest in cultured cells, or in embryonic, fetal or adult tissues, and for gene therapy.
  • Double or single stranded fragments may be obtained of the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc.
  • DNA fragments will be of at least 15 nt, usually at least 18 nt or 25 nt, and may be at least about 50 nt.
  • Such small DNA fragments are useful as primers for PCR, hybridization screening probes, etc.
  • a pair of primers will be used for use in amplification reactions, such as PCR.
  • the exact composition of the primer sequences is not critical to the invention, but for most applications the primers will hybridize to the subject sequence under stringent conditions, as known in the art. It is preferable to choose a pair of primers that will generate an amplification product of at least about 50 nt, preferably at least about 100 nt. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages. Amplification primers hybridize to complementary strands of DNA, and will prime towards each other.
  • the DNA may also be used to identify expression of the gene in a biological specimen.
  • DNA or mRNA is isolated from a cell sample.
  • the mRNA may be amplified by RT-PCR, using reverse transcriptase to form a complementary DNA strand, followed by polymerase chain reaction amplification using primers specific for the subject DNA sequences.
  • the mRNA sample is separated by gel electrophoresis, transferred to a suitable support, e.g. nitrocellulose, nylon, etc., and then probed with a fragment of the subject DNA as a probe.
  • oligonucleotide ligation assays such as in situ hybridizations, and hybridization to DNA probes arrayed on a solid chip may also find use. Detection of mRNA hybridizing to the subject sequence is indicative of ATnov gene expression in the sample.
  • the sequence of an ATnov gene including flanking promoter regions and coding regions, may be mutated in various ways known in the art to generate targeted changes in promoter strength, sequence of the encoded protein, etc.
  • the DNA sequence or protein product of such a mutation will usually be substantially similar to the sequences provided herein, i.e. will differ by at least one nucleotide or amino acid, respectively, and may differ by at least two but not more than about ten nucleotides or amino acids.
  • sequence changes may be substitutions, insertions or deletions.
  • Deletions may further include larger changes, such as deletions of a domain or exon.
  • Other modifications of interest include epitope tagging, e.g. with the FLAG system, HA, etc.
  • fusion proteins with green fluorescent proteins (GFP) may be used.
  • variant alleles may affect the pharmacokinetic parameters of substrates.
  • a drugDs volume of distribution, clearance, and the derived parameter, half-life, are particularly important, as they determine the degree of fluctuation between a maximum and minimum plasma concentration during a dosage interval, the magnitude of steady state concentration and the time to reach steady state plasma concentration upon chronic dosing.
  • Parameters derived from in vivo drug administration are useful in determining the clinical effect of a particular ATnov genotype.
  • the subject gene may be employed for producing all or portions of ATnov polypeptides. Fragments of interest include the glycosylation sites, transmembrane domains, ATP binding regions, the substrate binding sites, etc. Such domains will usually include at least about 20 amino acids of the provided sequence, more usually at least about
  • Binding contacts may be comprised of non-contiguous sequences, which are brought into proximity by the tertiary structure of the protein. The sequence of such fragments may be modified through manipulation of the coding sequence, as described above. Truncations may be performed at the carboxy or amino terminus of the fragment, e.g. to determine the minimum sequence required for biological activity.
  • a subset of the provided nucleic acid polymorphisms in ATnov3 confer a change in the corresponding amino acid sequence, as previously described.
  • the amino acid polymorphisms of the invention include asnDasp, pos. 130; and a frameshift at position 537 resulting in a truncated protein of 542 amino acids.
  • Polypeptides comprising at least one of the provided polymorphisms are of interest.
  • ATnov3 v polypeptides as used herein includes complete ATnov protein forms, e.g.
  • polypeptides will usually be at least about 8 amino acids in length, more usually at least about 12 amino acids in length, and may be 20 amino acids or longer, up to substantially the complete protein.
  • an expression cassette may be employed.
  • the expression vector will provide a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. These control regions may be native to an ATnov gene, or may be derived from exogenous sources.
  • the peptide may be expressed in prokaryotes or eukaryotes in accordance with conventional ways, depending upon the purpose for expression.
  • a unicellular organism such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism such as vertebrates, particularly mammals, e.g. COS 7 cells, may be used as the expression host cells.
  • Small peptides can also be synthesized in the laboratory.
  • Peptides that are subsets of the complete ATnov sequence may be used to identify and investigate parts of the protein important for function, or to raise antibodies directed against these regions.
  • the protein may be isolated and purified in accordance with conventional ways.
  • a lysate may be prepared of the expression host and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique.
  • the purified protein will generally be at least about 80% pure, preferably at least about 90% pure, and may be up to and including 100% pure. Pure is intended to mean free of other proteins, as well as cellular debris.
  • ATnov polypeptides are useful for the production of antibodies, where short fragments provide for antibodies specific for the particular polypeptide, and larger fragments or the entire protein allow for the production of antibodies over the surface of the polypeptide.
  • Antibodies may be raised to the wild-type or variant forms of ATnov.
  • Antibodies may be raised to isolated peptides corresponding to these domains, or to the native protein.
  • Antibodies are prepared in accordance with conventional ways, where the expressed polypeptide or protein is used as an immunogen, by itself or conjugated to known immunogenic carriers, e.g. KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the like. Various adjuvants may be employed, with a series of injections, as appropriate. For monoclonal antibodies, after one or more booster injections, the spleen is isolated, the lymphocytes immortalized by cell fusion, and then screened for high affinity antibody binding. The immortalized cells, i.e. hybridomas, producing the desired antibodies may then be expanded. For further description, see Monoclonal Antibodies: A Laboratory Manual.
  • the mRNA encoding the heavy and light chains may be isolated and mutagenized by cloning in E. coli, and the heavy and light chains mixed to further enhance the affinity of the antibody.
  • Alternatives to in vivo immunization as a method of raising antibodies include binding to phage "display" libraries, usually in conjunction with in vitro affinity maturation.
  • the subject nucleic acid and/or polypeptide compositions may be used in genotyping and to screen for the presence of polymorphisms in the sequence, or variation in the expression of the subject genes. Genotyping may be performed to determine whether a particular polymorphisms is associated with a disease state or genetic predisposition to a disease state, particularly diseases associated with liver disorders. Genotyping may also be performed for pharmacogenetic analysis to assess the association between an individual's genotype and that individual's ability to react to a therapeutic agent. Differences in substrate transport to relevant cells can lead to toxicity or therapeutic failure. Relationships between polymorphisms in transporter expression or specificity can be used to optimize therapeutic dose administration.
  • ATnov genotyping is performed by DNA or RNA sequence and/or hybridization analysis of any convenient sample from a patient, e.g. biopsy material, blood sample, scrapings from cheek, etc.
  • a nucleic acid sample from an individual is analyzed for the presence of polymorphisms in ATnov, particularly those that affect the activity, responsiveness or expression of ATnov.
  • Specific sequences of interest include any polymorphism that leads to changes in basal expression in one or more tissues, to changes in the modulation of ATnov expression, or alterations in ATnov specificity and/or activity.
  • the effect of a polymorphism in ATnov gene sequence on the response to a particular agent may be determined by in vitro or in vivo assays. Such assays may include monitoring during clinical trials, testing on genetically defined cell lines, etc. The response of an individual to the agent can then be predicted by determining the ATnov genotype with respect to the polymorphism. Where there is a differential distribution of a polymorphism by racial background, guidelines for drug administration can be generally tailored to a particular ethnic group. Biochemical studies may be performed to determine whether a sequence polymorphism in a ATnov coding region or control regions is associated with disease.
  • Disease associated polymorphisms may include deletion or truncation of the gene, mutations that alter expression level, that affect the specificity or transport kinetics of the transporter, etc.
  • a number of methods are available for analyzing nucleic acids for the presence of a specific sequence. Where large amounts of DNA are available, genomic DNA is used directly. Alternatively, the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis.
  • the nucleic acid may be amplified by conventional techniques, such as the polymerase chain reaction (PCR), to provide sufficient amounts for analysis.
  • PCR polymerase chain reaction
  • the use of the polymerase chain reaction is described in Saiki et al. (1985) Science 239:487, and a review of current techniques may be found in Sambrook et al.
  • Amplification may be used to determine whether a polymorphism is present, by using a primer that is specific for the polymorphism.
  • various methods are known in the art that utilize oligonucleotide ligation as a means of detecting polymorphisms, for examples see Delahunty et al. (1996) Am. J. Hum. Genet.58: 1239-1246.
  • a detectable label may be included in an amplification reaction.
  • Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2',7'-dimethoxy-4',5'- dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2',4',7',4,7- hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N',N'-tetramethyl-6- carboxyrhodamine (TAMRA), radioactive labels, e.g.
  • the label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label.
  • the label may be conjugated to one or both of the primers.
  • the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.
  • the sample nucleic acid e.g. amplified or cloned fragment, is analyzed by one of a number of methods known in the art.
  • the nucleic acid may be sequenced by dideoxy or other methods.
  • Hybridization with the variant sequence may also be used to determine its presence, by Southern blots, dot blots, etc.
  • the hybridization pattern of a control and variant sequence to an array of oligonucleotide probes immobilised on a solid support, as described in U.S. 5,445,934, or in WO95/35505, may also be used as a means of detecting the presence of variant sequences.
  • Single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), mismatch cleavage detection, and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility.
  • a polymorphism creates or destroys a recognition site for a restriction endonuclease (restriction fragment length polymorphism, RFLP)
  • the sample is digested with that endonuclease, and the products size fractionated to determine whether the fragment was digested. Fractionation is performed by gel or capillary electrophoresis, particularly acrylamide or agarose gels.
  • an array of oligonucleotides are provided, where discrete positions on the array are complementary to one or more of the provided polymorphic sequences, e.g. oligonucleotides of at least 12 nt, frequently 20 nt, or larger, and including the sequence flanking the polymorphic position.
  • Such an array may comprise a series of oligonucleotides, each of which can specifically hybridize to a different polymorphism.
  • arrays see Hacia et al. (1996) Nature Genetics 14:441-447; Lockhart et al. (1996) Nature Biotechnol. 14:1675-1680; and De Risi et al. (1996) Nature Genetics 14:457-460.
  • Screening for polymorphisms in ATnov may be based on the functional or antigenic characteristics of the protein. Protein truncation assays are useful in detecting deletions that may affect the biological activity of the protein.
  • Various immunoassays designed to detect polymorphisms in ATnov proteins may be used in screening. Where many diverse genetic mutations lead to a particular disease phenotype, functional protein assays have proven to be effective screening tools.
  • the activity of the encoded ATnov protein as a anion transporter may be determined by comparison with the wild-type protein.
  • Antibodies specific for a ATnov may be used in staining or in immunoassays.
  • Samples include biological fluids such as semen, blood, cerebrospinal fluid, tears, saliva, lymph, dialysis fluid and the like; organ or tissue culture derived fluids; and fluids extracted from physiological tissues. Also included in the term are derivatives and fractions of such fluids.
  • the cells may be dissociated, in the case of solid tissues, or tissue sections may be analyzed. Alternatively a lysate of the cells may be prepared.
  • Diagnosis may be performed by a number of methods to determine the absence or presence or altered amounts of normal or abnormal ATnov polypeptides in patient cells. For example, detection may utilize staining of cells or histological sections, performed in accordance with conventional methods.
  • the antibodies of interest are added to the cell sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes.
  • the antibody may be labeled with radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct detection.
  • a second stage antibody or reagent is used to amplify the signal. Such reagents are well known in the art.
  • the primary antibody may be conjugated to biotin, with horseradish peroxidase-conjugated avidin added as a second stage reagent.
  • the secondary antibody conjugated to a flourescent compound e.g. flourescein, rhodamine, Texas red, etc.
  • Final detection uses a substrate that undergoes a color change in the presence of the peroxidase.
  • the absence or presence of antibody binding may be determined by various methods, including flow cytometry of dissociated cells, microscopy, radiography, scintillation counting, etc. MODULATION OF GENE EXPRESSION
  • the ATnov genes, gene fragments, or the encoded protein or protein fragments are useful in gene therapy to treat disorders associated with ATnov defects.
  • Expression vectors may be used to introduce the ATnov gene into a cell. Such vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences.
  • Transcription cassettes may be prepared comprising a transcription initiation region, the target gene or fragment thereof, and a transcriptional termination region.
  • the transcription cassettes may be introduced into a variety of vectors, e.g. plasmid; retrovirus, e.g. lentivirus; adenovirus; and the like, where the vectors are able to transiently or stably be maintained in the cells, usually for a period of at least about one day, more usually for a period of at least about several days to several weeks.
  • the gene or ATnov protein may be introduced into tissues or host cells by any number of routes, including viral infection, microinjection, or fusion of vesicles. Jet injection may also be used for intramuscular administration, as described by Furth et al. (1992) Anal Biochem 205:365-368.
  • the DNA may be coated onto gold microparticles, and delivered intradermally by a particle bombardment device, or "gene gun” as described in the literature (see, for example, Tang et al. (1992) Nature 356:152-154), where gold microprojectiles are coated with the ATnov or DNA, then bombarded into skin cells.
  • Antisense molecules can be used to down-regulate expression of ATnov in cells.
  • the anti-sense reagent may be antisense oligonucleotides (ODN), particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such anti-sense molecules as RNA.
  • ODN antisense oligonucleotides
  • the antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products.
  • Antisense molecules inhibit gene expression through various mechanisms, e.g. by reducing the amount of mRNA available for translation, through activation of RNAse H, or steric hindrance.
  • One or a combination of antisense molecules may be administered, where a combination may comprise multiple different sequences.
  • Antisense molecules may be produced by expression of all or a part of the target gene sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule.
  • the antisense molecule is a synthetic oligonucleotide.
  • Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides in length, where the length is governed by efficiency of inhibition, specificity, including absence of cross-reactivity, and the like.
  • oligonucleotides of from 7 to 8 bases in length, can be strong and selective inhibitors of gene expression (see Wagner et al. (1996) Nature Biotechnology 14:840-844).
  • a specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence.
  • Selection of a specific sequence for the oligonucleotide may use an empirical method, where several candidate sequences are assayed for inhibition of expression of the target gene in an in vitro or animal model.
  • a combination of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation.
  • Antisense oligonucleotides may be chemically synthesized by methods known in the art (see Wagner et al. (1993) supra, and Milligan et al., supra.) Preferred oligonucleotides are chemically modified from the native phosphodiester structure, in order to increase their intracellular stability and binding affinity. A number of such modifications have been described in the literature, which alter the chemistry of the backbone, sugars or heterocyclic bases.
  • phosphorothioates Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates.
  • Achiral phosphate derivatives include 3a-OD-5D-S-phosphorothioate, 3D-S-5D-O-phosphorothioate, 3D-CH2- 5 ⁇ -O-phosphonate and 3D-NH-5D-O-phosphoroamidate.
  • Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage. Sugar modifications are also used to enhance stability and affinity.
  • the Q-anomer of deoxyribose may be used, where the base is inverted with respect to the natural D-anomer.
  • the 2D-OH of the ribose sugar may be altered to form 2D-O-tnethyl or 2D-O-allyl sugars, which provides resistance to degradation without comprising affinity. Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2D-deoxycytidine and 5-bromo-2D-deoxycytidine for deoxycytidine. 5- propynyl- 2D-deoxyuridine and 5-propynyl-2D-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.
  • catalytic nucleic acid compounds e.g. ribozymes, anti-sense conjugates, etc. may be used to inhibit gene expression.
  • Ribozymes may be synthesized in vitro and administered to the patient, or may be encoded on an expression vector, from which the ribozyme is synthesized in the targeted cell (for example, see International patent application WO 9523225, and Beigelman et al. (1995) Nucl. Acids Res 23:4434-42). Examples of oligonucleotides with catalytic activity are described in WO 9506764.
  • Conjugates of anti-sense ODN with a metal complex, e.g. terpyridylCu(ll), capable of mediating mRNA hydrolysis are described in Bashkin et al. (1995) Appl Biochem Biotechnol 54:43-56.
  • the subject nucleic acids can be used to generate transgenic animals or site specific gene modifications in cell lines.
  • Transgenic animals may be made through homologous recombination, where the normal ATnov locus is altered.
  • a nucleic acid construct is randomly integrated into the genome.
  • Vectors for stable integration include plasmids, retroviruses and other animal viruses, YACs, and the like.
  • modified cells or animals are useful in the study of ATnov function and regulation. For example, a series of small deletions and/or substitutions may be made in the
  • ATnov gene to determine the role of different transmembrane domains, of ATP catalysis, etc.
  • ATnov Tonov to construct transgenic animal models where expression of ATnov is specifically reduced or absent.
  • Specific constructs of interest include anti-sense
  • ATnov which will block ATnov expression, expression of dominant negative ATnov mutations, etc.
  • DNA constructs for homologous recombination will comprise at least a portion of the ATnov gene with the desired genetic modification, and will include regions of homology to the target locus.
  • DNA constructs for random integration need not include regions of homology to mediate recombination. Conveniently, markers for positive and negative selection are included.
  • Methods for generating cells having targeted gene modifications through homologous recombination are known in the art. For various techniques for transfecting mammalian cells, see Keown et al. (1990) Methods in Enzymology 185:527-537.
  • ES embryonic stem
  • an ES cell line may be employed, or embryonic cells may be obtained freshly from a host, e.g.
  • ES or embryonic cells When ES or embryonic cells have been transformed, they may be used to produce transgenic animals. After transformation, the cells are plated onto a feeder layer in an appropriate medium. Cells containing the construct may be detected by employing a selective medium. After sufficient time for colonies to grow, they are picked and analyzed for the occurrence of homologous recombination or integration of the construct. Those colonies that are positive may then be used for embryo manipulation and blastocyst injection. Blastocysts are obtained from 4 to 6 week old superovulated females.
  • LIF leukemia inhibiting factor
  • the ES cells are trypsinized, and the modified cells are injected into the blastocoel of the blastocyst. After injection, the blastocysts are returned to each uterine horn of pseudopregnant females. Females are then allowed to go to term and the resulting offspring screened for the construct.
  • chimeric progeny can be readily detected.
  • the chimeric animals are screened for the presence of the modified gene and males and females having the modification are mated to produce homozygous progeny. If the gene alterations cause lethality at some point in development, tissues or organs can be maintained as allogeneic or congenic grafts or transplants, or in in vitro culture.
  • the transgenic animals may be any non-human mammal, such as laboratory animals, domestic animals, etc. The transgenic animals may be used in functional studies, drug screening, etc.
  • Anion transporters such as ATnov polypeptides are involved in multiple biologically important processes. Pharmacological agents designed to affect only specific transporter subtypes are of particular interest.
  • the subject polypeptides may be used to test the specificity of novel compounds, and of analogs and derivatives of compounds known to be substrates, or to act on anion transporters.
  • Drug screening may be performed using an in vitro model, a genetically altered cell or animal, or purified ATnov protein. One can identify ligands or substrates that bind to, modulate or mimic the action of ATnov. Drug screening identifies agents that provide a replacement for ATnov function in abnormal cells. Of particular interest are screening assays for agents that have a low toxicity for human cells.
  • assays may be used for this purpose, including monitoring cellular excitation and conductance, labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, and the like.
  • the purified protein may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions.
  • agent as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of ATnov polypeptide.
  • agent e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of ATnov polypeptide.
  • a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations.
  • one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.
  • Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons.
  • Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
  • Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
  • the screening assay is a binding assay
  • the label can directly or indirectly provide a detectable signal.
  • Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like.
  • Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
  • the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
  • reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc. that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40°C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
  • the compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host in a variety of ways, orally, topically, parenterally e.g. subcutaneously, intraperitoneally, by viral infection, intravascularly, etc.
  • the compounds may be formulated in a variety of ways.
  • the concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt.%.
  • the pharmaceutical compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like.
  • compositions containing the therapeutically- active compounds can be used to make up compositions containing the therapeutically- active compounds.
  • Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.
  • Example 1 Three novel members of the OATP gene family, which are expressed in liver tissue, were cloned. These genes were isolated using trapped exons obtained from large-scale exon trapping of chromosome 12. The three anion transporters reported here are 70-80% identical to each other over the predicted protein sequence, and are each 40% identical to the reported OATP protein sequence (Kullack-Ublick et al., (1995) Gastroenterology 109:1274-1282). The chromosomal location of these three anion transporters, along with the mapping of OATP, suggests this gene-family is clustered on 12p12.
  • cDNA Isolation cDNA clones were isolated using the GeneTrapper system (Gibco- BRL). PCR primers within the trapped exons were used to detect which plasmid cDNA libraries contained the gene of interest. Oligonucleotide probes were designed: (SEQ ID NO:7) C12B_120: GGGGCTCTGATTGATACAACGTG ; (SEQ ID NO:8) C12C_151: ACTGTGGCACACGTGGGTCATGTAGGACAT) and the process proceeded according to the supplied protocol. cDNA clones were sequenced on an ABI 377 according to standard methods. The Primer Island Transposition kit was used according to the supplied protocol. Sequences were analyzed, edited, and assembled using the Sequencher software (Gene Codes).
  • RH mapping was achieved using the Stanford G3 panel DNAs (Research Genetics). DNA was aliquoted into 96-well trays, dried, and resuspended in PCR buffer prior to PCR amplification. 20 ⁇ l PCR reactions with standard conditions, 2.5 mM MgCI 2 , Taq Gold, and an annealing temperature of 60°C (for ATnovl and 2) or 55°C (for ATnov3) were used to detect expression. The assays were done in duplicate and results were scored and map positions determined via the RH server at Stanford University ⁇ http://www-shgc.stanford.edu/RH/G3index.html>.
  • RT-PCR was utilized to characterize the expression pattern of the novel anion transporters. This approach used RNA from 30 different tissues to generate first strand cDNA. Total RNA was purchased (Clontech, Invitrogen) and used to synthesize first strand cDNA using M-MLV reverse transcriptase and the supplied buffer (Gibco-BRL). The 20 ⁇ l reaction contained 5 ⁇ g total RNA, 100 ng of random primers, 10 mM DTT, 0.5 mM each dNTP, and an RNAse inhibitor (Gibco-BRL). Identical reactions were set up without reverse transcriptase to control for DNA contamination in the RNA samples.
  • cDNAs along with control cDNA synthesis reactions without reverse transcriptase, were diluted 1 :5 and 2 ⁇ l of each sample were arrayed into 96-well trays, dried, and resuspended in PCR buffer prior to PCR amplification.
  • the cDNAs were tested with primers with defined expression patterns to verify the presence of amplifiable cDNA from each tissue.
  • Gene-specific primers were used to amplify the cDNAs in 20 ⁇ l PCR reactions with standard conditions, 2.5 mM MgCI 2 , Taq Gold, and an appropriate annealing temperature.
  • This approach provides for relatively high-throughput analysis of gene expression in a large set of tissues in a cost-efficient manner and provides qualitative analysis of gene expression only. Modifications can be employed, such as the use of internal control primers, limited cycling parameters, and dilution series to convert this to a quantitative experiment.
  • RH primers (SEQ ID NO:11) CTGCTGCCAACTAACATTGC
  • RT-PCR primers (SEQ ID NO: 17) GATGCTTTCCTCTGTGCAGT (SEQ ID NO: 18) CCTTCAAGCCGAAGAAGGCT
  • cDNA clones were isolated using GeneTrapper (Gibco-BRL) from a liver cDNA library (Gibco-BRL). The resulting clones, the largest being up to 3.0 kb, were end- sequenced using vector primers. If the end sequences provided insufficient coverage of the cDNA clones, a transposon approach was used to complete the sequence of the cDNA clone.
  • the cDNA clones isolated with C12B_120 yielded two different sequence contigs, ATnovl and ATnov2, which were -89% identical to each other.
  • ATnov2 is identical to C12B_120.
  • cDNA clones isolated with C12C_151 generated a sequence contig, ATnov3, that was -86% identical to the first two contigs.
  • Conceptual translations yielded predicted proteins of 688-704 amino acids in length. A multiple alignment of these three proteins is shown in figure 1. These genes also show significant homology to a human organic anion transporter OATP (-40% identity, 60% similarity) and to a human prostaglandin transporter (-32% identity, 51% similarity) over the length of the predicted proteins.
  • OATP is expressed in multiple tissues, including brain, lung, liver, kidney, and testes (Kullak-Ubrick et al., supra.)
  • RT-PCR was utilized to characterize the expression pattern of the novel anion transporters. This approach used RNA from 30 different tissues to generate first strand cDNA. These cDNAs were arrayed, along with control cDNA synthesis reactions without reverse transcriptase, into 96-well trays, dried and stored until needed. This resource provides for relatively high-throughput analysis of gene expression in a large set of tissues in a cost-efficient manner. RT-PCR in this fashion allows for qualitative analysis of gene expression only. PCR was performed on these plates with gene-specific primers for each of the ATnov genes. ATnovl is expressed in fetal and adult liver; ATnov2 is expressed in adult liver and mammary gland; ATnov3 is expressed in fetal liver, adult liver, brain, adipose tissue, skin, and testes.
  • the predicted positions of transmembrane domains in the ATnov3 polypeptide are as follows:
  • novel members of the organic anion transporter family are expressed in the liver. Based on homology to another organic anion transporter, they are likely to be present on the basolateral surface of the hepatocytes and mediate the uptake of both xenobiotics and endogenous compounds for metabolism by the cytochrome p450s, glucuronosyl transferases, and other metabolic enzymes known to be present in the liver.
  • the ATnov genes are all expressed in the liver, with ATnov 2 and 3 also being expressed in a limited number of other tissues.
  • the RT-PCR approach described herein has a high level of sensitivity, with the ability to detect a control transcript diluted down to an expression level equivalent to a frequency of 1/10 7 .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des méthodes permettant d'isoler des gènes Atnov. Les compositions d'acide nucléique Atnov permettent d'identifier des protéines homologues ou associées ainsi que les séquences d'ADN codant pour ces protéines, de produire des compositions qui modulent l'expression ou la fonction de la protéine, et d'étudier les mécanismes physiologiques associés. En outre, la modulation de l'activité génique in vivo est utilisée à des fins prophylactiques et thérapeutiques, telles que l'identification du type cellulaire sur la base de l'expression et analogues.
PCT/US1999/017823 1998-08-07 1999-08-06 Genes humains transporteurs d'anions atnov WO2000008157A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU53406/99A AU5340699A (en) 1998-08-07 1999-08-06 Human anion transporter genes atnov
EP99939045A EP1141282A2 (fr) 1998-08-07 1999-08-06 Genes humains transporteurs d'anions atnov

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US9583598P 1998-08-07 1998-08-07
US60/095,835 1998-08-07

Publications (2)

Publication Number Publication Date
WO2000008157A2 true WO2000008157A2 (fr) 2000-02-17
WO2000008157A3 WO2000008157A3 (fr) 2000-11-23

Family

ID=22253806

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/017823 WO2000008157A2 (fr) 1998-08-07 1999-08-06 Genes humains transporteurs d'anions atnov

Country Status (3)

Country Link
EP (1) EP1141282A2 (fr)
AU (1) AU5340699A (fr)
WO (1) WO2000008157A2 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000075315A1 (fr) * 1999-06-03 2000-12-14 Sankyo Company, Limited Nouveau gene transporteur exprime dans le foie
WO2001072798A2 (fr) * 2000-03-27 2001-10-04 Bayer Aktiengesellschaft Regulation de la proteine humaine apparentee a oatp2
WO2001092314A1 (fr) * 2000-05-24 2001-12-06 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, polypeptide humain 10 de transport d'anions organiques, et polynucleotide codant ce polypeptide
WO2001092521A1 (fr) * 2000-05-30 2001-12-06 The University Of Bristol Composes therapeutiques
EP1186672A2 (fr) * 2000-08-23 2002-03-13 AstraZeneca AB Polymorphismes dans le gène humain du transporteur d'anion organique (OATP-C)
WO2002040541A2 (fr) * 2000-10-27 2002-05-23 Incyte Genomics, Inc. Transporteurs et canaux a ions
WO2003106709A1 (fr) * 2002-06-13 2003-12-24 Astrazeneca Ab Methodes de detection de polymorphismes faisant appel a l'arms ou a la rflp
EP1486510A1 (fr) * 1999-09-21 2004-12-15 Chugai Seiyaku Kabushiki Kaisha Gene pour le transporteur OATP-C
DE102008011008A1 (de) 2008-02-25 2009-09-03 Fachhochschule Jena Verfahren und Vorrichtung zur Beeinflussung von elektrisch leitfähigen Fluiden mit Hilfe der Lorentzkraft
US7700277B2 (en) 2003-07-26 2010-04-20 Astrazeneca Ab Use of polymorphisms in human OATP-C associated with an effect on statin pharmacokinetics in humans in statin therapy
US7807447B1 (en) 2000-08-25 2010-10-05 Merck Sharp & Dohme Corp. Compositions and methods for exon profiling

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997031111A2 (fr) * 1996-02-22 1997-08-28 Introgene B.V. Famille de transporteurs d'anions organiques, acides nucleiques codant ceux-ci, cellules les comprenant et procedes d'utilisation associes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997031111A2 (fr) * 1996-02-22 1997-08-28 Introgene B.V. Famille de transporteurs d'anions organiques, acides nucleiques codant ceux-ci, cellules les comprenant et procedes d'utilisation associes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ABE T., ET AL.: "Identification of a Novel Gene Family Encoding Human Liver-specific Organic Anion Transporter LST-1" J. BIOL. CHEM., vol. 274, no. 24, 11 June 1999 (1999-06-11), pages 17159-17163, XP000877288 *
HSIANG B.H., ZHU Y., WANG Z., WU Y., SASSEVILLE V., YANG W.-P.,: "A novel human hepatic organic anion transporting polypeptide (OATP2) Identification of a liver-specific human organic anion transporting polypeptide and identification of rat and human hydroxymethylglutaryl-coa reductase inhibitor transporter." JOURNAL OF BIOLOGICAL CHEMISTRY (MICROFILMS), vol. 274, no. 52, 24 December 1999 (1999-12-24), pages 37161-37168, XP002131865 MD US *
Embase accession number AB026257.1 Created 08-JUN-1999 , Sequence characterization: Homo sapiens mRNA for organic anion transporter OATP-C, complete XP002132655 *
KULLAK-UBLICK ET AL: "Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver" GASTROENTEROLOGY, vol. 109, 1 October 1995 (1995-10-01), pages 1274-1282, XP002092892 ISSN: 0016-5085 cited in the application *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000075315A1 (fr) * 1999-06-03 2000-12-14 Sankyo Company, Limited Nouveau gene transporteur exprime dans le foie
EP1486510A1 (fr) * 1999-09-21 2004-12-15 Chugai Seiyaku Kabushiki Kaisha Gene pour le transporteur OATP-C
US8748128B2 (en) 1999-09-21 2014-06-10 Chugai Seiyaku Kabushiki Kaisha Transporter genes OATP-B, C, D, and E
US7045316B2 (en) 1999-09-21 2006-05-16 Chugai Seiyaku Kabushiki Kaisha Transporter genes OATP-B,C,D, and E
WO2001072798A2 (fr) * 2000-03-27 2001-10-04 Bayer Aktiengesellschaft Regulation de la proteine humaine apparentee a oatp2
WO2001072798A3 (fr) * 2000-03-27 2002-07-25 Bayer Ag Regulation de la proteine humaine apparentee a oatp2
WO2001092314A1 (fr) * 2000-05-24 2001-12-06 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, polypeptide humain 10 de transport d'anions organiques, et polynucleotide codant ce polypeptide
WO2001092521A1 (fr) * 2000-05-30 2001-12-06 The University Of Bristol Composes therapeutiques
EP1589115A3 (fr) * 2000-08-23 2006-05-31 AstraZeneca AB Polymorphismes dans le gène humain du transporteur d'anion organique (OATP-C)
EP1186672A3 (fr) * 2000-08-23 2002-09-25 AstraZeneca AB Polymorphismes dans le gène humain du transporteur d'anion organique (OATP-C)
EP1186672A2 (fr) * 2000-08-23 2002-03-13 AstraZeneca AB Polymorphismes dans le gène humain du transporteur d'anion organique (OATP-C)
US7807447B1 (en) 2000-08-25 2010-10-05 Merck Sharp & Dohme Corp. Compositions and methods for exon profiling
WO2002040541A3 (fr) * 2000-10-27 2003-07-10 Incyte Genomics Inc Transporteurs et canaux a ions
WO2002040541A2 (fr) * 2000-10-27 2002-05-23 Incyte Genomics, Inc. Transporteurs et canaux a ions
WO2003106709A1 (fr) * 2002-06-13 2003-12-24 Astrazeneca Ab Methodes de detection de polymorphismes faisant appel a l'arms ou a la rflp
US7700277B2 (en) 2003-07-26 2010-04-20 Astrazeneca Ab Use of polymorphisms in human OATP-C associated with an effect on statin pharmacokinetics in humans in statin therapy
DE102008011008A1 (de) 2008-02-25 2009-09-03 Fachhochschule Jena Verfahren und Vorrichtung zur Beeinflussung von elektrisch leitfähigen Fluiden mit Hilfe der Lorentzkraft

Also Published As

Publication number Publication date
WO2000008157A3 (fr) 2000-11-23
EP1141282A2 (fr) 2001-10-10
AU5340699A (en) 2000-02-28

Similar Documents

Publication Publication Date Title
EP1066324B1 (fr) Nouveaux recepteurs de mammiferes couples a la proteine g et presentant des zones de repetition riches en leucine
EP1141282A2 (fr) Genes humains transporteurs d'anions atnov
WO1999043696A1 (fr) Genes humains du canal potassique
JP2003501088A (ja) 脂質輸送タンパク質
US7655771B1 (en) Polymorphisms in the human cyp3a4 and cyp3a7 genes and their use in diagnostic and therapeutic applications
US20100273256A1 (en) Human Potassium Channel Genes
CA2296178C (fr) Npt2b de l'intestin humain
US6043055A (en) Mammalian pro-apoptotic Bok genes and their uses
WO1999004626A1 (fr) Nouveau gene codant une endonuclease de reparation d'adn et ses methodes d'utilisation
US5705380A (en) Identification of a gene encoding TULP2, a retina specific protein
EP1165603A1 (fr) Sequences nucleotidiques codant la neurogenine 3 humaine
US6383792B1 (en) RAQ genes and their uses
CA2314677A1 (fr) Genes associes a l'asthme
US6239266B1 (en) ZAP-3 tumor associated genes and their uses
WO2000058464A2 (fr) Genes rab et leurs utilisations
US20050026248A1 (en) Novel mammalian G-protein coupled receptors having extracellular leucine rich repeat regions
US7122328B2 (en) Gene involved in mineral deposition and uses thereof
US5776762A (en) Obesity associated genes
US6803184B1 (en) MPR-related ABC transporter encoding nucleic acids and methods of use thereof
WO1999058669A1 (fr) Genes rhoh et leurs utilisations
CA2285631A1 (fr) Proteine anti-oxydante 2, gene et procedes d'utilisation correspondants
US6100058A (en) Gap12 genes and their uses
US6830925B2 (en) CaMK-X1 and its uses
WO1999046276A1 (fr) Genes zap-1 associes a une tumeur et leurs applications
MXPA00007131A (es) Genes relacionados con el asma

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 1999939045

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999939045

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999939045

Country of ref document: EP