WO1999043696A1 - Genes humains du canal potassique - Google Patents

Genes humains du canal potassique Download PDF

Info

Publication number
WO1999043696A1
WO1999043696A1 PCT/US1999/003826 US9903826W WO9943696A1 WO 1999043696 A1 WO1999043696 A1 WO 1999043696A1 US 9903826 W US9903826 W US 9903826W WO 9943696 A1 WO9943696 A1 WO 9943696A1
Authority
WO
WIPO (PCT)
Prior art keywords
hnov
protein
expression
nucleic acid
sequence
Prior art date
Application number
PCT/US1999/003826
Other languages
English (en)
Inventor
Andrew P. Miller
Mark Edward Curran
Ping Hu
Marc Rutter
Jian-Ying Wang
Original Assignee
Icagen Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icagen Inc. filed Critical Icagen Inc.
Priority to EP99908356A priority Critical patent/EP1056765A4/fr
Priority to CA002321194A priority patent/CA2321194A1/fr
Priority to AU27809/99A priority patent/AU747846B2/en
Publication of WO1999043696A1 publication Critical patent/WO1999043696A1/fr
Priority to US10/121,746 priority patent/US20030036648A1/en
Priority to US10/976,644 priority patent/US20050112662A1/en
Priority to US10/976,647 priority patent/US20050112663A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • Ion channels are multi-subunit, membrane bound proteins critical for maintenance of cellular homeostasis in nearly all cell types. Channels are involved in a myriad of processes including modulation of action potentials, regulation of cardiac myocyte excitability, heart rate, vascular tone, neuronal signaling, activation and proliferation of T-cells, and insulin secretion from pancreatic islet cells. In humans, ion channels comprise extended gene families with hundreds, or perhaps thousands, of both closely related and highly divergent family members. The majority of known channels regulate the passage of sodium (Na + ), chloride (Cl ), calcium (Ca ++ ) and potassium (K + ) ions across the cellular membrane.
  • ion channels have been shown to play a role in heritable human disease. Indeed, ion channel defects are involved in predisposition to epilepsy, cardiac arrhythmia (long QT syndrome), hypertension (Bartter's syndrome), cystic fibrosis, (defects in the CFTR chloride channel), several skeletal muscle disorders (hyperkalemic periodic paralysis, paramyotonia congenita, episodic ataxia) and congenital neural deafness (Jervell-Lange-Nieison syndrome), amongst others.
  • K + channels have critical roles in multiple cell types andpathways, and are the focus of significant investigation.
  • Four human conditions, episodic ataxia with myokymia, long QT syndrome, epilepsy and Bartter's syndrome have been shown to be caused by defective K + ion channels.
  • K + channel family is very diverse, and given that these proteins are critical components of virtually all cells, it is likely that abnormal K + channels will be involved in the etiology of additional renal, cardiovascular and central nervous system disorders of interest to the medical and pharmaceutical community.
  • the K + channel superfamily can be broadly classified into groups, based upon the number of transmembrane domain (TMD) segments in the mature
  • the minK (IsK) gene contains a single TMD, and although not a channel by itself, minK associates with different K + channel subunits, such as KvLQTI and HERG to modify the activity of these channels.
  • the inward rectifying K+ channels (GIRK, IRK, CIR, ROMK) contain 2 TMD domains and a highly conserved pore domain. Twik-1 is a member of the newly emerging 4TMD K + channel subset. Twik-like channels (leak channels) are involved in maintaining the steady-state K + potentials across membranes and therefore the resting potential of the cell near the equilibrium potential for potassium (Duprat et al. (1997) EMBO J 16(17):5464- 5471).
  • the 6TMD, or Shaker-like channels presently comprise the largest subset of known K + channels.
  • the slopoke (slo) related channels, or Ca ++ regulated channels apparently have either 10 TMD, or 6 TMD with 4 additional hydrophobic domains.
  • transmembrane domain, tandem pore domain K+ channels (4T/2P channels) represent a new family of potassium selective ion channels involved in the control of background membrane conductances.
  • 4T/2P channels Four transmembrane domain, tandem pore domain K+ channels (4T/2P channels) represent a new family of potassium selective ion channels involved in the control of background membrane conductances.
  • five channels fitting the 4T/2P architecture have been described: TWIK, TREK, TASK-1 , TASK- 2 and TRAAK.
  • the 4T/2P channels all have distinct characteristics, but are all thought to be involved in maintaining the steady-state K + potentials across membranes and therefore the resting potential of the cell near the equilibrium potential for potassium (Duprat et al. (1997) EMBO J 16(17):5464-5471). These proteins are particularly interesting targets for therapeutic regulation.
  • TWIK-1 , TREK-1 and TASK-1 and TASK-2 are widely distributed in many different tissues, while TRAAK is present exclusively in brain, spinal cord and retina.
  • the 4T/2P channels have different physiologic properties; TREK-1 channels, are outwardly rectifying (Fink et al. (1996) EMBO J 15(24):6854-62), while TWIK-1 channels, are inwardly rectifying (Lesage et al. (1996) EMBO J 15(5):1004-11.
  • TASK channels are regulated by changes in PH while TRAAK channels are stimulated by arachidonic acid (Reyes et al. (1998) JBC 273(47):30863-30869).
  • K+ channel gene family contains approximately 10 2 -10 3 individual genes.
  • an analysis of public sequence databases and the scientific literature demonstrates that only a small number, approximately 20-30, have been identified. This analysis suggests that many of these important genes remain to be identified.
  • Potassium channels are involved in multiple different processes and are important regulators of homeostasis in nearly all cell types. Their relevance to basic cellular physiology and role in many human diseases suggests that pharmacological agents could be designed to specific channel subtypes and these compounds then applied to a large market (Bulman, D.E. (1997) Hum Mol Genet 6:1679-1685; Ackerman, M.J. and Clapham D.E. (1997) NEJM 336:1575- 1586, Curran, M.E. (1998) Current Opinion in Biotechnology 9:565-572). The variety of therapeutic agents that modulate K+ channel activity reflects the diversity of physiological roles and importance of K+ channels in cellular function.
  • a difficulty encountered in therapeutic use of therapeutic agents that modify K+ channel activity is that the presently available compounds tend to be non-specific and elicit both positive and negative responses, thereby reducing clinical efficacy.
  • To facilitate development of specific compounds it is desirable to have further characterize novel K+ channels for use in in vitro and in vivo assays.
  • Type II pseudohypoaldosteronism is the designation used for a syndrome of chronic mineralocorticoid-resistant hyperkalemia with hypertension.
  • the primary abnormality in type II PHA is thought to be a specific defect of the renal secretory mechanism for potassium, which limits the kaliuretic response to, but not the sodium and chloride reabsorptive effect of, mineralocorticoid.
  • Mansfield et al. (1997) Nature Genet. 16:202-205 demonstrated locus heterogeneity of the trait, with linkage of the PHA2 gene to 1q31-q42 and 17p11-q21. Sequences of four transmembrane, two pore potassium channels have been previously described.
  • Reyes et al. discloses a pH sensitive channel. As with the related TASK-1 and TRAAK channels, the outward rectification is lost at high external K+ concentration.
  • the TRAAK channel is described by Fink et al. (1998) EMBO J 17(12):3297-308.
  • a cardiac two-pore channel is described in Kim et al. (1998) Circ Res 82(4):513-8.
  • An open rectifier potassium channel with two pore domains in tandem and having a postsynaptic density protein binding sequence at the C terminal was cloned by Leonoudakis et al. (1998) J Neurosci 18(3):868-77.
  • TASK currents are K+-selective, instantaneous and non-inactivating. They show an outward rectification when external [K+] is low, which is not observed for high [K+]out, suggesting a lack of
  • TASK is very sensitive to variations of extracellular pH in a narrow physiological range, a property probably essential for its physiological function, and suggests that small pH variations may serve a communication role in the nervous system.
  • K+Hnov genes Isolated nucleotide compositions and sequences are provided for K+Hnov genes.
  • the K+Hnov nucleic acid compositions find use in identifying homologous or related genes; in producing compositions that modulate the expression or function of its encoded proteins; for gene therapy; mapping functional regions of the proteins; and in studying associated physiological pathways.
  • modulation of the gene activity in vivo is used for prophylactic and therapeutic purposes, such as treatment of potassium channel defects, identification of cell type based on expression, and the like.
  • Nucleic acid compositions encoding K+Hnov polypeptides are provided. They are used in identifying homologous or related genes; in producing compositions that modulate the expression or function of the encoded proteins; for gene therapy; mapping functional regions of the proteins; and in studying associated physiological pathways.
  • the K+Hnov gene products are members of the potassium channel gene family, and have high degrees of homology to known potassium channels.
  • the encoded polypeptides may be alpha subunits, which form the functional channel, or accessory subunits that act to modulate the channel activity.
  • 5 sequences may encode a predicted K + channel, e.g. voltage gated, inward rectifier, etc.; or a modulatory subunit.
  • Electrophysiologic characterization of ion channels is an important part of understanding channel function.
  • Full length ion channel cDNAs may be combined with proper vectors to form expression constructs of each individual channel.
  • Functional analyses of expressed channels can be performed in heterologous systems, or by expression in mammalian cell lines.
  • heterologous systems such as Xenopus oocytes
  • synthetic mRNA is made through in vitro transcription of each channel construct.
  • mRNA is then injected, singly or in combination with interacting channel subunit mRNAs, into prepared oocytes and the cells allowed to express the channel for several days.
  • Oocytes expressing the channel of interest are then analyzed by whole cell voltage clamp and patch clamp techniques.
  • expression vectors specific to this type of analyses may be constructed and the resultant construct used to transform the target cells (for example human embryonic kidney (HEK) cells).
  • target cells for example human embryonic kidney (HEK) cells.
  • Both stable and transiently expressing lines may be studied using whole cell voltage clamp and patch clamp techniques.
  • Data obtained from EP studies includes, but is not limited to: current profiles elicited by depolarization and hyperpolarization, current-voltage (l-V) relationships, voltage dependence of activation, biophysical kinetics of channel activation, deactivation, and inactivation, reversal potential, ion selectivity, gating properties and sensitivity to channel antagonists and agonists.
  • Heterologous or mammalian cell lines expressing the novel channels can be used to characterize small molecules and drugs which interact with the channel. The same experiments can be used to assay for novel compounds which interact with the expressed channels.
  • the functional ion channel formed by K+Hnov polypeptides will be heteromultimers.
  • Heteromultimers are known to form between different voltage gated, outward rectifying potassium channel ⁇ subunits, generally comprising four subunits, and frequently associated with auxiliary, ⁇ subunits.
  • ⁇ subunits typically share a six-transmembrane domain structure (S1-S6),
  • Heteromultimers of greatest interest are those that form between subunits expressed in the same tissues, and are a combination of subunits from the same species.
  • the formation of multimers between the subject polypeptides and subunits that form functional channels are of particular interest.
  • the resulting channel may have decreased or increased conductance relative to a homomultimer, and may be altered in response to beta subunits or other modulatory molecules.
  • Kv1.1-1.8 (Gutman et al. (1993) Sem. Neurosci. 5:101-106); Kv2.1-2.2; Kv3.1-3.4; Kv4.1-4.3; Kv5.1 ; Kv6.1 ; Kv7.1 ; Kv8.1 ; Kv9.1-9.2.
  • the subunits capable of forming ion inducing channels include all of those in the Kv1 through Kv4; and Kv7 families.
  • the Kv5.1 , Kv6.1 , Kv8.1 and Kv9J-9.2 subunits may be electrically silent, but functional in modifying the properties in heteromultimers.
  • K+Hnov42 SEQ ID NO:26 SEQ ID NO:27 G1162A; T1460A; T2496A 8q11 Homology to K+ channel protein of C. elegans
  • SEQ ID NO.81 (ATCT) n repeats in the 3' 1q41 4T/2P channel; linked to the UTR sequence, starting at disease loci for rippling muscle position 2186 disease 1 (RMD1), and type II pseudohypoaldosteronism
  • K+Hnov is generically used to refer to any one of the provided genetic sequences listed in Table 1. Where a specific K+Hnov sequence is intended, the numerical designation, e.g. K49 or K59, will be added.
  • Nucleic acids encoding K+Hnov potassium channels may be cDNA or genomic DNA or a fragment thereof.
  • K+Hnov gene shall be intended to mean the open reading frame encoding any of the provided K+Hnov polypeptides, introns, as well as adjacent 5' and 3' non-coding nucleotide sequences involved in the regulation of expression, up to about 20 kb beyond the coding region, but possibly further in either direction.
  • the gene may be introduced into an appropriate vector for extrachromosomal maintenance or for integration into a host genome.
  • cDNA as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons and 3' and 5' non-coding regions. Normally mRNA species have contiguous exons, with the intervening ⁇ introns, when present, removed by nuclear RNA splicing, to create a continuous open reading frame encoding a K+Hnov protein.
  • a genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It may further include the 3' and 5' untranslated regions found in the mature mRNA. It may further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc., including about 1 kb, but possibly more, of flanking genomic DNA at either the 5' or 3' end of the transcribed region.
  • the genomic DNA may be isolated as a fragment of 100 kbp or smaller; and substantially free of flanking chromosomal sequence.
  • the genomic DNA flanking the coding region, either 3' or 5', or internal regulatory sequences as sometimes found in introns contains sequences required for proper tissue and stage specific expression.
  • the sequence of the 5' flanking region may be utilized for promoter elements, including enhancer binding sites, that provide for developmental regulation in tissues where K+Hnov genes are expressed.
  • the tissue specific expression is useful for determining the pattern of expression, and for providing promoters that mimic the native pattern of expression.
  • Naturally occurring polymorphisms in the promoter regions are useful for determining natural variations in expression, particularly those that may be associated with disease.
  • mutations may be introduced into the promoter regions to determine the effect of altering expression in experimentally defined systems.
  • Methods for the identification of specific DNA motifs involved in the binding of transcriptional factors are known in the art, e.g. sequence similarity to known binding motifs, gel retardation studies, etc. For examples, see Blackwell et al. (1995) Mol Med 1: 194-205; Mortlock et al. (1996) Genome Res. 6: 327-33; and Joulin and Richard-Foy (1995) Eur J Biochem 232: 620-626.
  • the regulatory sequences may be used to identify cis acting sequences required for transcriptional or translational regulation of K+Hnov expression, especially in different tissues or stages of development, and to identify cis acting sequences and trans acting factors that regulate or mediate K+Hnov expression.
  • Such transcription or translational control regions may be operably linked to a K+Hnov gene in order to promote expression of wild type or altered K+Hnov or other proteins of interest in cultured cells, or in embryonic, fetal or adult tissues, and for gene therapy.
  • the nucleic acid compositions of the subject invention may encode all or a part of the subject polypeptides. Double or single stranded fragments may be obtained of the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc. For the most part, DNA fragments will be of at least 15 nt, usually at least 18 nt or 25 nt, and may be at least about 50 nt. Such small DNA fragments are useful as primers for PCR, hybridization screening probes, etc. Larger DNA fragments, i.e. greater than 100 nt are useful for production of the encoded polypeptide. For use in amplification reactions, such as PCR, a pair of
  • primers will be used.
  • the exact composition of the primer sequences is not critical to the invention, but for most applications the primers will hybridize to the subject sequence under stringent conditions, as known in the art. It is preferable to choose a pair of primers that will generate an amplification product of at least about 50 nt, preferably at least about 100 nt. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages. Amplification primers hybridize to complementary strands of DNA, and will prime towards each other.
  • the K+Hnov genes are isolated and obtained in substantial purity, generally as other than an intact chromosome.
  • the DNA will be obtained substantially free of other nucleic acid sequences that do not include a K+Hnov sequence or fragment thereof, generally being at least about 50%, usually at least about 90% pure and are typically "recombinant", i.e. flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.
  • the DNA may also be used to identify expression of the gene in a biological specimen.
  • DNA or mRNA is isolated from a cell sample.
  • the mRNA may be amplified by RT-PCR, using reverse transcriptase to form a complementary DNA strand, followed by polymerase chain reaction amplification using primers specific for the subject DNA sequences.
  • the mRNA sample is separated by gel electrophoresis, transferred to a suitable support, e.g. nitrocellulose, nylon, etc., and then probed with a fragment of the subject DNA as a probe.
  • oligonucleotide ligation assays such as in situ hybridizations, and hybridization to DNA probes arrayed on a solid chip may also find use. Detection of mRNA hybridizing to the subject sequence is indicative of +Hnovgene expression in the sample.
  • sequence of a K+Hnov gene including flanking promoter regions and coding regions, may be mutated in various ways known in the art to generate targeted changes in promoter strength, sequence of the encoded protein, etc.
  • the DNA sequence or protein product of such a mutation will usually be substantially similar to the sequences provided herein, i.e. will differ by at least one nucleotide or amino acid, respectively, and may differ by at least two but not more than about ten nucleotides or amino acids.
  • the sequence changes may be substitutions, insertions or deletions. Deletions may further include larger changes, such as deletions of a domain or exon.
  • Other modifications of interest include epitope tagging, e.g. with the FLAG system, HA, etc.
  • fusion proteins with green fluorescent proteins (GFP) may be used. Techniques for in vitro mutagenesis of cloned genes are known.
  • a fragment of the provided cDNA may be used as a hybridization probe against a cDNA library from the target organism of interest, where low stringency conditions are used.
  • the probe may be a large fragment, or one or more short degenerate primers.
  • Nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50°C and 6XSSC (0.9 M sodium chloride/0.09 M sodium citrate) and remain bound when subjected to washing at 55°C in 1XSSC (0.15 M sodium chloride/0.015 M sodium citrate). Sequence identity may be determined by hybridization under stringent conditions, for example, at 50°C or higher and
  • Nucleic acids having a region of substantial identity to the provided K+Hnov sequences e.g. allelic variants, genetically altered versions of the gene, etc., bind to the provided K+Hnov sequences under stringent hybridization conditions.
  • probes, particularly labeled probes of DNA sequences one can isolate homologous or related genes.
  • the source of homologous genes may be any species, e.g. primate species, particularly human; rodents, such as rats and mice, canines, felines, bovines, ovines, equines, yeast, nematodes, etc.
  • homologs have substantial sequence similarity, i.e. at least 75% sequence identity between nucleotide sequences, in some cases 80 or 90% sequence identity, and may be as high as 95% sequence identity between closely related species. Sequence similarity is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared. Algorithms for sequence analysis are known in the art, such as BLAST, described in Altschul et al. (1990), J. Mol. Biol.
  • variants of the invention have a sequence identity greater than at least about 65%, preferably at least about 75%, more preferably at least about 85%, and may be greater than at least about 90% or more as determined by the Smith- Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular).
  • Exemplary search parameters for use with the MPSRCH program in order to identify sequences of a desired sequence identity are as follows: gap open penalty: 12; and gap extension penalty: 1.
  • the subject nucleic acid sequences may be employed for producing all or portions of K+Hnov polypeptides.
  • an expression cassette may be employed.
  • the expression vector will provide a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region
  • the 14 is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. These control regions may be native to a K+Hnov gene, or may be derived from exogenous sources.
  • the peptide may be expressed in prokaryotes or eukaryotes in accordance with conventional ways, depending upon the purpose for expression.
  • a unicellular organism such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism such as vertebrates, particularly mammals, e.g. COS 7 cells, may be used as the expression host cells.
  • K+Hnov gene in eukaryotic cells, where the K+Hnov protein will benefit from native folding and post-translational modifications.
  • Small peptides can also be synthesized in the laboratory. Peptides that are subsets of the complete K+Hnov sequence may be used to identify and investigate parts of the protein important for function, or to raise antibodies directed against these regions.
  • Fragments of interest include the transmembrane and pore domains, the signal sequences, regions of interaction between subunits, etc. Such domains will usually include at least about 20 amino acids of the provided sequence, more usually at least about 50 amino acids, and may include 100 amino acids or more, up to the complete domain. Binding contacts may be comprised of noncontiguous sequences, which are brought into proximity by the tertiary structure of the protein. The sequence of such fragments may be modified through manipulation of the coding sequence, as described above. Truncations may be performed at the carboxy or amino terminus of the fragment, e.g. to determine the minimum sequence required for biological activity.
  • the protein may be isolated and purified in accordance with conventional ways.
  • a lysate may be prepared of the expression host and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique.
  • purified protein will generally be at least about 80% pure, preferably at least about 90% pure, and may be up to and including 100% pure. Pure is intended to mean free of other proteins, as well as cellular debris.
  • K+Hnov polypeptides are useful for the production of antibodies, where short fragments provide for antibodies specific for the particular polypeptide, and larger fragments or the entire protein allow for the production of antibodies over the surface of the polypeptide.
  • Antibodies may be raised to the wild-type or variant forms of K+Hnov.
  • Antibodies may be raised to isolated peptides corresponding to specific domains, e.g. the pore domain and the transmembrane domain, or to the native protein.
  • Antibodies are prepared in accordance with conventional ways, where the expressed polypeptide or protein is used as an immunogen, by itself or conjugated to known immunogenic carriers, e.g. KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the like.
  • immunogenic carriers e.g. KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the like.
  • Various adjuvants may be employed, with a series of injections, as appropriate.
  • the spleen is isolated, the lymphocytes immortalized by cell fusion, and then screened for high affinity antibody binding.
  • the immortalized cells, i.e. hybridomas, producing the desired antibodies may then be expanded.
  • the mRNA encoding the heavy and light chains may be isolated and mutagenized by cloning in E. coli, and the heavy and light chains mixed to further enhance the affinity of the antibody.
  • Alternatives to in vivo immunization as a method of raising antibodies include binding to phage "display" libraries, usually in conjunction with in vitro affinity maturation.
  • the subject nucleic acid and/or polypeptide compositions may be used to genotyping and other analysis for the presence of polymorphisms in the sequence, or variation in the expression of the subject genes. Genotyping may be performed to determine whether a particular polymorphisms is associated with
  • a disease state or genetic predisposition to a disease state particularly diseases associated with defects in excitatory properties of cells, e.g. cardiac, muscle, renal and neural cells.
  • Disease of interest include rippling muscle disease, and type II psuedohypoaldosteronism.
  • Clinical disorders associated with K+ channel defects include long-QT syndrome; a congenital disorder affecting 1 in 10,000-15,000. Affected individuals have a prolonged QT interval in the electrocardiogram due to a delayed repolarization of the ventricle.
  • Genetic linkage analyses identified two loci for long QT syndrome, LQT1 , in 11p15.5 and LQT2, in 7q35-36.
  • Positional cloning techniques identified the novel K+ channel KvLQTI on chromosome 11 while candidate gene analysis identified causative mutations in the HERG K+ channel for LQT2.
  • the weaver mouse exhibits several abnormal neurological symptoms, including severe ataxia, loss of granule cell neurons in the cerebellum and dopaminergic cells in the substantia nigra, as well as seizures and male infertility.
  • a G-protein-coupled K+ channel having a mutation in the conserved pore domain has been determined to cause the disease.
  • the pancreatic-islet ⁇ -cell ATP- sensitive K+ channel (KATP) is composed of two subunits, the sulfonylurea receptor (SUR) and the inward rectifier K+ channel Kir6.2. Mutations in both SUR and Kir6.2 have been identified in patients with persistent hyperinsulinemic hypoglycemia of infancy, which is caused by unregulated secretion of insulin.
  • Genotyping may also be performed for pharmacogenetic analysis to assess the association between an individual's genotype and that individual's ability to react to a therapeutic agent. Differences in target sensitivity can lead to toxicity or therapeutic failure. Relationships between polymorphisms in channel expression or specificity can be used to optimize therapeutic dose administration.
  • K+Hnov gene examples are listed in table 1.
  • Nucleic acids comprising the polymorphic sequences are used to screen patients for altered reactivity and adverse side effects in response to drugs that act on K+ channels.
  • K+Hnov genotyping is performed by DNA or RNA sequence and/or hybridization analysis of any convenient sample from a patient, e.g. biopsy material, blood sample, scrapings from cheek, etc.
  • a nucleic acid sample from an individual is analyzed for the presence of polymorphisms in K+Hnov, particularly those that affect the activity, responsiveness or expression of K+Hnov.
  • Specific sequences of interest include any polymorphism that leads to changes in basal expression in one or more tissues, to changes in the modulation of K+Hnov expression, or alterations in K+Hnov specificity and/or activity.
  • the effect of a polymorphism in K+Hnov gene sequence on the response to a particular agent may be determined by in vitro or in vivo assays. Such assays may include monitoring during clinical trials, testing on genetically defined cell lines, etc. The response of an individual to the agent can then be predicted by determining the K+Hnov genotype with respect to the polymorphism. Where there is a differential distribution of a polymorphism by racial background, guidelines for drug administration can be generally tailored to a particular ethnic group.
  • Biochemical studies may be performed to determine whether a sequence polymorphism in a K+Hnov coding region or control regions is associated with disease, for example the association of K+Hnov 9 with idiopathic generalized epilepsy.
  • Disease associated polymorphisms may include deletion or truncation of the gene, mutations that alter expression level, that affect the electrical activity of the channel, etc.
  • a number of methods are available for analyzing nucleic acids for the presence of a specific sequence. Where large amounts of DNA are available, genomic DNA is used directly. Alternatively, the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis.
  • the nucleic acid may be amplified by conventional techniques, such as the polymerase chain reaction (PCR), to provide sufficient amounts for analysis.
  • PCR polymerase chain reaction
  • the use of the polymerase chain reaction is described in Saiki et al. (1985) Science 239:487, and a review of current techniques may be found in Sambrook et al. Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp.14.2-14.33. Amplification may be used
  • a detectable label may be included in an amplification reaction.
  • Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2',7 , -dimethoxy-4',5'- dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2',4',7',4,7- hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N',N'-tetramethyl-6- carboxyrhodamine (TAMRA), radioactive labels, e.g.
  • fluorochromes e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoery
  • the label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label.
  • the label may be conjugated to one or both of the primers.
  • the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.
  • the sample nucleic acid e.g. amplified or cloned fragment, is analyzed by one of a number of methods known in the art.
  • the nucleic acid may be sequenced by dideoxy or other methods.
  • Hybridization with the variant sequence may also be used to determine its presence, by Southern blots, dot blots, etc.
  • the hybridization pattern of a control and variant sequence to an array of oligonucleotide probes immobilised on a solid support, as described in U.S. 5,445,934, or in WO95/35505, may also be used as a means of detecting the presence of variant sequences.
  • Single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), mismatch cleavage detection, and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility.
  • SSCP Single strand conformational polymorphism
  • DGGE denaturing gradient gel electrophoresis
  • mismatch cleavage detection and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility.
  • RFLP restriction fragment length polymorphism
  • an array of oligonucleotides are provided, where discrete positions on the array are complementary to one or more of the provided sequences, e.g. oligonucleotides of at least 12 nt, frequently 20 nt, or larger, and including the sequence flanking a polymorphic position in a K ⁇ nov sequence; coding sequences for different K ⁇ nov channels, panels of ion channels comprising one or more of the provided K + channels; etc.
  • Such an array may comprise a series of oligonucleotides, each of which can specifically hybridize to a different polymorphism. For examples of arrays, see Hacia et al. (1996) Nature Genetics 14:441-447; Lockhart et al. (1996) Nature Biotechnol. 14:1675-1680; and De Risi et al. (1996) Nature Genetics 14:457-460.
  • Screening for polymorphisms in K+Hnov may be based on the functional or antigenic characteristics of the protein. Protein truncation assays are useful in detecting deletions that may affect the biological activity of the protein. Various immunoassays designed to detect polymorphisms in K+Hnov proteins may be used in screening. Where many diverse genetic mutations lead to a particular disease phenotype, functional protein assays have proven to be effective screening tools. The activity of the encoded K+Hnov protein as a potassium channel may be determined by comparison with the wild-type protein.
  • Antibodies specific for a K+Hnov may be used in staining or in immunoassays.
  • Samples include biological fluids such as semen, blood, cerebrospinal fluid, tears, saliva, lymph, dialysis fluid and the like; organ or tissue culture derived fluids; and fluids extracted from physiological tissues. Also included in the term are derivatives and fractions of such fluids.
  • the cells may be dissociated, in the case of solid tissues, or tissue sections may be analyzed. Alternatively a lysate of the cells may be prepared.
  • Diagnosis may be performed by a number of methods to determine the absence or presence or altered amounts of normal or abnormal K+Hnov polypeptides in patient cells. For example, detection may utilize staining of cells
  • the antibodies of interest are added to the cell sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes.
  • the antibody may be labeled with radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct detection.
  • a second stage antibody or reagent is used to amplify the signal.
  • Such reagents are well known in the art.
  • the primary antibody may be conjugated to biotin, with horseradish peroxidase-conjugated avidin added as a second stage reagent.
  • the secondary antibody conjugated to a flourescent compound e.g.
  • K+Hnov genes, gene fragments, or the encoded protein or protein fragments are useful in gene therapy to treat disorders associated with K+Hnov defects.
  • Expression vectors may be used to introduce the K+Hnov gene into a cell. Such vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences.
  • Transcription cassettes may be prepared comprising a transcription initiation region, the target gene or fragment thereof, and a transcriptional termination region. The transcription cassettes may be introduced into a variety of vectors, e.g. plasmid; retrovirus, e.g.
  • lentivirus adenovirus
  • the vectors are able to transiently or stably be maintained in the cells, usually for a period of at least about one day, more usually for a period of at least about several days to several weeks.
  • the gene or K+Hnov protein may be introduced into tissues or host cells by any number of routes, including viral infection, microinjection, or fusion of vesicles. Jet injection may also be used for intramuscular administration, as
  • the DNA may be coated onto gold microparticles, and delivered intradermally by a particle bombardment device, or "gene gun” as described in the literature (see, for example, Tang er a/. (1992) Nature 356:152-154), where gold microprojectiles are coated with the K+Hnov or DNA, then bombarded into skin cells.
  • Antisense molecules can be used to down-regulate expression of K+Hnov in cells.
  • the anti-sense reagent may be antisense oligonucleotides (ODN), particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such anti-sense molecules as RNA.
  • ODN antisense oligonucleotides
  • the antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products.
  • Antisense molecules inhibit gene expression through various mechanisms, e.g. by reducing the amount of mRNA available for translation, through activation of RNAse H, or steric hindrance.
  • One or a combination of antisense molecules may be administered, where a combination may comprise multiple different sequences.
  • Antisense molecules may be produced by expression of all or a part of the target gene sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule.
  • the antisense molecule is a synthetic oligonucleotide.
  • Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides in length, where the length is governed by efficiency of inhibition, specificity, including absence of cross-reactivity, and the like. It has been found that short oligonucleotides, of from 7 to 8 bases in length, can be strong and selective inhibitors of gene expression (see Wagner et al. (1996) Nature Biotechnology 14:840-844).
  • a specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence.
  • Selection of a specific sequence for the oligonucleotide may use an empirical method, where several candidate sequences are assayed for inhibition of expression of
  • the target gene in an in vitro or animal model.
  • a combination of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation.
  • Antisense oligonucleotides may be chemically synthesized by methods known in the art (see Wagner et al. (1993) supra, and Milligan et al., supra.) Preferred oligonucleotides are chemically modified from the native phosphodiester structure, in order to increase their intracellular stability and binding affinity. A number of such modifications have been described in the literature, which alter the chemistry of the backbone, sugars or heterocyclic bases.
  • phosphorothioates Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates.
  • Achiral phosphate derivatives include 3'-O'-5'-S-phosphorothioate, 3'-S-5'-O- phosphorothioate, 3'-CH2-5'-O-phosphonate and 3'-NH-5'-O-phosphoroamidate.
  • Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage. Sugar modifications are also used to enhance stability and affinity.
  • the ⁇ -anomer of deoxyribose may be used, where the base is inverted with respect to the natural ⁇ -anomer.
  • the 2'-OH of the ribose sugar may be altered to form 2'-O-methyl or 2'-O-allyl sugars, which provides resistance to degradation without comprising affinity. Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2'-deoxycytidine and 5-bromo-2'- deoxycytidine for deoxycytidine. 5- propynyl-2'-deoxyuridine and 5-propynyl-2'- deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.
  • catalytic nucleic acid compounds e.g. ribozymes, anti-sense conjugates, etc.
  • Ribozymes may be synthesized in vitro and administered to the patient, or may be encoded on an expression vector, from which the ribozyme is synthesized in the targeted cell (for example, see International patent application
  • the subject nucleic acids can be used to generate transgenic animals or site specific gene modifications in cell lines. Transgenic animals may be made through homologous recombination, where the normal K+Hnov locus is altered. Alternatively, a nucleic acid construct is randomly integrated into the genome. Vectors for stable integration include piasmids, retroviruses and other animal viruses, YACs, and the like.
  • the modified cells or animals are useful in the study of K+Hnov function and regulation.
  • a series of small deletions and/or substitutions may be made in the K+Hnov gene to determine the role of different transmembrane domains in forming multimeric structures, ion channels, etc.
  • K+Hnov to construct transgenic animal models for epilepsy and other neurological defects, where expression of K+Hnov is specifically reduced or absent.
  • Specific constructs of interest include anti-sense K+Hnov, which will block K+Hnov expression, expression of dominant negative K+Hnov mutations, etc.
  • One may also provide for expression of the K+Hnov gene or variants thereof in cells or tissues where it is not normally expressed or at abnormal times of development.
  • DNA constructs for homologous recombination will comprise at least a portion of the K+Hnov gene with the desired genetic modification, and will include regions of homology to the target locus.
  • DNA constructs for random integration need not include regions of homology to mediate recombination. Conveniently, markers for positive and negative selection are included. Methods for generating cells having targeted gene modifications through homologous recombination are
  • an ES cell line may be employed, or embryonic cells may be obtained freshly from a host, e.g. mouse, rat, guinea pig, etc. Such cells are grown on an appropriate fibroblast-feeder layer or grown in the presence of leukemia inhibiting factor (LIF).
  • LIF leukemia inhibiting factor
  • ES or embryonic cells may be used to produce transgenic animals. After transformation, the cells are plated onto a feeder layer in an appropriate medium. Cells containing the construct may be detected by employing a selective medium. After sufficient time for colonies to grow, they are picked and analyzed for the occurrence of homologous recombination or integration of the construct. Those colonies that are positive may then be used for embryo manipulation and blastocyst injection.
  • Blastocysts are obtained from 4 to 6 week old superovulated females.
  • the ES cells are trypsinized, and the modified cells are injected into the blastocoel of the blastocyst. After injection, the blastocysts are returned to each uterine horn of pseudopregnant females. Females are then allowed to go to term and the resulting offspring screened for the construct.
  • chimeric progeny can be readily detected.
  • the chimeric animals are screened for the presence of the modified gene and males and females having the modification are mated to produce homozygous progeny.
  • tissues or organs can be maintained as allogeneic or congenic grafts or transplants, or in in vitro culture.
  • the transgenic animals may be any non-human mammal, such as laboratory animals, domestic animals, etc.
  • the transgenic animals may be used in functional studies, drug screening, etc., e.g. to determine the effect of a candidate drug on Ras or related gene activation, oncogenesis, etc.
  • Potassium channels such as K+Hnov polypeptides are involved in multiple biologically important processes. Pharmacological agents designed to affect only specific channel subtypes are of particular interest. Presently available compounds tend to be non-specific and elicit both positive and negative responses, thereby reducing clinical efficacy.
  • the subject polypeptides may be used in in vitro and in vivo models to test the specificity of novel compounds, and of analogs and derivatives of compounds known to act on potassium channels.
  • Numerous pharmacological agents have profound affects on K+ channel activity.
  • Sotalol (BETAPACE) is a class III antiarrhythmic drug that prolongs cardiac action potentials by inhibiting delayed rectifier K+ channels.
  • Sulfonylurea drugs such as Glipizide (GLUCOTROL) and Tolazamide (TOLAMIDE) function as antidiabetic drugs by blocking ATP-sensitive K+ channels present in pancreatic islet cells, thereby regulating insulin secretion.
  • Diazoxide (HYPERSTAT IV) is an antihypertensive drug that activates ATP-sensitive K+ channels, resulting in the relaxation of vascular smooth muscle.
  • drugs that have antidiabetic, antihypertensive, or antiarrhythmic activities.
  • a number of drugs that activate K+ channels that have been proposed as coronary vasodilators for the treatment of both vasospastic and chronic stable angina.
  • K+ channel subunits allow in vitro reconstruction of functional channels, which may comprise different alpha and beta subunits.
  • the individual components may be modified by sequence deletion, substitution, etc. to determine the functional role of specific domains.
  • Drug screening may be performed using an in vitro model, a genetically altered cell or animal, or purified K+Hnov protein, either as monomers, homomultimers or hetermultimers.
  • Drug screening identifies agents that provide a replacement for K+Hnov function in abnormal cells.
  • screening assays for agents that have a low toxicity for human cells. A wide variety of assays may be used for this purpose, including
  • the purified protein may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions.
  • agent as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of K+Hnov polypeptide.
  • agent e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of K+Hnov polypeptide.
  • concentrations e.g. 1-10%
  • concentrations e.g. 1-10%
  • Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons.
  • Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
  • Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known
  • 27 pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
  • the screening assay is a binding assay
  • the label can directly or indirectly provide a detectable signal.
  • Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like.
  • Specific- binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
  • the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
  • reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etcA may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40°C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
  • the compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host in a variety of ways, orally, topically, parenterally e.g. subcutaneously, intraperitoneally, by viral infection, intravascularly, etc.
  • the compounds may be formulated in a variety of ways.
  • the concentration of therapeutically active compound in the formulation may vary from about 0J-100 wt.%.
  • the pharmaceutical compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like.
  • Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up
  • compositions containing the therapeutically-active compounds include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.
  • the pore domain is composed of 15-17 amino acids and can be divided into subfamilies based on the number of transmembrane segments present in the channel. Eleven variant peptide sequences corresponding to the pore domain were used in TBLASTN searches against the EST division of Genbank. Significant matches were identified, and classified into 2 categories: identical to known human K+ channels and related to known K+ channels. The pore sequences are shown in Table 2.
  • the second set of experiments was based on a complex, reiterative process.
  • GenBank Annotated protein and DNA sequences were obtained from GenBank for all known K+ channels from all species.
  • the TBLASTN and BLASTN programs were used to identify homologous ESTs, which were then analyzed using the BLASTX and BLASTN algorithms to identify ESTs which were related to K+ channels yet not identical to any known human K+ channel gene.
  • Novel human K+ channels were defined as those that had clear homology to known K+ channels from any species and were not present as identities or near identities to any human-derived sequences in any division of Genbank.
  • Sequences were assembled in Sequencher (Gene Codes). The presence of open reading frames was assessed as well as potential start codons. Potential polymorphisms were detected as sequence variants between multiple independent clones. Sequence homologies were detected using the BLAST algorithms.
  • ESTs that had top human hits with >95% identity over 100 amino acids were discarded. This was based upon the inventors' experience that these sequences were usually identical to the starting probe sequences, with the differences due to sequence error.
  • the remaining BLASTN and BLASTX outputs for each EST were examined manually, i.e., ESTs were removed from the analysis if the inventors determined that th ⁇ e variation from the known related probe sequence was a result of poor database sequence. Poor database sequence was usually identified as a number of 'N' nucleotides in the database sequence for a BLASTN search and as a base deletion or insertion in the database sequence, resulting in a peptide frameshift, for a BLASTX output. ESTs for which the highest scoring match was to non-related sequences were also discarded at this stage. The EST sequences that correspond to each clone are shown in Table 4.
  • Two primers were designed in the 3'-untranslated regions of each gene sequence to amplify a product across the Stanford G3 radiation hybrid map, or the Whitehead GB4 panel.
  • the PCR data were submitted for automatic two-point analysis.
  • OMIM human gene map data base were made. The following primers were made:
  • Map positions for K+Hnov15 and K+Hnov27 were obtained from public databases.
  • K+Hnov2 and K+Hnov4 have not been mapped.
  • RT-PCR was utilized to characterize the expression pattern of the novel ion channels. This approach used RNA from 30 different tissues to generate first strand cDNA. Total RNA was purchased (Clontech, Invitrogen) and used to synthesize first strand cDNA using M-MLV reverse transcriptase and the supplied buffer (Gibco-BRL).
  • the 20 ⁇ l reaction contained 5 ⁇ g total RNA, 100 ng of random primers, 10 mM DTT,
  • RNAse inhibitor Gabco-BRL
  • Identical reactions were set up without reverse transcriptase to control for DNA contamination in the RNA samples.
  • the synthesis reaction proceeded for 1 hour at 37 ⁇ C followed by 10 minutes at 95 ⁇ C.
  • These cDNAs, along with control cDNA synthesis reactions without reverse transcriptase, were diluted 1:5 and 2 ⁇ l of each sample were arrayed into 96-well trays, dried, and resuspended in PCR buffer prior to PCR amplification.
  • the cDNAs were tested with primers with defined expression patterns to verify the presence of amplifiable cDNA from each tissue.
  • Gene-specific primers were used to amplify the cDNAs in 20 ⁇ l PCR reactions with standard conditions, 2.5 mM MgCI 2 , Taq Gold, and an appropriate annealing temperature.
  • This approach provides for relatively high-throughput analysis of gene expression in a large set of tissues in a cost-efficient manner and provides qualitative analysis of gene expression only. Modifications can be employed, such as the use of internal control primers, limited cycling parameters, and dilution series to convert this to a quantitative experiment.
  • a “+” indicates expression in the tissue, a "-" indicates no expression, and blank square indicates no data for that sample
  • Primer 1 (SEQ ID NO:5): 5' - CATAGCCATAGGTGAGGACT - 3'
  • Primer 2 (SEQ ID N:6) 5' - GAGAGGAAAACAGTCTGGGC - 3' Results: Cytogenetic location 1q41 , 4.6cR from framework marker D1S217
  • Primer 1 (SEQ ID NOJ): 5' - GGACATCGAACTAAGACCTG - 3'
  • Primer 2 (SEQ ID NO:8): 5' - TCCCATGCCATTCAGATCTG - 3' Results: Cytogenetic location 19q13.2, 8.34cr from framework marker D19S425
  • a probe was created from a fragment corresponding to nucleotides 50 to 1284 of SEQ ID NO:83 (K+Hnov49) and purified DNA fragment was labeled with [ 32 P]dCTP (Amersham) by the random primer method.
  • MTMTM Multiple Tissue Northern
  • EJxSSC Elongation-Coupled Cell
  • SDS Elongation-Coupled Device

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Procédés permettant d'isoler des gènes K+Hnov. Lesdites compositions d'acide nucléique K+Hnov peuvent être utilisées pour identifier des protéines homologues ou apparentées et les séquences d'ADN codant lesdites protéines, pour produire des compositions qui modulent l'expression ou la fonction de la protéine et pour étudier des voies biologiques. De plus, la modulation de l'activité génique in vivo est utilisée à des fins prophylactiques et thérapeutiques, telles que l'identification de types cellulaires sur la base de l'expression, et analogue.
PCT/US1999/003826 1998-02-25 1999-02-22 Genes humains du canal potassique WO1999043696A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP99908356A EP1056765A4 (fr) 1998-02-25 1999-02-22 Genes humains du canal potassique
CA002321194A CA2321194A1 (fr) 1998-02-25 1999-02-22 Genes humains du canal potassique
AU27809/99A AU747846B2 (en) 1998-02-25 1999-02-22 Human potassium channel genes
US10/121,746 US20030036648A1 (en) 1998-08-07 2002-04-11 Human potassium channel genes
US10/976,644 US20050112662A1 (en) 1998-08-07 2004-10-29 Human potassium channel genes
US10/976,647 US20050112663A1 (en) 1998-08-07 2004-10-29 Human potassium channel genes

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US7668798P 1998-02-25 1998-02-25
US60/076,687 1998-02-25
US9583698P 1998-08-07 1998-08-07
US60/095,836 1998-08-07
US11644899P 1999-01-19 1999-01-19
US60/116,448 1999-01-19

Publications (1)

Publication Number Publication Date
WO1999043696A1 true WO1999043696A1 (fr) 1999-09-02

Family

ID=27372934

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/003826 WO1999043696A1 (fr) 1998-02-25 1999-02-22 Genes humains du canal potassique

Country Status (4)

Country Link
EP (1) EP1056765A4 (fr)
AU (1) AU747846B2 (fr)
CA (1) CA2321194A1 (fr)
WO (1) WO1999043696A1 (fr)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000022001A2 (fr) * 1998-10-13 2000-04-20 Sanofi-Synthelabo Nouveau canal potassique de la famille erg
WO2001061006A2 (fr) * 2000-02-15 2001-08-23 Wyeth Canaux potassiques, sequences nucleotidiques codant ceux-ci et leurs procedes d'utilisation
WO2001085788A2 (fr) * 2000-05-10 2001-11-15 Pharmacia & Upjohn Company Canaux ioniques humains
EP1155029A1 (fr) * 1999-02-23 2001-11-21 Icagen, Inc. Sous-unites de bk beta de canaux potassiques de famille slo
WO2002010389A2 (fr) * 2000-07-28 2002-02-07 Lexicon Genetics Incorporated Nouvelles proteines du canal ionique humain et polynucleotides codant ces dernieres
WO2002048369A2 (fr) * 2000-11-02 2002-06-20 Bristol-Myers Squibb Company Polynucleotide codant une nouvelle sous-unite beta du canal potassium chez l'homme, k+mbeta1
WO2002057452A2 (fr) * 2000-12-15 2002-07-25 Curagen Corporation Proteines, polynucleotides codant pour elles et leurs procedes d'utilisation
WO2002066601A2 (fr) * 2001-01-24 2002-08-29 Bristol-Myers Squibb Company Polynucleotide codant pour une nouvelle sous-unite beta de canal potassium humain, k+betam2
WO2002068587A2 (fr) * 2001-02-07 2002-09-06 Bristol-Myers Squibb Company Polynucleotide codant une nouvelle sous-unite beta du canal potassium humaine, k+betam3
WO2003037929A1 (fr) * 2001-11-01 2003-05-08 Bayer Healthcare Ag Polynucleotides codant des polypeptides du canal potassique humain
WO2003041496A1 (fr) * 2001-11-14 2003-05-22 Yamanouchi Pharmaceutical Co., Ltd. Animal transgenique
EP1475388A2 (fr) * 1999-07-20 2004-11-10 Merck & Co., Inc. Nouvelles sous-unites humaines du canal potassique sensible au calcium
EP1487964A2 (fr) * 2000-11-02 2004-12-22 Bristol-Myers Squibb Company Polynucleotide codant pour une nouvelle sous-unite alpha de canal potassique humain, k+alpham1, et variants de celui-ci
WO2005105838A2 (fr) * 2004-04-28 2005-11-10 Paradigm Therapeutics Limited Canal ionique
WO2006114647A1 (fr) * 2005-04-28 2006-11-02 Takeda Cambridge Limited Canal ionique
US8399663B2 (en) 2009-04-03 2013-03-19 Astellas Pharma Inc. Salt of 1,3,5-triazine-2,4,6-triamine derivative

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU7551494A (en) * 1994-07-28 1996-02-22 Human Genome Sciences, Inc. Human potassium channel 1 and 2 proteins
PT876491E (pt) * 1995-12-22 2009-07-14 Genzyme Corp Gene do síndroma qt longo que codifica para kvlqt1 e a sua associação com mink
EP0922763A1 (fr) * 1997-12-12 1999-06-16 Synthelabo Gène de canaux à potassium redressé vers l'intérieur et protéine

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PARTISETI M, ET AL.: "CLONING AND CHARACTERIZATION OF A NOVEL HUMAN INWARDLY RECTIFYING POTSSIUM CHANNEL PREDOMINANTLY EXPRESSED IN SMALL INTESTINE", FEBS LETTERS., ELSEVIER, AMSTERDAM., NL, vol. 434, 1 January 1998 (1998-01-01), NL, pages 171 - 176, XP002918904, ISSN: 0014-5793, DOI: 10.1016/S0014-5793(98)00972-7 *
See also references of EP1056765A4 *

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000022001A2 (fr) * 1998-10-13 2000-04-20 Sanofi-Synthelabo Nouveau canal potassique de la famille erg
WO2000022001A3 (fr) * 1998-10-13 2000-09-21 Sanofi Synthelabo Nouveau canal potassique de la famille erg
EP1155029A1 (fr) * 1999-02-23 2001-11-21 Icagen, Inc. Sous-unites de bk beta de canaux potassiques de famille slo
US7351553B2 (en) 1999-02-23 2008-04-01 Icagen, Inc. BK beta subunits of Slo family potassium channels
EP1155029A4 (fr) * 1999-02-23 2005-11-23 Icagen Inc Sous-unites de bk beta de canaux potassiques de famille slo
EP1475388A3 (fr) * 1999-07-20 2005-02-09 Merck & Co., Inc. Nouvelles sous-unites humaines du canal potassique sensible au calcium
EP1475388A2 (fr) * 1999-07-20 2004-11-10 Merck & Co., Inc. Nouvelles sous-unites humaines du canal potassique sensible au calcium
WO2001061006A2 (fr) * 2000-02-15 2001-08-23 Wyeth Canaux potassiques, sequences nucleotidiques codant ceux-ci et leurs procedes d'utilisation
WO2001061006A3 (fr) * 2000-02-15 2002-01-17 Basf Corp Canaux potassiques, sequences nucleotidiques codant ceux-ci et leurs procedes d'utilisation
WO2001085788A2 (fr) * 2000-05-10 2001-11-15 Pharmacia & Upjohn Company Canaux ioniques humains
WO2001085788A3 (fr) * 2000-05-10 2002-07-18 Upjohn Co Canaux ioniques humains
WO2002010389A3 (fr) * 2000-07-28 2003-05-22 Lexicon Genetics Inc Nouvelles proteines du canal ionique humain et polynucleotides codant ces dernieres
WO2002010389A2 (fr) * 2000-07-28 2002-02-07 Lexicon Genetics Incorporated Nouvelles proteines du canal ionique humain et polynucleotides codant ces dernieres
WO2002048369A2 (fr) * 2000-11-02 2002-06-20 Bristol-Myers Squibb Company Polynucleotide codant une nouvelle sous-unite beta du canal potassium chez l'homme, k+mbeta1
EP1487964A2 (fr) * 2000-11-02 2004-12-22 Bristol-Myers Squibb Company Polynucleotide codant pour une nouvelle sous-unite alpha de canal potassique humain, k+alpham1, et variants de celui-ci
EP1487964A4 (fr) * 2000-11-02 2005-07-20 Bristol Myers Squibb Co Polynucleotide codant pour une nouvelle sous-unite alpha de canal potassique humain, k+alpham1, et variants de celui-ci
WO2002048369A3 (fr) * 2000-11-02 2004-02-26 Bristol Myers Squibb Co Polynucleotide codant une nouvelle sous-unite beta du canal potassium chez l'homme, k+mbeta1
WO2002057452A2 (fr) * 2000-12-15 2002-07-25 Curagen Corporation Proteines, polynucleotides codant pour elles et leurs procedes d'utilisation
WO2002057452A3 (fr) * 2000-12-15 2003-08-21 Curagen Corp Proteines, polynucleotides codant pour elles et leurs procedes d'utilisation
WO2002066601A3 (fr) * 2001-01-24 2003-12-24 Bristol Myers Squibb Co Polynucleotide codant pour une nouvelle sous-unite beta de canal potassium humain, k+betam2
WO2002066601A2 (fr) * 2001-01-24 2002-08-29 Bristol-Myers Squibb Company Polynucleotide codant pour une nouvelle sous-unite beta de canal potassium humain, k+betam2
WO2002068587A2 (fr) * 2001-02-07 2002-09-06 Bristol-Myers Squibb Company Polynucleotide codant une nouvelle sous-unite beta du canal potassium humaine, k+betam3
WO2002068587A3 (fr) * 2001-02-07 2003-03-27 Bristol Myers Squibb Co Polynucleotide codant une nouvelle sous-unite beta du canal potassium humaine, k+betam3
WO2003037929A1 (fr) * 2001-11-01 2003-05-08 Bayer Healthcare Ag Polynucleotides codant des polypeptides du canal potassique humain
WO2003041496A1 (fr) * 2001-11-14 2003-05-22 Yamanouchi Pharmaceutical Co., Ltd. Animal transgenique
US7094948B2 (en) 2001-11-14 2006-08-22 Astellas Pharma, Inc. Transgenic animals
WO2005105838A2 (fr) * 2004-04-28 2005-11-10 Paradigm Therapeutics Limited Canal ionique
WO2005105838A3 (fr) * 2004-04-28 2006-03-30 Paradigm Therapeutics Ltd Canal ionique
WO2006114647A1 (fr) * 2005-04-28 2006-11-02 Takeda Cambridge Limited Canal ionique
US8399663B2 (en) 2009-04-03 2013-03-19 Astellas Pharma Inc. Salt of 1,3,5-triazine-2,4,6-triamine derivative

Also Published As

Publication number Publication date
AU2780999A (en) 1999-09-15
EP1056765A4 (fr) 2003-07-30
AU747846B2 (en) 2002-05-23
EP1056765A1 (fr) 2000-12-06
CA2321194A1 (fr) 1999-09-02

Similar Documents

Publication Publication Date Title
EP1066324B1 (fr) Nouveaux recepteurs de mammiferes couples a la proteine g et presentant des zones de repetition riches en leucine
WO1999043696A1 (fr) Genes humains du canal potassique
US20100273256A1 (en) Human Potassium Channel Genes
EP1141282A2 (fr) Genes humains transporteurs d'anions atnov
EP1194447B1 (fr) Nouveaux canaux potassiques et genes codant ces canaux potassiques
US20090117590A1 (en) Human calcium sensitive potassium channel beta3 subunit proteins, encoding nucleic acid and uses thereof
SE523043C2 (sv) Humant intestinalt Npt2B
US5705380A (en) Identification of a gene encoding TULP2, a retina specific protein
WO2000059936A1 (fr) Sequences nucleotidiques codant la neurogenine 3 humaine
WO1999049735A1 (fr) Transporteur abc apparente a mrp codant des acides nucleiques et procede d'utilisation dudit transporteur
US6383792B1 (en) RAQ genes and their uses
US20040053812A1 (en) Methods
US20040093627A1 (en) Methods
US20050026248A1 (en) Novel mammalian G-protein coupled receptors having extracellular leucine rich repeat regions
US5776762A (en) Obesity associated genes
US7312026B2 (en) MRP-related ABC transporter encoding nucleic acids and methods of use thereof
WO1999038975A2 (fr) Sequences polynucleotidiques et polypeptidiques associees a un phenomene de sensibilite aux depresseurs du systeme nerveux central
US20040093626A1 (en) Methods
US5770432A (en) Obesity associated genes
US20040242468A1 (en) Gene involved in mineral deposition and uses thereof
US20050250720A1 (en) Novel compound
EP1334190A2 (fr) Recepteur couple a la proteine g humaine et utilisations de celui-ci

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2321194

Country of ref document: CA

Ref country code: CA

Ref document number: 2321194

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999908356

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 27809/99

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 1999908356

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 10121746

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 27809/99

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 10976647

Country of ref document: US

Ref document number: 10976644

Country of ref document: US