WO2000008134A2 - SERINE PROTEASE DE HtrA HUMAINE - Google Patents
SERINE PROTEASE DE HtrA HUMAINE Download PDFInfo
- Publication number
- WO2000008134A2 WO2000008134A2 PCT/EP1999/005528 EP9905528W WO0008134A2 WO 2000008134 A2 WO2000008134 A2 WO 2000008134A2 EP 9905528 W EP9905528 W EP 9905528W WO 0008134 A2 WO0008134 A2 WO 0008134A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- htra
- expression
- human
- amino acid
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
Definitions
- Osteoarthritis the most prevalent form of degenerative joint disease, involves chondrocyte loss and breakdown of extracellular matrix components, leading to degeneration of articular cartilage and eventual deterioration of joint function (1 ).
- OA is characterized by degeneration and loss of articular cartilage and alterations of subchondral bone. Although it is the most common of the rheumatic diseases, its pathogenesis is not well understood (6). The disorder may be secondary to other diseases that cause joint deformity or to repeated joint trauma, but in many patients, no such associated factor is present. The incidence of osteoarthritis increases with age, but the disease is not caused solely by aging of articular tissues. The pathology differs from that of the inflammatory rheumatic diseases, such as rheumatoid arthritis, in that osteoarthritis is associated with only minor degrees of inflammation.
- Chondrocytes the exclusive cell-type in cartilage, maintain the integrity of the collagen/proteoglycan network by responding to a variety of stresses, including normal mechanical load as well as abnormal trauma and injury (5).
- the cellular response to stress stimuli occurs through the regulation of a myriad of signal transduction pathways leading to alterations in gene expression.
- HtrA is a critical component of the universal cellular response to stress, characterized by the induction of a set of so-called “heat shock” proteins (19). In addition to temperature elevation, heat shock proteins are induced by oxidative stress (20), viral (phage) infection (21), and intracellular expression of aberrant proteins (22). A functional htrA (high temperature requirement) gene is indispensable for the bacterial cell to survive heat shock (11 ). HtrA is identical to DegP (23), a serine endoprotease originally named "Do” as one of several proteolytic activities purified from E. coli (24).
- HtrA Mutation of the active site serine- 236 to alanine in HtrA results in loss of protease activity in vitro and loss of function, as determined by the inability to suppress the thermosensitivity of htrA null mutants (11).
- ORF480 The nucleotide sequence of ORF480 is identical to a recently described "transformation-sensitive" cDNA expressed in human fibroblasts (8).
- ORF480 codes for a protein with distinct domains of homology to human mac25 (9) and to the bacterial serine protease (HtrA) that is critical for the cellular response to thermal and oxidative stress (10-11).
- HtrA the gene and gene product of ORF480 is referred to herein as "HtrA", “HtrA cDNA”, “HtrA mRNA”, “human HtrA”, “human HtrA homologue”, “HtrA protein” and “HtrA polypeptide”.
- an aspect of the present invention encompasses assay techniques for detecting arthritic conditions by measuring human HtrA expression levels in bodily samples, preferably body tissue and fluid samples.
- a preferred embodiment of the assay aspect of the invention provides assays for measuring human HtrA mRNA expression in body tissue samples derived from a patient.
- Another embodiment of the assay aspect of the invention provides assays for measuring human HtrA polypeptide levels comprising incubating a body tissue or fluid sample, which has been obtained from a patient, with an anti-human HtrA antibody and measuring the level of bound anti-human HtrA antibody in the body tissue or fluid sample.
- human HtrA antagonists inhibitors
- methods for identifying such antagonists wherein such antagonists reduce or prevent the effect of human HtrA polypeptide.
- preferred antagonists are those which mimic human HtrA so as to bind to human HtrA receptor or binding molecules but do not elicit a human HtrA- induced response or more than one human HtrA-induced response.
- antagonists which are small molecules and antibodies and the like which bind to human HtrA polypeptide and regulate its biological activity.
- Also among preferred antagonists are molecules that bind to or interact with human HtrA so as to inhibit an effect of human HtrA or more than one effect of human HtrA or which prevent expression of human HtrA.
- assays for detecting antagonists to human HtrA which regulate human HtrA expression and/or activity there is provided anti-sense polynucleotides which regulate transcription of the human HtrA gene.
- HtrA polypeptides particularly human HtrA polypeptides, that are differentially expressed in arthritic conditions and therefore, when detected via assay, allows a diagnosis of arthritic conditions.
- the polypeptide comprises the sequence shown in Fig. 1 (SEQ ID NO:2).
- novel polypeptides of human origin as well as biologically, diagnostically or therapeutically useful fragments, variants and derivatives thereof, variants and derivatives of the fragments, and analogs of the foregoing.
- methods for producing the aforementioned human HtrA polypeptides comprising culturing host cells having expressibly incorporated therein a vector containing an exogenously- derived human HtrA-encoding polynucleotide under conditions for expression of human HtrA polypeptides in the host and then recovering the expressed polypeptide.
- antibodies against human HtrA polypeptides and methods for their production.
- the antibodies are highly selective for human HtrA polypeptides or portions of human HtrA polypeptides.
- kits comprising the components necessary for detecting an above-normal expression of human HtrA polynucleotides or polypeptides in body tissue samples derived from a patient.
- FIG. 1 Identification of differential display clones 49A50 and 58A5.
- Magnified phosphor screen images of two separate differential display gels show the PCR products, indicated by the arrows, corresponding to 49A50 (left panel) and 58A5 (right panel) amplified by RT-PCR from mRNA isolated from osteoarthritic cartilage (OA, individual patients indicated by numbers) or non- arthritic cartilage (NA, individual samples indicated by letters).
- OA osteoarthritic cartilage
- NA non- arthritic cartilage
- FIG. 1 Schematic illustration of ORF480 cDNA clones and protein coding domains.
- Genbank entry D87258, illustrated as a shaded bar is a 2036 bp cDNA from human osteoblasts (SEQ ID NO:1) containing a 480 codon open reading frame (lighter shaded area) encoded by nucleotide 49 to nucleotide 1491 of SEQ ID NO:1.
- Overlapping differential display PCR products 49A50 and 58A5
- EST sequences acces numbers W47107 and W67176
- cDNA3/ORF480 cDNA3/ORF480
- the mac25 and HtrA homology domains within ORF480 are indicated as open rectangles, preceded by the secretory signal sequence (S).
- the Kazal-type inhibitor motif (Kl) within the mac25 domain and the PDZ-related sequence within the HtrA domain are depicted as open triangles.
- ORF480 contains a Kazal-type inhibitor motif within the mac25 homology domain.
- the Kazal-type inhibitor motif is outlined by a rectangle.
- Figure 4 Elevated levels of ORF480-encoded HtrA mRNA and protein in human OA cartilage.
- COL3A and COL2A are abbreviations for pro-alpha1 (III) and pro-alpha1 (II) collagens, respectively.
- Figure 5 Expression of ORF480 cDNA and functional analysis of its encoded protein, HtrA.
- Samples 1 and 2 are negative controls; samples 3-7 are from independent clones expressing decreasing levels of HtrA protein. Specific HtrA-generated cleavage products of ⁇ -casein are indicated by the arrows.
- the high-molecular weight protein band (marked with * in panels B, C, and D), detected by immunoblot analysis with anti-HtrA antibody, is a stable complex of HtrA and ⁇ -1 -antitrypsin (hereinafter "AAT").
- AAT ⁇ -1 -antitrypsin
- FIG. 6 Mammalian HtrA is highly conserved.
- A) Human ORF480 cDNA hybridizes to genomic DNA of several species.
- a ZOO BLOT (Clontech), containing of EcoR l-digested genomic (4 ⁇ g DNA per lane) from different vertebrate species (indicated above each lane), was hybridized with the HtrA- related segment of ORF480 as described in Example 8.
- ORF480 residues are indicated ( * ) above the ORF480 residues.
- the 16 cysteine residues in the amino-terminal domain of ORF480 are underlined.
- the conserved serine protease active site sequence (39) is outlined by a rectangle, with the serine residue of the active site shaded.
- Identical residues between human, bovine (SEQ ID NO:29), rabbit (SEQ ID NO:30), and guinea pig (SEQ ID NO:31) HtrA homologues are denoted with a hyphen, and the actual amino acid substitutions in each species are shown.
- Identity refers to a polynucleotide or polypeptide sequence which comprises a percentage of the same bases as a reference polynucleotide or polypeptide (SEQ ID NO:1 or SEQ ID NO:2).
- a polynucleotide or polypeptide which is at least 90% identical to a reference polynucleotide or polypeptide has polynucleotide bases or amino acid residues which are identical in 90% of the bases or residues which make up the reference polynucleotide or polypeptide and may have different bases or residues in 10% of the bases or residues which comprise that polynucleotide or polypeptide sequence.
- Exemplary algorithms for determining "identity" are the BLAST program (Basic Local Alignment Search Tool at the National Center for Biological Information) and FAST program. "Identity" may be determined by procedures which are well-known in the art.
- Plasmids generally are designated herein by a lower case p preceded and/or followed by capital letters and/or numbers, in accordance with standard naming conventions that are familiar to those of skill in the art.
- Starting plasmids disclosed herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids by routine application of well known, published procedures.
- Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those of skill in the art.
- those of skill readily may construct any number of other plasmids suitable for use in the invention. The properties, construction and use of such plasmids, as well as other vectors, in the present invention will be readily apparent to those of skill from the present disclosure.
- isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
- Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
- polypeptide is used interchangeably herein with the terms “compound(s)”, “polypeptides” and “protein(s)”.
- the present invention relates to human HtrA polypeptides, among other things, as described in greater detail below.
- Human HtrA exhibits autocatalytic cleavage and endoproteolytic activity against an exogenous substrate, for example, ⁇ -casein.
- HtrA protein when incubated in the presence of serum, binds to and forms a stable complex with AAT.
- sequence of the HtrA- related domain of ORF480 is highly conserved among mammalian species as shown in Fig. 6.
- Human HrtA cDNA encodes a protein with two distinct domains of homology.
- the amino terminal domain is homologous to mac25, a recently characterized gene product related to IGF-BP (9) and follistatin (16).
- the second domain comprising the majority of the amino acid sequence, is greater than 40% identical to bacterial HtrA serine protease. Based on the conservation of HrtA polynucleotide sequence at the DNA level in mammals and at the amino acid level in bacteria, and on the biological activity of human HtrA, it is believed that function is also conserved.
- HtrA is involved in cell growth regulation, perhaps via modulation of growth factor systems other than IGF, e.g. the activin/inhibin system (28).
- ORF480-encoded protein which is conserved in a diverse group of serine protease inhibitors, also occurs within mac25, follistatin, and agrin.
- Agrin and agrin-related proteins appear to function as extracellular components that bind to and regulate the activity of growth factors (29).
- Recombinant agrin has been shown to inhibit serine proteases of the trypsin class, but not the thrombin class (30).
- the presence of the protease inhibitor motif in ORF480 suggests that the human HtrA serine protease is a self- regulating enzyme which also regulates other serine proteases.
- the translated sequence of Genbank entry D87258 contains an open reading frame of 480 amino acids ((ORF480) SEQ ID NO:2).
- the DNA sequence of clone C05 was identical to bases 477- 2036 of SEQ ID NO:1 (D87258), except for a 1 bp difference (most probably due to a PCR-generated error).
- RT-PCR analysis indicated that the mRNA for ORF480 is expressed in human placenta and in normal human dermal fibroblasts. Overlapping PCR- generated fragments corresponding to the entire ORF480 were isolated from cDNA derived from fibroblast RNA.
- the DNA sequence of the fibroblast-derived ORF480 cDNA was determined to be identical to Genbank entry D87258.
- PDZ domains include bacterial HtrA, as well as the human HtrA homologue.
- the location of the PDZ domain within ORF480 is indicated schematically in Fig. 2.
- 4A are data for both type II (COL2A) and type III (COL3A) collagen mRNA, also identified in the differential display screening, show that levels of these transcripts are significantly elevated in the OA-derived samples used, a finding consistent with previous reports of induced collagen synthesis in remodeling OA cartilage (17).
- a cDNA segment containing the entire coding region of ORF480 was inserted into expression vector pcDNA3 (see Experiment 7 and Fig. 2).
- This construct directed the expression of the expected size protein (-50 kDa) in an in vitro transcription/translation system (Fig. 5A, lanes 1 and 2).
- Lower molecular weight products (-40-45 kDa) were also evident in the gel electrophoresis pattern, a pattern remarkably similar to that observed for E. co// HtrA protein (11 ,18).
- Converting the conserved active-site serine-328 in ORF480 to alanine by site-directed mutagenesis resulted in the elimination of the lower molecular weight proteins (Fig. 5A, lanes 3 and 4).
- This result which was previously shown for E. co// HtrA (18), demonstrates that the translation product of ORF480, the human HtrA protein, is a serine protease with autocatalytic activity.
- Human 293 cells transfected with expression vector pcDNA3/ORF480 synthesize and secrete a 50 kDa protein as detected by immunoblot analysis (Fig.5B) using HtrA-specific antiserum.
- the media from different clones derived from transfected 293 cells contain an endoprotease that cleaves ⁇ -casein, resulting in at least 4 distinct fragments of the substrate that can be resolved by SDS-PAGE.
- the level of proteolytic activity in each sample shown in lower panel of Fig. 5B, correlates with the relative amount of immunoreactive HtrA protein in the immunoblot shown in the upper panel.
- the Ser328Ala mutant of ORF480 does not digest ⁇ -casein.
- ORF480-encoded protein observed in the cell- free expression system described above is also evident when the protein is produced in cell culture over an extended time period.
- ORF480 is expressed in baculovirus infected Sf9 cells (Fig. 5C)
- the primary translation product (-50 kDa), which is comprised of amino acids 30 to 480 of SEQ ID NO:2, appears in the culture medium between 24 and 41 hr post-infection.
- a set of lower molecular weight proteins become apparent by immunoblot analysis.
- proteins are a 42 kDa protein which is amino acids 99 to 480 of SEQ ID NO:2; a 38 kDa protein which is amino acids 30 to 373 of SEQ ID NO:2; and a 30 kDa protein which is amino acids 99 to 373 of SEQ ID NO:2.
- the endoproteolytic activity against ⁇ -casein shown in the lower panel of Fig. 5C, is notably elevated in samples from later incubation times.
- the mammalian HtrA gene is evolutionarily conserved
- Figure 6A shows a genomic "zoo blot" analysis, where total EcoR I -digested genomic DNA isolated from various mammalian and one avian species, was hybridized with 32 P-labeled human cDNA under relatively high stringency as shown in Example 8.
- the results which show specific hybridization to a limited number of genomic DNA fragments, show that the gene sequence coding for the HtrA-related domain of ORF480 is conserved among vertebrate species.
- This interpretation was confirmed by analysis of the nucleotide sequences of partial ORF480 cDNA clones isolated from bovine, guinea pig, and rabbit, which are 91%, 89%, and 88% identical to the human sequence, respectively.
- the amino acid sequences derived from the respective cDNA sequences of the three mammalian species are 98% identical to the human sequence (Fig 6B).
- the present invention relates to assays for diagnosing disease conditions by quantifying the level of expression of human HtrA in a body tissue sample derived from a patient.
- Disease states include but are not limited to, arthritis such as osteoarthrits (OA), and cancer.
- OA osteoarthrits
- a method of diagnosing OA by quantifying human HtrA mRNA expression in a body tissue sample derived from a patient.
- suitable body tissues include but are not limited to cartilage, blood, serum, saliva, urine, synovial fluid, etc.
- cartilage is removed from a patient and reverse transcriptase-polymerase chain reaction (RT- PCR) is used to quantify the level of human HtrA mRNA expression in the cartilage sample.
- the level of human HtrA mRNA thus quantified is then compared to the level of human HtrA mRNA expression from a host known not to have osteoarthritic conditions and referred to herein as a control. If the level of human HtrA from the patient being diagnosed is substantially higher than that of the control this will indicate to the attending medical professional the onset of OA.
- a substantially higher level of expression in this context refers to about three times or greater expression in the patient as compared to the control.
- the patient is a human and the human HtrA is human HtrA mRNA.
- RNAzol B system Biotecx Laboratories, Inc. 6023 South Loop East, Houston, TX 77033. An acceptable quantity of total RNA is isolated from tissue samples. The RNA is size resolved by electrophoresis through a 1% agarose gel under strongly denaturing conditions. RNA is blotted from the gel onto a nylon filter, and the filter then is prepared for hybridization to a detectably labeled polynucleotide probe.
- the antisense strand of the coding region of the human HtrA cDNA is labeled to a high specific activity.
- the cDNA is labeled by primer extension, using the Prime-It kit, available from Stratagene.
- the reaction is carried out using cDNA, following the standard reaction protocol as recommended by the supplier.
- the labeled polynucleotide is purified away from other labeled reaction components by column chromatography using a Select-G-50 column, obtained from 5-Prime - 3-Prime, Inc. of 5603 Arapahoe Road, Boulder, CO 80303.
- the labeled probe is hybridized to the filter, at a concentration of 1 ,000,000 cpm/ml, in a small volume of 7% SDS, 0.5 M NaP04, pH 7.4 at 65°C, overnight. Thereafter the probe solution is drained and the filter is washed twice at room temperature and twice at 60°C with 0.5 x SSC, 0.1% SDS. The filter then is dried and exposed to film at -70°C overnight with an intensifying screen. Autoradiography shows the level of human HtrA mRNA.
- the present invention also relates to diagnostic assays such as quantitative and diagnostic assays for detecting levels of human HtrA polypeptide in cells and tissues, including determination of normal and abnormal levels.
- diagnostic assays such as quantitative and diagnostic assays for detecting levels of human HtrA polypeptide in cells and tissues, including determination of normal and abnormal levels.
- a diagnostic assay in accordance with the invention for detecting over-expression of human HtrA polypeptide compared to normal control tissue samples may be used to detect the presence of arthritis, including but not limited to osteoarthritis and rheumatoid arthritis, and other diseases such as cancer, for example.
- Assay techniques that can be used to determine levels of a polypeptide, such as a human HtrA polypeptide of the present invention, in a sample derived from a host, are well- known to those of skill in the art.
- Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays. Among these ELISAs frequently are preferred.
- An ELISA assay initially requires preparing an antibody specific to the antigen, human HtrA, which can be monoclonal or polyclonal.
- a reporter antibody is prepared which binds to the specific antibody, or directly to the antigen itself.
- a detectable entity such as a radioactive, fluorescent or enzymatic reagent, in this example horseradish peroxidase enzyme.
- the specific antibody to HtrA is first incubated on a solid support, e.g. a polystyrene well, that binds the antibody permanently. Any free binding sites on the wells are then covered by incubating with an unrelated protein such as bovine serum albumin (hereinafter "BSA"). Next, sample removed from a host is incubated on the antibody bound to the wells; standards with known amounts of antigen may also be included to provide a quantitative measure.
- BSA bovine serum albumin
- a second specific antibody to HtrA which either is a monoclonal or polyclonal antibody different from the first antibody used to coat the well, or is a specific antibody already conjugated to a detection reagent, is incubated in the wells. During this time the second antibody attaches to any human HtrA polypeptides attached to the first antibody coated on the polystyrene well. Unbound antibody is washed out with buffer. If a reporter conjugated antibody has not already been used, a third antibody linked to a reporter molecule, e.g. horseradish peroxidase, is placed in the dish which can bind to the second antibody without binding to the first antibody used to coat the plate.
- a reporter conjugated antibody e.g. horseradish peroxidase
- Unattached reporter antibody is then washed out.
- a reagent to detect peroxidase activity for example a colorimetric substrate, is then added to the well.
- Immobilized peroxidase, linked to human HtrA polypeptide through the antibodies, produces a colored reaction product.
- the amount of color developed in a given time period indicates the amount of human HtrA polypeptide present in the sample.
- Quantitative results typically are obtained by reference to a standard curve.
- antibodies may be used to quantify the amount of a protein present in a sample wherein antibodies specific to human HtrA polypeptide are attached to a solid support and a sample derived from the host is passed over the solid support. The antibody is then eluted and the amount of bound HtrA polypeptide is quantified. The amount of HtrA polypeptide detected can be correlated to a quantity of human HtrA polypeptide in the sample.
- the preferred body tissues employed for the above- described assays are cartilage extracts, synovial fluid, blood serum and urine with synovial fluid and serum being most preferred.
- a substantially higher level of expression in this context refers to three times or greater expression in the patient as compared to the control.
- the patient is a human and the human HtrA is human HtrA protein.
- the present invention further relates to polypeptides which have the deduced amino acid sequence of Fig. 6 (SEQ ID NO:2), as well as fragments, derivatives and analogs of such polypeptide.
- fragment fragment
- derivative derivative
- analogs of such polypeptide fragments, derivatives and analogs of such polypeptide.
- polypeptide 6 means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
- an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active polypeptide.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
- the fragments, derivatives or analogs of the polypeptide of Fig. 6 may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the polypeptide or a proprotein sequence.
- Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
- polypeptides of the present invention include the polypeptide of SEQ ID NO:2 as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) and even more preferably at least 97% similarity (still more preferably at least 97% identity) and most preferably at least 99% similarity (still more preferably at least 99% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
- similarity or “identity” between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. Similarity or identity may be determined by procedures which are well-known in the art, for example, a BLAST program (Basic Local Alignment Search Tool at the National Center for Biological Information).
- a variant, i.e. a "fragment”, “analog” or “derivative” polypeptide, and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
- all variants of the amino acid sequence of SEQ ID NO:2 will contain the minimum protease domain which is a fragment containing amino acid 161 to amino acid 373 of SEQ ID NO:2. This was determined by expressing the amino acid 191 to amino acid 480 fragment and determining that it lacked protease activity. The 161 to 373 amino acid fragment of SEQ ID NO:2 was then expressed and which was determined to be active, thereby defining the minimum protease domain.
- substitutions are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid by another amino acid of like character. Conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and He; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
- Host cells can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention.
- polynucleotides may be introduced into host cells using well known techniques of infection, transduction, transfection, transvection and transformation.
- the polynucleotides may be introduced alone or with other polynucleotides.
- Such other polynucleotides may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention.
- polynucleotides may be transfected into host cells with another, separate, polynucleotide encoding a selectable marker, using standard techniques for co-transfection and selection in, for instance, mammalian cells.
- the polynucleotides generally will be stably inco ⁇ orated into the host cell genome.
- the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
- the vector construct may be introduced into host cells by the aforementioned techniques.
- a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid.
- Electroporation also may be used to introduce polynucleotides into a host. If the vector is a virus, it may be packaged in vitro or introduced into a packaging cell and the packaged virus may be transduced into cells.
- the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double- stranded RNA or DNA viral vector.
- Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells.
- the vectors, in the case of phage and viral vectors also may be and preferably are introduced into cells as packaged or encapsidated virus by well known techniques for infection and transduction.
- Viral vectors may be replication competent or replication defective. In the latter case viral propagation generally will occur only in complementing host cells.
- vectors are those for expression of polynucleotides and polypeptides of the present invention.
- such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleotide to be expressed.
- Appropriate trans-acting factors either are supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
- the vectors provide for specific expression.
- Such specific expression may be inducible expression or expression only in certain types of cells or both inducible and cell-specific.
- Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives.
- a variety of vectors suitable to this aspect of the invention, including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art.
- the engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, selecting transformants or amplifying genes.
- Culture conditions such as temperature, pH and the like, previously used with the host cell selected for expression generally will be suitable for expression of polypeptides of the present invention as will be apparent to those of skill in the art.
- vectors can be used to express a polypeptide of the invention.
- Such vectors include chromosomal, episomal and virus-derived vectors e.g., vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids, all may be used for expression in accordance with this aspect of the present invention.
- any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be used for expression in this regard.
- the appropriate DNA sequence may be inserted into the vector by any of a variety of well-known and routine techniques, in general, a DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA ligase. Procedures for restriction and ligation that can be used to this end are well known and routine to those of skill. Suitable procedures in this regard, and for constructing expression vectors using alternative techniques, which also are well known and routine to those skill, are set forth in great detail in Sambrook et al. cited elsewhere herein.
- the DNA sequence in the expression vector may be operatively linked to appropriate expression control sequence(s), including, for instance, a promoter to direct mRNA transcription.
- promoters include the phage lambda PL promoter, the E. coli lac, tip and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name just a few of the well-known promoters. It will be understood that numerous promoters not mentioned are suitable for use in this aspect of the invention are well known and readily may be employed by those of skill in the manner illustrated by the discussion and the examples herein.
- expression constructs will contain sites for transcription initiation and termination, and, in the transcribed region, a ribosome binding site for translation.
- the coding portion of the transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated.
- constructs may contain control regions that regulate as well as engender expression.
- control regions that regulate as well as engender expression.
- such regions will operate by controlling transcription, such as repressor binding sites and enhancers, among others.
- Vectors for propagation and expression generally will include selectable markers. Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose.
- the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.
- Preferred markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and tetracycline, theomycin, kanamycin or ampicillin resistance genes for culturing E. coli and other bacteria.
- the vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide.
- appropriate hosts include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Hosts for a great variety of expression constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptides in accordance with this aspect of the present invention.
- mammalian cell culture systems can be employed for expression, as well.
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblast, described in Gluzman et al., Cell 23: 175 (1981).
- Other cell lines capable of expressing a compatible vector include for example, the C127, 3T3, CHO, HeLa, human kidney 293 and BHK cell lines.
- the present invention also includes recombinant constructs, such as expression constructs, comprising one or more of the sequences described above.
- the constructs comprise a vector, such as a plasmid or viral vector, into which such a sequence of the invention has been inserted.
- the sequence may be inserted in a forward or reverse orientation.
- the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
- suitable vectors and promoters are known to those of skill in the art, and there are many commercially available vectors suitable for use in the present invention.
- vectors which are commercially available, are provided by way of example.
- preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; pcDNA3 available from Invitrogen; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
- These vectors are listed solely by way of illustration of the many commercially available and well known vectors that are available to those of skill in the art for use in accordance with this aspect of the present invention. It will be appreciated that any other plasmid or vector suitable for, for example, introduction, maintenance, propagation or expression of a polynucleotide or polypeptide of the invention in a host may be used in this aspect of the invention.
- Promoter regions can be selected from any desired gene using vectors that contain a reporter transcription unit lacking a promoter region, such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment; i.e., a fragment that may contain a promoter.
- a reporter transcription unit lacking a promoter region such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment; i.e., a fragment that may contain a promoter.
- introduction into the vector of a promoter- containing fragment at the restriction site upstream of the cat gene engenders production of CAT activity, which can be detected by standard CAT assays.
- Vectors suitable to this end are well known and readily available. Two such vectors are pKK232-8 and pCM7.
- promoters for expression of polynucleotides of the present invention include not only
- bacterial promoters suitable for expression of polynucleotides and polypeptides in accordance with the present invention are the E. coli lad and lacZ promoters, the T3 and T7 promoters, the T5 tac promoter, the lambda PR, PL promoters and the trp promoter.
- known eukaryotic promoters suitable in this regard are the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus ("RSV”), and metallothionein promoters, such as the mouse metallothionein-l promoter.
- RSV Rous sarcoma virus
- recombinant expression vectors will include origins of replication, a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence, and a selectable marker to permit isolation of vector containing cells after exposure to the vector.
- the present invention also relates to host cells containing the above-described constructs discussed above.
- the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
- Constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
- the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers. Proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
- the invention also provides a method of identifying antagonists which reduce or block the action of human HtrA protein, such as its interaction with human HtrA- binding molecules such as receptor molecules or with HtrA itself.
- a cellular compartment such as a membrane or a preparation thereof, such as a membrane-preparation, may be prepared from a cell that expresses a molecule that binds human HtrA protein, such as a molecule of a signaling or regulatory pathway modulated by human HtrA protein.
- the preparation is incubated with labeled human HtrA protein in me absence or the presence of a candidate molecule which may be a human HtrA antagonist.
- Human HtrA-like effects of potential antagonists may by measured, for instance, by determining activity of a second messenger system following interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of human HtrA or molecules that elicit the same effects as human HtrA.
- Second messenger systems that may be useful in this regard include but are not limited to AMP guanylate cyclase, ion channel or phosphoinositide hydrolysis second messenger systems.
- an assay for identifying human HtrA antagonists is a competitive assay that combines human HtrA and a potential antagonist with a known HtrA substrate, for example, the insulin chain ⁇ (Sigma) as set forth in Example 11.
- a competitive inhibition assay including optimal kinetic parameters are first determined with HtrA and insulin chain ⁇ .
- Human HtrA activity is determined by measuring the disappearance of the substrate using HPLC.
- the same assay is then performed in the presence of a potential inhibitor or antagonist and the rate of disappearance of the substrate is again measured to determine the effectiveness of the candidate antagonist.
- Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and thereby inhibit or extinguish its activity. Potential antagonists also may be a polypeptide such as a closely related protein or antibody that binds the same sites on a binding molecule, such as a receptor molecule, without inducing human HtrA-induced activities, thereby preventing the action of human HtrA by excluding human HtrA from binding.
- antisense molecules for preventing expression of the HtrA gene.
- Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation.
- Antisense techniques are discussed, for example, in - Okano, J. Neurochem. 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
- Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241 : 456 (1988); and Dervan et al., Science 251 : 1360 (1991).
- the methods are based on binding of a polynucleotide to a complementary DNA or RNA.
- the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
- a DNA oligonucleotide is designed to be complementary to a region of the gene (or promotor) involved in transcription thereby preventing transcription and the production of human HtrA.
- the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into human HtrA polypeptide.
- the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of human HtrA.
- the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
- the antagonists may be employed for instance to treat and/or prevent arthritis, including but not limited to osteoarthritis, rheumatoid arthritis, and cancer.
- the polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.
- the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
- Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides or a fragment thereof into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide. The antibodies may also be used to bind a soluble form of the polypeptide and therefore render it ineffective to perform its intended biological function. See Example 10.
- any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C, Nature 256: 495-497 (1975), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., Immunology Today 4: 72 (1983) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., pg. 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985).
- the above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or purify the polypeptide of the present invention by attachment of the antibody to a solid support for isolation and/or purification by affinity chromatography.
- Example 10 A specific example of the use of the polypeptide, or a portion thereof, of the present invention to prepare an antibody specific therefore is set forth in Example 10.
- HtrASP-1 amino acid 191 to 480 of SEQ ID NO:2
- the present invention also includes a kit for performing the assay aspect of the invention.
- a kit for performing the assay aspect of the invention includes vials or vessels for incubating a body tissue sample, the components necessary for quantifying human HtrA polynucleotides, for example, via RT-PCR.
- a kit for quantifying human HtrA polypeptide may contain anti-HtrA antibodies, for example, the antibodies may be prepared via the procedure set forth in Example 10.
- the invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the antagonists or inhibitors of the invention.
- Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration.
- the antagonist or inhibitor compounds of the present invention may be administered as pharmaceutical compositions either alone or in conjunction with other compounds, such as therapeutic compounds.
- compositions may be administered in any effective, convenient manner including, for instance, administration by topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others.
- compositions generally are administered in an amount effective for treatment or prophylaxis of a specific indication or indications.
- the compositions are administered in an amount of at least about 10 ⁇ g/kg body weight. In most cases they will be administered in an amount not in excess of about 8 mg/kg body weight per day. Preferably, in most cases, dose is from about 10 ⁇ g/kg to about 1 mg/kg body weight, daily. It will be appreciated that optimum dosage will be determined by standard methods for each treatment modality and indication, taking into account the indication, its severity, route of administration, complicating conditions and the like.
- HtrA polynucleotides, polypeptides and antagonists that are polypeptides may be employed in accordance with the present invention by expression of such polypeptides in vivo, in treatment modalities often referred to as "gene therapy.”
- cells from a patient may be engineered with a polynucleotide, such as a DNA or RNA, encoding a polypeptide ex vivo, and the engineered cells then can be provided to a patient to be treated with the polypeptide.
- a polynucleotide such as a DNA or RNA
- cells may be engineered ex vivo by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
- cells may be engineered in vivo for expression of a polypeptide in vivo by procedures known in the art.
- a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above.
- the retroviral expression construct then may be isolated and introduced into a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
- These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
- Retroviruses from which the retroviral plasmid vectors herein above mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
- the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
- Such vectors well include one or more promoters for expressing the polypeptide.
- Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller et al., Biotechniques 7: 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, RNA polymerase III, and ⁇ -actin promoters).
- CMV cytomegalovirus
- viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
- Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs herein above described); the ⁇ -actin promoter; and human growth hormone promoters.
- the promoter also may be the native promoter which controls the gene encoding the polypeptide
- the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
- packaging cells which may be transfected include, but are not limited to, the PE501 , PA317, Y-2, Y-AM, PA12, T19-14X, VT-19- 17-H2, YCRE, YCRIP, GP+E-86, GP+envAm12, and DAN cell lines as described in Miller, A., Human Gene Therapy 1 : 5-14 (1990).
- the vector may be transduced into the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP04 precipitation.
- the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
- the producer cell line will generate infectious retroviral vector particles, which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed to transduce eukaryotic cells, either in vitro or in vivo.
- the transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide.
- Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
- RNA from OA and non-arthritic human cartilage was isolated according to the method of Amin, A.R., et al. (1997) J. Clin. Invest 99, 1231-1237 and supplied to our laboratories by Drs. I. Patel and A. Amin (Hospital for Joint Diseases, New York University Medical School). Independent biochemical analyses of the isolated cartilage (R. Goldberg, personal communication), as well as the differential mRNA expression of type II and type III collagens were consistent with the indicated pathological state of the samples used in these examples.
- First strand cDNA was synthesized from 0.2 ⁇ g of total RNA with each of the 3 anchored oligo-dT primers from GenHunter Corporation. The reaction (20 ⁇ l) was carried out at 37°C for 60 min.
- 1 ⁇ l of the cDNA served as template in a 10 ⁇ l reaction mix containing 10 mM Tris-HCI (pH 8.4), 1.5 mM MgCI 2 , 50 mM KCI, 0.001 % gelatin, 2 ⁇ M dNTPs, 0.2 ⁇ M of 5' arbitrary primer (AP-49 or AP-58 from the RNAimage kits obtained from GenHunter Corporation), 2 ⁇ M of the same anchored primer used in the cDNA synthesis, 5 ⁇ Ci of ⁇ -[ 33 P]dATP (2,000 Ci/mmole, Dupont-New England Nuclear) and 2.5 units of AmpliTaq DNA polymerase (Perkin-Elmer).
- PCR products were resolved on a denaturing polyacrylamide gel and visualized by autoradiography of the dried gel.
- PCR products of interest were excised from the gel, and the DNA was eluted and re- amplified by PCR using the same primers and conditions described above, excluding the radio-labeled nucleotide.
- PCR products were analyzed on a 1.5% agarose gel and ligated into the cloning vector PCR II 2.1 (TA cloning Kit, Invitrogen).
- Clones of the PCR-generated fragments were obtained by transformation of E. coli strain DH5 ⁇ (Gibco/BRL). DNA sequences were determined for ⁇ t least 3 independent clones of each fragment using Dye Terminator Cycle Sequencing on an ABI PRISM 377 DNA sequencing system (Perkin-Elmer).
- Example 2 Quantification of PCR Products
- GGAGTCCTGTGGCATCCACGAAACTAC (SEQ ID NO: 14) and reverse: CACATCTGCTGGAAGGTGGACAGCG (SEQ ID NO:15)) under the following conditions: 25 ⁇ l reaction volume with 10 mM Tris-HCI (pH 8.3) , 50 mM KCI, 1.5 mM MgCI 2 , 0.001% gelatin, 20 ⁇ M of dNTPs, 1.25 units AmpliTaq Gold Polymerase (Perkin Elmer); 94°C, 8.5 min; 32 cycles of 94°C, 30 sec; 63°C, 30 sec; 72°C, 2 min, and a final incubation at 72°C, 7 min.
- An antisense primer derived from the sequence of clones 58A5/49A50 (TGTGCATTGACCTTTGGGTGCTGAC (SEQ ID NO: 16) and an anchor-specific primer were used for 5' RACE stepdown PCR: 15 mM KOAc, 3.5 mM MgOAc, 75 ⁇ g/ml BSA, 0.2 mM dNTPs, KlenTaq-1 DNA polymerase mix (Clontech), 94°C, 5min; 5 cycles of 94°C, 30 sec, 72°C, 2 min; 5 cycles of 94°C, 30 sec, 70°C, 2 min; 25 cycles of 94°C, 30 sec, 68°C, 2 min, and a final incubation at 72°C, 7 min.
- Reaction products were run on a 1.4% agarose gel. DNA fragments between 1.5-3 Kb and between 1-1.5 Kb were isolated from the gel and cloned using the TA cloning kit (Invitrogen). Colonies were screened by PCR with 2 ORF480 specific primers. The clones with the longest inserts were identified by PCR using T7 and M13 (reverse) primers. Plasmid DNA from clones were prepared and sequenced.
- the cDNA for ORF480 was generated by PCR using as template cDNA derived from MRHF fibroblast RNA. Initially, PCR primers AAACGGATCCACCATGCAGATCCCGCGCGCC (SEQ ID NO:17) and AAACGAATTCCTATGGGTCAATTTCTTCGGG (SEQ ID NO;18), corresponding to 5' end and 3' ends of the coding region of Genbank entry D87258, were used. PCR was performed with Pfu polymerase for 25 cycles (94 °C, 1 min; 58 °C, 1 min; 72 °C, 3 min).
- the Ser328Ala mutation was generated using the QuikChange Site-Directed mutagenesis kit (Stratagene). To avoid difficulty in primer extension with Pfu polymerase through the GC rich region located 5' of the unique Hind ⁇ site of ORF480 cDNA, we cloned a DNA fragment, corresponding to amino acid residue 161 to the end of the coding region, into pcDNA3 and used it as a template. Primers used for the mutagenesis reaction were
- ORF480 The translation product of ORF480 was synthesized in vitro using pcDNA3- ORF480 and pcDNA3-ORF480-Ser328Ala as templates in the TNT T7 Coupled Reticulocyte Lysate System (Promega), incorporating 35 S-methionine.
- the reaction products were separated on a 10% SDS-polyacrylamide gel. At the end of the run, the gel was dried under vacuum at 80 °C and analyzed on a PhosphorlmagerTM (Molecular Dynamics).
- ORF480- Human embryonic kidney cells, 293, were grown in Minimal Essential Medium (Gibco) supplemented with 10% heat inactivated fetal bovine serum (Gibco) and 1X antibiotic-antimycotic solution (Gibco) at 37°C in a humidified C0 2 incubator.
- Cells were stably transfected with the pcDNA3/ORF480 expression vector using the ProFection Mammalian Transf ection System (Promega). Clones were then selected by incubation with G418 (Gibco) at a concentration of 400 mg/ml and confirmed by immunoblot analysis of serum-free media.
- Sf-9 insect cells were maintained as suspension cultures at 28°C in Sf-900ll SF medium.
- Recombinant baculovirus stocks carrying the ORF480 cDNA were generated utilizing the pFASTBAC1/ORF-480 donor plasmid and the BAC-TO-BAC Baculovirus Expression System (Gibco). Optimal infection conditions were determined by varying the multiplicity of infection and conducting time course assays. Expression of the secreted ORF480 protein was confirmed by immunoblot blot analysis.
- Lys191 to Pro480 of human HtrA serine protease in E. coli An expression vector pET3d-HtrASP-1 containing the nucleotide sequence encoding human HtrA serine protease from Lys191 to Pro480 of SEQ ID NO:2 was constructed as follows. The cDNA for this expression construct was generated by first removing the Hind III fragment, containing the sequence for Met1 to Arg190 of HtrA serine protease, from pcDNA3/ORF480. This was followed by insertion of a linker that introduced a Nco I site and Met-Ala codons into the construct.
- the two primers for generating the linker are AGCTAAGAATTCAGGAAACAAAACCATGGCAA (SEQ ID NO:23) and AGCTTTGCCATGGTTTTGTTTCCTGAATTCTT (SEQ ID NO:24).
- the resulting construct was digested with Ncol/Notl and subcloned into the Ncol/Notl restriction sites of the expression vector pET3d(Not I) to create the expression vector pET3d-HtrASP-1.
- This expression construct generates a translation product, HtrASP-1 , that begins with Met-Ala followed by Lys191 to Pro480 of HtrA serine protease.
- pET3d-HtrASP-1 was transformed into E. coli strain BL21 (DE3)pLysS. Cells were grown at 37 °C in LB medium containing 150 mg/ml of ampicillin and 68 mg/ml of chloramphenicol with constant shaking. When the A 6 oo of the culture reached 0.5, isopropyl-b-D- thiogalactopyranoside was added to 0.6 mM. Cells were pelleted 4 hours later by centrifugation and stored at -80 °C.
- An expression vector pET3d-HtrASP-2 containing the nucleotide sequence encoding human HtrA serine protease from Asp161 to Pro480 was constructed as follows. First, a DNA fragment corresponding to Asp161 to Arg190 of HtrA serine protease cDNA was generated by a PCR reaction using primer pair A/B (A, sense: AACAAGCTTGAATTCACCATGGATCCCAACAGTTTGCGCCA (SEQ ID NO:25); B, antisense: TTGTCACGATCAGTCCATCT (SEQ ID NO:26)) with pcDNA/HtrASP as a template.
- Primer A which also includes a Nco I restriction site and a methionine translation initiation codon, corresponds to nucleotides 481 to 500 of the protein coding region of the HtrA serine protease cDNA.
- Primer B corresponds to nucleotides 633 to 652 of the protein coding region of the HtrA serine protease cDNA in the antisense orientation.
- PCR amplification was performed with Pfu polymerase for 25 cycles (94 °C, 45 sec; 58 °C, 45 sec; 72 °C, 45 sec).
- the resulting PCR fragment was digested with Nco I/Hind III and ligated with Hind Ill/Not I fragment of pcDNA/HtrASP (Lys191 to Pro480 of HtrA serine protease) and Nco I/Not I digested pET3d(Not I) to create the expression vector pET3d-HtrASP-2.
- pET3d-HtrASP-2 was transformed into E. coli strain BL21 (DE3)pLysS as set forth above.
- a ZOO-BLOT (Clontech) membrane filter containing EcoR l-digested genomic DNA from various species, was prehybridized for 30 min at 65°C, then hybridized with a random-primed 32 P-labeled BamH I- EcoR I (-900 bp, HtrA-related domain) fragment of ORF480 in rapid hybridization buffer (Amersham) at 65°C for 90 min.
- the hybridized filter was washed with 2X SSC (sodium chloride/sodium citrate) / 0.1 % SDS for 20 min at room temperature, twice for 10 min at 65°C, and once with 0.1X SSC, 0.1 % SDS at 65°C for 10 min. The results were visualized using a PhosphorlmagerTM (Molecular Dynamics).
- Bovine HtrA was isolated from a lung cDNA phage library (Clontech) by hybridization screening using the human cDNA as a probe.
- HtrA cDNA fragments were isolated by PCR from rabbit and guinea pig liver cDNA using primers designed from the human coding sequence corresponding to regions of maximum amino acid sequence identity with E. coli HtrA.
- the DNA sequences of the derived clones were determined using Dye Terminator Cycle Sequencing on an ABI PRISM 377 DNA sequencing system (Perkin-Elmer).
- Example 10 Antibody to HtrA serine protease domain - preparation and use
- Gel bands containing HtrASP-1 from Experiment 7 were kept frozen at -20°C.
- One gel band in a 15ml polystyrene tube was chopped into small pieces with a metal spatula and 0.5ml phosphate buffered saline (pH 7.2) (PBS) and 0.5ml Freund's Complete Adjuvant (Sigma, St Louis, MO) were added.
- the mixture was homogenized to a thin paste and taken up via an 18 gauge needle into a syringe.
- Two rabbits (#s 87 & 88) were immunized subcutaneously at two sites in the scapular region, with equal volumes of the mixture. After 24 days this process was repeated with a freshly homogenized gel band. At 19 and 29 days later, blood was collected from the ear veins of the animals and the serum prepared.
- the serine protease domain of HtrA amino acid 161 to 480 of SEQ ID NO:2 was cloned, expressed and purified.
- the purified protein was used to immunize two rabbits (#s 45 and 46) as follows: 0.5ml of a 1 mg/ml protein solution was homogenized with an equal volume of Freund's complete adjuvant and the mix injected (0.25ml) subcutaneously at two sites per rabbit. Three weeks later this process was repeated; then rabbit serum was obtained three and four weeks later. At this time the rabbits were re-immunized as before but with Freund's incomplete adjuvant. Serum was obtained after a further three weeks.
- an affinity column was prepared to enable specific purification of antibody from antisera.
- Two mg of purified protein in 0.1 M Na 2 C0 3 /NaHC0 3 buffer (pH 8.6) was covalently coupled to ⁇ -Aminohexyl-Agarose (Sigma) which had been activated for 15 min with 1% gluteraldehyde (Sigma, EM grade) in the same buffer.
- Precipitated material was removed by centrifugation, the ODs at 280nm determined and the solution concentrated by ultrafiltration (Centricon-10 or -30, Amicon/Millipore) to 0.5- 1 mg/ml. This was stored at 4°C.
- HtrA The supernatant was removed and analyzed for the presence of HtrA by Western blotting using PVDF membranes (Novex, San Diego, CA), after 4-20% gradient reducing SDS-PAGE (Novex) using directly loaded supernatant medium from a clone of 293 cells stably transfected with the HtrA gene as a positive control. Blots were probed with the corresponding anti-HtrA rabbit antiserum at 1 :1 ,000 antiserum for 2hr at 20°C, followed by mouse monoclonal anti-rabbit IgG conjugated to alkaline phosphatase (Sigma, clone 96) at 1 :5,000 (2hr at 20°C).
- Rabbit 88 antibody was covalently immobilized on a CM5 BIAcoreTM (BIAcore, Inc., Piscataway, NJ) sensor "chip” using EDC conjugation with instructions supplied by the manufacturer.
- Purified HtrA was passed over the sensor surface (10 ⁇ g/ml, 10 ⁇ l/min flow rate) and the binding of the antigen to the immobilized antibody in real time was observed.
- the antigen in solution bound to the antibody, confirming the immunoprecipitation analysis that the antibody recognized the intact protein in solution, as well as denatured protein in SDS-PAGE. Similar observations were made with antibodies from rabbits 87, 45 and 46.
- HtrA was assayed using oxidised insulin chain ⁇ (Sigma) as a substrate.
- the degradation products and the cleavage site within the substrate were identified by isolating and purifying the products of enzyme degradation by HPLC and peptide sequencing.
- HtrA (0.56 ⁇ g) was added to 11 ⁇ M oxidised Insulin chain ⁇ and incubated in 50 mM HEPES, pH 7.5 containing 2M NaCI at 37°C for 80 min. in a total volume of 160 ⁇ l. The reaction was terminated by the addition of 32 ⁇ l 12% TFA (final 2% TFA). 8 ⁇ l of 50 mM HEPES containing 2% TFA was added and 170 ⁇ l was separated by reverse phase-HPLC (RP-HPLC) using a micro Bondapak C 18 column (Waters, Milford, MA).
- RP-HPLC reverse phase-HPLC
- the column was equilibrated with 75% buffer A (5 mM NH40H-TFA in water) and 25% buffer B (5mM NH40H-TFA in acetonitrile). The gradient was 25 to 45% buffer B over 30 min at 1 ml/min. HtrA activity was determined by measuring the disappearance of the substrate. For the identification of the cleavage site fractions were collected and the two new peaks as well as the undigested insulin chain ⁇ isolated and sequenced.
- HPLC HPLC was performed on a waters 840 System equipped with a model 712 WISP and two 590 HPLC pumps.
- a Lambda 481 spectrophotometer (Waters Milford, MA) was used to monitor UV absorbance at 214 nm.
- the peptides isolated from the RP-HPLC were further analyzed for amino terminal analysis of new amino terminal generated as well as by mass spectrometry.
- the structure of the insulin chain ⁇ is as follows
- the Km of Insulin chain ⁇ was determined to be 11 ⁇ M, therefore the linearity of the rate of hydrolysis of the substrate was determined at 11 ⁇ M with incubation time. The results indicate that the rate of hydrolysis was linear up to 120 minutes using 11 ⁇ M of the substrate and 30 nM of the enzyme at 37°C. The linearity of the rate of hydrolysis of Insulin chain ⁇ with protein concentration of HtrA (10- 50 nM) was determined at 37°C for 80 minutes. The results indicate that the rates of hydrolysis was linear up to 50 nM of the enzyme.
- Fibroblasts are obtained from a subject by skin biopsy.
- the resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask.
- the flask is turned upside down, closed tight and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted - the chunks of tissue remain fixed to the bottom of the flask - and fresh media is added (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin).
- the tissue is then incubated at 37°C for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerges. The monolayer is trypsinized and scaled into larger flasks.
- a vector for gene therapy is digested with restriction enzymes for cloning a fragment to be expressed.
- the digested vector is treated with calf intestinal phosphatase to prevent self-ligation.
- the dephosphorylated, linear vector is fractionated on an agarose gel and purified.
- HtrA cDNA capable of expressing active HtrA is isolated.
- the ends of the fragment are modified, if necessary, for cloning into the vector. For instance, 5" overhanging may be treated with DNA polymerase to create blunt ends. 3' overhanging ends may be removed using S1 nuclease. Linkers may be ligated to blunt ends with T4 DNA ligase.
- Equal quantities of the Moloney murine leukemia virus linear backbone and the HtrA fragment are mixed together and joined using T4 DNA ligase.
- the ligation mixture is used to transform E. Coli and the bacteria are then plated onto agar- containing kanamycin. Kanamycin phenotype and restriction analysis confirm that the vector has the properly inserted gene.
- Packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin.
- DMEM Dulbecco's Modified Eagles Medium
- CS calf serum
- penicillin and streptomycin The vector containing the HtrA gene is introduced into the packaging cells by standard techniques. Infectious viral particles containing the HtrA gene are collected from the packaging cells, which now are called producer cells.
- Fresh media is added to the producer cells, and after an appropriate incubation period media is harvested from the plates of confluent producer cells.
- the media containing the infectious viral particles, is filtered through a Millipore filter to remove detached producer cells.
- the filtered media then is used to infect fibroblast cells.
- Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the filtered media.
- Polybrene Aldrich
- the media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his, to select out transduced cells for expansion.
- Engineered fibroblasts then may be injected into rats, either alone or after having been grown to confluence on microcarrier beads, such as cytodex 3 beads.
- the injected fibroblasts produce HtrA product, and the biological actions of the protein are conveyed to the host.
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU52904/99A AU5290499A (en) | 1998-08-03 | 1999-07-31 | Human htra serine protease |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12861998A | 1998-08-03 | 1998-08-03 | |
US09/128,619 | 1998-08-03 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2000008134A2 true WO2000008134A2 (fr) | 2000-02-17 |
WO2000008134A3 WO2000008134A3 (fr) | 2000-05-11 |
Family
ID=22436199
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP1999/005528 WO2000008134A2 (fr) | 1998-08-03 | 1999-07-31 | SERINE PROTEASE DE HtrA HUMAINE |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU5290499A (fr) |
WO (1) | WO2000008134A2 (fr) |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008067040A3 (fr) * | 2006-10-06 | 2008-11-20 | Univ Utah Res Found | Procédé de détection de maladies et d'affections pathologiques de l'œil et traitement de celles-ci |
EP2851432A1 (fr) | 2007-11-01 | 2015-03-25 | University of Iowa Research Foundation | Analyse de locus de RCA pour évaluer la sensibilité à l'AMD et aux MPGNII |
US9738727B2 (en) | 2011-10-14 | 2017-08-22 | Genentech, Inc. | Anti-HtrA1 antibodies and methods of use |
WO2018220034A1 (fr) * | 2017-06-01 | 2018-12-06 | F. Hoffmann-La Roche Ag | Oligonucléotides antisens pour moduler l'expression de htra1 |
US10421821B2 (en) | 2015-10-30 | 2019-09-24 | Genentech, Inc. | Anti-HtrA1 antibodies and methods of use thereof |
US10519450B2 (en) | 2016-07-01 | 2019-12-31 | Hoffmann-La Roche Inc. | Antisense oligonucleotides for modulating HTRA1 expression |
CN111512160A (zh) * | 2017-12-21 | 2020-08-07 | 豪夫迈·罗氏有限公司 | Htra1 rna拮抗剂的伴随诊断 |
US11267803B2 (en) | 2016-06-21 | 2022-03-08 | Orion Ophthalmology LLC | Carbocyclic prolinamide derivatives |
US11377439B2 (en) | 2016-06-21 | 2022-07-05 | Orion Ophthalmology LLC | Heterocyclic prolinamide derivatives |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0828003A2 (fr) * | 1996-09-06 | 1998-03-11 | Smithkline Beecham Plc | Sérine protéase humaine |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH09107980A (ja) * | 1995-08-17 | 1997-04-28 | Japan Tobacco Inc | 新規生理活性タンパク |
-
1999
- 1999-07-31 WO PCT/EP1999/005528 patent/WO2000008134A2/fr active Application Filing
- 1999-07-31 AU AU52904/99A patent/AU5290499A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0828003A2 (fr) * | 1996-09-06 | 1998-03-11 | Smithkline Beecham Plc | Sérine protéase humaine |
Non-Patent Citations (3)
Title |
---|
HU ET AL.: "Human HtrA, an evolutionarily conserved serine protease identified as a differentially expressed gene product in osteoarthritic cartilage" J. BIOL. CHEM., vol. 273, no. 51, 18 December 1998 (1998-12-18), pages 34406-34412, XP002127797 * |
PATENT ABSTRACTS OF JAPAN vol. 1997, no. 08, 29 August 1997 (1997-08-29) & JP 09 107980 A (JAPAN TOBACCO INC), 28 April 1997 (1997-04-28) * |
ZUMBRUNN ET AL.: "Primary structure of a putative serine protease specific for IGF-binding proteins" FEBS LETTERS, vol. 398, 1996, pages 187-192, XP002127796 cited in the application * |
Cited By (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008067040A3 (fr) * | 2006-10-06 | 2008-11-20 | Univ Utah Res Found | Procédé de détection de maladies et d'affections pathologiques de l'œil et traitement de celles-ci |
EP2851432A1 (fr) | 2007-11-01 | 2015-03-25 | University of Iowa Research Foundation | Analyse de locus de RCA pour évaluer la sensibilité à l'AMD et aux MPGNII |
US9738727B2 (en) | 2011-10-14 | 2017-08-22 | Genentech, Inc. | Anti-HtrA1 antibodies and methods of use |
US10421821B2 (en) | 2015-10-30 | 2019-09-24 | Genentech, Inc. | Anti-HtrA1 antibodies and methods of use thereof |
US10421822B2 (en) | 2015-10-30 | 2019-09-24 | Genetech, Inc. | Anti-HtrA1 antibodies and methods of use thereof |
US11512143B2 (en) | 2015-10-30 | 2022-11-29 | Genentech, Inc. | Anti-HtrA1 antibodies and methods of use thereof |
US11377439B2 (en) | 2016-06-21 | 2022-07-05 | Orion Ophthalmology LLC | Heterocyclic prolinamide derivatives |
US11866422B2 (en) | 2016-06-21 | 2024-01-09 | Orion Ophthalmology LLC | Carbocyclic prolinamide derivatives |
US11267803B2 (en) | 2016-06-21 | 2022-03-08 | Orion Ophthalmology LLC | Carbocyclic prolinamide derivatives |
US10519450B2 (en) | 2016-07-01 | 2019-12-31 | Hoffmann-La Roche Inc. | Antisense oligonucleotides for modulating HTRA1 expression |
WO2018220034A1 (fr) * | 2017-06-01 | 2018-12-06 | F. Hoffmann-La Roche Ag | Oligonucléotides antisens pour moduler l'expression de htra1 |
CN111512160A (zh) * | 2017-12-21 | 2020-08-07 | 豪夫迈·罗氏有限公司 | Htra1 rna拮抗剂的伴随诊断 |
CN111512160B (zh) * | 2017-12-21 | 2024-04-09 | 豪夫迈·罗氏有限公司 | Htra1 rna拮抗剂的伴随诊断 |
Also Published As
Publication number | Publication date |
---|---|
WO2000008134A3 (fr) | 2000-05-11 |
AU5290499A (en) | 2000-02-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6391853B1 (en) | Human tissue inhibitor of metalloproteinase-4 | |
US20050186616A1 (en) | Human cystatin F | |
US5780286A (en) | Arginase II | |
US20080096821A1 (en) | Cytostatin II | |
WO2000008134A2 (fr) | SERINE PROTEASE DE HtrA HUMAINE | |
US5985601A (en) | DNA encoding human cystatin E | |
EP1049708A1 (fr) | Polynucleotides et polypeptides meth1 et meth2 | |
KR20060136471A (ko) | 절단형 dance, dance 복합체, 및 이들을사용하는 방법 | |
KR20070000501A (ko) | 절단형 dance, dance 복합체, 및 이들을사용하는 방법 | |
US20080057510A1 (en) | Human Vascular IBP-Like Growth Factor | |
US5851814A (en) | Human elastate IV | |
AU710568B2 (en) | Human vascular IBP-like growth factor | |
US20020090694A1 (en) | Human Hox C10 and polynucleotides encoding | |
US5939284A (en) | Protein phosphatase 1 binding protein, R5 | |
US7309780B2 (en) | Antibodies to natural killer cell activating factor II | |
US6245540B1 (en) | Human choline acetyltransferase | |
EP0812916A2 (fr) | Gène de la cathepsin K | |
JPH10117788A (ja) | ヒト・myt−1キナーゼクローン | |
US7049081B2 (en) | Diagnostic methods based on human BTG-2 and BTG-3 polypeptides | |
US20050066266A9 (en) | Human CCN-like growth factor | |
WO1997033986A1 (fr) | Arginase ii | |
AU2004200046A1 (en) | Meth1 and Meth2 Polynucleotides and Polypeptides | |
MXPA97000151A (en) | Elastase iv hum | |
MXPA97009390A (en) | Cistatine and hum |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09777498 Country of ref document: US |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: CA |