
Publication number
WO2000006738A2 PCT/GB1999/002452 GB9902452W WO0006738A2 WO 2000006738 A2 WO2000006738 A2 WO 2000006738A2 GB 9902452 W GB9902452 W GB 9902452W WO 0006738 A2 WO0006738 A2 WO 0006738A2
Prior art keywords
Prior art date
Application number
Other languages
French (fr)
Other versions
WO2000006738A3 (en
Richard William Falla Le Page
Jeremy Mark Wells
Sean Bosco Hanniffy
Philip Michael Hansbro
Original Assignee
Microbial Technics Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to GBGB9816336.3A priority Critical patent/GB9816336D0/en
Priority to GB9816336.3 priority
Priority to US12532999P priority
Priority to US60/125,329 priority
Application filed by Microbial Technics Limited filed Critical Microbial Technics Limited
Publication of WO2000006738A2 publication Critical patent/WO2000006738A2/en
Priority claimed from US09/769,744 external-priority patent/US20030134407A1/en
Publication of WO2000006738A3 publication Critical patent/WO2000006738A3/en



    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C07K14/3156Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • C07K2319/00Fusion polypeptide


Novel proteins from Streptococcus pneumoniae are described, together with nucleic acid sequences encoding them. Their use in vaccines and in screening methods is also described.



The present invention relates to proteins derived from Streptococcus pneumoniae, nucleic acid molecules encoding such proteins, the use of the nucleic acid and/or proteins as antigens/immunogens and in detection/diagnosis, as well as methods for screening the proteins/nucleic acid sequences as potential anti-microbial targets.

Streptococcus pneumoniae, commonly referred to as the pneumococcus, is an important pathogenic organism. The continuing significance of Streptoccocus pneumoniae infections in relation to human disease in developing and developed countries has been authoritatively reviewed (Fiber, G.R. , Science, 265: 1385-1387 (1994)). That indicates that on a global scale this organism is believed to be the most common bacterial cause of acute respiratory infections, and is estimated to result in 1 million childhood deaths each year, mostly in developing countries (Stansfield, S.K. , Pediatr. Infect. Dis., 6: 622 (1987)). In the USA it has been suggested (Breiman et al, Arch. Intern. Med., 150: 1401 (1990)) that the pneumococcus is still the most common cause of bacterial pneumonia, and that disease rates are particularly high in young children, in the elderly, and in patients with predisposing conditions such as asplenia, heart, lung and kidney disease, diabetes, alcoholism, or with immunosupressive disorders, especially AIDS. These groups are at higher risk of pneumococcal septicaemia and hence meningitis and therefore have a greater risk of dying from pneumococcal infection. The pneumococcus is also the leading cause of otitis media and sinusitis, which remain prevalent infections in children in developed countries, and which incur substantial costs.

The need for effective preventative strategies against pneumococcal infection is highlighted by the recent emergence of penicillin-resistant pneumococci. It has been reported that 6.6% of pneumoccal isolates in 13 US hospitals in 12 states were found to be resistant to penicillin and some isolates were also resistant to other antibiotics including third generation cyclosporins (Schappert, S.M. , Vital and Health Statistics of the Centres for Disease Control/National Centre for Health Statistics, 214: 1 (1992)). The rates of penicillin resistance can be higher (up to 20%) in some hospitals (Breiman et al, J. Am. Med. Assoc , 271: 1831 (1994)). Since the development of penicillin resistance among pneumococci is both recent and sudden, coming after decades during which penicillin remained an effective treatment, these findings are regarded as alarming.

For the reasons given above, there are therefore compelling grounds for considering improvements in the means of preventing, controlling, diagnosing or treating pneumococcal diseases.

Various approaches have been taken in order to provide vaccines for the prevention of pneumococcal infections. Difficulties arise for instance in view of the variety of serotypes (at least 90) based on the structure of the polysaccharide capsule surrounding the organism. Vaccines against individual serotypes are not effective against other serotypes and this means that vaccines must include polysaccharide antigens from a whole range of serotypes in order to be effective in a majority of cases. An additional problem arises because it has been found that the capsular polysaccharides (each of which determines the serotype and is the major protective antigen) when purified and used as a vaccine do not reliably induce protective antibody responses in children under two years of age, the age group which suffers the highest incidence of invasive pneumococcal infection and meningitis.

A modification of the approach using capsule antigens relies on conjugating the polysaccharide to a protein in order to derive an enhanced immune response, particularly by giving the response T-cell dependent character. This approach has been used in the development of a vaccine against Haemophilus influenzae, for instance. There are, however, issues of cost concerning both the multi- polysaccharide vaccines and those based on conjugates.

A third approach is to look for other antigenic components which offer the potential to be vaccine candidates. This is the basis of the present invention. Using a specially developed bacterial expression system, we have been able to identify a group of protein antigens from pneomococcus which are associated with the bacterial envelope or which are secreted.

Thus, in a first aspect the present invention provides a Streptococcus pneumoniae protein or polypeptide having a sequence selected from those shown in table 1.

In a second aspect, the present invention provides a Streptococcus pneumoniae protein or polypeptide having a sequence selected from those shown in table 2.

A protein or polypeptide of the present invention may be provided in substantially pure form. For example, it may be provided in a form which is substantially free of other proteins.

As discussed herein, the proteins and polypeptides of the invention are useful as antigenic material. Such material can be "antigenic" and/or "immunogenic" . Generally, "antigenic" is taken to mean that the protein or polypeptide is capable of being used to raise antibodies or indeed is capable of inducing an antibody response in a subject. "Immunogenic" is taken to mean that the protein or polypeptide is capable of eliciting a protective immune response in a subject. Thus, in the latter case, the protein or polypeptide may be capable of not only generating an antibody response but, in addition, a non-antibody based immune response. The skilled person will appreciate that homologues or derivatives of the proteins or polypeptides of the invention will also find use in the context of the present invention, ie as antigenic/immunogenic material. Thus, for instance proteins or polypeptides which include one or more additions, deletions, substitutions or the like are encompassed by the present invention. In addition, it may be possible to replace one amino acid with another of similar "type" . For instance replacing one hydrophobic amino acid with another. One can use a program such as the CLUSTAL program to compare amino acid sequences. This program compares amino acid sequences and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is possible to calculate amino acid identity or similarity (identity plus conservation of amino acid type) for an optimal alignment. A program like BLASTx will align the longest stretch of similar sequences and assign a value to the fit. It is thus possible to obtain a comparison where several regions of similarity are found, each having a different score. Both types of identity analysis are contemplated in the present invention.

In the case of homologues and derivatives, the degree of identity with a protein or polypeptide as described herein is less important than that the homologue or derivative should retain the antigenicity or immunogenicity of the original protein or polypeptide. However, suitably, homologues or derivatives having at least 60% similarity (as discussed above) with the proteins or polypeptides described herein are provided. Preferably, homologues or derivatives having at least 70% similarity, more preferably at least 80% similarity are provided. Most preferably, homologues or derivatives having at least 90% or even 95% similarity are provided.

In an alternative approach, the homologues or derivatives could be fusion proteins, incorporating moieties which render purification easier, for example by effectively tagging the desired protein or polypeptide. It may be necessary to remove the "tag" or it may be the case that the fusion protein itself retains sufficient antigenicity to be useful.

In an additional aspect of the invention there are provided antigenic/immunogenic fragments of the proteins or polypeptides of the invention, or of homologues or derivatives thereof.

For fragments of the proteins or polypeptides described herein, or of homologues or derivatives thereof, the situation is slightly different. It is well known that is possible to screen an antigenic protein or polypeptide to identify epitopic regions, ie those regions which are responsible for the protein or polypeptide 's antigenicity or immunogenicity.

Methods for carrying out such screening are well known in the art. Thus, the fragments of the present invention should include one or more such epitopic regions or be sufficiently similar to such regions to retain their antigenic/immunogenic properties.

Thus, for fragments according to the present invention the degree of identity is perhaps irrelevant, since they may be 100% identical to a particular part of a protein or polypeptide, homologue or derivative as described herein. The key issue, once again, is that the fragment retains the antigenic/immunogenic properties.

Thus, what is important for homologues, derivatives and fragments is that they possess at least a degree of the antigenicity/immunogenicity of the protein or polypeptide from which they are derived.

Gene cloning techniques may be used to provide a protein of the invention in substantially pure form. These techniques are disclosed, for example, in J. Sambrook et al Molecular Cloning 2nd Edition, Cold Spring Harbor Laboratory Press (1989). Thus, in a third aspect, the present invention provides a nucleic acid molecule comprising or consisting of a sequence which is:

(i) any of the DNA sequences set out in Table 1 or their RNA equivalents;

(ii) a sequence which is complementary to any of the sequences of (i);

(iii) a sequence which codes for the same protein or polypeptide, as those sequences of (i) or (ii);

(iv) a sequence which has substantial identity with any of those of (i), (ii) and (iii);

(v) a sequence which codes for a homologue, derivative or fragment of a protein as defined in Table 1.

In a fourth aspect the present invention provides a nucleic acid molecule comprising or consisting of a sequence which is:

(i) any of the DNA sequences set out in Table 2 or their RNA equivalents;

(ii) a sequence which is complementary to any of the sequences of (i);

(iii) a sequence which codes for the same protein or polypeptide, as those sequences of (i) or (ii);

(iv) a sequence which has substantial identity with any of those of (i), (ii) and (iii); or (v) a sequence which codes for a homologue, derivative or fragment of a protein as defined in Table 2.

The nucleic acid molecules of the invention may include a plurality of such sequences, and/or fragments. The skilled person will appreciate that the present invention can include novel variants of those particular novel nucleic acid molecules which are exemplified herein. Such variants are encompassed by the present invention. These may occur in nature, for example because of strain variation. For example, additions, substitutions and/or deletions are included. In addition, and particularly when utilising microbial expression systems, one may wish to engineer the nucleic acid sequence by making use of known preferred codon usage in the particular organism being used for expression. Thus, synthetic or non-naturally occurring variants are also included within the scope of the invention.

The term "RNA equivalent" when used above indicates that a given RNA molecule has a sequence which is complementary to that of a given DNA molecule (allowing for the fact that in RNA "U" replaces "T" in the genetic code).

When comparing nucleic acid sequences for the purposes of determining the degree of homology or identity one can use programs such as BESTFIT and GAP (both from the Wisconsin Genetics Computer Group (GCG) software package) BESTFIT, for example, compares two sequences and produces an optimal alignment of the most similar segments. GAP enables sequences to be aligned along their whole length and finds the optimal alignment by inserting spaces in either sequence as appropriate. Suitably, in the context of the present invention when discussing identity of nucleic acid sequences, the comparison is made by alignment of the sequences along their whole length. Preferably, sequences which have substantial identity have at least 50% sequence identity, desirably at least 75% sequence identity and more desirably at least 90 or at least 95% sequence identity with said sequences. In some cases the sequence identity may be 99% or above.

Desirably, the term "substantial identity" indicates that said sequence has a greater degree of identity with any of the sequences described herein than with prior art nucleic acid sequences.

It should however be noted that where a nucleic acid sequence of the present invention codes for at least part of a novel gene product the present invention includes within its scope all possible sequence coding for the gene product or for a novel part thereof.

The nucleic acid molecule may be in isolated or recombinant form. It may be incorporated into a vector and the vector may be incorporated into a host. Such vectors and suitable hosts form yet further aspects of the present invention.

Therefore, for example, by using probes based upon the nucleic acid sequences provided herein, genes in Streptococcus pneumoniae can be identified. They can then be excised using restriction enzymes and cloned into a vector. The vector can be introduced into a suitable host for expression.

Nucleic acid molecules of the present invention may be obtained from S. pneumoniae by the use of appropriate probes complementary to part of the sequences of the nucleic acid molecules. Restriction enzymes or sonication techniques can be used to obtain appropriately sized fragments for probing. Alternatively PCR techniques may be used to amplify a desired nucleic acid sequence. Thus the sequence data provided herein can be used to design two primers for use in PCR so that a desired sequence, including whole genes or fragments thereof, can be targeted and then amplified to a high degree.

Typically primers will be at least 15-25 nucleotides long.

As a further alternative chemical synthesis may be used. This may be automated. Relatively short sequences may be chemically synthesised and ligated together to provide a longer sequence.

There is another group of proteins from S. pneumoniae which have been identified using the bacterial expression system described herein. These are known proteins from S. pneumoniae, which have not previously been identified as antigenic proteins. The amino acid sequences of this group of proteins, together with DNA sequences coding for them are shown in Table 3. These proteins, or homologues, derivatives and/or fragments thereof also find use as antigens/immunogens. Thus, in another aspect the present invention provides the use of a protein or polypeptide having a sequence selected from those shown in Tables 1-3, or homologues, derivatives and/or fragments thereof, as an immunogen/antigen.

In yet a further aspect the present invention provides an immunogenic/antigenic composition comprising one or more proteins or polypeptides selected from those whose sequences are shown in Tables 1-3, or homologues or derivatives thereof, and/or fragments of any of these. In preferred embodiments, the immunogenic/antigenic composition is a vaccine or is for use in a diagnostic assay.

In the case of vaccines suitable additional excipients, diluents, adjuvants or the like may be included. Numerous examples of these are well known in the art.

It is also possible to utilise the nucleic acid sequences shown in Tables 1-3 in the preparation of so-called DNA vaccines. Thus, the invention also provides a vaccine composition comprising one or more nucleic acid sequences as defined herein. DNA vaccines are described in the art (see for instance, Donnelly et al , Ann. Rev. Immunol., 15:617-648 (1997)) and the skilled person can use such art described techniques to produce and use DNA vaccines according to the present invention.

As already discussed herein the proteins or polypeptides described herein, their homologues or derivatives, and/or fragments of any of these, can be used in methods of detecting/diagnosing S. pneumoniae. Such methods can be based on the detection of antibodies against such proteins which may be present in a subject. Therefore the present invention provides a method for the detection/diagnosis of S.pneumoniae which comprises the step of bringing into contact a sample to be tested with at least one protein, or homologue, derivative or fragment thereof, as described herein. Suitably, the sample is a biological sample, such as a tissue sample or a sample of blood or saliva obtained from a subject to be tested.

In an alternative approach, the proteins described herein, or homologues, derivatives and/or fragments thereof, can be used to raise antibodies, which in turn can be used to detect the antigens, and hence S.pneumoniae. Such antibodies form another aspect of the invention. Antibodies within the scope of the present invention may be monoclonal or polyclonal.

Polyclonal antibodies can be raised by stimulating their production in a suitable animal host (e.g. a mouse, rat, guinea pig, rabbit, sheep, goat or monkey) when a protein as described herein, or a homologue, derivative or fragment thereof, is injected into the animal. If desired, an adjuvant may be administered together with the protein. Well- known adjuvants include Freund's adjuvant (complete and incomplete) and aluminium hydroxide. The antibodies can then be purified by virtue of their binding to a protein as described herein.

Monoclonal antibodies can be produced from hybridomas. These can be formed by fusing myeloma cells and spleen cells which produce the desired antibody in order to form an immortal cell line. Thus the well-known Kohler & Milstein technique (Nature 256 (1975)) or subsequent variations upon this technique can be used.

Techniques for producing monoclonal and polyclonal antibodies that bind to a particular polypeptide/protein are now well developed in the art. They are discussed in standard immunology textbooks, for example in Roitt et al, Immunology second edition (1989), Churchill Livingstone, London.

In addition to whole antibodies, the present invention includes derivatives thereof which are capable of binding to proteins etc as described herein. Thus the present invention includes antibody fragments and synthetic constructs. Examples of antibody fragments and synthetic constructs are given by Dougall et al in Tibtech 12 372-379 (September 1994).

Antibody fragments include, for example, Fab, F(ab')2 and Fv fragments. Fab fragments (These are discussed in Roitt et al [supra] ). Fv fragments can be modified to produce a synthetic construct known as a single chain Fv (scFv) molecule. This includes a peptide linker covalently joining Vh and V, regions, which contributes to the stability of the molecule. Other synthetic constructs that can be used include CDR peptides. These are synthetic peptides comprising antigen-binding deteirninants. Peptide mimetics may also be used. These molecules are usually conformationally restricted organic rings that mimic the structure of a CDR loop and that include antigen-interactive side chains.

Synthetic constructs include chimaeric molecules. Thus, for example, humanised (or primatised) antibodies or derivatives thereof are within the scope of the present invention. An example of a humanised antibody is an antibody having human framework regions, but rodent hypervariable regions. Ways of producing chimaeric antibodies are discussed for example by Morrison et al in PNAS, 81, 6851-6855 (1984) and by Takeda et al in Nature. 314, 452-454 (1985).

Synthetic constructs also include molecules comprising an additional moiety that provides the molecule with some desirable property in addition to antigen binding. For example the moiety may be a label (e.g. a fluorescent or radioactive label). Alternatively, it may be a pharmaceutically active agent.

Antibodies, or derivatives thereof, find use in detection/diagnosis of S.pneumoniae. Thus, in another aspect the present invention provides a method for the detection/diagnosis of S.pneumoniae which comprises the step of bringing into contact a sample to be tested and antibodies capable of binding to one or more proteins described herein, or to homologues, derivatives and/or fragments thereof.

In addition, so-called "Affibodies" may be utilised. These are binding proteins selected from combinatorial libraries of an alpha-helical bacterial receptor domain (Nord et al , ) Thus, Small protein domains, capable of specific binding to different target proteins can be selected using combinatorial approaches.

It will also be clear that the nucleic acid sequences described herein may be used to detect/diagnose S.pneumoniae. Thus, in yet a further aspect, the present invention provides a method for the detection/diagnosis of S.pneumoniae which comprises the step of bringing into contact a sample to be tested with at least one nucleic acid sequence as described herein. Suitably, the sample is a biological sample, such as a tissue sample or a sample of blood or saliva obtained from a subject to be tested. Such samples may be pre-treated before being used in the methods of the invention.

Thus, for example, a sample may be treated to extract DNA. Then, DNA probes based on the nucleic acid sequences described herein (ie usually fragments of such sequences) may be used to detect nucleic acid from S.pneumoniae.

In additional aspects, the present invention provides:

(a) a method of vaccinating a subject against S.pneumoniae which comprises the step of administering to a subject a protein or polypeptide of the invention, or a derivative, homologue or fragment thereof, or an immunogenic composition of the invention;

(b) a method of vaccinating a subject against S.pneumoniae which comprises the step of administering to a subject a nucleic acid molecule as defined herein;

(c) a method for the prophylaxis or treatment of S.pneumoniae infection which comprises the step of administering to a subject a protein or polypeptide of the invention, or a derivative, homologue or fragment thereof, or an immunogenic composition of the invention;

(d) a method for the prophylaxis or treatment of S.pneumoniae infection which comprises the step of administering to a subject a nucleic acid molecule as defined herein; (e) a kit for use in detecting/diagnosing S.pneumoniae infection comprising one or more proteins or polypeptides of the invention, or homologues, derivatives or fragments thereof, or an antigenic composition of the invention; and

(f) a kit for use in detecting/diagnosing S.pneumoniae infection comprising one or more nucleic acid molecules as defined herein.

Given that we have identified a group of important proteins, such proteins are potential targets for anti-microbial therapy. It is necessary, however, to determine whether each individual protein is essential for the organism's viability. Thus, the present invention also provides a method of determining whether a protein or polypeptide as described herein represents a potential anti-microbial target which comprises antagonising, inhibiting or otherwise interfering with the function or expression of said protein and determining whether S.pneumoniae is still viable.

A suitable method for inactivating the protein is to effect selected gene knockouts, ie prevent expression of the protein and determine whether this results in a lethal change. Suitable methods for carrying out such gene knockouts are described in Li et al , P.N.A.S., 94: 13251-13256 (1997) and Kolkman et al , 178:3736- 3741 (1996).

In a final aspect the present invention provides the use of an agent capable of antagonising, inhibiting or otherwise interfering with the function or expression of a protein or polypeptide of the invention in the manufacture of a medicament for use in the treatment or prophylaxis of S.pneumoniae infection.

As mentioned above, we have used a bacterial expression system as a means of identifying those proteins which are surface associated, secreted or exported and thus, would find use as antigens.

The information necessary for the secretion/export of proteins has been extensively studied in bacteria. In the majority of cases, protein export requires a signal peptide to be present at the N-terminus of the precursor protein so that it becomes directed to the translocation machinery on the cytoplasmic membrane. During or after translocation, the signal peptide is removed by a membrane associated signal peptidase. Ultimately the localization of the protein (i.e. whether it be secreted, an integral membrane protein or attached to the cell wall) is determined by sequences other than the leader peptide itself.

We are specifically interested in surface located or exported proteins as these are likely to be antigens for use in vaccines, as diagnostic reagents or as targets for therapy with novel chemical entities. We have therefore developed a screening vector-system in Lactococcus lactis that permits genes encoding exported proteins to be identified and isolated. We provide below a representative example showing how given novel surface associated proteins from Streptococcus pneumoniae have been identified and characterized. The screening vector incorporates the staphylococcal nuclease gene nuc lacking its own export signal as a secretion reporter. Staphylococcal nuclease is a naturally secreted heat-stable, monomeric enzyme which has been efficiently expressed and secreted in a range of Gram positive bacteria (Shortle, Gene, 22:181-189 (1983); Kovacevic et al. , J. Bacteriol, 162:521-528 (1985); Miller et al., J. Bacteriol , 169:3508-3514 (1987); Liebl et al. , J. Bacteriol, 174:1854-1861 (1992); Le Loir et al, J. Bacteriol, 176:5135-5139 (1994); Poquet et al , J. Bacteriol, 180:1904-1912 (1998)).

Recently, Poquet et al. ((1998), supra) have described a screening vector incorporating the nuc gene lacking its own signal leader as a reporter to identify exported proteins in Gram positive bacteria, and have applied it to L. lactis. This vector (pFUN) contains the pAMβl replicon which functions in a broad host range of Gram-positive bacteria in addition to the ColEl replicon that promotes replication in Escherichia coli and certain other Gram negative bacteria. Unique cloning sites present in the vector can be used to generate transcriptional and translational fusions between cloned genomic DNA fragments and the open reading frame of the truncated nuc gene devoid of its own signal secretion leader. The nuc gene makes an ideal reporter gene because the secretion of nuclease can readily be detected using a simple and sensitive plate test: Recombinant colonies secreting the nuclease develop a pink halo whereas control colonies remain white (Shortle, (1983), supra; Le Loir et al, (1994), supra).

Thus, the invention will now be described with reference to the following representative example, which provides details of how the proteins, polypeptides and nucleic acid sequences described herein identified as antigenic targets.

We describe herein the construction of three reporter vectors and their use in L. lactis to identify and isolate genomic DNA fragments from Streptococcus pneumoniae encoding secreted or surface associated proteins.

The invention will now be described with reference to the examples, which should not be construed as in any way limiting the invention. The examples refer to the figures in which:

Figure 1: shows the results of a number of DNA vaccine trials; and

Figure 2: shows the results of further DNA vaccine trials.


(i) Construction of the pTREPl-nuc series of reporter vectors (a) Construction of expression plasmid pTREPl

The pTREPl plasmid is a high-copy number (40-80 per cell) theta-replicating gram positive plasmid, which is a derivative of the pTREX plasmid which is itself a derivative of the previously published pIL253 plasmid. pIL253 incorporates the broad Gram-positive host range replicon of pAMβl (Simon and Chopin, Biochimie, 70:559-567 (1988)) and is non-mobilisable by the L lactis sex-factor. pIL253 also lacks the tra function which is necessary for transfer or efficient mobilisation by conjugative parent plasmids exemplified by pIL501. The Enterococcal pAMβl replicon has previously been transferred to various species including Streptococcus, Lactobacillus and Bacillus species as well as Clostridium acetobutylicum, (Oultram and Klaenhammer, FEMS Microbiological Letters, 27:129-134 (1985); Gibson et al , (1979); LeBlanc et al , Proceedings of the National Academy of Science USA, 75:3484-3487 (1978)) indicating the potential broad host range utility. The pTREPl plasmid represents a constitutive transcription vector.

The pTREX vector was constructed as follows. An artificial DNA fragment containing a putative RNA stabilising sequence, a translation initiation region (TIR), a multiple cloning site for insertion of the target genes and a transcription terminator was created by annealing 2 complementary oligonucleotides and extending with Tfl DNA polymerase. The sense and anti-sense oligonucleotides contained the recognition sites for Nhel and BamHI at their 5 ' ends respectively to facilitate cloning. This fragment was cloned between the Xbal and BamHI sites in pUC19NT7, a derivative of pUC19 which contains the T7 expression cassette from pLETl (Wells et al , J. Appl. Bacteriol. , 74:629-636 (1993)) cloned between the EcoRI and Hindlll sites. The resulting construct was designated pUCLEX. The complete expression cassette of pUCLEX was then removed by cutting with Hindlll and blunting followed by cutting with EcoRI before cloning into EcoRI and Sad (blunted) sites of pIL253 to generate the vector pTREX (Wells and Schofield, In Current advances in metabolism, genetics and applications -NATO ASI Series, H 98:37-62 (1996)). The putative RNA stabilising sequence and TIR are derived from the Escherichia coli T7 bacteriophage sequence and modified at one nucleotide position to enhance the complementarity of the Shine Dalgarno (SD) motif to the ribosomal 16s RNA of Lactococcus lactis (Schofield et al. pers. coms. University of Cambridge Dept. Pathology.).

A Lactococcus lactis MG1363 chromosomal DNA fragment exhibiting promoter activity which was subsequently designated P7 was cloned between the EcoRI and Bglll sites present in the expression cassette, creating pTREX7. This active promoter region had been previously isolated using the promoter probe vector pSB292 (Waterfield et al, Gene, 165:9-15 (1995)). The promoter fragment was amplified by PCR using the Vent DNA polymerase according to the manufacturer.

The pTREPl vector was then constructed as follows. An artificial DNA fragment which included a transcription terminator, the forward pUC sequencing primer, a promoter multiple -cloning site region and a universal translation stop sequence was created by annealing two overlapping partially complementary synthetic oligonucleotides together and extending with sequenase according to manufacturers instructions. The sense and anti-sense (pTREPF and pTREPpJ oligonucleotides contained the recognition sites for EcoRV and BamHI at their 5 ' ends respectively to facilitate cloning into pTREX7. The transcription terminator was that of the Bacillus penicillinase gene, which has been shown to be effective in Lactococcus (Jos et al, Applied and Environmental Microbiology, 50:540-542 (1985)). This was considered necessary as expression of target genes in the pTREX vectors was observed to be leaky and is thought to be the result of cryptic promoter activity in the origin region (Schofield et al. pers. coms. University of Cambridge Dept. Pathology.). The forward pUC primer sequencing was included to enable direct sequencing of cloned DNA fragments. The translation stop sequence which encodes a stop codon in 3 different frames was included to prevent translational fusions between vector genes and cloned DNA fragments. The pTREX7 vector was first digested with EcoRI and blunted using the 5' - 3' polymerase activity of T4 DNA polymerase (NEB) according to manufacturer's instructions. The EcoRI digested and blunt ended pTREX7 vector was then digested with Bgl II thus removing the P7 promoter. The artificial DNA fragment derived from the annealed synthetic oligonucleotides was then digested with EcoRV and Bam HI and cloned into the EcoRI(blunted)-Bgl II digested pTREX7 vector to generate pTREP. A Lactococcus lactis MG1363 chromosomal promoter designated PI was then cloned between the EcoRI and Bglll sites present in the pTREP expression cassette forming pTREPl. This promoter was also isolated using the promoter probe vector pSB292 and characterised by Waterfield et al , (1995), supra. The PI promoter fragment was originally amplified by PCR using vent DNA polymerase according to manufacturers instructions and cloned into the pTREX as an EcoRI-Bglll DNA fragment. The EcoRI-Bglll PI promoter containing fragment was removed from pTREXl by restriction enzyme digestion and used for cloning into pTREP (Schofield et al. pers. coms. University of Cambridge, Dept. Pathology.).

(b) PCR amplification of the S. aureus nuc gene.

The nucleotide sequence of the S. aureus nuc gene (EMBL database accession number V01281) was used to design synthetic oligonucleotide primers for PCR amplification. The primers were designed to amplify the mature form of the nuc gene designated nucA which is generated by proteolytic cleavage of the N-terminal 19 to 21 amino acids of the secreted propeptide designated Snase B (Shortle, (1983), supra). Three sense primers (nucSl, nucS2 and nucS3, Appendix 1) were designed, each one having a blunt-ended restriction endonuclease cleavage site for EcoRV or Smal in a different reading frame with respect to the nuc gene. Additionally Bglll and BamHI were incorporated at the 5' ends of the sense and anti-sense primers respectively to facilitate cloning into BamHI and Bglll cut pTREPl. The sequences of all the primers are given in Appendix 1. Three nuc gene DNA fragments encoding the mature form of the nuclease gene (NucA) were amplified by PCR using each of the sense primers combined with the anti-sense primer described above. The nuc gene fragments were amplified by PCR using S. aureus genomic DNA template, Vent DNA Polymerase (NEB) and the conditions recommended by the manufacturer. An initial denaturation step at 93 C for 2 min was followed by 30 cycles of denaturation at 93 C for 45 sec, annealing at 50 C for 45 seconds, and extension at 73 C for 1 minute and then a final 5 min extension step at 73 C. The PCR amplified products were purified using a Wizard clean up column (Promega) to remove unincorporated nucleotides and primers.

(c) Construction of the pTREPl -nuc vectors

The purified nuc gene fragments described in section b were digested with Bgl II and BamHI using standard conditions and ligated to BamHI and Bglll cut and dephosphorylated pTREPl to generate the pTREPl -nuc 1, pTREPl -nuc2 and pTREPl -nuc3 series of reporter vectors. General molecular biology techniques were carried out using the reagents and buffer supplied by the manufacture or using standard conditions(Sambrook and Maniatis, (1989), supra). In each of the pTREPl - nuc vectors the expression cassette comprises a transcription terminator, lactococcal promoter PI, unique cloning sites (Bglll, EcoRV or Smal) followed by the mature form of the nuc gene and a second transcription terminator. Note that the sequences required for translation and secretion of the nuc gene were deliberately excluded in this construction. Such elements can only be provided by appropriately digested foreign DNA fragments (representing the target bacterium) which can be cloned into the unique restriction sites present immediately upstream of the nuc gene. In possessing a promoter, the pTREPl -nuc vectors differ from the pFUN vector described by Poquet et al (1998), supra, which was used to identify L. lactis exported proteins by screening directly for Nuc activity directly in L. lactis. As the pFUN vector does not contain a promoter upstream of the nuc open reading frame the cloned genomic DNA fragment must also provide the signals for transcription in addition to those elements required for translation initiation and secretion of Nuc. This limitation may prevent the isolation of genes that are distant from a promoter for example genes which are within polycistronic operons. Additionally there can be no guarantee that promoters derived from other species of bacteria will be recognised and functional in L. lactis. Certain promoters may be under stringent regulation in the natural host but not in L. lactis. In contrast, the presence of the PI promoter in the pTREPl -nuc series of vectors ensures that promoter less DNA fragments (or DNA fragments containing promoter sequences not active in L. lactis) will still be transcribed.

(d) Screening for secreted proteins in S. pneumoniae

Genomic DNA isolated from S. pneumoniae was digested with the restriction enzyme Tru9I. This enzyme which recognises the sequence 5'- TTAA -3' was used because it cuts A/T rich genomes efficiently and can generate random genomic DNA fragments within the preferred size range (usually averaging 0.5 - 1.0 kb). This size range was preferred because there is an increased probability that the PI promoter can be utilised to transcribe a novel gene sequence. However, the PI promoter may not be necessary in all cases as it is possible that many Streptococcal promoters are recognised in L. lactis. DNA fragments of different size ranges were purified from partial Tru9I digests of S. pneumoniae genomic DNA. As the Tru 91 restriction enzyme generates staggered ends the DNA fragments had to be made blunt ended before ligation to the EcoRV or Smal cut pTREPl -nuc vectors. This was achieved by the partial fill-in enzyme reaction using the 5 '-3' polymerase activity of Klenow enzyme. Briefly Tru9I digested DNA was dissolved in a solution (usually between 10-20 μl in total) supplemented with T4 DNA ligase buffer (New England Biolabs; NEB) (IX) and 33 μM of each of the required dNTPs, in this case dATP and dTTP. Klenow enzyme was added (1 unit Klenow enzyme (NEB) per μg of DNA) and the reaction incubated at 25°C for 15 minutes. The reaction was stopped by incubating the mix at 75°C for 20 minutes. EcoRV or Smal digested pTREP-nuc plasmid DNA was then added (usually between 200-400 ng). The mix was then supplemented with 400 units of T4 DNA ligase (NEB) and T4 DNA ligase buffer (IX) and incubated overnight at 16°C. The ligation mix was precipitated directly in 100% Ethanol and 1/10 volume of 3M sodium acetate (pH 5.2) and used to transform L. lactis MG1363 (Gasson, 1983). Alternatively, the gene cloning site of the pTREP-nuc vectors also contains a Bglll site which can be used to clone for example Sau3AI digested genomic DNA fragments. L. lactis transformant colonies were grown on brain heart infusion agar and nuclease secreting (Nuc+) clones were detected by a toluidine blue-DNA-agar overlay (0.05 M Tris pH 9.0, 10 g of agar per litre, 10 g of NaCl per liter, 0.1 mM CaC12, 0.03% wt/vol. salmon sperm DNA and 90 mg of Toluidine blue O dye) essentially as described by Shortle, 1983, supra and Le Loir et al, 1994, supra). The plates were then incubated at 37°C for up to 2 hours. Nuclease secreting clones develop an easily identifiable pink halo. Plasmid DNA was isolated from Nuc+ recombinant L. lactis clones and DNA inserts were sequenced on one strand using the NucSeq sequencing primer described in Appendix 1 , which sequences directly through the DNA insert.

Isolation of Genes Encoding Exported Proteins from S. pneumoniae

A large number of gene sequences putatively encoding exported proteins in S. pneumoniae have been identified using the nuclease screening system. These have now been further analysed to remove artefacts. The sequences identified using the screening system have been analysed using a number of parameters.

1. All putative surface proteins were analysed for leader/signal peptide sequences using the software programs Sequencher (Gene Codes Corporation) and DNA Strider (Marck, Nucleic Acids Res., 16:1829-1836 (1988)). Bacterial signal peptide sequences share a common design. They are characterised by a short positively charged N-terminus (N region) immediately preceding a stretch of hydrophobic residues (central portion-h region) followed by a more polar C-terminal portion which contains the cleavage site (c-region). Computer software is available which allows hydropathy profiling of putative proteins and which can readily identify the very distinctive hydrophobic portion (h-region) typical of leader peptide sequences. In addition, the sequences were checked for the presence of or absence of a potential ribosomal binding site (Shine-Dalgarno motif) required for translation initiation of the putative nuc reporter fusion protein.

2. All putative surface protein sequences were also matched with all of the protein/DNA sequences using the publicly databases [OWL-proteins inclusive of SwissProt and GenBank translations] . This allows us to identify sequences similar to known genes or homologues of genes for which some function has been ascribed. Hence it has been possible to predict a function for some of the genes identified using the LEEP system and to unequivocally establish that the system can be used to identify and isolate gene sequences of surface associated proteins. We should also be able to confirm that these proteins are indeed surface related and not artifacts. The LEEP system has been used to identify novel gene targets for vaccine and therapy. 3. Some of the genes identified proteins did not possess a typical leader peptide sequence and did not show homology with any DNA/protein sequences in the database. Indeed these proteins may indicate the primary advantage of our screening method, i.e. the isolation of atypical surface-related proteins, which may have been missed in all previously described screening protocols or approaches based on sequence homology searches.

In all cases, only partial gene sequences were initially obtained. Full length genes were obtained in all cases by reference to the TIGR S.pneumoniae database

(www@tigr.org). Thus, by matching the originally obtained partial sequences with the database, we were able to identify the full length gene sequences. In this way, as described herein, three groups of genes were clearly identified, ie a group of genes encoding previously unidentified S.pneumoniae proteins, a second group exhibiting some homology with known proteins from a variety of sources and a third group which encoded known S.pneumoniae proteins, which were, however, not known as antigens.

Example 2: Vaccine trials

pcDNA3.1+ as a DNA vaccine vector

pcDNA3.1 + The vector chosen for use as a DNA vaccine vector was pcDNA3.1 (Invitrogen) (actually pcDNA3.1 + , the forward orientation was used in all cases but may be referred to as pcDNA3.1 here on). This vector has been widely and successfully employed as a host vector to test vaccine candidate genes to give protection against pathogens in the literature (Zhang, et al , Kurar and Splitter, Anderson et ah). The vector was designed for high-level stable and non-replicative transient expression in mammalian cells. pcDNA3.1 contains the ColEl origin of replication which allows convenient high-copy number replication and growth in E. coli. This in turn allows rapid and efficient cloning and testing of many genes. The pcDNA3.1 vector has a large number of cloning sites and also contains the gene encoding ampicillin resistance to aid in cloning selection and the human cytomegalovirus (CMV) immediate-early promoter/enhancer which permits efficient, high-level expression of the recombinant protein. The CMV promoter is a strong viral promoter in a wide range of cell types including both muscle and immune (antigen presenting) cells. This is important for optimal immune response as it remains unknown as to which cells types are most important in generating a protective response in vivo. A T7 promoter upstream of the multiple cloning site affords efficient expression of the modified insert of interest and which allows in vitro transcription of a cloned gene in the sense orientation.

Zhang, D. , Yang, X., Berry, J. Shen, C, McClarty, G. and Brunham, R.C. (1997) "DNA vaccination with the major outer-membrane protein genes induces acquired immunity to Chlamydia trachomatis (mouse pneumonitis) infection" . Infection and Immunity, 176, 1035-40.

Kurar, E. and Splitter, G.A. (1997) "Nucleic acid vaccination of Brucella abortus ribosomal L7/L12 gene elicits immune response". Vaccine, 15, 1851-57.

Anderson, R. , Gao, X.-M. , Papakonstantinopoulou, A., Roberts, M. and Dougan, G. (1996) "Immune response in mice following immunisation with DNA encoding fragment C of tetanus toxin" . Infection and Immunity, 64, 3168-3173.

Preparation of DNA vaccines

Oligonucleotide primers were designed for each individual gene of interest derived using the LEEP system. Each gene was examined thoroughly, and where possible, primers were designed such that they targeted that portion of the gene thought to encode only the mature portion of the gene protein. It was hoped that expressing those sequences that encode only the mature portion of a target gene protein, would facilitate its correct folding when expressed in mammalian cells. For example, in the majority of cases primers were designed such that putative N-terminal signal peptide sequences would not be included in the final amplification product to be cloned into the pcDNA3.1 expression vector. The signal peptide directs the polypeptide precursor to the cell membrane via the protein export pathway where it is normally cleaved off by signal peptidase I (or signal peptidase II if a lipoprotein). Hence the signal peptide does not make up any part of the mature protein whether it be displayed on the surface of the bacteria surface or secreted. Where an N-terminal leader peptide sequence was not immediately obvious, primers were designed to target the whole of the gene sequence for cloning and ultimately, expression in pcDNA3.1.

Having said that, however, other additional features of proteins may also affect the expression and presentation of a soluble protein. DNA sequences encoding such features in the genes encoding the proteins of interest were excluded during the design of oligonucleotides. These features included:

1. LPXTG cell wall anchoring motifs.

2. LXXC ipoprotein attachment sites.

3. Hydrophobic C-terminal domain. 4. Where no N-terminal signal peptide or LXXC was present the start codon was excluded.

5. Where no hydrophobic C-terminal domain or LPXTG motif was present the stop codon was removed.

Appropriate PCR primers were designed for each gene of interest and any and all of the regions encoding the above features was removed from the gene when designing these primers. The primers were designed with the appropriate enzyme restriction site followed by a conserved Kozak nucleotide sequence (in most cases(NB except in occasional instances for example ID59) GCCACC was used. The Kozak sequence facilitates the recognition of initiator sequences by eukaryotic ribosomes) and an ATG start codon upstream of the insert of the gene of interest. For example the forward primer using a BamHI site the primer would begin GCGGGATCCGCCACCATG followed by a small section of the 5' end of the gene of interest. The reverse primer was designed to be compatible with the forward primer and with a Notl restriction site at the 5' end in most cases (this site is TTGCGGCCGC) (NB except in occasional instances for example ID59 where a Xhol site was used instead of Notl).

PCR primers

The following PCR primers were designed and used to amplify the truncated genes of interest.


Forward Primer 5'










Cloning The insert along with the flanking features described above was amplified using PCR against a template of genomic DNA isolated from type 4 S. pneumoniae strain 11886 obtained from the National Collection of Type Cultures. The PCR product was cut with the appropriate restriction enzymes and cloned in to the multiple cloning site of pcDNA3.1 using conventional molecular biological techniques. Suitably mapped clones of the genes of interested were cultured and the plasmids isolated on a large scale ( > 1.5 mg) using Plasmid Mega Kits (Qiagen). Successful cloning and maintenance of genes was confirmed by restriction mapping and sequencing ~ 700 base pairs through the 5 ' cloning junction of each large scale preparation of each construct.

Strain validation

A strain of type 4 was used in cloning and challenge methods which is the strain from which the S. pneumoniae genome was sequenced. A freeze dried ampoule of a homogeneous laboratory strain of type 4 S. pneumoniae strain NCTC 11886 was obtained from the National Collection of Type Strains. The ampoule was opened and the cultured re suspended with 0.5 ml of tryptic soy broth (0.5% glucose, 5% blood). The suspension was subcultured into 10 ml tryptic soy broth (0.5% glucose, 5% blood) and incubated statically overnight at 37°C. This culture was streaked on to 5 % blood agar plates to check for contaminants and confirm viability and on to blood agar slopes and the rest of the culture was used to make 20% glycerol stocks. The slopes were sent to the Public Health Laboratory Service where the type 4 serotype was confirmed.

A glycerol stock of NCTC 11886 was streaked on a 5 % blood agar plate and incubated overnight in a CO2 gas jar at 37°C. Fresh streaks were made and optochin sensitivity was confirmed. Pneumococcal challenge

A standard inoculum of type 4 S. pneumoniae was prepared and frozen down by passaging a culture of pneumococcus lx through mice, harvesting from the blood of infected animals, and grown up to a predetermined viable count of around 109 cfu/ml in broth before freezing down. The preparation is set out below as per the flow chart. Streak pneumococcal culture and confirm identity


Grow over-night culture from 4-5 colonies on plate above


Animal passage pneumococcal culture

(i.p. injection of cardiac bleed to harvest)


Grow over-night culture from animal passaged pneumococcus

Grow day culture (to pre-determined optical density) from over-night of animal passage and freeze down at -70 °C - This is standard minimum

Thaw one aliquot of standard inoculum to viable count

Use standard inoculum to determine effective dose (called Virulence Testing) All subsequent challenges - use standard inoculum to effective dose

An aliquot of standard inoculum was diluted 500x in PBS and used to inoculate the mice.

Mice were lightly anaesthetised using halothane and then a dose of 1.4 x 105 cfu of pneumococcus was applied to the nose of each mouse. The uptake was facilitated by the normal breathing of the mouse, which was left to recover on its back.

S. pneumoniae Vaccine trials

Vaccine trials in mice were carried out by the administration of DNA to 6 week old CBA/ca mice (Harlan, UK). Mice to be vaccinated were divided into groups of six and each group was immunised with recombinant pcDNA3.1 + plasmid DNA containing a specific target-gene sequence of interest. A total of 100 μg of DNA in Dulbecco's PBS (Sigma) was injected intramuscularly into the tibialis anterior muscle of both legs (50 μl in each leg). A boost was carried using the same procedure 4 weeks later. For comparison, control groups were included in all vaccine trials. These control groups were either unvaccinated animals or those administered with non-recombinant pcDNA3.1 + DNA (sham vaccinated) only, using the same time course described above. 3 weeks after the second immunisation, all mice groups were challenged intra-nasally with a lethal dose of S. pneumoniae serotype 4 (strain NCTC 11886). The number of bacteria administered was monitored by plating serial dilutions of the inoculum on 5% blood agar plates. A problem with intranasal immunisations is that in some mice the inoculum bubbles out of the nostrils, this has been noted in results table and taken account of in calculations. A less obvious problem is that a certain amount of the inoculum for each mouse may be swallowed. It is assumed that this amount will be the same for each mouse and will average out over the course of inoculations. However, the sample sizes that have been used are small and this problem may have significant effects in some experiments. All mice remaining after the challenge were killed 3 or 4 days after infection. During the infection process, challenged mice were monitored for the development of symptoms associated with the onset of S. pneumoniae induced-disease. Typical symptoms in an appropriate order included piloerection, an increasingly hunched posture, discharge from eyes, increased lethargy and reluctance to move. The latter symptoms usually coincided with the development of a moribund state at which stage the mice were culled to prevent further suffering. These mice were deemed to be very close to death, and the time of culling was used to determine a survival time for statistical analysis. Where mice were found dead, the survival time was taken as the last time point when the mouse was monitored alive. Interpretation of Results

A positive result was taken as any DNA sequence that was cloned and used in challenge experiments as described above which gave protection against that challenge. Protection was taken as those DNA sequences that gave statistically significant protection (to a 95% confidence level (p <0.05)) and also those which were marginal or close to significant using Mann- Whitney or which show some protective features for example there were one or more outlying mice or because the time to the first death was prolonged. It is acceptable to allow marginal or nonsignificant results to be considered as potential positives when it is considered that the clarity of some of the results may be clouded by the problems associated with the administration of intranasal infections.


Trials 1-6 (see figure 1)


Figure imgf000033_0001

CO z m q c r* m rυ σ>

Figure imgf000033_0002

* - bubbled when dosed so may not have received full inoculum. T - terminated at end of experiment having no symptoms of infection. Numbers in brackets - survival times disregarded assuming incomplete dosing p value 1 refers to significance tests compared to unvaccinated controls

p value 2 refers to significance tests compared to pcDNA3.1 + vaccinated controls

Statistical Analyses.

Trial 1 - None of the other groups had significantly longer survival times than the controls. The survival times of the unvaccinated and pcDNA3.1 control groups were not significantly different. One of the mice from ID5 was an outlying result and the mean survival times for ID5 were extended but not significantly so.

Trial 2 - The group vaccinated with ID59 had significantly longer survival times than the unvaccinated control group.

Trial 5 - The group vaccinated with ID59 again survived for an average of almost 10 hours longer than the controls but the results were not quite statistically significant.

Trial 6 - The group vaccinated with ID51 did not have survival times significantly higher than unvaccinated controls (p= < 36.0), however, there were 2 outlying mice in the vaccinated group.

Vaccine trials 7 and 8 (See figure 2)

Figure imgf000034_0001

* - bubbled when dosed so may not have received full inoculum.

T - terminated at end of experiment having no symptoms of infection. Numbers in brackets - survival times disregarded assuming incomplete dosing p value 1 refers to significance tests compared to unvaccinated controls

Statistical Analyses. Trial 7 - The ID29 vaccinated group showed prolonged times to the first death. T

Trial 8 - The group vaccinated with ID50 survived significantly longer than unvaccinated controls.

SUBSTΓΓUTE SHEET (RULE 26) Appendix I - Oligonucleotide primers


Bgl ll Eco RV 5'- cgagatctgatatctcacaaacagataacggcgtaaatag -3'


Bgl II Sma I

5'- gaagatcttccccgggatcacaaacagataacggcgtaaatag -3'


Bgl ll Eco RV 5'- cgagatctgatatocatcacaaacagataacggcgtaaatag -3'


Bam HI

5'- cgggatccttatggacctgaatcagcgttgtc -3'

NucSeq 5 ' - ggatgctttgtttcaggtgtatc -3 '


5 ' - catgatatcggtacctcaagctcatatcattgtccggcaatggtgtgggctttttttgttttagcggataa caatttcacac -3 ' pTREPR

5 ' - gcggatcccccgggcttaattaatgtttaaacactagtcgaagatctcgcgaattctcctgtgtgaaatt gttatccgcta -3' pUCF

5'- cgccagggttttcccagtcacgac -3'


5'- tcaggggggcggagcctatg -3'


5'- tcgtatgttgtgtggaattgtg -3' V2

5'- tccggctcgtatgttgtgtggaattg -3'

TABLE 1 ID4 1200 bp





Z ID5 1125 bp







ID11 696 bp













ID29 945 bp













ID107 -78bp



ID109 714 bp





ID112 360 bp

































































ID6 597 bp



ID7 1401 bp














ID9 705 bp










ID14 1266 bp







ID16 1725 bp








ID18 1224 bp















ID23 1434 bp




























ID31 1182bp








ID32 900bp






ID33 855bp






ID34 633bp











ID36 1311bp






ID37 714bp




IP38 729bp

















ID41 762b






ID42 372bp












IP45 816bp








ID47 1260bp







ID48 705bp












ID50 759bp












ID52 774bp















ID101 1338bp














ID103 2292bp








ID104 879bp





ID106 327bp










TEIZ ID110 1902bp









ID111 1179bp







ID113 2466bp










ID114 1974bp










ID115 663bp












ID117 870bp





ID118 345bp




ID119 639bp













ID124 131 lbp



























ID12 684bp





ID13 1182bp






ID15 939bp





















ID54 1446bp











ID58 3990bp
















ID122 825bp




ID123 225bp




1. A Streptococcus pneumoniae protein or polypeptide having a sequence selected from those shown in table 1.
2. A Streptococcus pneumoniae protein or polypeptide having a sequence selected from those shown in table 2.
3. A protein or polypeptide as claimed in claim 1 or claim 2 provided in substantially pure form.
4. A protein or polypeptide which is substantially identical to one defined in any one of claims 1 to 3.
5. A homologue or derivative of a protein or polypeptide as defined in any one of claims 1 to 4.
6. An antigenic and/or immunogenic fragment of a protein or polypeptide as defined in Tables 1-3.
7. A nucleic acid molecule comprising or consisting of a sequence which is:
(i) any of the DNA sequences set out in Table 1 or their RNA equivalents;
(ii) a sequence which is complementary to any of the sequences of (i); (iii) a sequence which codes for the same protein or polypeptide, as those sequences of (i) or (ii);
(iv) a sequence which is substantially identical with any of those of (i), (ii) and (iii);
(v) a sequence which codes for a homologue, derivative or fragment of a protein as defined in Table 1.
8. A nucleic acid molecule comprising or consisting of a sequence which is:
(i) any of the DNA sequences set out in Table 2 or their RNA equivalents;
(ii) a sequence which is complementary to any of the sequences of (i);
(iii) a sequence which codes for the same protein or polypeptide, as those sequences of (i) or (ii);
(iv) a sequence which is substantially identical with any of those of (i), (ii) and (iii);
(v) a sequence which codes for a homologue, derivative or fragment of a protein as defined in Table 2.
9. The use of a protein or polypeptide having a sequence selected from those shown in Tables 1-3, or homologues, derivatives and/or fragments thereof, as an immunogen and/or antigen.
10. An immunogenic and/or antigenic composition comprising one or more proteins or polypeptides selected from those whose sequences are shown in Tables 1- 3, or homologues or derivatives thereof, and/or fragments of any of these.
11. An immunogenic and/or antigenic composition as claimed in claim 10 which is a vaccine or is for use in a diagnostic assay.
12. A vaccine as claimed in claim 11 which comprises one or more additional components selected from excipients, diluents, adjuvants or the like.
13. A vaccine composition comprising one or more nucleic acid sequences as defined in Tables 1-3.
14. A method for the detection/diagnosis of S.pneumoniae which comprises the step of bringing into contact a sample to be tested with at least one protein or polypeptide as defined in Tables 1-3, or homologue, derivative or fragment thereof.
15. An antibody capable of binding to a protein or polypeptide as defined in Tables 1-3, or for a homologue, derivative or fragment thereof.
16. An antibody as defined in claim 15 which is a monoclonal antibody.
17. A method for the detection/diagnosis of S.pneumoniae which comprises the step of bringing into contact a sample to be tested and at least one antibody as define din claim 15 or claim 16.
18. A method for the detection/diagnosis of S.pneumoniae which comprises the step of bringing into contact a sample to be tested with at least one nucleic acid
SUBSTΓΓUTE SHEET (RULE 26) sequence as defined in claim 7 or claim 8.
19. A method of determining whether a protein or polypeptide as defined in Tables 1-3 represents a potential anti-microbial target which comprises inactivating said protein or polypeptide and determining whether S.pneumoniae is still viable.
20. The use of an agent capable of antagonising, inhibiting or otherwise interfering with the function or expression of a protein or polypeptide as defined in Tables 1-3 in the manufacture of a medicament for use in the treatment or prophylaxis of S.pneumoniae infection
PCT/GB1999/002452 1998-07-27 1999-07-27 NUCLEIC ACIDS AND PROTEINS FROM $i(STREPTOCOCCUS PNEUMONIAE) WO2000006738A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
GBGB9816336.3A GB9816336D0 (en) 1998-07-27 1998-07-27 Proteins
GB9816336.3 1998-07-27
US12532999P true 1999-03-19 1999-03-19
US60/125,329 1999-03-19

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP99934990A EP1144640A3 (en) 1998-07-27 1999-07-27 Nucleic acids and proteins from streptococcus pneumoniae
JP2000562520A JP2002521058A (en) 1998-07-27 1999-07-27 Streptococcus pneumoniae-derived nucleic acids and proteins
US09/769,744 US20030134407A1 (en) 1998-07-27 2001-01-26 Nucleic acids and proteins from Streptococcus pneumoniae
US11/448,101 US8632784B2 (en) 1998-07-27 2006-06-07 Nucleic acids and proteins from Streptococcus pneumoniae

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US09/769,744 Continuation US20030134407A1 (en) 1998-07-27 2001-01-26 Nucleic acids and proteins from Streptococcus pneumoniae

Publications (2)

Publication Number Publication Date
WO2000006738A2 true WO2000006738A2 (en) 2000-02-10
WO2000006738A3 WO2000006738A3 (en) 2001-08-23



Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1999/002452 WO2000006738A2 (en) 1998-07-27 1999-07-27 NUCLEIC ACIDS AND PROTEINS FROM $i(STREPTOCOCCUS PNEUMONIAE)

Country Status (4)

Country Link
EP (1) EP1144640A3 (en)
JP (2) JP2002521058A (en)
CN (1) CN1318103A (en)
WO (1) WO2000006738A2 (en)

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000039299A2 (en) * 1998-12-23 2000-07-06 Shire Biochem Inc. Streptococcus antigens
WO2000076540A2 (en) * 1999-06-10 2000-12-21 Med Immune, Inc. Streptococcus pneumoniae proteins and vaccines
WO2002077021A2 (en) * 2001-03-27 2002-10-03 Chiron Srl. Streptococcus pneumoniae proteins and nucleic acids
WO2002079241A2 (en) * 2001-03-30 2002-10-10 Microbial Technics Limited Secreted streptococcus pneumoniae proteins
JP2003526676A (en) * 2000-03-14 2003-09-09 カイロン ベーリング ゲーエムベーハー アンド カンパニー Adjuvant for vaccines
WO2004048575A2 (en) * 2002-11-26 2004-06-10 Id Biomedical Corporation Streptococcus pneumoniae surface polypeptides
US6887480B1 (en) 1999-06-10 2005-05-03 Medimmune, Inc. Streptococcus pneumoniae proteins and vaccines
US7074415B2 (en) 2000-06-20 2006-07-11 Id Biomedical Corporation Streptococcus antigens
US7128918B1 (en) 1998-12-23 2006-10-31 Id Biomedical Corporation Streptococcus antigens
US7262024B2 (en) 2001-12-20 2007-08-28 Id Biomedical Corporation Streptococcus antigens
US7381815B2 (en) 1997-07-02 2008-06-03 Sanofi Parker Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
WO2009016515A3 (en) * 2007-08-01 2009-08-13 Novartis Ag Compositions comprising pneumococcal antigens
WO2009111337A1 (en) 2008-03-03 2009-09-11 Irm Llc Compounds and compositions as tlr activity modulators
WO2009115508A2 (en) * 2008-03-17 2009-09-24 Intercell Ag Peptides protective against s. pneumoniae and compositions, methods and uses relating thereto
US7608276B2 (en) 2001-03-27 2009-10-27 Novartis Vaccines And Diagnostics Srl Staphylococcus aureus proteins and nucleic acids
EP1950302A3 (en) * 1998-12-23 2010-06-23 ID Biomedical Corporation Streptococcus antigens
EP2218457A1 (en) * 2009-02-16 2010-08-18 Karlsruher Institut für Technologie CD44v6 peptides as inhibitors of bacterial infections
WO2010144734A1 (en) 2009-06-10 2010-12-16 Novartis Ag Benzonaphthyridine-containing vaccines
WO2011027222A2 (en) 2009-09-02 2011-03-10 Novartis Ag Immunogenic compositions including tlr activity modulators
WO2011030218A1 (en) 2009-09-10 2011-03-17 Novartis Ag Combination vaccines against respiratory tract diseases
WO2011049677A1 (en) 2009-09-02 2011-04-28 Irm Llc Compounds and compositions as tlr activity modulators
WO2011057148A1 (en) 2009-11-05 2011-05-12 Irm Llc Compounds and compositions as tlr-7 activity modulators
EP2336357A1 (en) * 2003-04-15 2011-06-22 Intercell AG S. pneumoniae antigens
WO2011084549A1 (en) 2009-12-15 2011-07-14 Novartis Ag Homogeneous suspension of immunopotentiating compounds and uses thereof
WO2011119759A1 (en) 2010-03-23 2011-09-29 Irm Llc Compounds (cystein based lipopeptides) and compositions as tlr2 agonists used for treating infections, inflammations, respiratory diseases etc.
US8071111B2 (en) * 2000-11-09 2011-12-06 Stichting Dienst Landbouwkundig Onderzoek Virulence of Streptococci
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
WO2012100234A1 (en) 2011-01-20 2012-07-26 Genocea Biosciences, Inc. Vaccines and compositions against streptococcus pneumoniae
WO2013131983A1 (en) 2012-03-07 2013-09-12 Novartis Ag Adjuvanted formulations of streptococcus pneumoniae antigens
US8728490B2 (en) 1998-07-22 2014-05-20 Stichting Dienst Landbouwkundig Onderzoek Streptococcus suis vaccines and diagnostic tests
WO2014118305A1 (en) 2013-02-01 2014-08-07 Novartis Ag Intradermal delivery of immunological compositions comprising toll-like receptor agonists
US20150374811A1 (en) * 2013-02-07 2015-12-31 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
US10105412B2 (en) 2009-06-29 2018-10-23 Genocea Biosciences, Inc. Vaccines and compositions against Streptococcus pneumoniae

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2707202T3 (en) 2005-04-08 2019-04-02 Wyeth Llc Separation of polysaccharide contaminants from Streptococcus pneumoniae by pH manipulation
CN103834667B (en) * 2013-12-31 2016-08-17 李越希 Streptococcus pneumoniae PspA chemically synthesized extracellular domain protein gene fragment and expression APPLIED

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995006732A2 (en) * 1993-09-01 1995-03-09 The Rockefeller University Bacterial exported proteins and acellular vaccines based thereon
WO1997037026A1 (en) * 1996-04-02 1997-10-09 Smithkline Beecham Corporation Novel compounds
WO1997043303A1 (en) * 1996-05-14 1997-11-20 Smithkline Beecham Corporation Novel compounds
WO1998018931A2 (en) * 1996-10-31 1998-05-07 Human Genome Sciences, Inc. Streptococcus pneumoniae polynucleotides and sequences
WO1998026072A1 (en) * 1996-12-13 1998-06-18 Eli Lilly And Company Streptococcus pneumoniae dna sequences
WO1998031786A2 (en) * 1997-01-17 1998-07-23 Microbial Technics Limited Novel microorganisms

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995006732A2 (en) * 1993-09-01 1995-03-09 The Rockefeller University Bacterial exported proteins and acellular vaccines based thereon
WO1997037026A1 (en) * 1996-04-02 1997-10-09 Smithkline Beecham Corporation Novel compounds
WO1997043303A1 (en) * 1996-05-14 1997-11-20 Smithkline Beecham Corporation Novel compounds
WO1998018931A2 (en) * 1996-10-31 1998-05-07 Human Genome Sciences, Inc. Streptococcus pneumoniae polynucleotides and sequences
WO1998026072A1 (en) * 1996-12-13 1998-06-18 Eli Lilly And Company Streptococcus pneumoniae dna sequences
WO1998031786A2 (en) * 1997-01-17 1998-07-23 Microbial Technics Limited Novel microorganisms

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
POQUET I ET AL: "An export-specific reporter designed for gram-positive bacteria: application to Lactococcus lactis" J. BACTERIOL., vol. 180, no. 7, April 1998 (1998-04), pages 1904-1912, XP002125469 cited in the application *

Cited By (78)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7385047B1 (en) 1997-07-02 2008-06-10 Sanofi Pasteur Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US7381816B2 (en) 1997-07-02 2008-06-03 Sanofi Pasteur Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US7381815B2 (en) 1997-07-02 2008-06-03 Sanofi Parker Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US7388090B2 (en) 1997-07-02 2008-06-17 Sanofi Pasteur Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US7381814B1 (en) 1997-07-02 2008-06-03 Sanofi Pasteur Limted Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US7390493B2 (en) 1997-07-02 2008-06-24 Sanofi Pasteur Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US7396532B2 (en) 1997-07-02 2008-07-08 Sanofi Pasteur Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US7404958B2 (en) 1997-07-02 2008-07-29 Sanofi Pasteur Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US7405291B2 (en) 1997-07-02 2008-07-29 Sanofi Pasteur Limited Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
USRE45170E1 (en) 1998-07-22 2014-09-30 Stichting Dienst Landbouwkundig Onderzoek Streptococcus suis vaccines and diagnostic tests
US8728490B2 (en) 1998-07-22 2014-05-20 Stichting Dienst Landbouwkundig Onderzoek Streptococcus suis vaccines and diagnostic tests
EP1950302A3 (en) * 1998-12-23 2010-06-23 ID Biomedical Corporation Streptococcus antigens
US7635482B2 (en) 1998-12-23 2009-12-22 Id Biomedical Corporation Streptococcus antigens
WO2000039299A3 (en) * 1998-12-23 2000-11-02 Iaf Biochem Int Streptococcus antigens
US8211437B2 (en) 1998-12-23 2012-07-03 Id Biomedical Corporation Of Quebec Streptococcus antigens
EP2261358A3 (en) * 1998-12-23 2011-02-23 ID Biomedical Corporation Novel streptococcus antigen
EA007409B1 (en) * 1998-12-23 2006-10-27 Шайе Биокем Инк. Antigenic polypeptides streptococci, methods for their preparation and use
US7128918B1 (en) 1998-12-23 2006-10-31 Id Biomedical Corporation Streptococcus antigens
WO2000039299A2 (en) * 1998-12-23 2000-07-06 Shire Biochem Inc. Streptococcus antigens
EP1731166A2 (en) * 1999-06-10 2006-12-13 MedImmune, Inc. Streptococcus pneumoniae proteins and vaccines
EP1731166A3 (en) * 1999-06-10 2007-02-21 MedImmune, Inc. Streptococcus pneumoniae proteins and vaccines
WO2000076540A3 (en) * 1999-06-10 2001-02-08 Med Immune Inc Streptococcus pneumoniae proteins and vaccines
WO2000076540A2 (en) * 1999-06-10 2000-12-21 Med Immune, Inc. Streptococcus pneumoniae proteins and vaccines
US7132107B2 (en) 1999-06-10 2006-11-07 Medimmune, Inc. Streptococcus pneumoniae proteins and vaccines
JP2003501110A (en) * 1999-06-10 2003-01-14 ヒューマン ジーノーム サイエンシズ,インコーポレイテッド Streptococcus pneumoniae protein and vaccine
US6887480B1 (en) 1999-06-10 2005-05-03 Medimmune, Inc. Streptococcus pneumoniae proteins and vaccines
JP2003526676A (en) * 2000-03-14 2003-09-09 カイロン ベーリング ゲーエムベーハー アンド カンパニー Adjuvant for vaccines
US7074415B2 (en) 2000-06-20 2006-07-11 Id Biomedical Corporation Streptococcus antigens
US8071111B2 (en) * 2000-11-09 2011-12-06 Stichting Dienst Landbouwkundig Onderzoek Virulence of Streptococci
EP2314697A1 (en) * 2001-03-27 2011-04-27 Novartis Vaccines and Diagnostics S.r.l. Streptococcus pneumoniae proteins and nucleic acids
EP1630230A2 (en) * 2001-03-27 2006-03-01 Chiron SRL Streptococcus pneumoniae proteins and nucleic acids
US8398996B2 (en) 2001-03-27 2013-03-19 Novartis Ag Staphylococcus aureus proteins and nucleic acids
US9764020B2 (en) 2001-03-27 2017-09-19 Glaxosmithkline Biologicals Sa Staphylococcus aureus proteins and nucleic acids
US9296796B2 (en) 2001-03-27 2016-03-29 Glaxosmithkline Biologicals Sa Staphylococcus aureus proteins and nucleic acids
EP1630230A3 (en) * 2001-03-27 2006-05-17 Chiron SRL Streptococcus pneumoniae proteins and nucleic acids
US7608276B2 (en) 2001-03-27 2009-10-27 Novartis Vaccines And Diagnostics Srl Staphylococcus aureus proteins and nucleic acids
US8287884B2 (en) 2001-03-27 2012-10-16 Novartis Ag Staphylococcus aureus proteins and nucleic acids
US8753650B2 (en) 2001-03-27 2014-06-17 Novartis Ag Staphylococcus aureus proteins and nucleic acids
WO2002077021A2 (en) * 2001-03-27 2002-10-03 Chiron Srl. Streptococcus pneumoniae proteins and nucleic acids
WO2002077021A3 (en) * 2001-03-27 2003-08-28 Chiron Srl Streptococcus pneumoniae proteins and nucleic acids
US8747864B2 (en) 2001-03-27 2014-06-10 Novartis Ag Staphylococcus aureus proteins and nucleic acids
US8465750B2 (en) 2001-03-27 2013-06-18 Novartis Ag Staphylococcus aureus proteins and nucleic acids
WO2002079241A2 (en) * 2001-03-30 2002-10-10 Microbial Technics Limited Secreted streptococcus pneumoniae proteins
WO2002079241A3 (en) * 2001-03-30 2003-08-14 Microbial Technics Ltd Secreted streptococcus pneumoniae proteins
EP1959015A3 (en) * 2001-03-30 2008-12-03 Sanofi Pasteur Limited Secreted streptococcus pneumoniae proteins
US8101187B2 (en) 2001-03-30 2012-01-24 Sanofi Pasteur Limited Secreted Streptococcus pneumoniae proteins
US7262024B2 (en) 2001-12-20 2007-08-28 Id Biomedical Corporation Streptococcus antigens
WO2004048575A2 (en) * 2002-11-26 2004-06-10 Id Biomedical Corporation Streptococcus pneumoniae surface polypeptides
WO2004048575A3 (en) * 2002-11-26 2004-11-04 Shire Biochem Inc Streptococcus pneumoniae surface polypeptides
EP2336357A1 (en) * 2003-04-15 2011-06-22 Intercell AG S. pneumoniae antigens
WO2009016515A3 (en) * 2007-08-01 2009-08-13 Novartis Ag Compositions comprising pneumococcal antigens
EP2572726A1 (en) 2007-08-01 2013-03-27 Novartis AG Compositions comprising pneumococcal antigens
WO2009111337A1 (en) 2008-03-03 2009-09-11 Irm Llc Compounds and compositions as tlr activity modulators
US8445001B2 (en) 2008-03-17 2013-05-21 Intercell Ag Peptides protective against S. pneumoniae and compositions, methods and uses relating thereto
WO2009115508A2 (en) * 2008-03-17 2009-09-24 Intercell Ag Peptides protective against s. pneumoniae and compositions, methods and uses relating thereto
US8241643B2 (en) 2008-03-17 2012-08-14 Intercell Ag Peptides protective against S. pneumoniae and compositions, methods and uses relating thereto
WO2009115508A3 (en) * 2008-03-17 2009-11-12 Intercell Ag Peptides protective against s. pneumoniae and compositions, methods and uses relating thereto
CN101977927A (en) * 2008-03-17 2011-02-16 英特塞尔股份公司 Peptides protective against s. pneumoniae and compositions, methods and uses relating thereto
EP2218457A1 (en) * 2009-02-16 2010-08-18 Karlsruher Institut für Technologie CD44v6 peptides as inhibitors of bacterial infections
US8933017B2 (en) 2009-02-16 2015-01-13 Karlsruher Institut Fur Technologie CD44V6 peptides as inhibitors of bacterial infections
WO2010144734A1 (en) 2009-06-10 2010-12-16 Novartis Ag Benzonaphthyridine-containing vaccines
US10105412B2 (en) 2009-06-29 2018-10-23 Genocea Biosciences, Inc. Vaccines and compositions against Streptococcus pneumoniae
WO2011027222A2 (en) 2009-09-02 2011-03-10 Novartis Ag Immunogenic compositions including tlr activity modulators
WO2011049677A1 (en) 2009-09-02 2011-04-28 Irm Llc Compounds and compositions as tlr activity modulators
WO2011030218A1 (en) 2009-09-10 2011-03-17 Novartis Ag Combination vaccines against respiratory tract diseases
WO2011057148A1 (en) 2009-11-05 2011-05-12 Irm Llc Compounds and compositions as tlr-7 activity modulators
US10046048B2 (en) 2009-12-15 2018-08-14 Glaxosmithkline Biologicals S.A. Homogenous suspension of immunopotentiating compounds and uses thereof
WO2011084549A1 (en) 2009-12-15 2011-07-14 Novartis Ag Homogeneous suspension of immunopotentiating compounds and uses thereof
US9408907B2 (en) 2009-12-15 2016-08-09 Glaxosmithkline Biologicals Sa Homogenous suspension of immunopotentiating compounds and uses thereof
WO2011119759A1 (en) 2010-03-23 2011-09-29 Irm Llc Compounds (cystein based lipopeptides) and compositions as tlr2 agonists used for treating infections, inflammations, respiratory diseases etc.
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
US9393294B2 (en) 2011-01-20 2016-07-19 Genocea Biosciences, Inc. Vaccines and compositions against Streptococcus pneumoniae
WO2012100234A1 (en) 2011-01-20 2012-07-26 Genocea Biosciences, Inc. Vaccines and compositions against streptococcus pneumoniae
US10188717B2 (en) 2011-01-20 2019-01-29 Genocea Biosciences, Inc. Vaccines and compositions against Streptococcus pneumoniae
WO2013131983A1 (en) 2012-03-07 2013-09-12 Novartis Ag Adjuvanted formulations of streptococcus pneumoniae antigens
WO2014118305A1 (en) 2013-02-01 2014-08-07 Novartis Ag Intradermal delivery of immunological compositions comprising toll-like receptor agonists
US9827190B2 (en) 2013-02-01 2017-11-28 Glaxosmithkline Biologicals Sa Intradermal delivery of immunological compositions comprising toll-like receptor 7 agonists
US20150374811A1 (en) * 2013-02-07 2015-12-31 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease

Also Published As

Publication number Publication date
WO2000006738A3 (en) 2001-08-23
JP2002521058A (en) 2002-07-16
JP2008022856A (en) 2008-02-07
CN1318103A (en) 2001-10-17
EP1144640A2 (en) 2001-10-17
EP1144640A3 (en) 2001-11-28

Similar Documents

Publication Publication Date Title
Hammerschmidt et al. SpsA, a novel pneumococcal surface protein with specific binding to secretory immunoglobulin A and secretory component
US8372411B2 (en) S. pneumoniae antigens
Langermann et al. Protective humoral response against pneumococcal infection in mice elicited by recombinant bacille Calmette-Guérin vaccines expressing pneumococcal surface protein A.
EP0571538B1 (en) Structural gene of pneumococcal protein
CN100398653C (en) Novel streptococcus antigens
Charles et al. Molecular cloning and characterization of protective outer membrane protein P. 69 from Bordetella pertussis
Briles et al. Pneumococcal diversity: considerations for new vaccine strategies with emphasis on pneumococcal surface protein A (PspA)
AU716225B2 (en) Proteinase K resistant surface protein of neisseria meningitidis
Luo et al. Cloning and characterization of the major outer membrane protein gene (ompH) of Pasteurella multocida X-73.
Whatmore Streptococcus pyogenes sclB encodes a putative hypervariable surface protein with a collagen-like repetitive structure
US20030228323A1 (en) Novel group B streptococcus antigens
Rajam et al. Pneumococcal surface adhesin A (PsaA): a review
US5955089A (en) Strain selection of pneumococcal surface proteins
JPH1156374A (en) New hiss
JP2000510688A (en) Aspartyl tRNA synthetase of Streptococcus pneumoniae
JP2001519651A (en) Novel compounds
US20030035805A1 (en) Group B Streptococcus vaccine
JPH11513371A (en) Pneumococcal genes, portions thereof, the use thereof derived expression products as well as the gene, a portion of the gene, and the gene product
Wang et al. The involvement of sortase A in high virulence of STSS-causing Streptococcus suis serotype 2
CA2098448A1 (en) Dna fragments which encode the transferrin receptor subunits of neisseria meningitidis
Gouin et al. iactA of Listeria ivanovii, although distantly related to Listeria monocytogenes actA, restores actin tail formation in an L. monocytogenes actA mutant.
CA2253252A1 (en) Choline binding proteins for anti-pneumococcal vaccines
US20080031877A1 (en) Purification of bacterial antigens
CA2575548A1 (en) Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99810978.9

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): CN JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase in:

Ref document number: 2000 562520

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 09769744

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 1999934990

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999934990

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999934990

Country of ref document: EP