JP2002521058A - Nucleic acids and proteins from S. pneumoniae - Google Patents

Abstract

  (57) [Summary] Novel proteins from S. pneumoniae are described, along with the nucleic acid sequences that encode them. Vaccines and their use in screening methods are also described.

Description

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to proteins from S. pneumoniae, Streptococcus pneumoniae, nucleic acid molecules encoding such proteins, and further to the use and detection / diagnosis of said nucleic acid molecules and / or proteins as antigens / immunogens And a method of screening the protein / nucleic acid sequence as a potential antimicrobial target.

[0002] Streptococcus pneumoniae, commonly called pneumococcus (Pneumococcus), is an important pathogenic organism. An authoritative review has been written of the constant importance of S. pneumoniae infection with respect to human disease in developing and developed countries (Fiber, GR, GR).
Science, 265 : 1385-1387 (1994)). This review estimates that, on a global scale, this microorganism is believed to be the most common cause of acute respiratory infections, with one million children dying each year in many developing countries. (Stancefield, SK, Pediatr. Infect. Dis., 6 : 622 (1987)). In the United States, pneumococcus is still the most common cause of bacterial pneumonia, with mortality rates in young children, the elderly, and asplenia, heart, lung and kidney disease, diabetes, alcoholism, or immunosuppressive disease , Especially in those susceptible to such conditions as AIDS (Bryman et al., Arch. Intern. Med., 150:
1401 (1990)). These groups are at increased risk for pneumococcal sepsis and consequent meningitis, thus increasing the risk of death from pneumococcal infection. Pneumococci also cause otitis media and sinusitis. It is rampant in transmitting children in developed countries and is spending considerable money.

[0003] The need for effective prevention strategies against pneumococcal infections has been highlighted by the recent emergence of penicillin-resistant pneumococci. 6.6% of pneumococci isolated at 13 US hospitals in 12 states were found to be resistant to penicillin, and some of the isolates contained third generation cyclosporins. Were reported to be resistant to antibiotics (Schapert, SM, Vital and Health Statistics of the Centers for D
isease Control / National Center for Health Statistics, 214: 1 (1992)). The rate of penicillin resistance may be higher (up to 20%) in some hospitals (Bryman et al., J. Am. Med. Assoc., 271: 1831 (1994)). These facts are considered warnings, as the increase in penicillin resistance in pneumococci is recent, sudden, and decades after penicillin was an effective treatment.

[0004] For the above reasons, there is a compelling basis to consider how to prevent, control, diagnose, or treat pneumococcal disease.

[0005] Various efforts have been made to provide vaccines for the prevention of pneumococcal infection. Difficulties arise, for example, because of the diverse serotypes (at least 90) based on the structure of the polysaccharide capsule surrounding this organism. Vaccines against individual serotypes are not effective against other serotypes. This means that the vaccine must contain polysaccharide antigens from all ranges of serotypes in order to be effective in the majority of cases. A further problem is that capsular polysaccharides, each of which determines serotype and is a major protective antigen, have the highest levels of invasive pneumococcal infection and meningeal salts when purified and used as vaccines. It results from the finding that infants under the age of two who are at an incidence do not elicit a reliable protective antibody response.

[0006] An improvement in approaches using capsular antigens is to attach polysaccharides to the protein, especially to elicit an enhanced immune response by rendering the response T-cell dependent. This approach has been used, for example, in the development of vaccines against Haemophilus influenzae. However, there are cost issues with both multi-polysaccharide vaccines and conjugate-based vaccines.

A third approach is to search for other antigen components that confer potential vaccine candidates. This is the basis of the present invention. Using a specially developed bacterial expression system, we were able to identify a group of protein antigens from pneumococcus. It is associated with or secreted by the bacterial envelope.

Thus, in a first aspect, the present invention provides a S. pneumoniae protein or polypeptide having one sequence selected from the sequence group shown in Table 1.

[0009] In a second aspect, the invention provides a S. pneumoniae protein or polypeptide having one sequence selected from the group of sequences shown in Table 2.

[0010] The protein or polypeptide of the present invention may be provided in a substantially pure form. For example, it can be provided substantially free of other proteins.

[0011] As discussed herein, the proteins or polypeptides of the present invention are useful as antigenic substances. Such substances can be "antigenic" and / or "immunogenic". Generally, "antigenic" is understood to mean that the protein or polypeptide can be used to raise antibodies and indeed be able to elicit an antibody response in a patient. "Immunogenic" is understood to mean that the protein or polypeptide is capable of eliciting a protective immune response in a patient. Thus, in the latter case, the protein or polypeptide may not only generate an antibody response, but may also generate a non-antibody-based immune response.

The skilled person will find that homologues or derivatives of the proteins or polypeptides according to the invention can also be used in the context of the present invention, ie as antigenic / immunogenic substances. Thus, for example, proteins or polypeptides containing one or more additions, deletions, substitutions, and the like, are encompassed by the present invention. Further, it is possible to substitute one amino acid for another similar "type". For example, replacing one hydrophobic amino acid with another.

To compare amino acid sequences, programs such as the CLUSTAL program can be used. The program compares amino acid sequences and finds an optimal alignment by inserting the appropriate space in either sequence. It is possible to calculate the identity or similarity of amino acids to the optimal alignment (identity of amino acid types plus conservation). Programs such as BLASTx align the longest stretch of similar sequences and assign a numerical value to its fitness. Thus, a comparison can be made if several similar regions are found, each with a different score. Both types of identity analysis are contemplated by the present invention.

In the case of homologues and derivatives, the degree of identity for a protein or polypeptide as described herein is determined by the degree to which the homologue or derivative is antigenic or immunogenic of the original protein or polypeptide. Is not as important as it should be.
However, it is appropriate to provide a homolog or derivative with at least 60% similarity (as discussed above) to the proteins or polypeptides described herein. Preferably, homologs or derivatives with at least 70% similarity, more preferably at least 80% similarity, are provided. Most preferably, homologues or derivatives with at least 90% or even 95% similarity are provided.

As an alternative approach, these homologs or derivatives could be fusion proteins that incorporate moieties that make purification easier, for example, by effectively labeling the desired protein or polypeptide. . The "label" may need to be removed, or the fusion protein itself may retain sufficient antigenicity to be useful.

In a further aspect of the invention there is provided an antigenic / immunogenic fragment of a protein or polypeptide of the invention or a homolog or derivative thereof.

For fragments of the proteins or polypeptides described herein, or homologs or derivatives thereof, the situation is somewhat different. An epitope region, i.e., a region responsible for the antigenicity or immunogenicity of a protein or polypeptide,
It is well known that it is possible to screen said antigenic proteins or polypeptides to identify Methods for performing such screening are well-known in the art. Thus, a fragment of the invention should include, or be sufficiently similar to, one or more such epitope regions in order to retain their antigenic / immunogenic properties. Thus, for fragments of the present invention, the degree of identity is likely irrelevant, as they may be 100% identical to certain portions of the proteins or polypeptides, homologues or derivatives described herein. . The important point, again, is that the fragment retains antigenic / immunogenic properties.

Thus, what is important for homologs, derivatives and fragments is that they have at least some of the antigenic / immunogenic properties of the protein or polypeptide from which they are derived.

Gene cloning techniques can be used to provide the proteins of the invention in substantially pure form. These techniques are described, for example, in Jay. Sambrook et al., Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press (1989). Thus, in a third aspect, the present invention relates to any of the following sequences: (i) any of the DNA sequences listed in Table 1 or their RNA equivalents; (ii) any of the sequences (i) (Iii) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii), (iv) substantially any of the sequences of (i), (ii) and (iii) (V) a sequence encoding a homologue, derivative or fragment of the protein defined in Table 1 or a nucleic acid molecule comprising or consisting of said sequence.

In a fourth aspect, the invention relates to any one of the following sequences: (i) any of the DNA sequences shown in Table 2 or their RNA equivalents; (ii) any of the sequences of (i) (Iii) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii), and (iv) substantially any of the sequences of (i), (ii) and (iii). (V) a sequence encoding a homologue, derivative or fragment of the protein defined in Table 2 or a nucleic acid molecule comprising or consisting of said sequence.

[0021] The nucleic acid molecule of the present invention may comprise a plurality of such sequences and / or fragments. The skilled artisan will appreciate that the present invention may include novel variants of these particular novel nucleic acid molecules exemplified herein. Such variants are encompassed by the present invention.
These can occur in nature, for example, due to strain mutations. For example, additions, substitutions, and / or deletions are included. In addition, and particularly when utilizing microbial expression systems, it is desirable to design the nucleic acid sequence by utilizing known and preferred codon terms in the particular organism used for expression. Thus, synthetic or non-naturally occurring variants are also included within the scope of the invention.

The term “RNA equivalent” used above refers to the fact that a given RNA molecule is a sequence that is complementary to the sequence of a given DNA molecule (“U” in RNA is replaced by “T” in the genetic code) Is allowed).

When comparing nucleic acid sequences for the purpose of determining the degree of homology or identity, BESTFIT
And GAP (both from the Wisconsin Genetics Computer Group (GCG) software package) can be used. For example, BESTFIT compares two sequences and produces an optimal alignment of the most similar fragments. GAP allows sequences to be aligned along their entire length, and seeks the best alignment by inserting the appropriate space in either sequence.
When discussing the identity of nucleic acid sequences, in the context of the present invention, this comparison is preferably made by aligning the sequences along their entire length.

A sequence having substantial identity has at least 50% sequence identity, preferably at least 75% sequence identity, and more preferably at least 90% sequence identity with the sequence.
Or it is preferred to have at least 95% sequence identity. In some cases, this sequence identity can be 99% or more.

The term "substantial identity" desirably indicates that the sequence has a greater degree of identity to any of the sequences described herein than to the prior art nucleic acid sequences.

However, if the nucleic acid sequence of the present invention encodes at least a part of a novel gene product, the present invention includes within its scope all possible sequences encoding the gene product or the novel part thereof You should be careful.

[0027] The nucleic acid molecule may be in isolated or recombinant form. It may be incorporated into a vector. The vector may be integrated into a host. Such vectors and suitable hosts form a further aspect of the invention.

Thus, for example, by using a probe based on the nucleic acid sequences provided herein, a S. pneumoniae gene can be identified. They can then be excised using restriction enzymes and cloned into a vector. This vector can be introduced into a suitable host for expression.

The nucleic acid molecule of the present invention can be obtained from S. pneumoniae by using an appropriate probe complementary to a part of the sequence of the nucleic acid molecule. Restriction enzymes or sonication techniques can be used to prepare appropriately sized fragments for the probe.

[0030] PCR techniques can also be used to amplify the required nucleic acid sequences.
Thus, the sequence data provided herein can be used to design two primers for use in PCR, so that the desired sequence, such as the entire gene or a fragment thereof, can be targeted and then amplified at high can do.

[0031] Primers are usually at least 15 to 25 nucleotides in length.

As a further alternative, chemical synthesis can be utilized. This may be automated. Relatively short sequences can be chemically synthesized and joined to make longer sequences.

There is another group of proteins from S. pneumoniae that have been identified using the bacterial expression systems described herein. These are known proteins from Streptococcus pneumoniae, which have never been identified as antigenic proteins. The amino acid sequences of this group of proteins, along with the DNA sequences that encode them, are listed in Table 3.
It is shown in These proteins, their homologs, derivatives and / or fragments can also be used as antigens / immunogens. Thus, in another aspect, the invention relates to the use of a protein or polypeptide having a sequence selected from those shown in Tables 1 to 3, or homologs, derivatives and / or fragments thereof, as an immunogen / antigen. provide.

[0034] In a further aspect, the present invention provides a protein or polypeptide selected from the sequences set forth in Tables 1-3, or a homolog or derivative thereof, and / or one or more fragments thereof. An immunogenic / antigenic composition comprising: In a preferred embodiment, the immunogenic / antigenic composition is a vaccine or is for use in a diagnostic test.

In the case of a vaccine, suitable additional excipients, diluents, adjuvants and the like may be included. A myriad of examples of these are well known in the art.

In the preparation of a so-called DNA vaccine, the nucleic acid sequences shown in Tables 1 to 3 can be used. Accordingly, the present invention also provides a vaccine composition comprising one or more of the nucleic acid sequences as defined herein. DNA vaccines have been described in the art (see, for example, Donnelli et al., Ann. Rev. Immunol., 15 : 617-648 (1997)), and the skilled artisan will be able to make and use DNA vaccines in accordance with the present invention. Such disclosed techniques can be used.

As already discussed herein, the proteins or polypeptides, homologues or derivatives thereof, and / or fragments thereof described herein may be used to detect / diagnose S. pneumoniae. Can be used. Such methods are based on the detection of antibodies to such proteins that may be present in the patient. Accordingly, the present invention provides a method for detecting / diagnosing S. pneumoniae, comprising the step of contacting a specimen sample with at least one of the proteins or homologues, derivatives or fragments thereof as described herein. This sample is preferably a tissue sample obtained from the patient to be tested or a biological sample such as a blood or saliva sample.

In another approach, the proteins described herein, or homologs, derivatives and / or fragments thereof, can be used to produce antibodies, and the resulting antibodies are then used to produce the corresponding antigens. And thus S. pneumoniae. Such antibodies form another aspect of the invention. Antibodies within the scope of the present invention may be monoclonal or polyclonal.

[0039] Polyclonal antibodies are those in which a protein as described herein, or a homolog, derivative or fragment thereof, is suitable for an animal host (eg, mouse, rat, guinea pig, rabbit, sheep, goat, or monkey). Upon injection, its production is stimulated and formed in the animal. If necessary, an adjuvant may be administered with the protein. Well known adjuvants include Freund's adjuvant (complete or incomplete) and aluminum hydroxide. This antibody can then be purified utilizing its binding to the proteins described herein.

[0040] Monoclonal antibodies can be produced by hybridomas. These can be formed by fusing myeloma cells with spleen cells producing the desired antibody to form an immortal cell line. Thus, the well-known Kohler and Milstein method (Nature 256 (1975)) or a subsequent variation of this method can be used.

Techniques for producing monoclonal and polyclonal antibodies that bind to a particular polypeptide / protein are now well developed in the art. These are discussed in standard immunology textbooks, such as Reut et al., Immunology Second Edition (1989), Churchill Livingstone, London.

In addition to whole antibodies, the present invention includes derivatives thereof, which are capable of binding to the proteins described herein. Thus, the invention includes antibody fragments and synthetic constructs. Examples of antibody fragments and synthetic constructs are described by Dagole et al.
ibtech 12 372-379 (September, 1994).

[0043] Antibody fragments include, for example, Fab, F (ab ') ₂ and Fv fragments. F
ab fragments, which are discussed in Reut et al. (supra). Fv fragments can be modified to make synthetic constructs known as single-chain Fv (scFv) molecules.
It contains a peptide linker covalently linked to the V _h and V _l regions. This linker contributes to the stability of the molecule. Other synthetic constructs that can be used include CDR peptides. These are synthetic peptides containing antigen binding determinants. Peptide mimetics may also be used. These molecules are usually conformationally restricted organic rings that mimic the structure of CDR loops and contain side chains that interact with antigen.

[0044] Synthetic constructs include chimeric molecules. Thus, for example, their humanized (primatized) antibodies or derivatives are also within the scope of the invention. An example of a humanized antibody is an antibody that has a human framework region while having a rodent hypervariable region. How to make a chimeric antibody
For example, discussed in Morrison et al. In PNAS, 81 , 6851-6855 (1984) and Takeda et al. In Nature, 314 , 452-454 (1985).

Synthetic constructs also include molecules that include additional moieties that provide a molecule with some desirable properties in addition to antigen binding. For example, the moiety may be a label (eg, a fluorescent or radioactive label). It may also be a pharmaceutically active substance.

The antibodies, or derivatives thereof, can be used for the detection / diagnosis of S. pneumoniae. Thus, in another aspect, the invention is a method of detecting / diagnosing S. pneumoniae,
A method comprising contacting an analyte sample with an antibody capable of binding to one or more of the proteins described herein, or homologs, derivatives and / or fragments thereof.

Further, so-called “Affibodies” can be used.
These are binding proteins selected from a combinatorial library of bacterial α-helix receptor domains (Nord et al.). Thus, small protein domains that can specifically bind to different target protein groups can be selected using a combinatorial approach.

It is also clear that the nucleic acid sequences described herein can be used for detecting / diagnosing S. pneumoniae. Thus, in a further aspect, the present invention provides:
Provided is a method of detecting / diagnosing S. pneumoniae, comprising contacting at least one of the nucleic acid sequences described herein with a sample sample. The sample is suitably a tissue sample obtained from the patient to be examined or a biological sample such as a blood or saliva sample. Such a sample may be pre-treated before use in the method of the invention. Thus, for example, a sample may be processed to extract DNA. The nucleic acid from S. pneumoniae can then be detected using a DNA probe based on the nucleic acid sequences described herein (ie, typically a fragment of such a sequence).

In a further aspect, the invention provides (a) a method of vaccinating a patient against S. pneumoniae, wherein the protein or polypeptide of the invention, or a derivative, homolog or fragment thereof,
Or (b) a method of vaccinating a patient against S. pneumoniae, wherein the nucleic acid molecule as defined herein is administered to the patient. (C) a method for preventing or treating S. pneumoniae infection, wherein the protein or polypeptide of the present invention, or a derivative, homolog or fragment thereof, or the immunogenic composition of the present invention. (D) a method of preventing or treating Streptococcus pneumoniae infection comprising administering to a patient a nucleic acid molecule as defined herein; (e) pneumonia A kit used for detecting / diagnosing a streptococcal infection, comprising a protein or polypeptide of the present invention, or a homolog, derivative or fragment thereof, or one of the antigenic compositions of the present invention. Kits containing more than a kit for use in detecting / diagnosing a (f) Streptococcus pneumoniae infection provides a kit, comprising one or more nucleic acid molecules as defined herein.

[0050] If we identified a group of important proteins, such proteins are potential targets for antimicrobial therapy. However, it is necessary to determine whether each individual protein is essential for the survival of the microorganism. Thus, the present invention is a method of determining whether a protein or polypeptide described herein is a potential antimicrobial target, which antagonizes the function or expression of the protein and inhibits them. Or other methods of interfering and determining whether S. pneumoniae is still alive.

A suitable way to inactivate the protein is to perform a selective gene knockout, ie, to block the expression of the protein and determine if it results in a lethal change. Suitable methods for performing such gene knockouts are described in Lee et al., PNAS, 94 : 13251-13256 (1997) and Corkman et al., 178 : 3736-3741 (1996).

In a last aspect, the invention antagonizes, inhibits, or otherwise antagonizes the function or expression of a protein or polypeptide of the invention in the manufacture of a medicament for use in the treatment or prevention of S. pneumoniae infection. The use of an agent which can be hindered in the manner described above is provided.

As mentioned above, we bind to the surface or secrete or release (exported)
Bacterial expression systems were used as a means to identify these proteins and thus could be used as antigens.

The information required for protein secretion / release has been studied extensively in bacteria. In most cases, release of the protein requires a signal peptide located at the N-terminus of the precursor protein for it to travel to a translocation device on the plasma membrane. During or after the transfer, the signal peptide is removed by a membrane-bound signal peptidase. Ultimately, the localization of this protein (ie, whether it should be secreted, an intact membrane protein, or attached to the cell wall) is determined by sequences other than the leader peptide itself. You.

We are particularly interested in surface localized or released proteins. This is because these are likely to be diagnostic reagents with novel chemical entities or antigens for use in vaccines as targets for therapy. Accordingly, the present inventors have developed a screening vector system in Lactococcus lactis that allows the identification and isolation of the gene encoding the released protein. We provide below a representative example showing how a novel surface-associated protein from a given S. pneumoniae was identified and characterized. In this screening vector, as a secretory reporter,
The staphylococcal nuclease gene nuc, which lacks its own release signal, has been integrated. Staphylococcal nuclease is a naturally secreted thermostable monomeric enzyme that is efficiently expressed and secreted in the range of Gram-positive bacteria (Shortle, Gene, 22 : 181-189 (1983) , Kobasevik et al., J. Bacte
riol., 162 : 521-528 (1985); Miller et al., J. Bacteriol., 169 : 3508-3514 (198
7), Libre et al., J. Bacteriol., 174 : 1854-1861 (1992), Le Loire et al., J. B.
acteriol., 176 : 5135-5139 (1994), Pocket et al., J. Bacteriol., 180 : 1904-1.
912 (1998)).

Recently, Pocket et al. ((1998), supra) lacked their own signal leader as a reporter to identify released proteins in Gram-positive bacteria.
A screening vector incorporating the uc gene has been described, and it has been described Applied to Lactis. This vector (pFUN) contains the pAMβ1 replicon, which functions in a broad host of Gram-positive bacteria, in addition to the ColE1 replicon, which promotes the replication of E. coli and certain other Gram-negative bacteria. The unique cloning site present in this vector provides for transcription and translation between the cloned genomic DNA fragment and the open reading frame of the truncated nuc gene lacking its own signal secretion leader. Can be used to create fusions for This nuc gene becomes an ideal reporter gene. This is because nuclease secretion can be easily detected by a simple and highly sensitive plate test. That is, the recombinant colony secreting this nuclease forms a pink halo, while the control colony remains white (Shortle, (11983), supra, Leroyal et al., (1994), supra).

The invention is thus described herein with reference to the following representative examples, which provide details of how the protein, polypeptide and nucleic acid sequences described herein were identified as antigenic targets. I do.

We have constructed three reporter vectors and used them to identify and isolate genomic DNA fragments from S. pneumoniae that encode secreted or surface-associated proteins. The use in Lactis is described here.

The present invention will now be described with reference to examples, which should not be construed as limiting the invention in any way. In the embodiments, reference is made to the drawings.

Example 1 (i) Construction of a reporter vector of the pTREP1-nuc series (a) Construction of the expression plasmid pTREP1 The pTREP1 plasmid is a high copy number (40 to 80 per cell) θ-replicating Gram-positive plasmid. It is a derivative of the pTREX plasmid, which itself is a derivative of the previously published pIL253 plasmid. pIL253 is pAMβ
1 (Simon and Chopin, Biochimie, 70: 559-567 (1988)). Immobile due to Lactis sex factor. pIL253 also lacks the trans function required for transfer or efficient mobilization by the parental conjugative plasmid, exemplified by pIL501. PAMβ1 replicon Enterococcus Clostridium & Asetobuchinikumu and Streptococcus, have already been transferred to various species including Lactobacillus and Bacillus species (Ourutoramu and Clen hammers, FEMS Microbiological Letters, 27: 12
9-134 (1985), Gibson et al., (1979), Leblanc et al., Proceedings of the Natio
nal Academy of Science USA, 75 : 3484-3487 (1978), showing its potential broad host utility. This pTREP1 plasmid is one transcription vector construct.

The pTREX vector was constructed as follows. An artificial DNA fragment containing a sequence believed to be an RNA stabilizing sequence, a translation initiation region (TIR), a target gene and a multiple cloning site for insertion of a transcription terminator, was annealed with two complementary oligonucleotides and TflDNA Prepared by extension with polymerase. The sense and anti-sense oligonucleotides included recognition sites for NheI and BamHI at their 5 'end, respectively, to facilitate cloning. This fragment was cloned into pLET1 (Wells et al., J. Appl. Bacteriol., 74: 629-6) cloned between the EcoRI and HindIII sites.
PUC19, which is a derivative of pUC19 containing a T7 expression cassette from S. 36 (1993)
It was cloned between the XbaI and BamHI sites of NT7. The resulting construct was named pUCLEX. This complete expression cassette of pUCLEX was then replaced with H
Cleavage with indIII removes, blunt ends, cuts with EcoRI, then p
The vector pTREX was created by cloning between the EcoRI and SacI (blunted) sites of IL253 (Wells and Schofield, Curren).
t advances in metabolism, genetics and applications-NATO ASI Series, H 9
8: 37-62 (1996)). The putative RNA stabilizing sequence and TIR were derived from the E. coli T7 bacteriophage sequence and at one nucleotide position to enhance complementation of the Shine-Dalgarno (SD) motif to the 16 sRNA of the Lactobacillus lactis ribosome. Qualified (Schofield et al., Personal communication, Department of Pathology, Cambridge University).

Chromosome D of Lactobacillus lactis MG1363 showing promoter activity
The NA fragment was later named P7, which was named EcoRI present in the expression cassette.
Cloning between the site and BglII created pTREX7. This active promoter region was previously isolated using the promoter-probe vector pSB292 (Watfield et al., Gene, 165: 9-15 (1995)).
. This promoter fragment was transformed into PC using Vent DNA polymerase according to the manufacturer.
Amplified by R.

The pTREP1 vector was then constructed as follows. An artificial DNA fragment containing a transcription termination segment, a forward pUC sequencing primer, a promoter with multiple cloning sites and a universal translation termination sequence is annealed together with two partially overlapping complementary synthetic oligonucleotides. By elongation with Sequenase according to the manufacturer's instructions. This sense and anti-sense (p
The oligonucleotides of TREP _F and pTREP _R ) included recognition sites for EcoRV and BamHI at their 5 ′ end, respectively, to facilitate cloning into pTREX7. The transcription termination was the transcription termination of the Bacillus penicillinase gene, which has been shown to be effective in Lactococcus (Jos et al., Applied and Environmental Microbiology, 50 : 540-542 (198
Five)) . This is necessary because the expression of the target gene in the pTREX vector was observed to be leaky and likely to be the result of cryptotic promoter activity in the origin region (Schofield et al., Private communication, Cambridge University, Department of Pathology). Was thought to be. The forward pUC sequencing primer is the cloned DNA
Included to allow direct sequencing of the fragment. The translation termination sequence encoding one stop codon in three different frames was included to prevent translational fusion between the vector gene and the cloned DNA fragment. This p
The TREX7 vector is first digested with EcoRI and treated with TRI according to the manufacturer's instructions.
The DNA was blunt-ended using the 5'-3 'polymerase activity of 4 DNA polymerase (NEB). The pTREX7 vector digested with EcoRI and blunted was then digested with BglII to remove the P7 promoter. The artificial DNA fragment derived from the annealed synthetic oligonucleotide was then digested with EcoRV and BamHI.
And cloned into EcoRI (blunt ended) -BglII digested pTREX7 vector to create pTREP. The chromosomal promoter of Lactococcus lactis MG1363, designated P1, was then cloned between the EcoRI and BglII sites present in the pTREP expression cassette to create pTRE.
P1 was formed. This promoter was also isolated and characterized using the promoter probe vector pSB292, as described by Waterfield et al., (1995), supra. This P1 promoter fragment was initially prepared using the vent DNA
It was amplified by PCR using a polymerase and cloned into pTREX as an EcoRI-BglII DNA fragment. EcoRI-BglII containing this fragment
The P1 promoter was excised from pTREX1 by restriction enzyme digestion and pTREP1 digested.
Used for cloning (Schofield et al., Personal communication, Cambridge University, Faculty of Pathology).

(B) S. PCR amplification of aureus nuc gene The nucleotide sequence of the aureus nuc gene (EMBL database accession number V01281) was used to design synthetic oligonucleotide primers for PCR amplification. These primers comprise a nucA gene, designated nucA, formed by cleavage of the N-terminal 19-21 amino acids of a secreted peptide, designated Snase B (Shortle, (1983), supra) with a protease. It was designed to amplify the mature form of Three sense primers (nucS1
, NucS2 and nucS3, supplement 1) were designed. Each has a blunt-ended restriction enzyme cleavage site for EcoRV or SmaI in a different reading frame for the nuc gene. PT cleaved with BamHI and BglII
To facilitate cloning into REP1, BglII and BamHI were additionally incorporated at the 5 ′ ends of sense and anti-sense primers, respectively. The sequences of all primers are given in Appendix 1. Nuclease gene (NucA)
Were amplified by PCR using each of the sense primers in combination with the anti-sense primers described above. This nuc gene fragment was Aureus genomic DNA template, Ve
nt DNA polymerase (NEB) and conditions recommended by the manufacturer.
Amplified by CR. Initial denaturation step After 2 minutes at 93 ° C, 30 cycles of 93 ° C
For 45 seconds, annealing at 50 ° C. for 45 seconds and extension at 73 ° C. for 1 minute, and finally extension at 73 ° C. for 5 minutes. The PCR amplification product was purified using a Wizard Clean Up Column (Promega) to remove unincorporated nucleotides and primers.

(C) Construction of pTREP1-nuc vector The purified nuc gene fragment described in section b was ligated under standard conditions to Bg
After digestion with lII and BamHI, and digesting with BamHI and BglII and ligating to dephosphorylated pTREP1, a reporter vector of the pTREP1-nuc1, pTREP1-nuc2 and pTREP1-nuc3 series was prepared. General molecular biology techniques were performed using reagents and buffers supplied by the manufacturer or using standard conditions (Sambrook and Maniatis, (1989), supra). pT
In each of the REP1-nuc vectors, the expression cassette is a unique cloning site (BglII, EcoRV or SmaI) followed by a transcription stop, a Lactococcus promoter P1, the mature form of the nuc gene and a second transcription stop.
including. Note that sequences required for translation and secretion of the nuc gene have been carefully excluded in this construction. Such elements contain a properly digested foreign DN which can be cloned into a unique restriction site located immediately upstream of the nuc gene.
It can only be provided by the A fragment (representing the target bacterium).

This pTREP1-nuc vector differs from the pFUN vector described by Pocket et al. (1998), supra, in having a promoter. This is L.
Lactis by directly screening for Nuc activity. Lactis was used to identify the released protein. pFUN vector is n
Because it does not contain a promoter upstream of the open reading frame of uc, the cloned genomic DNA fragment must supply the necessary signals for the initiation and secretion of Nuc as well as for transcription. This restriction can prevent the isolation of genes that are distal to the promoter, for example, those within the polycistronic operon. In addition, promoters from other species of bacteria have been described in L. et al. There is no guarantee that it will be recognized and functioning in Lactis. Certain promoters are tightly regulated in the natural host but have been described in L. et al. Not in Lactis. Conversely, pTREP
The presence of the P1 promoter in the 1-nuc series of vectors ensures that promoterless DNA fragments (or DNA fragments containing promoter sequences that are not active in L. lactis) are still transcribed.

(D) Screening for secreted proteins of S. pneumoniae Genomic DNA isolated from S. pneumoniae was digested with the restriction enzyme Tru9I.
Using this enzyme that recognizes the sequence 5'-TTAA-3 ', it efficiently cleaves A / T-rich genomes and within the preferred size range (usually on average
. This is because a random genomic DNA fragment can be prepared. This size range is preferred because it increases the probability of using the P1 promoter to transcribe novel gene sequences. However, the Streptococcus promoter is L. Lactis is likely to be recognized, so P
One promoter may not be necessary in all cases. DNA fragments of different size ranges were purified from Tru9I partial digests of S. pneumoniae genomic DNA.
Since the Tru9I restriction enzyme creates a staggered end, this DNA fragment is EcoRV
Alternatively, it had to be blunt-ended prior to ligation into the Smal cut pTREP1-nuc vector. This was achieved by a partially filled enzymatic reaction using the 5'-3 'polymerase activity of the Klenow enzyme. Briefly, Tru9I digested DNA was combined with T4 DNA ligase buffer (New England Biolabs, NEB) (1 ×) and the required dNTPs, dATP and dTTP in this experiment.
TP was dissolved in a solution supplemented with 33 μM of each (usually a total volume of 10-20 μl). Klenow enzyme was added (1 unit of Klenow enzyme per μg of DNA (NEB)) and the reaction was incubated at 25 ° C. for 15 minutes. The reaction was stopped by incubating the mixture at 75 ° C. for 20 minutes. Then, pTREP-nuc plasmid DNA digested with EcoRV or SmaI was added (usually between 200-400 ng). This mixture was then supplemented with 400 units of T4 DNA ligase (NEB) and T4 DNA ligase buffer (1 ×) and incubated at 16 ° C. overnight. Combine the ligation mixture with 100% ethanol and 1
Precipitated directly in 1/10 volume of 3M sodium acetate, pH 5.2, and Lactis MG1363 (Gasson, 1983) was used to transform. Further, the gene cloning site of the pTREP-nuc vector is, for example, S
It also contains a BglII site that can be used to clone genomic DNA fragments digested with au3AI.

L. Lactis transformant colonies were grown on Brain Heart Infusion Agar and nuclease secreting (Nuc ⁺ ) clones were Toluidine Blue DNA-Agar (0.05 M Tris pH 9.0, 10 g agar / liter; 10 g NaCl / liter, 0.1 mM CaCl ₂ , 0.03% w /
v salmon sperm DNA and 90 mg of toluidine blue O dye) were detected approximately as described by Shortl, 1983, supra, and Le Loire et al., 1994, supra. The plates were then incubated at 37 ° C for up to 2 hours. Nuclease secreting clones form easily identifiable pink halos. Nuc ⁺ recombinant L. Plasmid DNA was isolated from Lactis clones and the sequence of the DNA insert was determined on one strand using NucSeq sequencing primers that sequence directly through the DNA insert as described in Appendix 1.

A simple gene encoding a protein released from S. pneumoniae (Exported proteins)
The number of gene sequences that are estimated to code for proteins released in the release S. pneumoniae were identified using nuclease-screening system. These were further analyzed to remove artifacts. Sequences identified using this screening system were analyzed using several parameters.

1. All putative surface proteins were sequenced using a software program sequencer (Gene Cause Corporation) and DNA Strider (Mark, Nucleic Acids Res., 16 : 1829-1836 (1988)). Was analyzed. Bacterial signal peptide sequences share a common design. These include a short positively charged N-terminus (N region) immediately before the hydrophobic residue region (middle region-h region) and a more polar C-terminal portion (c-terminal region) that includes a cleavage site behind it. Area). Putative protein hydropathy (
Computer software is available that allows for hydropathy contouring and allows easy identification of the highly characteristic hydrophobic portion (h-region) that is representative of the leader peptide sequence. In addition, these sequences were checked for the presence of a potential ribosome binding site (Shine-Dalgarno motif) required for translation initiation of the putative nuc reporter fusion protein.

2. All putative surface protein sequences were also compared to all protein / DNA sequences using published databases (OWL-protein with Swiss plot and Genbank translation). This makes it possible to identify sequences similar to known genes or homologues of genes whose function has been confirmed. Thus, it is indisputable to predict the function of some of the genes identified using the LEEP system and to use this system to identify and isolate the gene sequence of surface-associated proteins. It became possible. We can also confirm that these proteins are actually surface related and not artificial. This LEEP system has been used to identify novel gene targets for vaccines and therapeutics.

[0072] 3. Some of the proteins whose genes were identified did not have typical leader peptide sequences and did not show homology to any DNA / protein sequence in the database. Indeed, these proteins are the first advantage of our screening method, an atypical that may have been missed in all the screening methods or approaches described so far based on sequence homology searches. It can be said that this indicates the isolation of a typical surface-related protein.

In all cases, only partial gene sequences were initially obtained. The full length gene is T
Obtained in all cases by reference to the IGR Streptococcus pneumoniae database (www@tigr.org). Thus, by matching the initially obtained partial sequence to this database, we were able to identify the full-length gene sequence. In this way, three groups of genes were unambiguously identified, as described herein. A group of genes encoding previously unidentified S. pneumoniae proteins, a second group showing some homology with known proteins from various sources, and a known group of S. pneumoniae proteins A third group that codes what was not known as.

Example 2 Vaccine Trial pcDNA3.1 + as a Vaccine Vector The vector chosen for use as a pcDNA3.1 + DNA vaccine vector is pcDN.
A3.1 (Invitrogen) (actually pcDNA3.1 +, here pcDN
Called A3.1, but in all cases the forward direction was used. )Met. This vector has been widely adopted and successfully employed in the literature (Zang et al., Kral and Splitter, Anderson et al.) As a candidate vaccine vector for testing vaccine candidate genes that protect against pathogens. This vector was designed for high level stable and non-replicating transient expression in mammalian cells. pcDNA3.1 contains a ColE1 origin of replication which allows convenient high copy number replication and propagation in E. coli.
This in turn allows for the rapid and efficient cloning and testing of large numbers of genes. This pcDNA3.1 vector has a large number of cloning sites, and the human cytomegalovirus (C) allows efficient high-level expression of the gene encoding ampicillin resistance and the recombinant protein to aid in clone selection.
MV) immediate early promoter / enhancer. The CMV promoter is a strong viral promoter in a wide range of cell types, including both muscle cells and immune (antigen presenting) cells. This is important for an optimal immune response, as it is not yet known which cell types are most important in generating a protective response in vivo. The T7 promoter upstream of the multiple cloning site efficiently expresses the modified insert of interest and allows for in vitro transcription of the cloned gene in the sense orientation.

Zang, D. , Young, X. , Berry, Jay. , Shen, She. ,
McLarty, G. And Brunham, Earl. C. (1997) "DNA vaccine injections using major outer membrane protein genes are available from Chlamydia trachomatis.
(Pneumonia in mice) Induces immunity against infection. '', Infection and Immu
nity, 176, 1035-40.

Kral, E. And splitter G. A. (1997) "Nucleic acid vaccination of the ribosome L7 / L12 gene of Brucella abortus elicits an immune response.
Vaccine, 15. 1851-57.

[0077] Anderson, Earl. , Gao, X. -M. , Papa Constantinopoulou, A. , Roberts, M. And Dougan, G. (1996) "Immune response in mice after immunization with DNA encoding fragment C of tetanus toxin."
n and Immunity, 64 , 3168-3173.

Preparation of DNA Vaccines Oligonucleotide primers were designed for each of the individual genes of interest derived using the LEEP system. Each gene was thoroughly examined and, where possible, primers were designed to target those parts of the gene that would encode only the mature part of the gene protein. It was expected that expressing these sequences encoding only the mature portion of the target gene protein would facilitate its correct folding when expressed in mammalian cells. For example, in most cases,
Primers were designed such that the final amplification product cloned into the pcDNA3.1 expression vector did not contain the putative N-terminal signal peptide sequence.
This signal peptide directs the polypeptide precursor to the cell membrane via a protein release pathway where it is normally cleaved off by signal peptidase I (or signal peptidase II in the case of lipoproteins). Thus, this signal peptide does not constitute any part of the mature protein, whether it is displayed on the surface of bacteria or secreted. If the N-terminal leader peptide sequence was not immediately apparent, primers were used for cloning and finally pcD.
It was designed to target the entire gene sequence for NA3.1 expression.

As such, however, other additional features of the protein may also affect the expression and presentation of the soluble protein. DNA sequences encoding such features in the gene encoding the protein of interest were eliminated during oligonucleotide design. These features include: 1. LPXTG cell wall binding motif. 2. LXXC lipoprotein attachment site. 3. Hydrophobic C-terminal domain. 4. If no N-terminal signal peptide or LXXC was present, the start codon was omitted. 5. If no hydrophobic C-terminal domain or LPXTG motif was present, the stop codon was removed.

The appropriate PCR primers were designed for each gene of interest, and when designing these primers any and all of the regions encoding the above features were removed from the gene. These primers used an appropriate restriction enzyme site followed by a conserved Kozak nucleotide sequence (often (except in special cases such as ID59) GCCACC), which was initiated by a eukaryotic ribosome. To facilitate sequence recognition) and an ATG initiation codon upstream of the gene of interest insert. For example, a forward primer using a BamHI site begins with GCGGGATCCGCCACCCATG followed by a small portion of the 5 'end of the gene of interest. The reverse primer was designed to be consistent with the forward primer, and was often designed to have a NotI restriction site at the 5 'end, which is TTGCGGGCCGC (eg, an XhoI site instead of NotI). Except for the special case of ID 59 used).

PCR Primers The following PCR primers were designed and used to amplify the target gene with the truncated end. ID5 Forward primer 5'CGGATCCGCCACCATGGGTCTATAATTGAAGACTTA
AAAAATCAA 3 'reverse primer 5'TTGCGGCCGCCAATGCTAGACTAAACACAAAGACT
CA3 ′ ID59 Forward primer 5′CGCGGATCCATGAAAAAATCTATTCATTTTTTAG
CA3 'reverse primer 5'CCCTCGAGGGCTACTTCCGATACATTTTAAAACTG
TAGG3 'ID51 Forward primer 5'CGGATCCGCCACCATGAGTCATGTCGCTGCAAAT
G3 'Reverse primer 5'TTGCGGCCGCATACCAAACGCTGGACATCTACG3'
ID29 Forward primer 5′CGGATCCGCCACCCATGCAAAAAGAGCGGTATGGGT
TATG3 'Reverse primer 5'TTGCGGCCGCACCCCCATCTTAATCCCTT3' ID50 Forward primer 5'CGGATCCGCCACCATGGGAGTATGTGAAATGTCA
CGTAAAA3 'Reverse primer 5'TTGCGGCCGCTTTTCAAAAGTCAAGCAAAGCC3'

Cloning The insert with the flanking features described above was used to perform PCR using genomic DNA isolated from type 4 S. pneumoniae strain 11886 obtained from the National Collection of Type Culture as a template. Amplified with This PCR product was cut with appropriate restriction enzymes and cloned into the multiple cloning site of pcDNA3.1 using conventional molecular biology techniques. Clones, properly mapped on the gene of interest, were cultured and plasmids were isolated on a large scale (> 1.5 mg) using the plasmid mega kit (Quiagen). Successful cloning and maintenance of the gene was confirmed by creating a respective restriction map of the large scale preparation of each construct and sequencing about 700 base pairs by 5 'cloning ligation.

Confirmation of Efficacy of the Strain A strain of type 4 which had been sequenced for the S. pneumoniae genome was used for the cloning and challenge procedures. A lyophilized ampoule of a homogeneous laboratory strain of Type 4 S. pneumoniae strain NCTC11886 was obtained from the National Collection of Type Straines. The ampoule was opened and the culture was resuspended in 0.5 ml of tryptic soy broth (0.5% glucose, 5% blood). This suspension was subcultured in 10 ml of tryptic soy broth (0.5% glucose, 5% blood) and incubated at 37 ° C. overnight. The culture was spread on a 5% blood agar plate to check for contamination and to confirm survival, and spread on a blood agar slope. The rest of the culture was used to make a 20% glycerol stock. The slope was sent to Public Health Laboratory Services, a place to check for type 4 serotype.

The glycerol stock of NCTC11886 was spread on a 5% blood agar plate and incubated overnight at 37 ° C. in a CO ₂ gas bath. Make fresh coating bacteria,
Optohin sensitivity was confirmed.

[0085]Pneumococcal attack The standard inoculum for Streptococcus pneumoniae of type 4 is 1 × culture of pneumococcus through mice.
Subcultured, harvested from the blood of infected animals, and placed in broth before freezing. ⁹ prepared by growing to a predetermined viable cell count of cfu / ml,
And frozen. This preparation is shown below by the flow chart. Apply pneumococcal culture and confirm identity ↓ Grow 4-5 overnight cultures on upper plate ↓ Animal subculture of pneumococcus (intraperitoneal injection of collected heart blood draw) ↓ Grow overnight culture from animal subcultured pneumococci. ↓ Grow animal subculture overnight to overnight culture (to predetermined optical density) and freeze at -70 ° C. This is a standard minimum. ↓ Thaw one partial specimen of the standard inoculum and count the number of viable bacteria. ↓ Use standard inoculum to determine effective dose (called virulence test) ↓ All subsequent attacks-use standard inoculum to an effective dose. To inoculate mice with a 500-fold dilution of a standard inoculum from PBS
used. The mice were lightly anesthetized with halothane, and then 1.4 × 10 ^Five A dose of pneumococci of cfu was applied. Intake is facilitated by normal respiration of mice
Was done. The mice were left to recover.

Trial of Streptococcus pneumoniae vaccine Trial of vaccine in mice was performed using 6 week old CBA / ca mice (Halland, UK).
) Was administered by administering DNA. The vaccinated mice were divided into six groups, each group immunized with recombinant pcDNA3.1 + plasmid DNA containing the specific target gene sequence of interest. Dulbecco's total amount in PBS (Sigma) 100μg
DNA was injected intramuscularly into the tibialis anterior muscle of both legs (50 μl per leg). Four weeks later, the same procedure was used to reinforce. A control group was included in all vaccine trials for comparison. These control groups were animals that were not vaccinated or that received only non-recombinant pcDNA3.1 + DNA (mock vaccination) according to the same time course described above. Three weeks after the second immunization, all groups of mice were challenged intranasally with a lethal dose of S. pneumoniae serotype 4 (strain NCTC11886). The number of bacteria administered was monitored by plating serial dilutions of the inoculum on 5% blood agar plates. The problem with intranasal immunization was that inoculation was bubbled out of the nares in some mice, which was noted in the results table and taken into account in the calculations. A less obvious problem is that only a portion of the inoculum for each mouse is swallowed. This amount is assumed to be the same for each mouse and averaged during the course of inoculation. However, the amount of sample used is small, and in some experiments this problem may have significant effects. All mice surviving the challenge were killed 3 or 4 days after infection. During the infection process, the challenged mice were monitored for the development of symptoms associated with the development of S. pneumoniae-induced disease. Typical symptoms include piloerection, increased stoop, secretion from the eye, increased lethargy, and resistance to movement in the proper order. The latter symptom is
Consistent with the formation of a normally moribund condition in which the mouse was removed to prevent further distress. These mice appeared very close to the time of death and elimination used to determine survival for statistical analysis. When the death of a mouse was found, its survival time was taken as the last time the mouse was alive and monitored.

Interpretation of Results Positive results were conferred protection against that challenge with any of the DNA sequences cloned and used in the above challenge experiments. Protection was determined to be statistically significant protection (DNA sequences that conferred to a 95% confidence level (p <0.05) and DNA sequences that were marginally or significantly closer using Mann-Whitney or some protective features). DNA sequences indicating, for example, that one or more mice are out of range or that the time to first death has increased.The clarity of these results has been clouded by problems associated with intranasal infection. It is acceptable to consider marginal or non-significant results to be potentially positive when considered.

Results Trials 1-6 (see FIG. 1)

[0089]

[Outside 1]

^* -It may not have received all of the inoculum since it foamed when administered.
The experiment was terminated at the end of the experiment without any signs of T-infection. Numbers in parentheses-considered incomplete administration, survival was ignored. A p-value of 1 refers to a significance test compared to a non-vaccinated control. A p-value of 2 refers to a significance test comparing pcDNA3.1 + to a vaccinated control.

Statistical Analysis Trial 1—No other groups showed significantly longer survival times than controls. The survival times of the non-vaccinated control group and the control group of pcDNA3.1 were not significantly different. One of the mice from ID5 was an out-of-range result and the ID
The mean survival time of 5 was increased, but not significantly. Trial 2-The group vaccinated with ID59 had significantly longer survival than the non-vaccinated group. The group vaccinated with Trial 5-ID59 again survived on average about 10 hours longer than the control. However, the results were not statistically significant. Trial 6- The group vaccinated with ID51 did not have a significantly higher survival time than the non-vaccinated control (p = <36.0), but the vaccinated group was out of 2 There was a mouse.

Vaccine trials 7 and 8 (see FIG. 2)

[0093]

[Outside 2]

^* -It may not have received all the inoculum since it foamed when administered. The experiment was terminated at the end of the experiment without any signs of T-infection. Numbers in parentheses-considered incomplete administration, survival was ignored. A p-value of 1 refers to a significance test compared to a non-vaccinated control.

Statistical Analysis Trial The group vaccinated with 7-ID29 showed an extended time to first death. The group vaccinated with Trial 8-ID50 survived significantly longer than the unvaccinated control.

[0096]

[Outside 3]

[0097]

[Outside 4]

[0098]

[Outside 5]

[0099]

[Outside 6]

[0100]

[Outside 7]

[0101]

[Outside 8]

[0102]

[Outside 9]

[0103]

[Outside 10]

[0104]

[Outside 11]

[0105]

[Outside 12]

[0106]

[Outside 13]

[0107]

[Outside 14]

[0108]

[Outside 15]

[0109]

[Outside 16]

[0110]

[Outside 17]

[0111]

[Outside 18]

[0112]

[Outside 19]

[0113]

[Outside 20]

[0114]

[Outside 21]

[0115]

[Outside 22]

[0116]

[Outside 23]

[0117]

[Outside 24]

[0118]

[Outside 25]

[0119]

[Outside 26]

[0120]

[Outside 27]

[0121]

[Outside 28]

[0122]

[Outside 29]

[0123]

[Outside 30]

[0124]

[Outside 31]

[0125]

[Outside 32]

[0126]

[Outside 33]

[0127]

[Outside 34]

[0128]

[Outside 35]

[0129]

[Outside 36]

[0130]

[Outside 37]

[Sequence list]

[Brief description of the drawings]

FIG. 1 shows the results of several DNA vaccine trials.

FIG. 2 shows the results of a further DNA vaccine trial.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 11/00 A61P 31/04 4H045 31/04 C07K 14/315 C07K 14/315 16/12 16/12 C12Q 1/04 C12Q 1/04 1/68 A 1/68 G01N 33/566 G01N 33/566 33/569 F 33/569 33/577 B 33/577 C12N 15/00 ZNAA (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), CN, JP, US (72) Inventor Wells, Jeremy Mark UK, CB 59 PB Cambridge, Water Beach, Denny End Industrial Center, Pembroke Avenue 12, Acti VALIMITED (72) Inventor Hanifi, Cyan Bosco UK, CB21 Kew Kembridge, Tennis Court Road, Department of Pathology, University of Cambridge , Tennis Court Road, Department of Pathology, University of Cambridge F-term (Reference) 4B024 AA01 AA13 BA31 BA50 CA01 HA12 HA15 4B063 QA01 QA18 QQ02 QQ06 QQ79 QQ96 QR32 QR48 QR55 QR68 QS33 QS34 QX11 4C08A A4B08A CC21 DD62 DD86 FF24 4C086 AA01 AA02 AA03 EA16 MA01 MA04 NA14 ZA59 ZB35 4H045 AA10 AA11 AA30 BA10 CA11 DA76 DA86 EA50 FA71

Claims (20)

[Claims] 1. A Streptococcus pneumoniae protein or polypeptide having a sequence selected from the sequences shown in Table 1. 2. A protein or polypeptide of S. pneumoniae having a sequence selected from the sequences shown in Table 2. 3. The protein or polypeptide according to claim 1, which is provided in a substantially pure form. 4. A protein or polypeptide substantially identical to the protein or polypeptide according to any one of claims 1 to 3. 5. A homolog or derivative of the protein or polypeptide according to any one of claims 1 to 4. 6. An antigenic and / or immunogenic fragment of a protein or polypeptide as defined in Tables 1-3. 7. The following one sequence: (i) any of the DNA sequences listed in Table 1 or their RNA equivalents; (ii) a sequence complementary to any of the sequences of (i); A) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii); (iv) a sequence substantially identical to any of the sequences of (i), (ii) and (iii); A nucleic acid molecule comprising or consisting of a sequence encoding a homolog, derivative or fragment of a protein as defined in Table 1. 8. The following one sequence: (i) any of the DNA sequences listed in Table 2 or their RNA equivalents; (ii) a sequence complementary to any of the sequences of (i); A) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii); (iv) a sequence substantially identical to any of the sequences of (i), (ii) and (iii); A nucleic acid molecule comprising or consisting of a sequence encoding a homolog, derivative or fragment of a protein as defined in Table 2. 9. A protein or polypeptide having one sequence selected from the group of sequences shown in Tables 1 to 3, or homologues, derivatives and / or fragments thereof,
Use as immunogen and / or antigen. 10. An immunogenic and / or antigenic composition comprising one or more proteins or polypeptides, wherein the sequence of said protein or polypeptide is as shown in Tables 1 to 3, or a sequence thereof. A composition selected from homologues, derivatives and / or fragments thereof. 11. The immunogenic and / or antigenic composition according to claim 10, which is for use in a vaccine or a diagnostic test. 12. The vaccine according to claim 11, comprising one or more additional components selected from excipients, diluents, adjuvants and the like. 13. A vaccine composition comprising one or more nucleic acid sequences as defined in Tables 1-3. 14. A method for detecting / diagnosing S. pneumoniae, comprising a step of contacting a test sample with at least one protein or polypeptide defined in Tables 1 to 3, or a homolog, derivative or fragment thereof. 15. An antibody capable of binding to a protein or polypeptide defined in Tables 1 to 3, or a homolog, derivative or fragment thereof. 16. The antibody according to claim 15, which is a monoclonal antibody. 17. A method for detecting / diagnosing S. pneumoniae, comprising a step of bringing a test sample into contact with at least one of the antibodies according to claim 15 or 16. 18. A method for detecting / diagnosing S. pneumoniae, comprising a step of bringing a test sample into contact with at least one of the nucleic acid sequences according to claim 7 or 8. 19. A method for determining whether a protein or polypeptide according to Tables 1 to 3 is a potential antimicrobial target, comprising the step of inactivating said protein or polypeptide and the pneumonia chain. Determining whether the cocci are still alive. 20. In the manufacture of a medicament for use in the treatment or prevention of S. pneumoniae infection, antagonize, inhibit or inhibit the function or expression of the proteins or polypeptides listed in Tables 1 to 3. Use of agents that can interfere in a way.