JP2008022856A - Nucleic acid and protein derived from streptococcus pneumoniae - Google Patents

Nucleic acid and protein derived from streptococcus pneumoniae Download PDF

Info

Publication number
JP2008022856A
JP2008022856A JP2007221409A JP2007221409A JP2008022856A JP 2008022856 A JP2008022856 A JP 2008022856A JP 2007221409 A JP2007221409 A JP 2007221409A JP 2007221409 A JP2007221409 A JP 2007221409A JP 2008022856 A JP2008022856 A JP 2008022856A
Authority
JP
Japan
Prior art keywords
sequence
protein
polypeptide
streptococcus pneumoniae
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
JP2007221409A
Other languages
Japanese (ja)
Inventor
Sean Bosco Hanniffy
Philip Michael Hansbro
Page Richard William Falla Le
Jeremy Mark Wells
マーク ウエルズ,ジェレミー
ボスコ ハニフィ,シアン
マイケル ハンスブロ,フィリップ
ウィリアム ファラ ルページ,リチャード
Original Assignee
Microbial Technics Ltd
マイクロビアル テクニクス リミティッド
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to GBGB9816336.3A priority Critical patent/GB9816336D0/en
Priority to US12532999P priority
Application filed by Microbial Technics Ltd, マイクロビアル テクニクス リミティッド filed Critical Microbial Technics Ltd
Publication of JP2008022856A publication Critical patent/JP2008022856A/en
Application status is Pending legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C07K14/3156Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Abstract

A method for preventing, controlling, diagnosing or treating pneumococcal disease is improved.
Novel proteins from Streptococcus pneumoniae, nucleic acid sequences encoding them, and their use in vaccines and screening methods are provided.
[Selection figure] None

Description

  The present invention relates to proteins from Streptococcus pneumoniae (Streptococcus pneumoniae), nucleic acid molecules encoding such proteins, and further to the use of the nucleic acid molecules and / or proteins as antigens / immunogens and in detection / diagnosis. As well as methods of screening the protein / nucleic acid sequences as potential antimicrobial targets.

Streptococcus pneumoniae is usually called pneumococcus and is an important pathogenic organism. An authoritative review has been written about the ever-increasing importance of Streptococcus pneumoniae infections for human disease in developing and developed countries (Fiber, GR, Science, 265 : 1385-1387 (1994)). This review estimates that on a global scale, this microorganism is believed to be the most common cause of acute respiratory infections, with an estimated 1 million children dying each year in many developing countries (Stancefield, SK, Pediatr. Infect. Dis., 6 : 622 (1987)). In the United States, Streptococcus pneumoniae is still the most common cause of bacterial pneumonia, with mortality rates in young children, the elderly, and asplenia, heart, lung and kidney disease, diabetes, alcoholism, or immunosuppressive disease It has been suggested to be particularly high, especially in susceptible patients such as AIDS (Bryman et al., Arch. Intern. Med., 150: 1401 (1990)). These groups are at increased risk of pneumococcal sepsis and therefore meningitis, and therefore increase the risk of death from pneumococcal infection. Streptococcus pneumoniae can cause otitis media and sinusitis. This has been devastating to children's infections in developed countries, and has spent considerable money.

The need for effective prevention strategies against pneumococcal infection has been highlighted by the recent emergence of penicillin-resistant pneumococci. 6.6% of Streptococcus pneumoniae isolated in 13 US hospitals in 12 states were found to be resistant to penicillin, and some of the isolates were third-generation cyclo®sporins It was also reported that it was resistant to other antibiotics including (Shapert, SM, Vital and Health Statistics of the Centers for Disease Control / National Center for Health Statistics, 214: 1 (1992)). The proportion of penicillin resistance may be higher (up to 20%) in some hospitals (Bryman et al., J. Am. Med. Assoc., 271: 1831 (1994)). These facts are considered a warning because the increase in penicillin resistance among pneumococci is recent, sudden, and came decades after penicillin was an effective treatment.

  For the above reasons, there are compelling grounds to consider improving methods for preventing, controlling, diagnosing, or treating pneumococcal disease.

  Various efforts have been made to provide vaccines for the prevention of pneumococcal infection. Difficulties arise, for example, due to the (at least 90) diverse serotypes based on the structure of the polysaccharide capsule surrounding this organism. Vaccines against individual serotypes are not effective against other serotypes. This means that in order to be effective in the majority of cases, the vaccine must contain polysaccharide antigens from the full range of serotypes. A further problem is that capsular polysaccharides, each of which determines the serotype and is the primary protective antigen, are the highest in invasive pneumococcal infection and meningeal salt when purified and used as a vaccine This arises from the discovery that it does not elicit a reliable protective antibody response in infants under the age of 2 years of age showing onset.

  An improved approach to using capsular antigens is to attach a polysaccharide to the protein, particularly to elicit an enhanced immune response by imparting T-cell dependence to the response. This approach has been used, for example, in the development of a vaccine against Haemophilus influenzae. However, there are cost issues for both multi-polysaccharide vaccines and conjugate-based vaccines.

  The third approach is to search for other antigen components that give potential vaccine candidates. This is the basis of the present invention. Using a specially developed bacterial-based expression system, we were able to identify a group of protein antigens from pneumococci. This is associated with or secreted from the bacterial envelope.

  Thus, in the first aspect, the present invention provides a Streptococcus pneumoniae protein or polypeptide having one sequence selected from the sequence group shown in Table 1.

  In a second aspect, the present invention provides a Streptococcus pneumoniae protein or polypeptide having a sequence selected from the sequence group shown in Table 2.

  The protein or polypeptide of the invention can be provided in substantially pure form. For example, it can be provided in a form substantially free of other proteins.

  As discussed herein, the protein or polypeptide of the invention is useful as an antigenic substance. Such substances can be “antigenic” and / or “immunogenic”. In general, “antigenic” is understood to mean that the protein or polypeptide can be used to produce antibodies and indeed can elicit an antibody response in a patient. “Immunogenic” is understood to mean that the protein or polypeptide is capable of eliciting a protective immune response in a patient. Thus, in the latter case, the protein or polypeptide can not only generate an antibody response, but can also generate an immune response that is not based on antibodies.

  The skilled person will find that homologues or derivatives of the proteins or polypeptides of the invention can also be used in the context of the present invention, ie as antigenic / immunogenic substances. Thus, for example, a protein or polypeptide comprising one or more additions, deletions, substitutions, etc. is encompassed by the present invention. Furthermore, it is possible to replace one amino acid with another similar “type”. For example, replacing one hydrophobic amino acid with another.

  Programs such as the CLUSTAL program can be used to compare amino acid sequences. This program finds the optimal alignment by comparing amino acid sequences and inserting appropriate spaces in either sequence. It is possible to calculate amino acid identity or similarity (amino acid type identity plus conservation) for optimal alignment. A program like BLASTx aligns the longest stretch of similar sequences and assigns a numerical value to their suitability. Thus, if several similar regions are found, each with a different score, a comparison can be made. Both types of identity analysis are contemplated by the present invention.

  In the case of homologues and derivatives, the degree of identity with respect to a protein or polypeptide as described herein is such that the homologue or derivative retains the antigenicity or immunogenicity of the original protein or polypeptide. It is not as important as it should be. However, it is appropriate to provide homologues or derivatives that have at least 60% similarity (as discussed above) to the proteins or polypeptides described herein. It is preferred to provide homologues or derivatives with at least 70% similarity, more preferably at least 80% similarity. Most preferably, homologues or derivatives with at least 90% or even 95% similarity are provided.

  As an alternative approach, these homologues or derivatives could be fusion proteins that incorporate a moiety that makes purification easier, for example by effectively labeling the desired protein or polypeptide. The “label” may need to be removed, or it may retain sufficient antigenicity that the fusion protein itself is useful.

  In a further aspect of the invention there is provided an antigenic / immunogenic fragment of the protein or polypeptide of the invention or a homologue or derivative thereof.

  The situation is somewhat different for fragments of the proteins or polypeptides described herein, or homologues or derivatives thereof. It is well known that it is possible to screen an antigenic protein or polypeptide to identify the epitope region, ie, the region responsible for the antigenicity or immunogenicity of the protein or polypeptide. Methods for performing such screening are well known in the art. Thus, a fragment of the invention should contain or be sufficiently similar to one or more such epitope regions in order to retain its antigenic / immunogenic properties. Thus, the degree of identity is probably irrelevant for the fragments of the present invention because they can be 100% identical to a particular portion of a protein or polypeptide, homologue or derivative described herein. . The important point is, again, that the fragments retain their antigenic / immunogenic properties.

  Thus, what is important for homologues, derivatives and fragments is that they have at least some of the antigenicity / immunogenicity of the original protein or polypeptide from which they are derived.

Gene cloning techniques can be used to provide the proteins of the invention in substantially pure form. These techniques are described in, for example, Jay. Sambrook et al., Molecular Cloning, 2nd Edition, Cold Spring Harbor Laboratory Press (1989). Thus, in a third aspect, the present invention relates to one of the following sequences: (i) any of the DNA sequence groups shown in Table 1 or their RNA equivalents,
(Ii) a sequence complementary to any of the sequence groups of (i),
(Iii) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii), (iv) a sequence substantially identical to any of the sequences of (i), (ii) and (iii),
(V) a sequence encoding a homologue, derivative or fragment of a protein as defined in Table 1,
A nucleic acid molecule comprising or consisting of the sequence is provided.

In a fourth aspect, the invention relates to one of the following sequences: (i) any of the DNA sequence groups shown in Table 2 or their RNA equivalents,
(Ii) a sequence complementary to any of the sequence groups of (i),
(Iii) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii), (iv) a sequence substantially identical to any of the sequences of (i), (ii) and (iii),
(V) a sequence encoding a homologue, derivative or fragment of a protein as defined in Table 2,
A nucleic acid molecule comprising or consisting of the sequence is provided.

  The nucleic acid molecule of the present invention may contain a plurality of such sequences and / or fragments. Those skilled in the art will appreciate that the present invention may include novel variants of these particular novel nucleic acid molecules exemplified herein. Such variants are encompassed by the present invention. These can occur in nature due to, for example, strain variation. For example, additions, substitutions and / or deletions are included. In addition, and particularly when utilizing microbial expression systems, it is desirable to design nucleic acid sequences by utilizing known and preferred codon terms in the particular organism used for expression. Thus, synthetic or non-naturally occurring variants are also included within the scope of the present invention.

  The term “RNA equivalent” used above allows for the fact that a given RNA molecule is complementary to the sequence of a given DNA molecule (“U” in RNA replaces “T” in the genetic code). )).

  Use programs such as BESTFIT and GAP (both from the Wisconsin Genetics Computer Group (GCG) software package) when comparing nucleic acid sequences to determine the degree of homology or identity be able to. For example, BESTFIT compares two sequences and creates an optimal alignment of the most similar fragments. GAP can align sequences along their entire length and seeks the optimal alignment by inserting appropriate spaces in either sequence. When discussing the identity of nucleic acid sequences, in the context of the present invention, this comparison is preferably made by alignment of the sequences along their entire length.

  A sequence with substantial identity may have at least 50% sequence identity with the sequence, desirably at least 75% sequence identity, and more desirably at least 90% or at least 95% sequence identity. preferable. In some cases, this sequence identity may be 99% or more.

  The term “substantial identity” should preferably indicate that the sequence has a greater degree of identity with any of the sequences described herein than with a prior art nucleic acid sequence.

  However, if the nucleic acid sequence of the present invention encodes at least a portion of a novel gene product, it is noted that the present invention includes within its scope all possible sequences encoding the gene product or the novel portion thereof. Should.

  The nucleic acid molecule may be isolated or recombinant. It may be incorporated into a vector. The vector may be incorporated into the host. Such vectors and suitable hosts form a further aspect of the present invention.

  Thus, for example, by using a probe based on the nucleic acid sequences provided herein, the gene for S. pneumoniae can be identified. They can then be excised using restriction enzymes and cloned into a vector. This vector can be introduced into a suitable host for expression.

  The nucleic acid molecule of the present invention can be obtained from Streptococcus pneumoniae by using an appropriate probe complementary to a part of the sequence of the nucleic acid molecule. Restriction enzymes or sonication techniques can be used to prepare appropriately sized fragments for the probe.

  PCR techniques can also be used to amplify the necessary nucleic acid sequences. Thus, the sequence data provided herein can be used to design two primers for use in PCR, so that the desired sequence such as the full length gene or a fragment thereof can be targeted and then amplified at a high degree. can do.

  Primers are usually at least 15-25 nucleotides in length.

  As a further alternative, chemical synthesis can be utilized. This may be automated. Relatively short sequences can be chemically synthesized and ligated to create longer sequences.

  There is another group of proteins from Streptococcus pneumoniae identified using the bacterial expression system described herein. These are known proteins derived from Streptococcus pneumoniae and have not been previously identified as antigenic proteins. The amino acid sequences of this group of proteins are shown in Table 3, along with the DNA sequences that encode them. These proteins, their homologues, derivatives and / or fragments can also be used as antigen / immunogen. Accordingly, in another aspect, the invention provides the use of a protein or polypeptide having a sequence selected from those shown in Tables 1 to 3 or homologues, derivatives and / or fragments thereof as an immunogen / antigen. provide.

  In a further aspect, the present invention relates to an immunogen comprising a protein or polypeptide selected from the sequence groups shown in Tables 1 to 3 or homologues or derivatives thereof and / or fragments of any of these. A sex / antigenic composition is provided. In preferred embodiments, the immunogenic / antigenic composition is a vaccine or for use in a diagnostic test.

  In the case of a vaccine, suitable additional excipients, diluents, adjuvants and the like can be included. These countless examples are well known in the art.

It is also possible to utilize the nucleic acid sequences shown in Tables 1 to 3 in the preparation of so-called DNA vaccines. Accordingly, the present invention also provides a vaccine composition comprising one or more of the nucleic acid sequences defined herein. DNA vaccines have been described in the art (see, for example, Donneri et al., Ann. Rev. Immunol., 15 : 617-648 (1997)), for the skilled person to make and use DNA vaccines according to the present invention, Such disclosed techniques can be used.

  As already discussed herein, the proteins or polypeptides described herein, their homologues or derivatives, and / or fragments of any of these are used in methods for detecting / diagnosing S. pneumoniae. be able to. Such methods are based on the detection of antibodies against such proteins that may be present in the patient. Accordingly, the present invention provides a method for the detection / diagnosis of Streptococcus pneumoniae comprising the step of contacting a specimen sample with at least one of a protein as described herein, or a homologue, derivative or fragment thereof. The sample is preferably a tissue sample obtained from the patient to be tested or a biological sample such as a blood or saliva sample.

  In another approach, the proteins described herein, or homologues, derivatives and / or fragments thereof, can be used to produce antibodies, and the resulting antibodies are then corresponding antigens, and thus Can be used to detect S. pneumoniae. Such antibodies constitute another aspect of the present invention. Antibodies within the scope of the present invention may be monoclonal or polyclonal.

  A polyclonal antibody is a protein as described herein, or a homologue, derivative or fragment thereof, which is injected into a suitable animal host (eg, mouse, rat, guinea pig, rabbit, sheep, goat, or monkey). And its production is stimulated and formed in the animal. If necessary, an adjuvant may be administered with the protein. Well known adjuvants include Freund's adjuvant (complete or incomplete) and aluminum hydroxide. This antibody can then be purified utilizing its binding to the proteins described herein.

Monoclonal antibodies can be produced by hybridomas. These can be formed by fusing myeloma cells with spleen cells producing the desired antibody to form an immortal cell line. Thus, the well-known Kohler and Milstein method (Nature 256 (1975)) or a subsequent modification of this method can be used.

  Techniques for producing monoclonal and polyclonal antibodies that bind to specific polypeptides / proteins are now well developed in the art. These are discussed in standard immunology textbooks such as Reutto et al., Immunology 2nd edition (1989), Churchill Livingston, London.

In addition to intact antibodies, the present invention includes derivatives thereof that are capable of binding to the proteins described herein. Thus, the present invention includes antibody fragments and synthetic constructs. Examples of antibody fragments and synthetic constructs are described by Dagor et al. In Tibtech 12 372-379 (September, 1994).

Antibody fragments include, for example, Fab, F (ab ′) 2 and Fv fragments. Fab fragments (these are discussed in Reut et al. (Supra)). Fv fragments can be modified to create synthetic constructs known as single chain Fv (scFv) molecules. This includes a peptide linker covalently linked to the V h and V l regions. This linker contributes to the stability of this molecule. Other synthetic constructs that can be used include CDR peptides. These are synthetic peptides containing antigen binding determinants. Peptidomimetics can also be used. These molecules are usually conformationally restricted organic rings that mimic the structure of the CDR loop and contain side chains that interact with the antigen.

Synthetic constructs include chimeric molecules. Thus, for example, humanized (primatized) antibodies or derivatives thereof are also within the scope of the invention. An example of a humanized antibody is an antibody having a human frame region while having a rodent hypervariable region. Methods for making chimeric antibodies are discussed, for example, by Morrison et al. In PNAS, 81 , 6851-6855 (1984) and by Takeda et al. In Nature, 314 , 452-454 (1985).

  Synthetic constructs also include molecules that contain additional moieties that provide molecules with some desirable properties in addition to antigen binding. For example, the moiety can be a label (eg, a fluorescent or radioactive label). It may also be a pharmaceutically active substance.

  The antibodies, or derivatives thereof, can be used for detection / diagnosis of S. pneumoniae. Thus, in another aspect, the invention is a method for detecting / diagnosing Streptococcus pneumoniae, wherein the antibody and analyte are capable of binding to one or more of the proteins described herein, or homologues, derivatives and / or fragments thereof. A method is provided that includes contacting a sample.

  Furthermore, so-called “Affibodies” can be used. These are binding proteins selected from combinatorial libraries of bacterial α-helix receptor domains (Node et al.). Thus, small protein domains that can specifically bind to different target protein groups can be selected using a combinatorial approach.

  It will also be apparent that the nucleic acid sequences described herein can be used to detect / diagnose S. pneumoniae. Accordingly, in a further aspect, the present invention provides a method for detecting / diagnosing S. pneumoniae comprising contacting an analyte sample with at least one of the nucleic acid sequences described herein. The sample is suitably a tissue sample obtained from a patient to be examined or a biological sample such as a blood or saliva sample. Such samples may be pretreated prior to use in the method of the present invention. Thus, for example, the sample may be processed to extract DNA. A DNA probe based on the nucleic acid sequences described herein (ie, usually a fragment of such a sequence) can then be used to detect nucleic acid from Streptococcus pneumoniae.

In a further aspect, the present invention provides (a) a method of vaccinating a patient against Streptococcus pneumoniae, the protein or polypeptide of the invention, or a derivative, homologue or fragment thereof, or the immunogenicity of the invention Administering a composition to a patient,
(B) a method of vaccinating a patient against Streptococcus pneumoniae, comprising administering to the patient a nucleic acid molecule as defined herein;
(C) A method for preventing or treating Streptococcus pneumoniae infection, comprising the step of administering the protein or polypeptide of the present invention, or a derivative, homologue or fragment thereof, or the immunogenic composition of the present invention to a patient. Including methods,
(D) a method of preventing or treating Streptococcus pneumoniae infection comprising the step of administering to a patient a nucleic acid molecule as defined herein;
(E) A kit for use in detecting / diagnosing S. pneumoniae infection, the protein or polypeptide of the present invention, or a homologue, derivative or fragment thereof, or one of the antigenic compositions of the present invention A kit including the above,
(F) a kit for use in detecting / diagnosing S. pneumoniae infection, comprising one or more nucleic acid molecules as defined herein;
I will provide a.

  If we have identified a group of important proteins, such proteins are potential targets for antimicrobial therapy. However, it is necessary to determine whether each individual protein is essential for the survival of the microorganism. Thus, the present invention is a method for determining whether a protein or polypeptide described herein is a potential antimicrobial target, antagonizing and inhibiting the function or expression of the protein. Alternatively, a method is provided that includes interfering with other methods and determining whether the Streptococcus pneumoniae is still alive.

A suitable way to inactivate the protein is to perform selective gene knockout, i.e. to prevent the expression of the protein and to determine if this causes a lethal change. Suitable methods for performing such gene knockouts are Lee et al., PNAS, 94 : 13251-13256 (1997) and Corkman et al.,
178 : 3736-3741 (1996).

  In a final aspect, the present invention antagonizes, inhibits or otherwise inhibits the function or expression of the protein or polypeptide of the present invention in the manufacture of a medicament for use in the treatment or prevention of S. pneumoniae infection. Provide the use of agents that can interfere.

  As noted above, we used bacterial expression systems as a means of identifying these proteins that bound to the surface or were secreted or exported and could therefore be used as antigens. .

  The information required for protein secretion / release has been extensively studied in bacteria. In most cases, the release of the protein requires a signal peptide that is present at the N-terminus of the precursor protein in order for it to travel towards the mobile device on the cytoplasmic membrane. During or after migration, this signal peptide is removed by signal peptidase bound to the membrane. Ultimately the localization of this protein (ie whether it should be secreted, should be a complete membrane protein or attached to the cell wall) is determined by sequences other than this leader peptide itself. The

We are particularly interested in surface localized proteins or released proteins. This is because they are likely diagnostic reagents with novel chemical entities or antigens for use in vaccines as therapeutic targets. Accordingly, the present inventors have developed a screening vector system in Lactococcus lactis that allows the gene encoding the released protein to be identified and isolated. We provide the following representative examples showing how a novel surface binding protein from a given S. pneumoniae has been identified and characterized. This screening vector incorporates a staphylococcal nuclease gene nuc that lacks its own release signal as a secretion reporter. Staphylococcus nuclease is a naturally secreted, thermostable monomeric enzyme that is efficiently expressed and secreted in a range of Gram-positive bacteria (Shortle, Gene, 22 : 181-189 (1983) , Kobasevic et al., J. Bacteriol., 162 : 521-528 (1985), Miller et al., J. Bacteriol., 169 : 3508-3514 (1987), Libre et al., J. Bacteriol., 174 : 1854-1861 (1992) ), Le Loire et al., J. Bacteriol., 176 : 5135-5139 (1994), Pocket et al., J. Bacteriol., 180 : 1904-1912 (1998)).

  Recently, Pocket et al. ((1998), supra) described a screening vector incorporating a nuc gene lacking its own signal leader as a reporter to identify released proteins in Gram-positive bacteria, and Elle. Applied to lactis. This vector (pFUN) contains a pAMβ1 replicon that functions in a broad range of hosts of gram positive bacteria, in addition to a ColE1 replicon that promotes replication of E. coli and certain other gram negative bacteria. The unique cloning site present in this vector is for transcription and translation between the cloned genomic DNA fragment and the open reading frame of the truncated nuc gene lacking its own signal secretion leader Can be used to create fusions. This nuc gene is an ideal reporter gene. This is because nuclease secretion can be easily detected with a simple and sensitive plate test. That is, recombinant colonies that secrete this nuclease form a pink halo, whereas control colonies remain white (Shordle, (11983), supra, Luloir et al., (1994), supra).

  Thus, the present invention is described herein with reference to the following representative examples that provide details of how the protein, polypeptide and nucleic acid sequences described herein have been identified as antigenic targets.

  We have constructed three reporter vectors and identified their isolated DNA fragments from Streptococcus pneumoniae that encode secreted proteins or surface-binding proteins. The use in Ractis is described here.

  The present invention is described herein with reference to examples, which should not be construed as limiting the invention in any way. In the examples, reference is made to the figures.

Example 1
(I) Construction of reporter vectors of pTREP1-nuc series (a) Construction of expression plasmid pTREP1 The pTREP1 plasmid is a high copy number (40-80 per cell) θ-replicating gram positive plasmid, which was previously published. A derivative of the pTREX plasmid, which is a derivative of the pIL253 plasmid. pIL253 incorporates a broad gram-positive host replicon of pAMβ1 (Simon and Chopin, Biochimie, 70: 559-567 (1988)). Non-mobility due to Lactis sex factor. pIL253 also lacks the tra function required for transfer or efficient mobilization by the parent conjugative plasmid exemplified by pIL501. Enterococcus pAMβ1 replicon has already been transferred to various species including Clostridium acetobutinicum and Streptococcus, Lactobacillus and Bacillus species (Oultrum and Clenhammer, FEMS Microbiological Letters, 27 : 129-134 (1985), Gibson (1979), Leblanc et al., Proceedings of the National Academy of Science USA, 75 : 3484-3487 (1978), showing its potential broad host utility.This pTREP1 plasmid is a single transcription vector construct. is there.

The pTREX vector was constructed as follows. An artificial DNA fragment containing a sequence considered to be an RNA stabilization sequence, a translation initiation region (TIR), a target gene and multiple cloning sites for insertion of a transcription termination region, annealed with two complementary oligonucleotides, and TflDNA It was created by extending with polymerase. The sense and anti-sense oligonucleotides included recognition sites for NheI and BamHI at their 5 ′ ends, respectively, to facilitate cloning. This fragment was transformed into the XbaI of pUC19NT7, a pUC19 derivative containing the T7 expression cassette from pLET1 (Wells et al., J. Appl. Bacteriol., 74: 629-636 (1993) cloned between the EcoRI and HindIII sites. The resulting construct was named pUCLEX, and the complete expression cassette of pUCLEX was then removed by digestion with HindIII, blunted and then digested with EcoRI, followed by pIL253. The vector pTREX was created by cloning between the EcoRI site and the SacI (blunted) site of (Now ASI series, Well advances and metabolism, Genetics and applications-NATO ASI Series, H 98: 37-62 (1996). This putative RNA stabilization sequence and TIR are expressed in E. coli T7 bacteriophage. Derived from the sequence and modified at a single nucleotide position to enhance the complementation of the Shine-Dalgarno (SD) motif to the 16sRNA of Lactobacillus lactis ribosome (Shoffield et al., Personal Communications, Department of Pathology, Cambridge University) ).

A chromosomal DNA fragment of Lactobacillus lactis MG1363 exhibiting promoter activity was later named P7, which was cloned between the EcoRI site present in the expression cassette and BglII to create pTREX7. This active promoter region was previously isolated using the promoter probe vector pSB292 (Waterfield et al., Gene, 165: 9-15 (1995)). This promoter fragment was amplified by PCR according to the manufacturer using Vent DNA polymerase.

The pTREP1 vector was then constructed as follows. An artificial DNA fragment containing a transcription termination region, a forward pUC sequencing primer, a promoter with multiple cloning sites and a universal translation termination sequence, annealed together with two partially overlapping complementary synthetic oligonucleotides It was prepared by extending with sequenase according to the instructions of the person. The sense and anti-sense (pTREP F and pTREP R ) oligonucleotides included recognition sites for EcoRV and BamHI at their 5 ′ ends to facilitate cloning into pTREX7, respectively. The transcription termination region is a transcription termination region of the Bacillus penicillinase gene, which has been shown to be effective in Lactococcus (Jos et al., Applied and Environmental Microbiology, 50 : 540-542 (1985)). This is necessary because the expression of the target gene in the pTREX vector is observed to be leaky and is thought to be the result of cryptic promoter activity in the origin region (Shoffield et al., Personal communication, University of Cambridge, Department of Pathology) It was thought that. A forward pUC sequencing primer was included to allow direct sequencing of the cloned DNA fragment. The translation stop sequence encoding one stop codon in three different frames was included to prevent translational fusion between the vector gene and the cloned DNA fragment. This pTREX7 vector was first digested with EcoRI and blunted using the 5'-3 'polymerase activity of T4 DNA polymerase (NEB) according to the manufacturer's instructions. The pTREX7 vector digested with EcoRI and blunted was then digested with BglII to remove the P7 promoter. Artificial DNA fragments derived from annealed synthetic oligonucleotides were then digested with EcoRV and BamHI and cloned into EcoRI (blunted) -BglII digested pTREX7 vector to create pTREP. The chromosomal promoter of Lactococcus lactis MG1363, designated P1, was then cloned between the EcoRI and BglII sites present in the pTREP expression cassette to form pTREP1. This promoter was also isolated and characterized using the promoter probe vector pSB292 as described above in Waterfield et al. (1995). This P1 promoter fragment was first amplified by PCR using vent DNA polymerase according to the manufacturer's instructions and cloned into pTREX as an EcoRI-BglII DNA fragment. The EcoRI-BglII P1 promoter containing this fragment was excised from pTREX1 by restriction enzyme digestion and used to clone into pTREP (Shoffield et al., Personal communication, Cambridge University, Department of Pathology).

(B) S. PCR amplification of aureus nuc gene . Synthetic oligonucleotide primers for PCR amplification were designed using the nucleotide sequence of the Aureus nuc gene (EMBL database accession number V01281). These primers are named nucA, which is formed by cleavage of the N-terminal 19-21 amino acids of the secreted peptide, designated as snase B (Shorle, (1983), supra) with a protease. Designed to amplify the mature form of Three sense primers (nucS1, nucS2 and nucS3, Appendix 1) were designed. Each has a blunt-ended restriction enzyme cleavage site for EcoRV or SmaI in a different reading frame with respect to the nuc gene. To facilitate cloning into pTREP1 cut with BamHI and BglII, BglII and BamHI were additionally incorporated at the 5 ′ ends of the sense and anti-sense primers, respectively. All primer sequences are shown in Appendix 1. Three nuc gene DNA fragments encoding the mature form of the nuclease gene (NucA) were amplified by PCR using each of the sense primers in combination with the anti-sense primer described above. This nuc gene fragment was designated as S. Amplified by PCR using Aureus genomic DNA template, Vent DNA polymerase (NEB) and conditions recommended by the manufacturer. First denaturation step 2 min at 93 ° C, 30 cycles of denaturation at 93 ° C for 45 sec, annealing at 50 ° C for 45 sec and extension at 73 ° C for 1 min, finally extension at 73 ° C for 5 min Went. The PCR amplification product was purified using a wizard cleanup column (Promega) to remove unincorporated nucleotides and primers.

(C) Construction of pTREP1-nuc vector The purified nuc gene fragment described in section b is digested with BglII and BamHI under standard conditions, ligated to pTREP1 cleaved with BamHI and BglII and dephosphorylated. -Reporter vectors of the nuc1, pTREP1-nuc2 and pTREP1-nuc3 series were made. General molecular biology techniques were performed using reagents and buffers supplied by the manufacturer or using standard conditions (Sambrook and Maniatis, (1989), supra). In each of the pTREP1-nuc vectors, the expression cassette is a transcription termination region, a Lactococcus promoter P1, a mature form of the nuc gene and a unique cloning site followed by a second transcription termination region (BglII, EcoRV or SmaI) including. Note that sequences necessary for translation and secretion of the nuc gene have been carefully excluded in this construction. Such elements can only be provided by appropriately digested foreign DNA fragments (representing the target bacteria) that can be cloned into a unique restriction site present immediately upstream of the nuc gene.

  This pTREP1-nuc vector differs from the pFUN vector described by Pocket et al. (1998), above, in that it has a promoter. This is L. By directly screening for Nuc activity in lactis. Used to identify lactis released protein. Since the pFUN vector does not contain a promoter upstream of the nuc open reading frame, the cloned genomic DNA fragment must provide a signal for transcription in addition to the elements necessary for translation initiation and secretion of Nuc. This constraint can inhibit the isolation of genes that are distal to the promoter, eg, genes within the polycistron operon. In addition, promoters derived from other species of bacteria are available from EL. There can be no guarantee that it will be recognized and functioning in Lactis. Some promoters are subject to strict control in the natural host. Not so in Ractis. In contrast, the presence of the P1 promoter in the vectors of the pTREP1-nuc series ensures that a DNA fragment without a promoter (or a DNA fragment containing a promoter sequence that is not active in L. lactis) is still transcribed.

(D) Screening of Streptococcus pneumoniae secreted protein Genomic DNA isolated from Streptococcus pneumoniae was digested with the restriction enzyme Tru9I. This enzyme that recognizes the sequence 5′-TTAA-3 ′ was used because it efficiently cleaves the A / T-rich genome and is within the preferred size range (usually 0.5-1 on average). This is because a random genomic DNA fragment can be prepared. This size range is preferred because it increases the probability that the P1 promoter can be used to transcribe new gene sequences. However, the promoter of Streptococcus is EL. The P1 promoter may not be necessary in all cases because it is likely to be recognized by lactis. Different size range DNA fragments were purified from a Tru9I partial digest of Streptococcus pneumoniae genomic DNA. Since the Tru9I restriction enzyme creates a staggered end, this DNA fragment had to be blunted before ligation into the EcoRV or SmaI cut pTREP1-nuc vector. This was achieved by a partially packed enzyme reaction using the 5′-3 ′ polymerase activity of Klenow enzyme. Briefly, Tru9I digested DNA was prepared from T4 DNA ligase buffer (New England Biolabs, NEB) (1 ×) and the required dNTPs, in this experiment a solution supplemented with 33 μM each of dATP and dTTP (usually, In a total volume of 10-20 μl). Klenow enzyme was added (1 unit Klenow enzyme (NEB) per μg of DNA) and the reaction was incubated at 25 ° C. for 15 minutes. The reaction was stopped by incubating this mixture at 75 ° C. for 20 minutes. PTREP-nuc plasmid DNA digested with EcoRV or SmaI was then added (usually between 200-400 ng). This mixture was then supplemented with 400 units of T4 DNA ligase (NEB) and T4 DNA ligase buffer (1 ×) and incubated overnight at 16 ° C. The ligation mixture was directly precipitated in 100% ethanol and 1/10 volume of 3M sodium acetate (pH 5.2) and Lactis MG1363 (Gasson, 1983) was used to transform. The gene cloning site of the pTREP-nuc vector also contains a BglII site that can be used, for example, to clone a genomic DNA fragment digested with Sau3AI.

El. Lactis transformant colonies were grown on brain heart infusion agar and nuclease-secreting (Nuc + ) clones were toluidine blue DNA-aggar (0.05 M Tris pH 9.0, 10 g agar / liter, 10 g NaCl / liter, 0.1 mM CaCl 2 , 0.03% w / v sperm DNA and 90 mg toluidine blue O dye) overlaid with a nearly short, 1983, above, and Le Loire et al., 1994 Detected as described above. These plates were then incubated at 37 ° C. for up to 2 hours. Nuclease-secreting clones form an easily identifiable pink halo. Nuc + recombinant L. Plasmid DNA was isolated from the Lactis clone and the sequence of the DNA insert was determined on one strand using NucSeq sequencing primers that sequence directly through the DNA insert described in Appendix 1.

Isolation of Genes Encoding Exported Proteins from S. pneumoniae Numerous gene sequences presumed to encode proteins released in S. pneumoniae were identified using a nuclease screening system. These were further analyzed to remove artifacts. Sequences identified using this screening system were analyzed using several parameters.

1. All putative surface proteins are sequenced using the software program sequence (Gene Cause Corporation) and DNA strider (Mark, Nucleic Acids Res., 16 : 1829-1836 (1988)). Was analyzed. Bacterial signal peptide sequences share a common design. These are the more polar C-terminal part (c-) containing a short positively charged N-terminal (N region) immediately behind the hydrophobic residue region (central part-h region) and the cleavage part behind it. (Region). Computer software is available that allows the hydropathic delineation of putative proteins and can easily identify highly characteristic hydrophobic moieties (h-regions) that are representative of the leader peptide sequence is there. In addition, these sequences were also checked for the presence of a potential ribosome binding site (Shine-Dalgarno motif) required for translation initiation of the putative nuc reporter fusion protein.

  2. All putative surface protein sequences were compared with all of the protein / DNA sequences using published databases (OWL-proteins including Swiss plots and Genbank translations). This makes it possible to identify sequences similar to known genes or homologues of genes that have been confirmed to have some function. Thus, it is unquestionably established that the function of a part of the genes identified using the LEEP system can be predicted and this system can be used to identify and isolate the gene sequences of surface binding proteins. It became possible. We can also confirm that these proteins are actually related to the surface and not artifacts. This LEEP system has been used to identify novel gene targets for vaccines and therapeutics.

  3. Some of the proteins whose genes were identified did not have typical leader peptide sequences and the database did not show any homology with any DNA / protein sequences. In fact, these proteins are the first advantage of our screening method, an atypical that may have been missed in all the screening methods or approaches described so far based on sequence homology search. It can be said that this shows the isolation of a typical surface-related protein.

  In all cases, only partial gene sequences were initially obtained. The full-length gene was obtained in all cases by referring to the TIGR Streptococcus pneumonia database (www@tigr.org). Thus, by matching the initial partial sequence obtained with this database, we were able to identify the full-length gene sequence. In this way, three groups of genes were clearly identified as described herein. A group of genes encoding Streptococcus pneumoniae proteins not previously identified, a second group showing some homology with known proteins from various sources, and known Streptococcus pneumoniae proteins but antigens A third group that encodes what was not known as.

Example 2: Vaccine trial
PcDNA3.1 + as a DNA vaccine vector
pcDNA3.1 +
The vector chosen for use as a DNA vaccine vector was pcDNA3.1 (Invitrogen) (actually pcDNA3.1 +, here called pcDNA3.1, but in all cases its forward orientation was used). Met. This vector has been widely adopted and successfully used in the literature (Zang et al., Krall and Splitter, Anderson et al.) As a host vector for testing vaccine candidate genes that protect against pathogens. This vector was designed for transient expression that is stable and non-replicating at high levels in mammalian cells. pcDNA3.1 contains a ColE1 origin of replication that allows easy high-copy number replication and propagation in E. coli. This in turn allows for rapid and efficient cloning and testing of large numbers of genes. This pcDNA3.1 vector has a large number of cloning sites and a human cytomegalovirus (CMV) that allows efficient high-level expression of genes and recombinant proteins encoding ampicillin resistance to aid in clone selection. ) Immediate early promoter / enhancer. The CMV promoter is a strong viral promoter in a wide range of cell types, including both muscle cells and immune (antigen presenting) cells. This is important for an optimal immune response, as it is not yet known as to which cell type is most important in creating an in vivo protective response. The T7 promoter upstream of the multiple cloning site efficiently expresses the modified insert of interest and allows in vitro transcription of the cloned gene in sense orientation.

Zang, Dee. Young, X. , Berry, Jay. , Shen, See. , McLarty, G. And Brunham, Earl. Sea. (1997) “DNA vaccination with a major outer membrane protein gene induces immunity against Chlamydia trachomatis (pneumonia in mice) infection,” Infection and Immunity, 176, 1035-40.

Krall, e. And splitter, G. A. (1997) "Nucleic acid vaccine injection of the ribosomal L7 / L12 gene of Brucella aboltus induces an immune response." Vaccine, 15. 1851-57.

Anderson, Earl. , Gao, X. -M. , Papa Constantino Plow, A. , Roberts, M. And Dougan, Gee. (1996) "Immune responses in mice after immunization with DNA encoding fragment C of tetanus toxin." Infection and Immunity, 64 , 3168-3173.

Preparation of DNA vaccine Oligonucleotide primers were designed for each individual gene of interest derived using the LEEP system. Each gene was examined thoroughly and, where possible, primers were designed to target the part of the gene that would only encode the mature part of the gene protein. It was expected that expressing these sequences encoding only the mature portion of the target gene protein would facilitate its correct folding when expressed in mammalian cells. For example, in most cases, the primers were designed so that the final amplification product cloned into the pcDNA3.1 expression vector did not contain a putative N-terminal signal peptide sequence. This signal peptide directs the polypeptide precursor to the cell membrane through a protein release pathway where it is normally cleaved by signal peptidase I (or signal peptidase II if lipoprotein). Therefore, this signal peptide does not constitute any part of the mature protein, whether it is presented on the surface of the bacteria or secreted. When the N-terminal leader peptide sequence was not immediately apparent, the primer was designed to target the entire gene sequence for cloning and ultimately pcDNA3.1 expression.

That said, however, other additional features of the protein can also affect soluble protein expression and presentation. DNA sequences encoding such features in the gene encoding the protein of interest were excluded during oligonucleotide design. These features include the following:
1. LPXTG cell wall binding motif.
2. LXXC lipoprotein attachment site.
3. Hydrophobic C-terminal domain.
4). In the absence of N-terminal signal peptide or LXXXC, the start codon was excluded.
5. In the absence of the hydrophobic C-terminal domain or LPXTG motif, the stop codon was removed.

  Appropriate PCR primers were designed for each gene of interest, and any and all of the regions encoding the above features were removed from the genes when designing these primers. These primers used the appropriate restriction enzyme site followed by a conserved Kozak nucleotide sequence (in many cases (except for special cases such as ID59) GCCACC, which is initiated by a eukaryotic ribosome). Designed to have an ATG start codon upstream of the insertion of the gene of interest. For example, a forward primer using a BamHI site begins with GCGGGATCCCGCACCATG followed by a small portion at the 5 'end of the gene of interest. The reverse primer was designed to be consistent with the forward primer and was often designed to have a NotI restriction site at the 5 ′ end (this site is TTGCGGCCCGC) (eg, the XhoI site is replaced by NotI). Except for the special case of ID59 used).

PCR primers The following PCR primers were designed and used to amplify the gene of interest with the tip cut off.
ID5
Forward primer 5'CGGATCCCGCCACATGGGGTCTAATTGAAGACTTAAAAAATCAA3 'Reverse primer 5'TTGCGGCCGCCAATGCTAGACTAAAACACAAGACTCA3'ID59
Forward primer 5'CGCGGATCCATGAAAAAAACTCTATTCATTTTAGCA3 'Reverse primer 5'CCCTCGAGGGCTACTTCCCATACATTTTAAACTGTTAGG3'
ID51
Forward primer 5 'CGGATCCGCCCACCCATGAGTCATGTCGCTGCAAAATG3'
Reverse primer 5 'TTGCGGCCCGCATACCAAACGCTGGACATCTACCG3'
ID29
Forward primer 5'CGGATCCGCCACCCATGCAAAAAGAGCGGTATGGTTTATG3 '
Reverse primer 5 'TTGCGGCCCGCACCCCCATTTCTTAATCCCTT3'
ID50
Forward primer 5 'CGGATCCGCCCACCATGGAGGTATGTGAAATGTCACGTAAA 3'
Reverse orientation primer 5 'TTGCGGCCCCTTTTACAAAGTCAAGCAAAGCC3'

Cloning An insert with the above-mentioned features sandwiched on both sides is amplified by PCR using genomic DNA isolated from type 4 S. pneumoniae strain 11886 obtained from National Collection of Type Culture as a template. It was done. This PCR product was cut with appropriate restriction enzymes and cloned into the multiple cloning site of pcDNA3.1 using conventional molecular biology techniques. Clones located on the appropriate map of the gene of interest were cultured and plasmids were isolated on a large scale (> 1.5 mg) using the plasmid mega kit (Qiagen). The success of gene cloning and maintenance was confirmed by sequencing of approximately 700 base pairs by the creation of a respective restriction map of a large scale preparation of each construct and 5 ′ cloning ligation.

Confirmation of strain effectiveness A strain of type 4 which was a sequence of the genome of Streptococcus pneumoniae was used for the cloning method and the attack method. A homogenous laboratory strain lyophilized ampoule of type 4 Streptococcus pneumoniae strain NCTC 11886 was obtained from the National Collection of Type Strains. The ampoule was opened and the culture was resuspended with 0.5 ml tryptic soy broth (0.5% glucose, 5% blood). This suspension was subcultured in 10 ml tryptic soy broth (0.5% glucose, 5% blood) and incubated at 37 ° C. overnight. This culture was applied to a 5% blood agar plate to check for contamination and to confirm survival and was applied on a blood agar slope. The rest of the culture was used to make a 20% glycerol stock. The slope was sent to the Public Health Laboratory Service, where the Type 4 serotype is confirmed.

NCTC 11886 glycerol stock was spread on 5% blood agar plates and incubated overnight at 37 ° C. in a CO 2 gas bath. Freshly applied bacteria were made and optohin sensitivity was confirmed.

Standard inoculum of S. pneumoniae attack type 4 pneumococcal from the culture 1 × pneumococcal subcultured through mice infected harvested from the animal's blood, and about 10 9 cfu before freezing broth / Prepared by growing to a predetermined viable count of ml and frozen. This preparation is shown below by means of a flowchart.
Apply pneumococcal culture and confirm identity

Grow an overnight culture of 4-5 colonies on the upper plate

Subculture of pneumococcal animals
(Intraperitoneal injection of collected heart blood)

Growing overnight cultures from pneumococci in subcultured animals

Animal subcultures are grown from overnight to daily culture (to a predetermined optical density) and frozen at -70 ° C. This is the standard minimum.

Thaw a partial sample of the standard inoculum and count the number of viable bacteria.

Use standard inoculum to determine effective dose
(Called virulence test)

All subsequent attacks-use the standard inoculum to an effective dose.
A portion of the standard inoculum was diluted 500 times with PBS and used to inoculate mice.
Mice were lightly anesthetized with halothane and then a dose of 1.4 × 10 5 cfu of Streptococcus pneumoniae was applied to each mouse's nose. Ingestion was facilitated by normal breathing of the mice. The mice were left to recover.

Vaccine trials in Streptococcus pneumoniae trial mice were performed by administering DNA to 6-week-old CBA / ca mice (Harlan, UK). Vaccinated mice were divided into 6 groups, each group immunized with recombinant pcDNA3.1 + plasmid DNA containing the specific target gene sequence of interest. A total of 100 μg of DNA in Dulbecco's PBS (Sigma) was injected intramuscularly into the anterior tibialis muscle of both legs (50 μl per leg). Four weeks later, the same operation was performed. For comparison, a control group was included in all vaccine trials. These control groups were either non-vaccinated animals or those receiving only non-recombinant pcDNA3.1 + DNA (sham vaccine injection) by the same time course as described above. Three weeks after the second immunization, all groups of mice were challenged intranasally with a lethal dose of Streptococcus pneumoniae serotype 4 (strain NCTC11886). The number of bacteria administered was monitored by applying a dilution series of inoculum on 5% blood agar plates. A problem with intranasal immunization is that in some mice, the inoculum is bubbled out of the nostril, which is noted in the results table and taken into account in the calculations. A less obvious problem is that only a small amount of inoculum for each mouse is introduced. This amount is the same for each mouse and is estimated to be averaged during the inoculation process. However, the amount of sample used is small and in some experiments this problem can have a negligible effect. All mice that survived the challenge were killed 3 or 4 days after infection. During the infection process, challenged mice were monitored for the formation of symptoms associated with the development of Streptococcus pneumoniae-induced disease. Typical symptoms include napling, increased dorsum, eye secretion, increased lethargy, and resistance to movement in an appropriate order. The latter symptom was consistent with the formation of a normal moribund state where the mouse was removed to prevent further pain. These mice appeared to be very close to the time of death and removal used to determine survival for statistical analysis. When a mouse was found dead, its survival time was the last time the mouse was alive and monitored.

Interpretation of results A positive result was attributed to any DNA sequence that had been cloned and used in the above attack experiments and provided protection against that attack. Protection consists of a DNA sequence that gave statistically significant protection (up to 95% confidence level (p <0.05) and a DNA sequence that was marginal or significantly close using Mann-Whitney or some protective features. For example, one or more mice out of range, or increased time to first death.The obviousness of these results is clouded by problems associated with intranasal infection When considered, it is acceptable to consider marginal or non-significant results as potential positives.

result
Trials 1-6 (see Figure 1)

* -Foaming when administered may not have received all of the inoculum. Terminate at the end of the experiment, showing no symptoms of T-infection.
Numbers in parentheses-considered incomplete administration and survival was ignored.
A p-value of 1 refers to a significance test compared to a control that has not received the vaccine.
A p-value of 2 refers to a significance test comparing pcDNA3.1 + with a vaccinated control.

Statistical analysis trial 1—None of the other groups showed significantly longer survival times than controls. The survival time of the non-vaccinated control group and the pcDNA3.1 control group was not significantly different. One of the mice from ID5 was out of range, and the average survival time for ID5 was increased but not significantly increased.
Trial 2-ID59 vaccinated group had significantly longer survival than the non-vaccinated group.
The group vaccinated with Trial 5-ID59 again survived on average approximately 10 hours longer than the controls. However, this result was not statistically significant.
Trial 6-ID51 vaccinated group did not have significantly higher survival than non-vaccinated control (p = <36.0), but vaccinated group was out of range of 2 animals There were no mice.

Vaccine trials 7 and 8 (see Figure 2)

* -Foaming when administered may not have received all of the inoculum. Terminate at the end of the experiment, showing no symptoms of T-infection.
Numbers in parentheses-considered incomplete administration and survival was ignored.
A p-value of 1 refers to a significance test compared to a control that has not received the vaccine.

Statistical analysis trial 7-The group vaccinated with ID29 showed an extended time to first death.
Trial 8-ID50 vaccinated group survived significantly longer than the non-vaccinated control.

FIG. 1 shows the results of several DNA vaccine trials. FIG. 2 shows the results of further DNA vaccine trials.

Claims (20)

  1.   A protein or polypeptide of Streptococcus pneumoniae having a sequence selected from the sequences shown in Table 1.
  2.   A protein or polypeptide of Streptococcus pneumoniae having a sequence selected from the sequences shown in Table 2.
  3.   The protein or polypeptide of claim 1 or claim 2 provided in substantially pure form.
  4.   A protein or polypeptide substantially the same as the protein or polypeptide according to any one of claims 1 to 3.
  5.   A homologue or derivative of the protein or polypeptide of any one of claims 1 to 4.
  6.   Antigenic and / or immunogenic fragments of proteins or polypeptides as defined in Tables 1 to 3.
  7. 1 sequence below (i) any of the DNA sequences listed in Table 1 or their RNA equivalents,
    (Ii) a sequence complementary to any of the sequences of (i),
    (iii) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii), (iv) a sequence substantially identical to any of the sequence groups of (i), (ii) and (iii),
    (V) a sequence encoding a homologue, derivative or fragment of a protein as defined in Table 1,
    A nucleic acid molecule comprising or consisting of the sequence.
  8. 1 sequence (i) below either of the DNA sequence groups listed in Table 2 or their RNA equivalents,
    (Ii) a sequence complementary to any of the sequences of (i),
    (iii) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii), (iv) a sequence substantially identical to any of the sequence groups of (i), (ii) and (iii),
    (V) a sequence encoding a homologue, derivative or fragment of a protein as defined in Table 2,
    A nucleic acid molecule comprising or consisting of the sequence.
  9.   Use of a protein or polypeptide having one sequence selected from the sequence group shown in Tables 1 to 3 or a homologue, derivative and / or fragment thereof as an immunogen and / or antigen.
  10.   An immunogenic and / or antigenic composition comprising one or more proteins or polypeptides, wherein the sequences of the proteins or polypeptides are those shown in Tables 1 to 3, or their homologues, derivatives and A composition that is selected from / or any fragment thereof.
  11.   11. An immunogenic and / or antigenic composition according to claim 10 for use in a vaccine or diagnostic test.
  12.   12. A vaccine according to claim 11 comprising one or more additional components selected from excipients, diluents, adjuvants and the like.
  13.   A vaccine composition comprising one or more nucleic acid sequences as defined in Tables 1-3.
  14.   A method for detecting / diagnosing Streptococcus pneumoniae, comprising a step of bringing a test sample into contact with at least one protein or polypeptide defined in Tables 1 to 3 or a homologue, derivative or fragment thereof.
  15.   An antibody capable of binding to a protein or polypeptide as defined in Tables 1 to 3 or a homologue, derivative or fragment thereof.
  16.   The antibody according to claim 15, which is a monoclonal antibody.
  17.   A method for detecting / diagnosing Streptococcus pneumoniae, comprising a step of contacting a test sample with at least one of the antibodies according to claim 15 or 16.
  18.   A method for detecting / diagnosing Streptococcus pneumoniae, comprising a step of bringing a test sample into contact with at least one of the nucleic acid sequences according to claim 7 or 8.
  19.   A method for determining whether a protein or polypeptide described in Tables 1 to 3 is a potential antimicrobial target, the step of inactivating the protein or polypeptide and the Streptococcus pneumoniae still alive Determining whether or not.
  20.   To antagonize the function or expression of the protein or polypeptide listed in Tables 1 to 3 in the manufacture of a medicament for use in the treatment or prevention of Streptococcus pneumoniae infection or inhibit or otherwise interfere with it. Use of active substances that can
JP2007221409A 1998-07-27 2007-08-28 Nucleic acid and protein derived from streptococcus pneumoniae Pending JP2008022856A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
GBGB9816336.3A GB9816336D0 (en) 1998-07-27 1998-07-27 Proteins
US12532999P true 1999-03-19 1999-03-19

Related Child Applications (1)

Application Number Title Priority Date Filing Date
JP2000562520 Division

Publications (1)

Publication Number Publication Date
JP2008022856A true JP2008022856A (en) 2008-02-07

Family

ID=26314124

Family Applications (2)

Application Number Title Priority Date Filing Date
JP2000562520A Pending JP2002521058A (en) 1998-07-27 1999-07-27 Nucleic acids and proteins from S. pneumoniae
JP2007221409A Pending JP2008022856A (en) 1998-07-27 2007-08-28 Nucleic acid and protein derived from streptococcus pneumoniae

Family Applications Before (1)

Application Number Title Priority Date Filing Date
JP2000562520A Pending JP2002521058A (en) 1998-07-27 1999-07-27 Nucleic acids and proteins from S. pneumoniae

Country Status (4)

Country Link
EP (1) EP1144640A3 (en)
JP (2) JP2002521058A (en)
CN (1) CN1318103A (en)
WO (1) WO2000006738A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8101187B2 (en) * 2001-03-30 2012-01-24 Sanofi Pasteur Limited Secreted Streptococcus pneumoniae proteins

Families Citing this family (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6800744B1 (en) 1997-07-02 2004-10-05 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
CA2341268C (en) 1998-07-22 2010-10-12 Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V. Streptococcus suis vaccines and diagnostic tests
US7128918B1 (en) 1998-12-23 2006-10-31 Id Biomedical Corporation Streptococcus antigens
EP1950302B1 (en) * 1998-12-23 2012-12-05 ID Biomedical Corporation of Quebec Streptococcus antigens
KR100802198B1 (en) * 1998-12-23 2008-02-11 샤이어 바이오켐 인코포레이티드 Novel Streptococcus antigens
EP1731166B1 (en) * 1999-06-10 2011-03-09 MedImmune, LLC Streptococcus pneumoniae proteins and vaccines
US6887480B1 (en) 1999-06-10 2005-05-03 Medimmune, Inc. Streptococcus pneumoniae proteins and vaccines
DE10012370A1 (en) * 2000-03-14 2001-09-27 Chiron Behring Gmbh & Co Use of oil-in-water emulsion as vaccine adjuvant, particularly for influenza and pneumococcal vaccines, administered at different site from the vaccine
US7074415B2 (en) 2000-06-20 2006-07-11 Id Biomedical Corporation Streptococcus antigens
EP1205552A1 (en) * 2000-11-09 2002-05-15 ID-Lelystad, Instituut voor Dierhouderij en Diergezondheid B.V. Virulence of streptococci, involving ORFs from Streptococcus suis
GB0107658D0 (en) * 2001-03-27 2001-05-16 Chiron Spa Streptococcus pneumoniae
GB0107661D0 (en) 2001-03-27 2001-05-16 Chiron Spa Staphylococcus aureus
AU2002351623A1 (en) 2001-12-20 2003-07-09 Shire Biochem Inc. Streptococcus antigens
WO2004048575A2 (en) * 2002-11-26 2004-06-10 Id Biomedical Corporation Streptococcus pneumoniae surface polypeptides
US7635487B2 (en) * 2003-04-15 2009-12-22 Intercell Ag S. pneumoniae antigens
WO2006110352A2 (en) * 2005-04-08 2006-10-19 Wyeth Separation of contaminants from streptococcus pneumoniae polysaccharide by ph manipulation
GB0714963D0 (en) * 2007-08-01 2007-09-12 Novartis Ag Compositions comprising antigens
EP2268618B1 (en) 2008-03-03 2015-05-27 Novartis AG Compounds and compositions as tlr activity modulators
JP2011514167A (en) 2008-03-17 2011-05-06 インターセル アーゲー Protective peptides against S. pneumoniae and compositions, methods and uses related thereto
AT523204T (en) * 2009-02-16 2011-09-15 Karlsruher Inst Technologie Cd44v6 peptides as bacterial infection inhibitors
US9517263B2 (en) 2009-06-10 2016-12-13 Glaxosmithkline Biologicals Sa Benzonaphthyridine-containing vaccines
SG10201403702SA (en) 2009-06-29 2014-09-26 Genocea Biosciences Inc Vaccines and compositions against streptococcus pneumoniae
CN102844047B (en) 2009-09-02 2017-04-05 诺华股份有限公司 Immunogenic composition containing TLR active regulators
TWI445708B (en) 2009-09-02 2014-07-21 Irm Llc Compounds and compositions as tlr activity modulators
BR112012008338A2 (en) 2009-09-10 2019-09-24 Novartis Ag combination of vaccines against respiratory tract diseases.
WO2011057148A1 (en) 2009-11-05 2011-05-12 Irm Llc Compounds and compositions as tlr-7 activity modulators
CA2784580A1 (en) 2009-12-15 2011-07-14 Novartis Ag Homogeneous suspension of immunopotentiating compounds and uses thereof
US8808703B2 (en) 2010-03-23 2014-08-19 Tom Yao-Hsiang Wu Compounds (cystein based lipopeptides) and compositions as TLR2 agonists used for treating infections, inflammations, respiratory diseases etc
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
BR112013018642A2 (en) 2011-01-20 2019-04-30 Childrens Medical Center compositions and vaccines against Streptococcus pneumoniae
US20150132339A1 (en) 2012-03-07 2015-05-14 Novartis Ag Adjuvanted formulations of streptococcus pneumoniae antigens
JP6411378B2 (en) 2013-02-01 2018-10-24 グラクソスミスクライン バイオロジカルズ ソシエテ アノニム Intradermal delivery of an immunological composition comprising a TOLL-like receptor agonist
EP2953638A4 (en) * 2013-02-07 2016-08-03 Childrens Medical Center Protein antigens that provide protection against pneumococcal colonization and/or disease
CN103834667B (en) * 2013-12-31 2016-08-17 李越希 The streptococcus pneumoniae PspA protein extracellular genetic fragment of chemosynthesis and expression, application

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5928900A (en) * 1993-09-01 1999-07-27 The Rockefeller University Bacterial exported proteins and acellular vaccines based thereon
WO1997037026A1 (en) * 1996-04-02 1997-10-09 Smithkline Beecham Corporation Novel compounds
WO1997043303A1 (en) * 1996-05-14 1997-11-20 Smithkline Beecham Corporation Novel compounds
EP1400592A1 (en) * 1996-10-31 2004-03-24 Human Genome Sciences, Inc. Streptococcus pneumoniae polynucleotides and sequences
US6136557A (en) * 1996-12-13 2000-10-24 Eli Lilly And Company Strepococcus pneumoniae gene sequence FtsH
GB9700939D0 (en) * 1997-01-17 1997-03-05 Microbial Technics Limited Therapy

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8101187B2 (en) * 2001-03-30 2012-01-24 Sanofi Pasteur Limited Secreted Streptococcus pneumoniae proteins

Also Published As

Publication number Publication date
EP1144640A2 (en) 2001-10-17
EP1144640A3 (en) 2001-11-28
JP2002521058A (en) 2002-07-16
CN1318103A (en) 2001-10-17
WO2000006738A3 (en) 2001-08-23
WO2000006738A2 (en) 2000-02-10

Similar Documents

Publication Publication Date Title
JP2017074071A (en) Genes of an otitis media isolate of nontypeable haemophilus influenzae
Briles et al. PspA, a protection-eliciting pneumococcal protein: immunogenicity of isolated native PspA in mice
Hambleton et al. Anthrax: the disease in relation to vaccines
AU767143B2 (en) Lactobacilli harboring aggregation and mucin binding genes as vaccine delivery vehicles
KR101667837B1 (en) Compositions relating to a mutant clostridium difficile toxin and methods thereof
EP0649435B1 (en) Membrane-associated immunogens of mycobacteria
JP4283872B2 (en) Microbial protein, microorganisms producing this protein, and use of the protein in vaccines and tuberculosis detection
CN1191362C (en) Streptococcus antigens
Briles et al. Pneumococcal diversity: considerations for new vaccine strategies with emphasis on pneumococcal surface protein A (PspA)
AU2001256957B2 (en) Salmonella vaccine materials and methods
Bhatnagar et al. Anthrax toxin
CN102836425B (en) The Vaccinum Calmette-Guerini of antigen expressed during comprising the latent infection stage
US20140017270A1 (en) Small streptococcus pyogenes antigens and their use
EP1708749B1 (en) Mucosal vaccine adjuvants containing bacterial flegellins as an active component
Konjufca et al. A recombinant attenuated Salmonella enterica serovar Typhimurium vaccine encoding Eimeria acervulina antigen offers protection against E. acervulina challenge
Amani et al. Immunogenic properties of chimeric protein from espA, eae and tir genes of Escherichia coli O157: H7
US7476391B2 (en) Anti-bacterial vaccine compositions
Grangette et al. Enhanced mucosal delivery of antigen with cell wall mutants of lactic acid bacteria
AU2001255772B2 (en) Immunogenic pneumococcal protein and vaccine compositions thereof
US7763262B2 (en) Attenuated yiaO mutants of Pasteurellaceae bacteria
JP5349070B2 (en) Porphymonasgingivalis polypeptides and nucleotides
US20110275132A1 (en) Purification of bacterial antigens
CN1198932C (en) Streptococcus pneumoniae antigens
US10188717B2 (en) Vaccines and compositions against Streptococcus pneumoniae
KR20090071551A (en) Immunogenic pcpa polypeptides and uses thereof

Legal Events

Date Code Title Description
A711 Notification of change in applicant

Free format text: JAPANESE INTERMEDIATE CODE: A711

Effective date: 20080130

A131 Notification of reasons for refusal

Free format text: JAPANESE INTERMEDIATE CODE: A131

Effective date: 20090616

A02 Decision of refusal

Free format text: JAPANESE INTERMEDIATE CODE: A02

Effective date: 20091201