WO1999043824A1 - Gene de specificite de cultivar provenant du pathogene de riz magnaporthe grisea, et procedes d'utilisation - Google Patents
Gene de specificite de cultivar provenant du pathogene de riz magnaporthe grisea, et procedes d'utilisation Download PDFInfo
- Publication number
- WO1999043824A1 WO1999043824A1 PCT/US1999/004047 US9904047W WO9943824A1 WO 1999043824 A1 WO1999043824 A1 WO 1999043824A1 US 9904047 W US9904047 W US 9904047W WO 9943824 A1 WO9943824 A1 WO 9943824A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- gene
- avr1
- nucleic acid
- acid molecule
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
Definitions
- This invention relates to the field of disease resistance in plants.
- the invention provides a novel avirulence gene from the rice blast pathogen, Magnaporthe grisea , and methods of using the gene and its encoded products for improving resistance of rice to this pathogen.
- Rice is a major staple food for about two- thirds of the world's population. More than ninety percent of the world's rice is grown and consumed in developing countries. Rice blast disease, caused by the fungus Magnaporthe grisea , threatens rice crops worldwide. The disease can cause yield losses of ten to thirty percent in infested fields. Rice blast has been an ongoing problem in rice growing areas of the southern United States. It has now become a significant problem in rice growing areas of California, as well.
- the "gene-for-gene” hypothesis has been advanced to explain the very specific disease resistance / susceptibility relationship that often exists between races of a plant pathogen and cultivars of its host - 2 - species.
- the gene-for-gene hypothesis has been found applicable to many host -pathogen interactions, including that of the rice blast fungus, Magnaporthe grisea , and its host, Oryza sativa .
- M. grisea is rapidly able to overcome new disease resistance in rice soon after their deployment.
- M. grisea exists as a complex genus with many subspecific groups that are infertile, but differ in their host range.
- Gene-for-gene resistance also known as hypersensitive resistance (HR) or race-specific resistance
- HR hypersensitive resistance
- R resistance
- a pathogen gene is referred to as an Avr gene if its expression causes the pathogen to produce a signal that triggers a strong defense response in a plant having a corresponding R gene. This response is not observed in the absence of either the Avr gene in the pathogen or the corresponding R gene in the plant.
- a single plant may have many R genes, and a single pathogen may have many Avr genes.
- strong resistance occurs only when an Avr gene and its specific R gene are matched in a host-pathogen interaction.
- - 3 - resistance generally occurs as activation of a HR response, in which the cells in the immediate vicinity of the infection undergo programmed necrosis in order to prevent the further advance of the pathogen into living plant tissue.
- Other features of the resistance response may also include synthesis of antimicrobial metabolites or pathogen- inhibiting enzymes, reinforcement of plant cell walls in the infected area, and induction of signal transduction pathways leading to systemic acquired resistance (SAR) in the plant.
- SAR systemic acquired resistance
- the molecular basis of host-cultivar specificity and pathogenic variability in M. grisea is only beginning to be elucidated with the identification, mapping and, in some instances, cloning of specific Avr genes from pathogenic isolates of M. grisea .
- AVR2 - YAM0 cultivar specificity
- PWL2 host specificity
- Rice Blast Disease R. Zeigler, S.A. Leong, P. Teng, Eds.
- AVR2 - YAMO encodes a 223-amino acid protein with homology to proteases, while PWL2 encodes a 145-amino acid polypeptide which is glycine- rich. Based on the predicted amino acid sequences of the proteins, both may be secreted.
- homologs of both AVR2-YAMO and PWL2 appear to be widely distributed in rice and in other grass- infecting isolates of M. grisea , thereby confirming that M. grisea isolates which do not infect rice still may carry host or cultivar specificity genes for rice.
- homologs of AVR2 - YAMO and PWL2 have been shown to be functional and to exhibit the same host or cultivar specificity as AVR2- YAM0 or PWL2 . - 4 -
- the cultivar specificity gene AVR1 -C039 which determines avirulence on rice cultivar C039, has been identified (Valent et al . , Genetics 127 : 87-101, 1991) and mapped to a position on M. grisea chromosome 1 (Smith & Leong, Theor. Appl . Genet. . 88 . : 901-908, 1994).
- a segment of chromosome 1 that appears to contain the AVR1 - C039 gene has been isolated and cloned into a cosmid vector (Leong et al . , pp. 846-852 in Rice Genetics III, Proceedings of the Third Annual Rice Genetics Symposium, G.S. Khush, Ed., Island Harbor Press, Manila, 1996); however, the gene itself heretofore has not been identified and characterized.
- an isolated nucleic acid from Magnaporthe grisea that confers rice cultivar C039- specific avirulence to fungal plant pathogens that contain the nucleic acid.
- the nucleic acid preferably comprises part or all of Sequence I.D. No. 1, or hybridizes with part or all of Sequence I.D. No. 1 or its complement .
- the polypeptide is selected from the group of polypeptides encoded by ORFS 1, 2, 3, 4, 5, 6 and 7, corresponding to Sequence ID No's. 2, 3, 4, 5, 6, 7 and 8, respectively, and most preferably is encoded by ORF 3.
- a transgenic epiphytic bacterium which expresses a portion of an AVR1 -C039 gene effective to confer rice cultivar C039-specific avirulence to microorganisms expressing the gene.
- the transgenic epiphytic bacterium expresses ORF3 of Sequence ID No . 1, or a functional equivalent.
- a method of enhancing the scope of resistance of rice cultivar C039 plants to pathogenic microorganisms comprises treating the plants with an epiphytic bacterium that expresses a portion of an AVR1 -C039 gene effective to trigger expression of a C039- specific R gene in the plants.
- a second method of enhancing the scope of resistance of rice cultivar C039 plants to pathogenic microorganisms comprises treating the plants with a protein extract comprising polypeptides produced by expression of AVR1 -C039 , in an amount effective to trigger expression of a C039-specific R gene in the plants .
- isolated nucleic acid refers to a DNA molecule that is separated from sequences with which it is immediately contiguous (in the 5' and 3' directions) in the naturally occurring genome of the organism from which it was derived.
- the "isolated nucleic acid” may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a procaryote or eucaryote .
- An “isolated nucleic acid molecule” may also comprise a cDNA molecule.
- isolated nucleic acid primarily refers to an RNA molecule encoded by an isolated D ⁇ A molecule as defined above.
- the term may refer to an R ⁇ A molecule that has been sufficiently separated from RNA molecules with which it would be associated in its natural state (i.e., in cells or tissues), such that it exists in a “substantially pure” form (the term “substantially pure” is defined below) .
- isolated protein or “isolated and purified protein” is sometimes used herein. This term refers primarily to a protein produced by expression of an isolated nucleic acid molecule of the invention. Alternatively, this term may refer to a protein which has been sufficiently separated - 7 - from other proteins with which it would naturally be associated, so as to exist in "substantially pure” form.
- substantially pure refers to a preparation comprising at least 50-60% by weight the compound of interest (e.g., nucleic acid, oligonucleotide, protein, etc.). More preferably, the preparation comprises at least 75% by weight, and most preferably 90-99% by weight, the compound of interest. Purity is measured by methods appropriate for the compound of interest (e.g. chromatographic methods, agarose or polyacrylamide gel electrophoresis , HPLC analysis, and the like) .
- the term "immunologically specific” refers to antibodies that bind to one or more epitopes of a protein of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
- the term “specifically hybridizing” refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed “substantially complementary”) .
- the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence .
- pathogen-inoculated refers to the inoculation of a plant with a pathogen. - 8 -
- disease defense response refers to a change in metabolism, biosynthetic activity or gene expression that enhances the plant's ability to suppress the replication and spread of a microbial pathogen (i.e., to resist the microbial pathogen) .
- Examples of plant disease defense responses include, but are not limited to, production of low molecular weight compounds with antimicrobial activity (referred to as phytoalexins) and induction of expression of defense (or defense-related) genes, whose products include, for example, peroxidases, cell wall proteins, proteinase inhibitors, hydrolytic enzymes, pathogenesis-related (PR) proteins and phytoalexin biosynthetic enzymes, such as phenylalanine ammonia lyase and chalcone synthase .
- Such defense responses appear to be induced in plants by several signal transduction pathways involving secondary defense signaling molecules produced in plants.
- Agents that induce disease defense responses in plants include, but are not limited to: (1) microbial pathogens, such as fungi, bacteria and viruses; (2) microbial components and other defense response elicitors, such as proteins and protein fragments, small peptides, ⁇ -glucans, elicitins and harpins, cryptogein and oligosaccharides ; and (3) secondary defense signaling molecules produced by the plant, such as salicylic acid, H 2 0 2 , ethylene and jasmonates .
- microbial pathogens such as fungi, bacteria and viruses
- microbial components and other defense response elicitors such as proteins and protein fragments, small peptides, ⁇ -glucans, elicitins and harpins, cryptogein and oligosaccharides
- secondary defense signaling molecules produced by the plant such as salicylic acid, H 2 0 2 , ethylene and jasmonates .
- promoter region refers to the 5 ' regulatory regions of a gene.
- reporter gene refers to genetic sequences which may be operably linked to a promoter region forming a transgene, such that expression of the reporter gene coding region is regulated by the promoter and expression of the transgene is readily assayed. - 9 -
- selectable marker gene refers to a gene product that when expressed confers a selectable phenotype, such as antibiotic resistance, on a transformed cell or plant.
- operably linked means that the regulatory sequences necessary for expression of the coding sequence are placed m the DNA molecule m the appropriate positions relative to the coding sequence so as to effect expression of the coding sequence. This same definition is sometimes applied to the arrangement of coding sequences and transcription control elements (e.g. promoters, enhancers, and termination elements) m an expression vector.
- DNA construct refers to genetic sequence used to transform plants and generate progeny transgenic plants. These constructs may be administered to plants m a viral or plasmid vector. Other methods of delivery such as Agrobacterium T-DNA mediated transformation and transformation using the biolistic process are also contemplated to be within the scope of the present invention.
- the transforming DNA may be prepared according to standard protocols such as those set forth m "Current Protocols m Molecular Biology", eds . Frederick M. Ausubel et al . , John Wiley & Sons, 1998.
- AVR1 -C039 and its Encoded Peptides
- Th s gene is referred to herein as AVR1 -C039 , to denote its function as a gene that confers cultivar-specific interactions with rice cultivar C039.
- Example 1 The cloning of an AVR1 -C039 gene from M. grisea strain 2539 and analysis of the gene are described in detail in Example 1.
- the gene contains four open reading frames, one of which (ORF3) appears to play the most key role in conferring cultivar specific avirulence to Magnaporthe isolates that carry the gene.
- ORF3 open reading frames
- Homologs of the strain 2539 isolate AVR1C039 gene have been identified in a diverse array of other Magnaporthe isolates.
- Sequence I.D. No. 1 contains four open reading frames. It is believed that one or more of these open reading frames are responsible for conferring avirulence on cultivar
- AVR1 -C039 is described and exemplified herein, this invention is intended to encompass nucleic acid sequences and proteins from other Magnaporthe isolates that are sufficiently similar to be used instead of the isolate 2539 AVR1 -C039 nucleic acid and proteins for the purposes described below. These include, but are not limited to, allelic variants and natural mutants of Sequence I.D. No. 1, which are likely to be found in any given population of Magnaporthe isolates.
- this invention provides an isolated AVR1 -C039 nucleic acid molecule having at least about 60% (preferably 70% and more - 11 - preferably over 80%) sequence homology __n the coding regions with the nucleotide sequence set forth as Sequence I.D. No. 1 (and, most preferably, specifically comprising the coding region of sequence I.D. No. 1) .
- This invention also provides isolated polypeptide products of the open reading frames of Sequence I.D. No. 1, having at least about 60% (preferably 70% or 80% or greater) sequence homology with the amino acid sequences of Sequence I.D. No's. 2, 3, 4, 5, 6 or 7, respectively.
- the term “substantially the same” refers to nucleic acid or amino acid sequences having sequence variation that do not materially affect the nature of the protein (i.e. its structure and/or biological activity) .
- the term “substantially the same” is intended to refer to coding regions and to conserved sequences governing expression, and refers primarily to degenerate codons encoding the same amino acid, or alternate codons encoding conservative substitute amino acids in the encoded - 12 - polypeptide.
- amino acid sequences refers generally to conservative substitutions and/or variations in regions of the polypeptide that do not affect structure or function.
- AVR1 -C039 nucleic acid molecules of the invention may be prepared by two general methods: (1) they may be synthesized from appropriate nucleotide triphosphates, or (2) they may be isolated from biological sources. Both methods utilize protocols well known in the art .
- the availability of nucleotide sequence - 13 - information, such as the genomic isolate having Sequence I.D. No. 1, enables preparation of an isolated nucleic acid molecule of the invention by oligonucleotide synthesis.
- Synthetic oligonucleotides may be prepared by the phosphoramadite method employed in the Applied
- Biosystems 38A DNA Synthesizer or similar devices may be purified according to methods known in the art, such as high performance liquid chromatography (HPLC) .
- HPLC high performance liquid chromatography
- a 1.05 kb double-stranded molecule may be synthesized as several smaller segments of appropriate complementarity. Complementary segments thus produced may be annealed such that each segment possesses appropriate cohesive termini for attachment of an adjacent segment.
- Adjacent segments may be ligated by annealing cohesive termini in the presence of DNA ligase to construct an entire 1.05 kb double-stranded molecule.
- a synthetic DNA molecule so constructed may then be cloned and amplified in an appropriate vector.
- AVR1 -C039 genes also may be isolated from appropriate biological sources using methods known in the art.
- a genomic clone has been isolated from a M. grisea strain 2539 cosmid library.
- a cDNA clone comprising one or more of the open reading frames of the genomic AVR1 -C039 locus may be isolated.
- nucleic acids having the appropriate level sequence homology with part or all the coding regions of Sequence I.D. No. 1 may be identified by using hybridization and - 14 - washing conditions of appropriate stringency. For example, hybridizations may be performed, according to the method of Sambrook et al .
- Hybridization is carried out at 37-42°C for at least six hours. Following hybridization, filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 1% SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1% SDS; (3) 30 minutes-1 hour at 37oc in 2X SSC and 0.1% SDS; (4) 2 hours at 45-55oin 2X SSC and 0.1% SDS, changing the solution every 30 minutes.
- a modification of the Amasino hybridization protocol is preferred for use in the present invention and is described in greater detail in Example 1.
- T m 81.5°C + 16.6Log [Na+] + 0.41(% G+C) - 0.63 (% formamide) - 600/#bp in duplex
- the T m is 57°C.
- the T m of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology.
- targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42 °C.
- Nucleic acids of the present invention may be maintained as DNA in any convenient cloning vector.
- clones are maintained in plasmid - 15 - cloning/expression vector, such as pGEM-T (Promega Biotech, Madison, WI) or pBluescript (Stratagene, La Jolla, CA) , either of which is propagated in a suitable E. coli host cell.
- AVR1 -C039 nucleic acid molecules of the invention include cDNA, genomic DNA, RNA, and fragments thereof which may be single- or double-stranded.
- this invention provides oligonucleotides (sense or antisense strands of DNA or RNA) having sequences capable of hybridizing with at least one sequence of a nucleic acid molecule of the present invention, such as selected segments of the cDNA having Sequence I.D. No. 1.
- Such oligonucleotides are useful as probes for detecting AVR1 - C039 genes or mRNA in test samples of fungal isolates, e.g. by PCR amplification, or for the positive or negative regulation of expression of AVR1 -C039 genes at or before translation of the mRNA into proteins.
- AVR1 -C039 genomic isolate described herein contains four open reading frames (ORF's 1-4), whose deduced amino acid sequences are set forth herein as Sequence I.D. No's. 2-5, respectively. Any one of these polypeptides may be prepared in a variety of ways, according to known methods. If produced in si tu the polypeptides may be purified from appropriate sources, e.g., fungal isolates.
- nucleic acid molecules encoding the polypeptides enables production of the proteins using in vi tro expression methods known in the art.
- a cDNA or gene may be cloned into an appropriate in vi tro transcription vector, such a pSP64 or pSP65 for in vi tro transcription, followed by cell-free translation in a suitable cell-free translation - 16 - system, such as wheat germ or rabbit reticulocytes .
- a suitable cell-free translation - 16 - system such as wheat germ or rabbit reticulocytes .
- vi tro transcription and translation systems are commercially available, e.g., from Promega Biotech, Madison, Wisconsin or BRL, Rockville, Maryland.
- larger quantities of A VR1 -C039-encoded polypeptides may be produced by expression in a suitable procaryotic or eucaryotic system.
- a DNA molecule such as the cDNA having Sequence I.D. No. 1
- a plasmid vector adapted for expression in a bacterial cell (such as E. coli ) or a yeast cell (such as Saccharomyces cerevisiae) , or into a baculovirus vector for expression in an insect cell .
- Such vectors comprise the regulatory elements necessary for expression of the DNA in the host cell, positioned in such a manner as to permit expression of the DNA in the host cell .
- Such regulatory elements required for expression include promoter sequences, transcription initiation sequences and, optionally, enhancer sequences.
- the AVR1-C039 polypeptide (s) produced by gene expression in a recombinant procaryotic or eucyarotic system may be purified according to methods known in the art.
- a commercially available expression/secretion system can be used, whereby the recombinant protein is expressed and thereafter secreted from the host cell, to be easily purified from the surrounding medium.
- an alternative approach involves purifying the recombinant protein by affinity separation, such as by immunological interaction with antibodies that bind specifically to the recombinant protein. Such methods are commonly used by skilled practitioners.
- the A VR1 -C039-encoded polypeptides of the invention may be analyzed according to standard procedures. Methods for - 17 - analyzing the functional activity, i.e. ability to confer avirulence, are described in Example 1.
- the present invention also provides antibodies capable of immunospecifically binding to polypeptides of the invention.
- Polyclonal or monoclonal antibodies directed toward any of the peptides encoded by the ORFs of AVR1 -C039 may be prepared according to standard methods.
- Monoclonal antibodies may be prepared according to general methods of K ⁇ hler and Milstein, following standard protocols.
- antibodies are prepared, which react immunospecifically with various epitopes of the A VR1 -C039-encoded polypeptides .
- Polyclonal or monoclonal antibodies that immunospecifically interact with one or more of the polypeptides encoded by AVR1 -C039 can be utilized for identifying and purifying such proteins.
- antibodies may be utilized for affinity separation of proteins with which they immunospecifically interact .
- Antibodies may also be used to immunoprecipitate proteins from a sample containing a mixture of proteins and other biological molecules. Other uses of the antibodies are described below.
- the potential of recombinant genetic engineering methods to enhance disease resistance in agronomically important plants has received considerable attention in recent years. Protocols are currently available for the stable introduction of genes into plants, as well as for augmentation of gene expression.
- the present invention provides nucleic acid molecules which, upon stable introduction into a recipient plant, or into an epiphytic microorganism, can enhance the - 18 - plant's ability to resist pathogen attack.
- AVR1 -C039- encoded proteins of the invention may also be applied directly to a plant, to induce a disease defense response .
- AVR1 -C039 nucleic acids may be used for a variety of purposes in accordance with the present invention.
- the DNA, RNA, or fragments thereof may be used as probes to detect the presence of and/or expression of AVR1 -C039 genes.
- Methods in which AVR1 -C039 nucleic acids may be utilized as probes for such assays include, but are not limited to: (1) in si tu hybridization; (2) Southern hybridization (3) northern hybridization; and (4) assorted amplification reactions such as polymerase chain reactions (PCR) .
- PCR polymerase chain reactions
- AVR1 -C039 nucleic acids of the invention may also be utilized as probes to identify homologs from other Magnaporthe isolates. As described above, AVR1 -C039 nucleic acids are also used to advantage to produce large quantities of substantially pure AVR1- C039 proteins, or selected portions thereof.
- the AVR1 - C039 coding region is operably linked to a heterologous promoter, preferably one that is either generally pathogen inducible (i.e. inducible upon challenge by a broad range of pathogens) or wound inducible.
- promoters include, but are not limited to: a) promoters of genes encoding lipoxygenases - 19 -
- promoters of genes encoding glutathione-S- transferase preferably from plants, most preferably from rice, or alternatively, the PRP1 promoter from potato
- promoters from pollen-specific genes such as corn Zmgl3 , which has been show to be expressed in rice transgenic pollen carrying the corn gene
- promoters from genes encoding chitinases preferably from plants, most preferably from rice; e.g., Zhu S Lamb, Mol. Gen. Genet. 226: 289-296, 1991; h) promoters from genes induced early (within 5 hours post-inoculation) in the interaction of M.
- gri sea and rice e.g., Bhargava & Hamer; Abstract B-10, 8th International Congress Molecular Plant Microbe Interactions, Knoxville, TN July 14-19, 1996) ; - 2 0 - i) promoters from plant (preferably rice) viral genes, either contained on a bacterial plasmid or on a plant viral vector, as described by Hammond-Kosack et al . , Mol. Plant-Microbe Interactions 8 . : 181-185 (1994); j ) promoters from genes involved in the plant
- the chimeric gene is then used to transform rice cultivars that already carry the appropriate R gene. Upon wounding or challenge with a plant pathogen, the resulting transgenic plants would be induced to produce the AVR1 -C039 gene product, thereby triggering the R gene defense response. In this embodiment, care must be taken to avoid using a promoter that is induced by necrosis, since use of such a promoter could result in a self- perpetuating hypersensitive response that may be lethal to the plant (see, e.g., Kim et al . , Proc. Natl. Acad. Sci. USA . 91: 10445-10449, 1994) .
- a coding region of AVR1 -C039 (preferably the coding region corresponding to
- 0RF3 is inserted into an expression vector in a microorganism that grows epiphytically on rice plants.
- a suspension of such recombinant microorganisms is sprayed on rice cultivars carrying the appropriate R gene.
- pathogen attack two levels of protection can occur: (1) the gene product produced by the recombinant epiphytes triggers an interaction on the plant surface that prevents further penetration by the pathogen (e.g., the fungal conidia develop appresoria, but do not develop penetration pegs) ; or (2) the gene product produced by - 21 - the recombinant epiphytes is carried into the plant tissue at the wound site, where it interacts with the corresponding R gene product and induces an internal disease defense response.
- this pre-treatment confers resistance to Maganporthe isolates (and, presumably, other plant pathogens) which normally are virulent on those cultivars. This embodiment is described in greater detail in Example 3.
- bacterial and phage expression and delivery systems such as those commercially available from InVitrogen, will be particularly useful .
- the bacterial system expresses a protein hybrid with pilin, such that the foreign protein is exposed on the exterior of the bacterium.
- the phage system also expresses a hybrid protein with coat component and exterior exposure of the foreign protein.
- the AVR1 -C039 gene also may be used as a tool to identify and isolate its corresponding R gene.
- the R gene in rice that corresponds to AVR1 -C039 can be isolated by transposon tagging: (1) AVR1 -C039 is transformed into, and constitutively expressed in a susceptible rice line; (2) the transgenic line is crossed with a resistant line that carries an identifiable transposon; (2) seedlings of FI progeny constitutively expressing both the Avr gene and the corresponding R gene should die, thereby enabling a simple screening for live FI progeny; (4) any live FI progeny should be surviving by virtue of interruption of either the AVR1 -C039 transgene or the corresponding R gene, presumably by the transposon.
- the transposon, along with the gene it has interrupted, can thus be isolated. - 22 -
- Purified gene products of AVR1 -C039 may be used to produce polyclonal or monoclonal antibodies, which also may serve as sensitive detection reagents for the presence and accumulation of AVR1-C039 polypeptides in transformed microbial epiphytes, transgenic plants, or other biological materials.
- Polyclonal or monoclonal antibodies immunologically specific for AVR1-C039 polypeptides may be used in a variety of assays designed to detect and quantitate the proteins. Such assays include, but are not limited to: (1) flow cytometric analysis; (2) immunochemical localization of expressed proteins in cells or tissues; and (3) immunoblot analysis (e.g., dot blot, Western blot) of extracts from various cells and tissues.
- antibodies can be used for purification of AVR1-C039 polypeptides (e.g., affinity column purification, immunoprecipitation) .
- purified AVR1-C039 polypeptides are used as a pre-treatment or co-treatment to confer broad- spectrum pathogen resistance to rice cultivars carrying the C039 R gene.
- a chromosomal segment putatively containing the cultivar specificity gene, AVR1 -C039 was isolated from M. gri sea strain 2539 using a map-based cloning approach, followed by chromosome walking (Leong et al . , 1996) .
- chromosome walking Leong et al . , 1996) .
- this example we describe the identification, cloning and analysis of the AVR1 -C039 gene.
- Hybridization protocol Hybridization methods were modified from Amasino (1986) "Acceleration of Nucleic Acid Hybridization Rate by Polyethylene Glycol", Analytical Biochemistry 152:304-307.
- the hybridization buffer was prepared according the Amasino protocol, but without the PEG and NaCl and with reduced concentrations of NaHP04 : 0.125M NaHP04 , 7% SDS, 50% formamide, 1.0 mM EDTA, pH 7.2. High stringency conditions were used (42 °C, 16 h) .
- Post hybridization washes were: one rinse with 2XSSC at room temperature; one wash in 2XSSC for 10 min at 65 °C; one wash in 2XSSC, 15 min at 65 °C; one final wash in 0.1 X SSC, 0.1% SDS for 15 min at 65 °C.
- the final washing conditions were of greater stringency than were the hybridization conditions, giving a T m of 68. Thus, greater than 95% homology would be required to maintain a hybrid. None of the post hybridization phosphate-containing buffers described in Amasino (1986) were employed.
- Chromosome walking strategy A total genomic DNA library of M. grisea strain 2539 consisting of 5,194 - 24 - clones was constructed in cosmid vector pMLFl (Leong et al., 1994, supra) and pMLF2 (An et al . , Gene 176: 93-96, 1996) . Clones were templated individually as colony blots as well as in pools in which the DNA was restriction digested, electrophoresed and blotted. The latter blots were used initially to identify candidate pools containing hybridizing clones. Colony blots derived from these pools were then screened.
- Steps were performed using endclones prepared from the insert DNA by digesting the cosmid clones with Apal , which does not digest the vector, and recircularizing the plasmid by ligation. This procedure results in a derivative containing DNA from each end of the insert (An et al . , 1996 supra) . Liberation of both ends of the insert from the vector was achieved by digesting with Apal and NotI . The required endclone was then identified by virtue of its inability to hybridize with the previous cosmid in the walk.
- Transformation of virulent strain Guyll with cosmids within the AVR1 -C039 locus Cosmids from within the genetic interval containing AVR1 -C039 were introduced into Guyll using the transformation protocol described in LEUNG et al . (1990) . The procedure was modified as follows: After the protoplasts were incubated in complete medium (CM) ⁇ sorbitol , they were poured into 100 ml molten (45°C) CM+20% sucrose agar . The agar was then poured into four petri plates . When the agar had solidified (1 h) it was overlaid with 15 ml of 1.5% water agar containing 800 ⁇ g/ml hygromycin B (300 ⁇ g/ l final concentration) .
- CM complete medium
- hygromycin B 300 ⁇ g/ l final concentration
- the nucleotide sequence change was from 5 CCAGCAGCCAATGCTTGGAAAGATTG 3' (SEQ ID NO: 11) to 5' CCAGCAGCCAAAGCTTTGGAAAGATTG 3' (SEQ ID NO: 12).
- the peptide retains only 19 aa of its original sequence and is truncated after 36 aa .
- the native ORF2 peptide is 77 aa .
- the 0RF2 peptide sequence is almost unchanged except for the terminal 10 aa and the resulting peptide is 17 aa longer.
- ORF3 retains only 20 aa from its N-terminal and terminates after 31 aa .
- ATG mutations in open reading frames at the AVR1 -C039 gene locus The 1.05 kb fragment containing AVR1 -C039 was cloned into pCB1004 and Quickchange mutagenesis (Stratagene) was used to make the following mutant constructs:
- a gene conferring cultivar- specific interactions with rice cultivar C039 was isolated from M. grisea strain 2539 using a map-based cloning approach, followed by a 20-step chromosome walk.
- the AVR1 -C039 locus was delimited to a 1.05 kb region by subcloning and transformation of Guyll, a strain normally virulent on C039, to avirulence.
- the nucleotide sequence of this 1.05 kb region of Chromosome 1 is set forth below - 27 - as SEQ ID NO : 1 :
- ORF6- -ORF4 TTAATGAGGC CTGCCATCCC TACCCAGTTA TACTTCCCGA CAGATCGGTC T3
- DNA sequence analysis revealed four small open reading frames of 45, 77, 89 and 69 amino acids in length (ORFl, 0RF2, 0RF3, 0RF4 , respectively, as shown on SEQ ID No. 1 above) .
- the amino acid sequences encoded by the four open reading frames are set forth below as Sequence ID No's. 2, 3, 4 and 5, respectively.
- Three other open reading frames were also identified (ORFS 5, 6, and 7, set forth below as SEQ ID NOS : 6, 7 and 8, respectively.
- AVR1-C039 ORFl (SEQ ID NO: 2)
- AVR1-C039 ORF2 (SEQ ID NO: 3) MGPVFSLLWT TQFFANARQS TSLPPFLLFK NLLLAATETS
- AVR1-C039 ORF3 (SEQ ID NO: 4)
- AVR1-C039 ORF4 (SEQ ID NO: 5)
- AVR1-C039 ORF5 (SEQ ID NO: 6)
- AVR1-C039 ORF6 (SEQ ID NO: 7)
- AVR1-C039 ORF7 (SEQ ID NO: 8) - 29 -
- the sequence surrounding the ATG of 0RF3 matched four out of five of the conserved bases found in fungal translation start sites and contained a hydrophobic amino terminus punctuated by a lysine in position 2, and two putative cleavage sites for removal of the signal peptide.
- a fourth open reading frame (0RF4) was identified on the opposite strand. However, the sequence surrounding that ATG contained only two matches with the fungal translation start site consensus sequence .
- AVR1 -C039 homologs were investigated by probing a large sample of host-specific forms of M. grisea with a segment of AVR1 -C039 DNA, using hybridization conditions such as those described in Example 1. The results of this survey indicate that isolates infecting rice, Digi taria and wheat largely lack homologs of Avr-C039. However, homologs of the gene were commonly found in Elutine (Setaria) -infecting isolates. Moreover, a detailed analysis of the AVR1 -C039 locus from virulent rice isolate Guy 11 indicated that at least 20 Kb of DNA corresponding to and containing the AVR1 -C039 locus of isolate 2539 was absent.
- the ORF3 of AVR1 -C039 described in Example 1 was transferred into a pET expression vector in Escherichia coli .
- a suspension containing the transformed E. coli was sprayed onto leaves of rice plants carrying the corresponding R gene for AVR1 -C039.
- the plants were then inoculated with M. grisea isolate Guy 11, which is a virulent strain on the plant cultivars tested.
- As a control plants were sprayed with an E. coli suspension which did not contain the ORF-3 encoding plasmid, then inoculated with isolate Guy 11.
- Inoculated plants pre-treated with the ORF3- expressing E. coli displayed reduced lesion size and number as compared to inoculated control plants pre- - 3 1 - treated with E. coli lacking the ORF3 -expressing plasmid. These data support the role of 0RF3 in conferring avirulence in M. grisea .
- ORF 3 of AVR1 -C039 The ORF3 of AVR1 -C039 described in Example 1 was transferred into a pET expression vector in Escherichia coli . Protein extracts from IPTG-induced E. coli cells carrying either the pET vector alone (control) or the pET-ORF3 construct were tested for their effects on virulence. The cellular protein extracts were concentrated by ammonium sulfate precipitation. Cultivar C039 was inoculated with virulent M. gri sea strain Guyll in combination with the concentrated protein extract to give 5 x 10 5 conidia and 20 mg total protein extract in 10 ml sterile water.
- Inoculated plants co-treated with the ORF3- containing protein extract displayed reduced lesion size and number as compared to inoculated control plants co- treated with protein extract lacking ORF3. These data further support the role of ORF3 in conferring avirulence in M. grisea .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Pretreatment Of Seeds And Plants (AREA)
Abstract
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU33105/99A AU3310599A (en) | 1998-02-25 | 1999-02-25 | Cultivar specificity gene from the rice pathogen (magnaporthe grisea), and methods of use |
KR1020007009375A KR20010041277A (ko) | 1998-02-25 | 1999-02-25 | 벼 병원균 마그나포르테 그리시아로부터의 품종 특이성유전자 및 이들을 이용하는 방법 |
CA002321950A CA2321950A1 (fr) | 1998-02-25 | 1999-02-25 | Gene de specificite de cultivar provenant du pathogene de riz magnaporthe grisea, et procedes d'utilisation |
IL13788199A IL137881A0 (en) | 1998-02-25 | 1999-02-25 | Cultivar specificity gene from the rice pathogen magnaporthe grisea, and methods of use |
EP99936094A EP1056866A1 (fr) | 1998-02-25 | 1999-02-25 | GENE DE SPECIFICITE DE CULTIVAR PROVENANT DU PATHOGENE DE RIZ $i(MAGNAPORTHE GRISEA), ET PROCEDES D'UTILISATION |
JP2000533563A JP2002504373A (ja) | 1998-02-25 | 1999-02-25 | イネ病原菌マグナポルテ・グリシー由来の栽培変種特異性遺伝子および使用法 |
NO20004239A NO20004239L (no) | 1998-02-25 | 2000-08-24 | Dyrkbart spesifisitetsgen fra Magnaporthe Grisea, og metoder for anvendelse |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US7592598P | 1998-02-25 | 1998-02-25 | |
US60/075,925 | 1998-02-25 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1999043824A1 true WO1999043824A1 (fr) | 1999-09-02 |
Family
ID=22128797
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1999/004047 WO1999043824A1 (fr) | 1998-02-25 | 1999-02-25 | Gene de specificite de cultivar provenant du pathogene de riz magnaporthe grisea, et procedes d'utilisation |
Country Status (10)
Country | Link |
---|---|
EP (1) | EP1056866A1 (fr) |
JP (1) | JP2002504373A (fr) |
KR (1) | KR20010041277A (fr) |
CN (1) | CN1308678A (fr) |
AU (1) | AU3310599A (fr) |
CA (1) | CA2321950A1 (fr) |
ID (1) | ID27274A (fr) |
IL (1) | IL137881A0 (fr) |
NO (1) | NO20004239L (fr) |
WO (1) | WO1999043824A1 (fr) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002034927A2 (fr) * | 2000-10-20 | 2002-05-02 | Wisconsin Alumni Research Foundation | Phytogenes conferant une resistance aux souches de magnaporthe grisea contenant le gene de specificite cultivar avr1 co39 |
CN100398556C (zh) * | 2006-03-16 | 2008-07-02 | 华南农业大学 | 水稻稻瘟病菌无毒基因Avr-Pii及其应用 |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101112656B1 (ko) * | 2009-04-07 | 2012-03-14 | 서울대학교산학협력단 | 기주의 1차 방어 반응을 억제하는 도열병 진균 유래의 신규 병원성 유전자 및 그 용도 |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1991015585A1 (fr) * | 1990-04-02 | 1991-10-17 | Rijkslandbouwuniversiteit Wageningen | Procede de protection des plantes contre les pathogenes |
WO1995031564A2 (fr) * | 1994-05-11 | 1995-11-23 | John Innes Centre Innovations Limited | Procede d'introduction d'une resistance aux agents pathogenes chez les vegetaux |
WO1996036697A1 (fr) * | 1995-05-18 | 1996-11-21 | Board Of Trustees Of The University Of Kentucky | Sequences et procedes de regulation de la transcription |
WO1996039802A1 (fr) * | 1995-06-07 | 1996-12-19 | Cornell Research Foundation, Inc. | Resistance chez les plantes induite par une reponse hypersensible |
WO1997035980A1 (fr) * | 1996-03-25 | 1997-10-02 | University Of Florida | Anticorps diriges contre les proteines d'avirulence ou de pathogenicite des agents pathogenes des vegetaux |
-
1999
- 1999-02-25 AU AU33105/99A patent/AU3310599A/en not_active Abandoned
- 1999-02-25 CA CA002321950A patent/CA2321950A1/fr not_active Abandoned
- 1999-02-25 IL IL13788199A patent/IL137881A0/xx unknown
- 1999-02-25 KR KR1020007009375A patent/KR20010041277A/ko not_active Application Discontinuation
- 1999-02-25 JP JP2000533563A patent/JP2002504373A/ja active Pending
- 1999-02-25 ID IDW20001623A patent/ID27274A/id unknown
- 1999-02-25 EP EP99936094A patent/EP1056866A1/fr not_active Withdrawn
- 1999-02-25 CN CN99805473A patent/CN1308678A/zh active Pending
- 1999-02-25 WO PCT/US1999/004047 patent/WO1999043824A1/fr not_active Application Discontinuation
-
2000
- 2000-08-24 NO NO20004239A patent/NO20004239L/no not_active Application Discontinuation
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1991015585A1 (fr) * | 1990-04-02 | 1991-10-17 | Rijkslandbouwuniversiteit Wageningen | Procede de protection des plantes contre les pathogenes |
WO1995031564A2 (fr) * | 1994-05-11 | 1995-11-23 | John Innes Centre Innovations Limited | Procede d'introduction d'une resistance aux agents pathogenes chez les vegetaux |
WO1996036697A1 (fr) * | 1995-05-18 | 1996-11-21 | Board Of Trustees Of The University Of Kentucky | Sequences et procedes de regulation de la transcription |
WO1996039802A1 (fr) * | 1995-06-07 | 1996-12-19 | Cornell Research Foundation, Inc. | Resistance chez les plantes induite par une reponse hypersensible |
WO1997035980A1 (fr) * | 1996-03-25 | 1997-10-02 | University Of Florida | Anticorps diriges contre les proteines d'avirulence ou de pathogenicite des agents pathogenes des vegetaux |
Non-Patent Citations (5)
Title |
---|
FARMAN, M.L., ET AL.: "Chromosome walking to the AVR1-CO39 avirulence gene of Magnaporthe grisea: discrepancy between the physical and genetic maps", GENETICS, vol. 150, no. 3, November 1998 (1998-11-01), pages 1049 - 1058, XP002107757 * |
LIEW, C.C., ET AL.: "K5827F fetal heart, lambda ZAP express Homo sapiens cDNA clone K5827 5' similar to EST (EST07299)", EMBL ACCESSION NO. N88845, 25 July 1996 (1996-07-25), XP002107756 * |
SMITH, J.R., ET AL.: "Mapping of a Magnaporthe grisea locus affecting rice (Oryza sativa) cultivar specificity", THEOR APPL GENET, vol. 88, 1994, pages 901 - 908, XP002107755 * |
SWEIGARD J A ET AL: "Identification, cloning, and characterization of PWL2, a gene for host species specificity in the rice blast fungus", PLANT CELL, vol. 7, 1 August 1995 (1995-08-01), pages 1221 - 1233, XP002091581, ISSN: 1040-4651 * |
VALENT, B., ET AL.: "Magnaporthe grisea genes for pathogenicity and virulence identified through a series of backcrosses", GENETICS, vol. 127, 1991, pages 87 - 101, XP002107758 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002034927A2 (fr) * | 2000-10-20 | 2002-05-02 | Wisconsin Alumni Research Foundation | Phytogenes conferant une resistance aux souches de magnaporthe grisea contenant le gene de specificite cultivar avr1 co39 |
WO2002034927A3 (fr) * | 2000-10-20 | 2003-01-23 | Wisconsin Alumni Res Found | Phytogenes conferant une resistance aux souches de magnaporthe grisea contenant le gene de specificite cultivar avr1 co39 |
CN100398556C (zh) * | 2006-03-16 | 2008-07-02 | 华南农业大学 | 水稻稻瘟病菌无毒基因Avr-Pii及其应用 |
Also Published As
Publication number | Publication date |
---|---|
AU3310599A (en) | 1999-09-15 |
EP1056866A1 (fr) | 2000-12-06 |
ID27274A (id) | 2001-03-22 |
NO20004239D0 (no) | 2000-08-24 |
CA2321950A1 (fr) | 1999-09-02 |
NO20004239L (no) | 2000-10-19 |
KR20010041277A (ko) | 2001-05-15 |
JP2002504373A (ja) | 2002-02-12 |
CN1308678A (zh) | 2001-08-15 |
IL137881A0 (en) | 2001-10-31 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Fudal et al. | Heterochromatin-like regions as ecological niches for avirulence genes in the Leptosphaeria maculans genome: map-based cloning of AvrLm6 | |
Hahn et al. | Cultivar-specific elicitation of barley defense reactions by the phytotoxic peptide NIP1 from Rhynchosporium secalis | |
Görlach et al. | Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. | |
Sacks et al. | Molecular characterization of nucleotide sequences encoding the extracellular glycoprotein elicitor from Phytophthora megasperma | |
WO1998013486A1 (fr) | Nouveaux genes associes a une resistance accrue aux maladies chez les plantes | |
CN101292037A (zh) | 自激活抗性蛋白 | |
US6653533B1 (en) | Nucleic acids encoding proteins with pathogen resistance activity and plants transformed therewith | |
US6479731B1 (en) | Pi-ta gene conferring fungal disease resistance to plants | |
US20040083501A1 (en) | Plant genes that confer resistance to strains of Magnaporthe grisea having AVR CO39 cultivar specificity gene | |
WO1997047183A9 (fr) | Genes renforçant la resistance de vegetaux aux maladies | |
Liu et al. | Molecular Cloning and Analysis of Abundant and Stage-Specific mRNAs for Puccinia graminis | |
Chen et al. | cDNA cloning and characterization of a plant protein that may be associated with the harpinPSS-mediated hypersensitive response | |
US6794176B1 (en) | Cultivar specificity gene from the rice pathogen Magnaporthe grisea, and methods of use | |
WO1999043824A1 (fr) | Gene de specificite de cultivar provenant du pathogene de riz magnaporthe grisea, et procedes d'utilisation | |
US20030084477A1 (en) | Genes enhancing disease resistance in plants | |
JP2000342262A (ja) | 耐病性遺伝子 | |
Knogge et al. | Molecular identification and characterization of the nip1 gene, an avirulence gene from the barley pathogen Rhynchosporium secalis | |
CN108277229B (zh) | 一种水稻稻粒黑粉病菌effector基因Smut_5844及其应用 | |
Farman | Leong et al. | |
MXPA00008302A (en) | Cultivar specificity gene from the rice pathogen magnaporthe grisea | |
US6225532B1 (en) | Tomato CF-5 gene encoding a disease resistance polypeptide | |
US20030192075A1 (en) | Elicitor from cladosporium | |
US6287865B1 (en) | Cf-2 plant pathogen resistance genes | |
US7256323B1 (en) | RPSk-1 gene family, nucleotide sequences and uses thereof | |
AU709028B2 (en) | Plant pathogen resistance genes and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 99805473.9 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 33105/99 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1999936094 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 137881 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: IN/PCT/2000/00307/MU Country of ref document: IN |
|
ENP | Entry into the national phase |
Ref document number: 2321950 Country of ref document: CA Ref document number: 2321950 Country of ref document: CA Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2000/008302 Country of ref document: MX Ref document number: 1020007009375 Country of ref document: KR |
|
ENP | Entry into the national phase |
Ref document number: 2000 533563 Country of ref document: JP Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1200000753 Country of ref document: VN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 507090 Country of ref document: NZ |
|
WWP | Wipo information: published in national office |
Ref document number: 1999936094 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1020007009375 Country of ref document: KR |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1999936094 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1020007009375 Country of ref document: KR |