WO1999043812A2 - Dlc-1 gene, a putative tumors suppressor gene - Google Patents

Dlc-1 gene, a putative tumors suppressor gene Download PDF

Info

Publication number
WO1999043812A2
WO1999043812A2 PCT/US1999/004164 US9904164W WO9943812A2 WO 1999043812 A2 WO1999043812 A2 WO 1999043812A2 US 9904164 W US9904164 W US 9904164W WO 9943812 A2 WO9943812 A2 WO 9943812A2
Authority
WO
WIPO (PCT)
Prior art keywords
dlc
gene
protein
dna
sequence
Prior art date
Application number
PCT/US1999/004164
Other languages
French (fr)
Other versions
WO1999043812A3 (en
Inventor
Bao-Zhu Yuan
Nicholas C. Popescu
Snorri S. Thorgeirsson
Original Assignee
The United States Of America, Represented By The Secretary, Department Of Health & Human Services, National Institutes Of Health
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The United States Of America, Represented By The Secretary, Department Of Health & Human Services, National Institutes Of Health filed Critical The United States Of America, Represented By The Secretary, Department Of Health & Human Services, National Institutes Of Health
Priority to AU28791/99A priority Critical patent/AU2879199A/en
Publication of WO1999043812A2 publication Critical patent/WO1999043812A2/en
Publication of WO1999043812A3 publication Critical patent/WO1999043812A3/en
Priority to US10/995,914 priority patent/US7534565B2/en
Priority to US12/239,581 priority patent/US20090239220A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention relates to the cloning and sequencing of the human cDNA molecule corresponding to a newly discovered gene, called DLC-1 , which is frequently deleted in liver, breast and colon cancer cells. In addition, lower DLC-1 expression is frequently observed in liver, colon, and prostate cancer cells, compared to normal tissue.
  • the present invention also relates to methods for screening and diagnosis of a genetic predisposition to liver cancer and other cancer types, and methods of gene therapy utilizing recombinant DNA technologies.
  • the present invention discloses the discovery of new human gene involved in the pathogenesis of hepatocellular cancer (HCC), the most common primary liver cancer, and one of the most common cancers in the world, with 251,000 new cases reported each year.
  • HCC hepatocellular cancer
  • the present invention discloses the isolation of the full length cDNA and the chromosomal localization of a new gene which is frequently deleted in liver cancer, and hence is named the DLC-1 gene.
  • the full-length cDNA for DLC-1 is 3850 bp long (Seq. I.D. No. 1), encodes a protein of 1091 amino acids (Seq. I.D. No. 2), and was localized by fluorescence in situ hybridization to chromosome 8 at bands p21.3-22. Because the DLC-1 gene is deleted from a significant percentage of primary HCC tumor cells and cell lines, primary breast cancers (BC), and colorectal cancer (CRC) cell lines, and its expression is decreased or not observed in a significant percentage of HCC cell lines, CRC cell lines and prostate cancer (PC) cell lines, the DLC-1 gene appears to operate as a tumor suppressor in liver cancer and other cancers including PC, CRC and BC.
  • the object of identifying the hitherto unknown DLC-1 gene has been achieved by providing an isolated human cDNA molecule which is able specifically to correct the cellular defects characteristic of cells from patients with a deleted or mutated DLC-1 gene.
  • the invention provides, for the first time, an isolated cDNA molecule which, when transfected into cells derived from a patient with a deleted or mutated DLC-1 gene, can produce the DLC-1 protein believed to be active in suppressing HCC pathogenesis and other cancers, such as breast, colorectal, and prostate cancers.
  • the invention encompasses the DLC-1 cDNA molecule (derived from normal human liver cells), the nucleotide sequence of this cDNA, and the putative amino acid sequence of the DLC-1 protein encoded by this cDNA. Having herein provided the nucleotide sequence of the DLC-1 cDNA, correspondingly provided are the complementary DNA strands of the cDNA molecule and DNA molecules which hybridize under stringent conditions to the DLC- 1 cDNA molecule or its complementary strand. Such hybridizing molecules include DNA molecules differing only by minor sequence changes, including nucleotide substitutions, deletions and additions.
  • isolated oligonucleotides comprising at least a segment of the cDNA molecule or its complementary strand, such as oligonucleotides which may be employed as effective DNA hybridization probes or primers useful in the polymerase chain reaction or as hybridization probes.
  • Such probes and primers are particularly useful in the screening and diagnosis of persons genetically predisposed to HCC, and other cancers, as the result of DLC-1 gene deletions.
  • Hybridizing DNA molecules and variants on the DLC-1 cDNA may readily be created by standard molecular biology techniques.
  • variants of the DLC- 1 protein may be made which differ in precise amino acid sequence from the disclosed protein yet which maintain the essential characteristics of the DLC- 1 protein or which are selected to differ in one or more characteristics from this protein
  • variants are another aspect of the present invention
  • recombinant DNA vectors comprising the disclosed DNA molecules, and transgenic host cells containing such recombinant vectors
  • the genomic sequence for the gene was determined according to the following method A human genomic library constructed using the PI vector, pADl OSacBII, was transferred from its original E coli host into a second E colt host, strain N3516 following procedures well-known in the art A positive PI clone containing the DLC- 1 gene was then obtained by performing a protocol of PCR-based PI library screening (Sheperd, Proc Natl Acad Sci USA 91 2629-33, 1994, Neuhausen, Hum Mol Genet 3 1919-26, 1994) The PCR primers used in this screening designed from a genomic fragment isolated through Representational Difference Analysis (described more fully below), are listed below PL7-3F 5' GACACCACCATCTCTGTGCTC 3' (Seq I D No 7)
  • An embodiment of the present invention is a method for screening a subject to determine if the subject carries a mutant DLC-1 gene, or if the gene has been partially or completely deleted, as is thought to occur in many HCC cases
  • the method comprises the steps of providing a biological sample obtained from the subject, which sample includes DNA or RNA, and providing an assay for detecting in the biological sample the presence of a mutant DLC-1 gene, a mutant DLC-1 RNA, or the absence, through deletion, of the DLC-1 gene and corresponding RNA
  • the foregoing assay may be assembled in the form of a diagnostic kit and preferably comprises either hybridization with oligonucleotides, PCR amplification of the DLC-1 gene or a part thereof using oligonucleotide primers, RT-PCR amplification of the DLC- 1 RNA or a part thereof using oligonucleotide primers, or direct sequencing of the DLC-1 gene of the subject's genome using oligonucleotide primers
  • the efficiency of these molecular genetic methods should permit a rapid classification of patients affected by deletions or mutations of the DLC- 1 gene
  • a further aspect of the present invention is a method for screening a subject to assay for the presence of a mutant or deleted DLC- 1 gene, comprising the steps of providing a biological sample of the subject which sample contains cellular proteins, and providing an immunoassay for quantitating the level of DLC-1 protein in the biological sample Diagnostic methods for the detection of mutant or deleted DLC-1 genes made possible by this invention will provide an enhanced ability
  • Another aspect of the present invention is an antibody preparation comprising antibodies that specifically detect the DLC- 1 protein, wherein the antibodies are selected from the group consisting of monoclonal antibodies and polyclonal antibodies
  • FIG 1 is a digital image of a Southern blot which compares primary HCC tumor cells (T) with healthy normal liver cells (N), and demonstrates a genomic deletion of the L7-3 clone in the HCC cells
  • Primary tumors 94-25T, 95-03T and 95-06T showed 50% decrease of DNA intensity as compared with normal liver tissues
  • FIG 2 is a digital image of a Southern blot which compares representative HCC cell lines with healthy liver cells (NL-DNA), and demonstrates a genomic deletion of the L7-3 clone in 9 of 1 1 HCC cell lines Cell lines Sk-Hep-1, PLC/PRF/5, WRL, Focus, HLF, Hep3B, Huh-7, Huh-6, Chang showed reduction of DNA intensity compared with human normal liver genomic DNA
  • FIG 3 is a digital image of a Southern blot which compares representative primary human breast cancers (T) with healthy normal blood cells (N) from the same patient, and demonstrates a genomic deletion of the DLC- 1 gene in 7 of 15 primary breast cancers
  • a representative 10 of the 15 primary tumors are shown DNA was digested with either (a) Bglll or (b) BamHI Cell lines IC 1 1 T, IC 12T, IC 13T, IC2T, IC6T, and IC7T showed reduction of DNA intensity compared with normal DNA
  • FIG 4 is a digital image of a Southern blot which compares representative human colon cancer cell lines with normal DNA (lane 1 ), and demonstrates a genomic deletion of the DLC- 1 gene in two out of five colon cancer cell lines Cell lines SW1 1 16 and SW403 (lanes 5 and 6) showed reduction of DNA intensity compared with normal DNA (lane 1)
  • FIG 5 is a digital image of a Northern blot showing the mRNA expression of the DLC- 1 gene in normal human tissues
  • the DLC- 1 gene is expressed in all normal tissues tested as a 7 5 kb major transcript and a 4 5 kb minor transcript
  • FIG 6 is a digital image of a Northern blot comparing the mRNA expression of DLC-1 gene in normal human tissues (NL-RNA) and HCC cell lines DLC- 1 mRNA expression was decreased or not detected in the WRL, 7703, Chang and Focus HCC cell lines
  • FIG. 7 is a digital image of a Northern blot comparing the mRNA expression of DLC-1 gene in normal human tissues (CDD33C0) and human colon cancer cell lines. DLC-1 mRNA was expression was decreased or not detected in HCT-15, LS 147T, DLD- 1. HD29, SW1 1 16, T84, SW1417, SW403, SW948, LS180, and SW48 cell lines.
  • FIG. 8 is a digital image of a Northern blot showing the mRNA expression of DLC-1 gene in three human prostate cancer cell lines. DLC-1 mRNA was not detected in the LN-Cap and SP3504 cell lines.
  • FIG. 9 is a schematic drawing of the human DLC-1 gene. Exons 1-14 are represented by boxes, with introns represented by the lines connecting the boxes.
  • FIG. 10 is a schematic drawing of how the mouse DLC- 1 gene was targeted using homologous recombination. The resulting construct can be used to generate DLC-1 homozygous knock-out mice.
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • Seq. I.D. No. 1 is the nucleotide sequence of the human DLC-1 cDNA.
  • Seq. I.D. No. 2 is the amino acid sequence of the human DLC-1 protein.
  • Seq. I.D. Nos. 3-4 are oligonucleotide sequences of PCR primers which can be used to amplify the entire DLC-1 cDNA molecule.
  • Seq. I.D. Nos. 5-6 are oligonucleotide sequences of PCR primers which can be used to amplify the open reading frame of the DLC-1 cDNA molecule.
  • Seq. I.D. Nos. 7-8 are the oligonucleotide sequences of PCR primers used to screen a human genomic library.
  • Seq. I.D. Nos. 9- 1 1 are the oligonucleotide sequences of the primers used for 5' and 3' RACE.
  • Seq. I.D. No. 12 is the nucleotide sequence for the L7-3 probe.
  • Seq. I.D. No. 13 is the nucleotide sequence for the P-35 probe.
  • Seq. I.D. No. 14 is the nucleotide sequence for part of the human genomic DLC-1 sequence.
  • Seq. I.D. No. 15 is the nucleotide sequence for part of the human genomic DLC- 1 sequence.
  • Seq. I.D. No. 16 is the nucleotide sequence for part of the human genomic DLC- 1 sequence.
  • Seq I D No 17 is the nucleotide sequence for part of the human genomic DLC- 1 sequence
  • Seq I D No 18 is the nucleotide sequence for part of the human genomic DLC- 1 sequence
  • Seq I D No 19 is the nucleotide sequence for part of the human genomic DLC- 1 sequence
  • Seq I D No 20 is the nucleotide sequence for part of the mouse genomic DLC-1 sequence
  • Seq I D No 21 is the nucleotide sequence for part of the mouse genomic DLC-1 sequence
  • Seq I D No 22 is the nucleotide sequence for part of the mouse genomic DLC- 1 sequence
  • Seq I D No 23 is the nucleotide sequence for part of the mouse genomic DLC- 1 sequence
  • Seq I D No 24 is the nucleotide sequence for part of the mouse genomic DLC-1 sequence
  • Seq I D No 25 is the nucleotide sequence for part of the mouse genomic DLC-1 sequence
  • Seq I D No 26 is the nucleotide sequence for a cDNA fragment of the mouse DLC- 1 sequence
  • Seq I D No 27 is the nucleotide sequence for a cDNA fragment of the mouse DLC-1 sequence
  • Seq I D No 28 is the nucleotide sequence for a cDNA fragment of the mouse DLC- 1 sequence
  • Seq I D No 29 is the nucleotide sequence for a cDNA fragment of the mouse DLC-1 sequence
  • Seq I D No 30 is the nucleotide sequence for a cDNA fragment of the mouse DLC-1 sequence
  • Seq I D No 31 is the nucleotide sequence for a cDNA fragment of the mouse DLC-1 sequence
  • the present invention discloses the isolation of the full length cDNA and the chromosomal localization of a new gene, called the DLC-1 gene
  • the DLC-1 gene As discussed in Examples 1-3 below, deletion of the DLC- 1 gene has been detected in about half of the primary HCC tumor cells and in a majority of the HCC cell lines which were studied In addition, studies of other cancers revealed that DLC-1 was also deleted in 7 of 15 primary breast cancers and in 2 of 5 CRC cell lines Moreover, the DLC- 1 gene was not expressed in 29% of HCC cell lines 64% of CRC cell lines and 67% of PC cell lines These frequent deletions suggest that the DLC- 1 gene is a tumor suppressor gene for HCC as well as PC, BC and CRC
  • the full-length cDNA for DLC- 1 is 3850 bp long (Seq I D No 1 ) and encodes a protein of 1091 amino acids (Seq I D No 2) Fluorescent in situ hybridization has generally localized the gene on the short arm of chromosome 8 at bands p21 3-22
  • the rat pi 22 RhoGAP gene encodes a GTPase activating protein that catalvzes the conversion of the active GTP-bound Rho complex to an inactive GDP-bound one
  • Rho family proteins a subfamily of the Ras small GTP binding superfamily, function as important regulators in the organization of actin cytoskeleton (Nobes, et al , Cell 81 53-62, 1995) Rho proteins are also involved in Ras-mediated oncogemc transformation (Khosravi-Far, et al , Adv Cancer Res 69 59- 105, 1997) GAP genes may function as tumor suppressors by down-regulating oncogemc Rho proteins (Quil am, et al Bioessavs 17 395-404, 1995, Wang, et
  • BC Breast Carcinoma
  • DLC- 1 tumor suppressor gene cDNA complementary DNA: a piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences which determine transcription cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells
  • Colorectal Carcinoma (CRC) colorectal cancer (such as adenocarcmoma) thought to result, in some instances, from the deletion or mutation of the DLC- 1 tumor suppressor gene
  • DLC-1 gene a gene, the mutation of which is associated with hepatocellular, breast, colon and prostate carcinomas, and particularly adenocarcinomas of those organs
  • a mutation of the DLC-1 gene may include nucleotide sequence changes, additions or deletions, including deletion of large portions or all of the DLC-1 gene
  • DLC- 1 gene is understood to include the various sequence polymorphisms and allelic variations that exist within the population This term relates primarily to an isolated coding sequence, but can also include some or all of the flanking regulatory elements and/or intron sequences
  • DLC-1 cDNA a mammalian cDNA molecule which when transfected into DLC- 1 cells expresses the DLC-1 protein
  • the DLC- 1 cDNA can be derived by reverse transcription from the mRNA encoded by the DLC-1 gene and lacks internal non-coding segments and transcription regulatory sequences present in the DLC-1 gene
  • DLC-1 protein the protein encoded by the DLC-1 cDNA, the altered expression or mutation
  • Hepatocellular carcinoma liver cancer thought to result, in some instances, from the deletion or mutation of the DLC-1 tumor suppressor gene Isolated: requires that the material be removed from its original environment For example, a naturally occurring DNA molecule present in a living animal is not isolated, but the same DNA molecule, separated from some or all of the coexisting materials in the natural system, is isolated
  • Mutant DLC-1 gene a mutant form of the DLC- 1 gene which in some embodiments is associated with hepatocellular, breast, colon and/or prostate carcinoma
  • Mutant DLC-1 RNA the RNA transcribed from a mutant DLC-1 gene
  • Mutant DLC-1 protein the protein encoded by a mutant DLC-1 gene
  • Oligonucleotide A linear polynucleotide sequence of up to about 200 nucleotide bases in length, for example a polynucleotide (such as DNA or RNA) which is at least 6 nucleotides, for example at least 15, 50, 100 or even 200 nucleotides long
  • ORF open reading frame Contains a series of nucleotide triplets (codons) coding for am o acids without any termination codons These sequences are usually translatable into protein
  • PCR polymerase chain reaction Describes a technique in which cycles of denaturation, annealing with primer, and then extension with DNA polymerase are used to amplify the number of copies of a target DNA sequence
  • parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle
  • pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
  • solid compositions e g , powder, pill, tablet, or capsule forms
  • conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose starch or magnesium stearate
  • pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate
  • Nucleic acid probes and primers may readily be prepared based on the nucleic acids provided by this invention
  • a probe comprises an isolated nucleic acid attached to a detectable label or reporter molecule
  • Typical labels include radioactive isotopes, gands, chemiluminescent agents, and enzymes Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e g , in Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al (Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences, 1987)
  • Primers are short nucleic acids, for example DNA oligonucleotides 15 nucleotides or more m length Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme Primer pairs can be used for amplification of a nucleic acid sequence, e g , by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art Methods for preparing and using probes and primers are described, for example, in
  • PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0 5, ⁇ 1991 , Whitehead Institute for Biomedical Research, Cambridge, MA)
  • Prostate Carcinoma prostate cancer (such as prostatic adenocarcinoma) thought to result, in some instances, from the deletion or mutation of the DLC-1 tumor suppressor gene
  • Protein a biological molecule expressed by a gene and comprised of amino acids
  • Purified the term "purified" does not require absolute purity, rather, it is intended as a relative term
  • a purified protein preparation is one in which the protein referred to is more pure than the protein in its natural environment within a cell Recombinant
  • a recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherw ise separated segments of sequence This artificial combination is often accomplished by chemical synthesis or, more commonly by the artificial manipulation of isolated segments of nucleic acids e g , by genetic engineering techniques
  • RDA Representational Difference Analysis
  • Sequence identity the similarity between two nucleic acid sequences or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity Sequence identity is frequently measured in terms of percentage identity (or similarity or homology) the higher the percentage, the more similar are the two sequences
  • BLAST Basic Local Alignment Search Tool
  • Homologs of the DLC-1 protein are typically characterized by possession of at least 70% sequence identity counted over the full length alignment with the disclosed amino acid sequence using the NCBI Blast 2 0, gapped blastp set to default parameters
  • Such homologous peptides will more preferably possess at least 75%, more preferably at least 80% and still more preferably at least 90% or 95% sequence identity determined by this method
  • homologs will possess at least 75% and more preferably at least 85% and more preferably still at least 90% or 95% sequence identity over short windows of 10-20 amino acids
  • Methods for determining sequence identity over such short windows are described at http //www ncbi nlm nih gov/BLAST blast FAQs html
  • sequence identity ranges are provided for guidance only, it is entirely possible that strongly significant homologs or other variants could be obtained that fall outside of the ranges provided
  • the present invention provides not only the peptide homologs that are described above, but also nucleic
  • Vector A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication
  • a vector may also include one or more selectable marker genes and other genetic elements known in the art VNTR probes: Variable Number of Tandem Repeat probes These are highly polymorphic DNA markers for human chromosomes The polymorphism is due to variation in the number of tandem repeats of a short DNA sequence Use of these probes enables the DNA of an individual to be distinguished from that derived from another individual Tumor a neoplasm Neoplasm abnormal growth of cells
  • Cancer malignant neoplasm that has undergone characteristic anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and is capable of metastasis Malignant cells which have the properties of anaplasia invasion and metastasis Normal cells
  • Non-tumor, non-malignant cells Mammal This term includes both human and non-human mammals Similarly, the term "patient" includes both human and veterinary subjects
  • Animal Living multicellular vertebrate organisms a category which includes, for example, mammals and birds
  • Transgenic Cell transformed cells which contain foreign, non-native DNA Additional definitions of common terms in molecular biology may be found in Lewm,
  • HCC Samples and HCC Cell Lines All of the primary liver tumor DNAs were obtained from surgical resection of HCC tissues from patients in Qidong, China Each tumor sample was matched with its surrounding non- cancerous liver tissue DNAs were extracted after diagnosis of HCC with or without cirrhosis
  • the tumors were Hepatitis B virus (HBV) positive for HBVsAg and/or PCR detection of HB Vx gene HCC cell lines were obtained from ATCC (Manassas, VA), Qidong Liver Cancer Institute, China, and Dr Curtis C Harris (Laboratory of Human Carcmogenesis, Division of Basic Sciences, National Cancer Institute) (Wang, et al , Chin J Oncol 3 241 -4, 1981) Breast, Prostate and Colorectal Carcinomas
  • HCC One primary HCC, having a homozygous point mutation of the p53 gene, but not in its surrounding, non-cancerous liver tissue, was selected for analysis
  • RDA was performed as originally described in Lisitsyn et al (Proc Natl Acad Sci USA 92 151-5, 1995), with tumor DNA as tester and normal liver DNA as driver Bglll (Promega, Madison, WI) was chosen as the restriction enzyme and its adaptors were used for direct preparation of amphcons and PCR-based subtractive hybridization
  • the final difference products showing distinct bands in agarose gel were recovered after Bglll digestion and ligated into the Bglll site of dephosphorylated pSP72 vector (Promega)
  • the recombinant difference products were then transfected into E coli DH 1 OB
  • DNA sequencing was performed using the Dye Terminator Cycle DNA Sequencing kit (Perkm Elmer, Rockville, MD) Sequencing reaction products were purified by spin columns (Princeton Separations, Adelphia, NJ), and run on a 377 DNA Sequencer (Perkm Elmer/Applied Biosystems, Foster City, CA) The homology analysis was carried out by BLAST search of the GenBank DNA databases (Altschul, et al , J Mol Biol 215 403- 10, 1990) The RDA products that elicited significant homology or appeared in multiple clones, were selected for further Southern blot and/or Northern blot analysis
  • Genomic DNA was isolated from tumor and non-tumor cell lysates and digested with restriction enzymes The digested DNA was separated by electrophoresis in a 1% agarose gel and transferred to nylon membrane for hybridization 50 ng of DNA probe was radio-labeled (Prime-It RmT, Stratagene) as per the manufacturers instructions and used for hybridization A probe for beta- actin was used as a standard to control for the amount of DNA loaded. Hybridization was performed at 68°C for 2-4 hours using Quickhybrid solution (Stratagene). Following hybridization, the membranes were washed three times at 37°C for 10 min in 1XSSC solution containing 0.1X SDS.
  • RACE Rapid Amplification of cDNA Ends
  • PrRACE5 5' CACTCCGGTCCTTGTAGTCTGGAACC 3' (Seq. I.D. No. 9) was used for the first round of PCR for 5' RACE.
  • PrRACE5N 5' ATCCTCTTCATGAACTCGGGCACGG 3' (Seq. I.D. No. 10) was used as the nested primer in the second round of 5' RACE.
  • PrRACE3 5' GATCAAGGTTCTAGACTACAAGGACCG 3' (Seq. I.D. No. 1 1) was used for 3' RACE.
  • the final 5' RACE product exhibiting the same band pattern as the deleted fragment in Northern blot hybridization, was labeled with -[ 32 P]-dCTP to screen a 5' Strech cDNA library constructed from human lung tissue (Clontech, Inc.).
  • the lambda DNA of positive clones was converted into plasmid DNA by transfecting lambda DNA into AMI bacterial cells.
  • the full-length cDNA sequencing of positive clones was completed by primer walking and assembled by SequencherTM 3.1 program.
  • FISH Fluorescence in situ Hybridization
  • CGH Comparative Genomic Hybridization
  • a genomic probe isolated from human PI library was labeled with biotin and used for FISH chromosomal localization and CGH analysis.
  • chromosomes prepared from methotrexate-synchronized normal peripheral lymphocyte cultures were used The original CGH protocol, described in Kal oniemi et al (Science 258 818-21 , 1992), was employed with minor modifications The conditions of hx b ⁇ dization, the detection of hybridization signals, digital-image acquisition, processing and analysis, and direct fluorescent signal localization on banded chromosomes were performed as previously described in Zimonjic et al (Cancer Genet Cytogenet 80 100-2, 1995)
  • FIG 1 Seven of the fifteen primary HCC tumors (representatives are shown in FIG 1) and 9 of the 1 1 HCC cell lines (FIG 2) had a genomic deletion of the L7-3 clone compared to no deletions in the normal liver cells
  • DNA from five CRC cell lines were digested with EcoRI. and probed with a mixture of L7-3 and P- 35 (Seq I D Nos 12 and 13) which correspond to exon 2 and exon 7 of the human DLC-1 gene (see FIG 9), respectively Genomic deletions of DLC- 1 gene were detected in two of five human CRC cell lines (FIG 4) Cell lines SW403 and SW1 1 16 showed half of the DNA intensity for probe P-35 when compared with normal genomic DNA (compare lanes 5 and 6 with lane 1) Interestingly, the signal was unaltered when the L7-3 probe was used, indicating that this region (exon 2) is not responsible for the development of CRC in these cell lines Therefore, the signal from L7-3 can be used as an internal control for the amount of DNA loaded
  • RNA from normal and CRC cell lines was prepared and probed with the full-length DLC-1 cDNA (Seq I D No 1)
  • 1 1 out of 17 HCT-15, LS147T, DLD-1, HD29, SW1 1 16, T84, SW1417, SW403, SW948, LS180, SW48
  • FIG. 7 the normal human colon fibroblast cell line CDD33CO was used as a normal control
  • RNA from PC cell lines was prepared and probed with the full-length DLC-1 cDNA (Seq I D No 1) Low levels or no DLC-1 gene expression was demonstrated by in two (LN-Cap and SP3504) out of three human PC cell lines (FIG 8) EXAMPLE 4 Obtaining the DLC-1 cDNA
  • the cDNA for the clone L7-3 was obtained by 5' RACE and 3' RACE coupled with cDNA library screening as described above
  • the full-length cDNA of DLC-1 gene is 3850 bp long (Seq I D No 1 ) and encodes a protein of 1091 amino acids (Seq I D No 2)
  • T he estimated molecular weight of DLC- 1 protein is 125 kD
  • the untranslated regions of 5' end and 3' end of DLC-1 gene are 324 bp and 250 bp, respectively (Seq I D No 1 )
  • the DLC-1 gene was chromosomally localized using the materials and methods described above
  • the majority of metaphases hybridized with biotin or digoxigenin-labeled genomic probe had fluorescent signal at identical sites on both chromatids of the short arm of chromosome 8
  • the signal was analyzed in 100 metaphases with both homologous labeled
  • Fifty metaphases were examined by imaging of DAPI generated and enhanced G-like banding
  • the fluorescent signals were distributed within region 8p21-22 However, over 50% of doublets were at bands 8p21 3-22, the most likely location of the DLC-1 gene
  • the DLC-1 cDN A sequence (Seq I D No 1) described above does not contain the introns, upstream transc ⁇ ptional promoter or regulatory regions or downstream transc ⁇ ptional regulatory regions of the DLC- 1 gene It is possible that some mutations in the DLC- 1 gene that may lead to HCC are not included in the cDNA but rather are located in other regions of the DLC- 1 gene Mutations located outside of the open reading frame that encodes the DLC-1 protein are not likely to affect the functional activity of the protein but rather are likely to result in altered levels of the protein in the cell For example, mutations in the promoter region of the DLC-1 gene may prevent transcription of the gene and therefore lead to the complete absence of the DLC-1 protein in the cell
  • mutations within intron sequences in the genomic gene may also prevent expression of the DLC-1 protein Following transcription of a gene containing introns, the intron sequences are removed from the RNA molecule in a process termed splicing prior to translation of the RNA molecule which results in production of the encoded protein
  • the cellular enzymes that perform the splicing function recognize sequences around the mtron/exon border and in this manner recognize the appropriate splice sites If there is a mutation within the sequence of the intron close to the junction of the intron with an exon, the enzymes may not recognize the junction and ma ⁇ fail to remove the intron If this occurs, the encoded protein will likely be defective
  • mutations inside the intron sequences within the DLC- 1 gene may also lead to the development of HCC
  • knowledge of the exon structure and lntronic splice site sequences of the DLC- 1 gene is required to
  • the ATCC deposit (98676) of the genomic DLC- 1 gene may be utilized in aspects of the present invention
  • the DLC- 1 gene may be isolated by one or more routine procedures, including PCR-based screening of a human genomic PI library as described above
  • the method described in WO 93/22435 can be utilized
  • a YAC library of human genomic sequences (Monaco and Lehrach, Proc Natl Acad Sci USA 88 4123-7, 1991) is screened for the DLC- 1 gene by the polymerase chain reaction (PCR)
  • the library is arranged in a number (e g , 39) of primary DNA pools, prepared from high-density grids each containing around 300-400 YAC clones Primary pools are screened by PCR to identify a pool which contains a positive clone
  • a secondary PCR screen is then performed on the appropriate set of eight row and 12 column pools, as described by Bentley et al (Genomics 12 534-41 , 1992) PCR primers based on the DLC
  • primers derived from these sequences may be used in diagnostic tests (described below) to determine the presence of mutations in any part of the genomic DLC-1 gene of a patient
  • Such primers will be oligonucleotides comprising a fragment of sequence from the DLC-1 gene (either intron sequence, exon sequence or a sequence spanning an intron-exon boundary) and will comprise at least 15 consecutive nucleotides of the DLC-1 cDNA or gene
  • the primers used may comprise 20, 25, 30 or even 50 consecutive nucleotides of the DLC-1 cDNA or gene
  • the analysis of a large and as yet untapped source of patient material for mutations will now be possible using methods such as chemical cleavage of mismatches (Cotton et al Proc
  • genomic clone for the human DLC-1 gene (Seq I D Nos 14-19)
  • genomic clone or the cDNA or sequences derived from these clones may be utilized in applications of this invention, including but not limited to, studies of the expression of the DLC-1 gene, studies of the function of the DLC-1 protein, the generation of antibodies to the DLC-1 protein diagnosis and therapy of DLC-1 deleted or mutated patients to prevent or treat the onset of HCC
  • Descriptions of applications describing the use of DLC-1 cDNA are therefore intended to comprehend the use of the genomic DLC-1 gene
  • homologs of this gene may now be cloned from other species, such as the rat or the mouse, by standard cloning methods Such homologs will be useful in the production of animal models of HCC
  • Human DLC-1 was cloned and the intron/exon sequences characterized (Seq I D Nos 14-19 and FIG 9) Human DLC-1 is approximately 25 kb, and contains 14 exons The largest exon is exon 2, at 1 5 kb, while the remaining exons are less than 300 bp on average (FIG 9)
  • EXAMPLE 7 Cloning Mouse DLC-1 A full understanding of the function of DLC-1 and its role in cancer development is essential This understanding can be facilitated by the generation of knock-out mice which contain a non-functional DLC-1 gene Prior to generating knock-out mice, the partial cDNA (Seq I D Nos 26-31 ) and partial genomic (Seq I D Nos 20-25) mouse DLC- 1 sequences were determined
  • Mouse DLC- 1 genomic DNA was cloned and localized to chromosome 8 by FISH (see above for methods) using a mouse DLC- 1 genomic DNA clone as the probe Mouse DLC-1 is in a syntenic region of the human DLC-1 gene The localization of DLC-1 gene in mice may permit studies with in vivo models for carcmogenesis EXAMPLE 8 Generating Transgenic Mice
  • the vector shown in FIG 10 can be used to generate DLC-1 knock-out mice by homologous recombination
  • the knock-out vector is introduced into embryonic stem cells (ES cells) by standard methods which may include transfection, retroviral infection or electroporation (also see Example 1 1)
  • the transfected ES cells expressing the knock-out vector will grow in medium containing the antibiotic G418
  • the neomycin resistant ES cells will be microinjected into mouse embryos (blastocysts), which are implanted into the uterus of pseudopregnant mice
  • the litter will be screened for chime ⁇ c mice by observing their coat color Chime ⁇ c mice are ones in which the injected ES cells developed into the germ line, thereby allowing transmission of the gene to their offspring
  • the resulting heterozygotic mice will be mated to generate a homozygous line of transgenic mice functionally deleted for DLC- 1 These homozygous mice will then be screened phenotypically, for example, their pre
  • RNA isolation is extracted from human cells by any one of a variety of methods routinely used, Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al (In Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences, 1987) provide descriptions of methods for RNA isolation Any human cell line derived from a non-DLC- 1 deleted individual would be suitable, such as the widely used HeLa cell line, or the WI-38 human skin fibroblast cell line available from the American Type Culture Collection, Rockville, MD The extracted RNA is then used as a template for performing the reverse transc ⁇ ption-polymerase chain reaction (RT-PCR) amplification of c
  • RT-PCR reverse transc ⁇ ption-polymerase chain reaction
  • PCR primers will be made according to the portions of the cDNA which are to be amplified. Primers may be chosen to amplify small segments of a cDNA or the entire cDNA molecule. Variations in amplification conditions may be required to accommodate primers of differing lengths; such considerations are well known in the art and are discussed in Innis et al. (PCR Protocols. A Guide to Methods and Applications, Innis et al. (eds.), Academic Press, Inc., San Diego. California, 1990). The entire DLC-1 cDNA molecule may be amplified using the following combination of primers: 5' TAT GGG CTC GAG CGG CCG CCC 3' (Seq. I.D. No. 3)
  • the open reading frame of the cDNA molecule may be amplified using the following combination of primers:
  • primers are illustrative only; it will be appreciated by one skilled in the art that many different primers may be derived from the provided cDNA sequence in order to amplify particular regions of these cDNAs.
  • the nucleotide sequence of the DLC- 1 cDNA (Seq. I.D. No. 1 ) and the amino acid sequence of the DLC- 1 protein (Seq. I.D. No. 2) which is encoded by that cDNA, respectively are shown in FIG. 5.
  • this invention now also facilitates the creation of DNA molecules, and thereby proteins, which are derived from those disclosed but which vary in their precise nucleotide or amino acid sequence from those disclosed. Such variants may be obtained through a combination of standard molecular biology laboratory techniques and the nucleotide sequence information disclosed by this invention.
  • Variant DNA molecules include those created by standard DNA mutagenesis techniques, for example. Ml 3 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989, Ch. 15). By the use of such techniques, variants may be created which differ in minor ways from those disclosed. DNA molecules and nucleotide sequences which are derivatives of those specifically disclosed herein and which differ from those disclosed by the deletion, addition or substitution of nucleotides while still encoding a protein which possesses the functional characteristic of the DLC- 1 protein are comprehended by this invention. Also within the scope of this invention are small DNA molecules which are derived from the disclosed DNA molecules.
  • Such small DNA molecules include oligonucleotides suitable for use as hybridization probes or polymerase chain reaction (PCR) primers.
  • these small DNA molecules will comprise at least a segment of the DLC- 1 cDN A molecule or the DLC-1 gene and, for the pu ⁇ oses of PCR. will comprise at least a 15 nucleotide sequence and, more preferably, a 20-50 nucleotide sequence of the DLC-1 cDNA (Seq. I.D. No. 1 ) or the DLC- 1 gene (Seq. I.D. Nos. 14-19) (i.e., at least 20-50 consecutive nucleotides of the DLC-1 cDNA or gene sequences).
  • DNA molecules and nucleotide sequences which are derived from the disclosed DNA molecules as described above may also be defined as DNA sequences which hybridize under stringent conditions to the DNA sequences disclosed, or fragments thereof.
  • Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing DNA used. Generally, the temperature of hybridization and the ionic strength (especially the Na " concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989 ch. 9 and 1 1), herein inco ⁇ orated by reference.
  • a hybridization experiment may be performed by hybridization of a DNA molecule (for example, a deviation of the DLC-1 cDNA) to a target DNA molecule (for example, the DLC-1 cDNA) which has been electrophoresed in an agarose gel and transferred to a nitrocellulose membrane by Southern blotting (Southern, J. Mol. Biol. 98:503, 1975), a technique well known in the art and described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989).
  • Hybridization with a target probe labeled with [ 32 P]-dCTP is generally carried out in a solution of high ionic strength such as 6xSSC at a temperature that is 20-25°C below the melting temperature, T m , described below.
  • a solution of high ionic strength such as 6xSSC at a temperature that is 20-25°C below the melting temperature, T m , described below.
  • hybridization is typically carried out for 6-8 hours using 1-2 ng/ml radiolabeled probe (of specific activity equal to 10 9 CPM/ ⁇ g or greater).
  • the nitrocellulose filter is washed to remove background hybridization. The washing conditions should be as stringent as possible to remove background hybridization but to retain a specific hybridization signal.
  • T m represents the temperature above which, under the prevailing ionic conditions, the radiolabeled probe molecule will not hybridize to its target DNA molecule.
  • the 7j_ of such a hybrid molecule may be estimated from the following equation (Bolton and McCarthy, Proc. Nad. Acad. Sci. USA 48: 1390, 1962):
  • stringent conditions may be defined as those under which DNA molecules with more than 25% sequence variation (also termed
  • stringent conditions are those under which DNA molecules with more than 15% mismatch will not hybridize, and more preferably still, stringent conditions are those under which DNA sequences with more than 10% mismatch will not hybridize In another embodiment, stringent conditions are those under which DNA sequences with more than 6% mismatch will not hybridize
  • the degeneracy of the genetic code further widens the scope of the present invention as it enables major variations in the nucleotide sequence of a DNA molecule while maintaining the ammo acid sequence of the encoded protein
  • the sixteenth amino acid residue of the DLC-1 protein is alanine
  • the nucleotide codon triplet GCC Because of the degeneracy of the genetic code, three other nucleotide codon triplets, GCT, GCG and GCA, also code for alanine
  • the nucleotide sequence of the DLC-1 cDNA could be changed at -9"
  • variant DNA molecules may be derived from the cDNA molecules disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences. DNA sequences which do not hybridize under stringent conditions to the cDNA sequences disclosed by virtue of sequence variation based on the degeneracy of the genetic code are herein also comprehended by this invention.
  • the invention also includes DNA sequences that are substantially identical to any of the DNA sequences disclosed herein, where substantially identical means a sequence that has identical nucleotides in at least 75% of the aligned nucleotides, for example 80%, 85%, 90%, 95% or 98% identity of the aligned sequences.
  • He Thr Asn Ser T lie Thr Asn Ser c A A He Thr Lys Arg A
  • “Stop (och)” stands for the ochre termination triplet, and “Stop (amb)” for the amber.
  • ATG is the most common initiator codon; GTG usually codes for valine, but it can also code for methionine to initiate an mRNA chain.
  • DNA mutagenesis techniques described above may be used not only to produce variant DNA molecules, but will also facilitate the production of proteins which differ in certain structural aspects from the DLC-1 protein, yet which proteins are clearly derivative of this protein and which maintain the essential characteristics of the DLC-1 protein.
  • Newly derived proteins may also be selected in order to obtain variations on the characteristic of the DLC-1 protein, as will be more fully described below.
  • Such derivatives include those with variations in amino acid sequence including minor deletions, additions and substitutions. While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined.
  • random mutagenesis may be conducted at the target codon or region and the expressed protein variants screened for the optimal combination of desired activity.
  • Techniques for making substitution mutations at predetermined sites in DNA having a known sequence as described above are well known. Amino acid substitutions are typically of single residues; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. Obviously, the mutations that are made in the DNA encoding the protein must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure.
  • Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Table 3 when it is desired to finely modulate the characteristics of the protein. Table 3 shows amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions.
  • Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 3, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
  • substitutions which in general are expected to produce the greatest changes in protein properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine.
  • a hydrophilic residue e.g
  • DLC-1 protein The effects of these amino acid substitutions or deletions or additions may be assessed for derivatives of the DLC-1 protein by assays in which DNA molecules encoding the derivative proteins are transfected into DLC-1 cells using routine procedures.
  • the DLC-1 gene, DLC- 1 cDNA, DNA molecules derived therefrom and the protein encoded by the cDNA and derivatives thereof may be utilized in aspects of both the study of HCC and for diagnostic and therapeutic applications related to HCC.
  • Utilities of the present invention include, but are not limited to, those utilities described in the examples presented herein. Those skilled in the art will recognize that the utilities herein described are not limited to the specific experimental modes and materials presented and will appreciate the wider potential utility of this invention
  • DLC-1 cDNA (Seq I D No 1 )
  • the purified protein may be used for functional analyses, antibody production, diagnostics and patient therapy
  • the DNA sequence of the DLC- 1 cDNA can be manipulated in studies to understand the expression of the gene and the function of its product
  • Mutant forms of the DLC- 1 may be isolated based upon information contained herein, and may be studied in order to detect alteration in expression patterns in terms of relative quantities, tissue specificity and functional properties of the encoded mutant DLC- 1 protein
  • Partial or full-length cDNA sequences, which encode for the subject protein may be ligated into bacterial expression vectors
  • Methods for expressing large amounts of protein from a cloned gene introduced into Escherichia coli (E coli) may be utilized for the purification, localization and functional analysis of proteins
  • fusion proteins consisting of amino terminal peptides encoded by a portion of the E coli lacZ or
  • Intact native protein may also be produced in E coli in large amounts for functional studies
  • Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al (In Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989, ch 17) herein inco ⁇ orated by reference
  • Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response
  • Native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient ⁇ bosome binding site upstream of the cloned gene If low levels of protein are produced, additional steps may be taken to increase protein production, if high levels of protein are produced, purification is relatively easy Suitable methods are presented in Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989) and are well known in the art Often, proteins expressed at high levels are found in insoluble inclusion bodies Methods for extracting proteins from these aggregates are described by Sambrook et al
  • Vector systems suitable for the expression of lacZ fusion genes include the pUR series of vectors (Ruther and Muller-Hill, EMBO J 2 1791 , 1983), pEXl-3 (Stanley and Luzio, EMBO J 3 1429, 1984) and pMRl OO (Gray et al , Proc Natl Acad Sci US4 79 6598, 1982) Vectors suitable for the production of intact native proteins include pKC30 (Shimatake and Rosenberg, Nature 292 128 1981 ), pKK177-3 (Amann and Brosius, Ge «e 40 183, 1985) and pET-3 (Studiar and Moffatt J Mol Biol 189 1 13, 1986) DLC-1 fusion proteins may be isolated from protein gels, lyophihzed, ground into a powder and used as an antigen The DNA sequence can also be transferred from its existing context in pREP4 to other cloning vehicles, such as other plasmi
  • the cDNA sequence may be ligated to heterologous promoters, such as the simian virus (SV) 40, promoter in the pSV2 vector (Mulligan and Berg, Proc Natl Acad Sci USA 78 2072-6, 1981), and introduced into cells, such as monkey COS-1 cells (Gluzman, Cell 23 175-182, 1981 ), to achieve transient or long-term expression
  • heterologous promoters such as the simian virus (SV) 40, promoter in the pSV2 vector (Mulligan and Berg, Proc Natl Acad Sci USA 78 2072-6, 1981)
  • cells such as monkey COS-1 cells (Gluzman, Cell 23 175-182, 1981 )
  • the stable integration of the chime ⁇ c gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, J Mol Appl Genet 1 327-41 , 1982) and mycophenohc acid (Mulligan and Berg, Proc
  • DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, hgation of synthetic or cloned DNA sequences, site-directed sequence- alteration via single-stranded bacte ⁇ ophage intermediate or with the use of specific oligonucleotides in combination with PCR
  • the cDNA sequence (or portions derived from it) or a mini gene (a cDNA with an intron and its own promoter) may be introduced into eukaryotic expression vectors by conventional techniques These vectors are designed to permit the transcription of the cDNA in eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription of the cDNA and ensure its proper splicing and polyadenylation Vectors containing the promoter and enhancer regions of the SV40 or long terminal repeat (LTR) of the Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan and Berg, Proc Natl Acad Sci USA 78 2072-6, 1981 , Gorman et al , Proc Natl Acad Sci USA 78 6777-6781 , 1982)
  • the level of expression of the cDNA can be manipulated with this type of vector, either by using promoters that have different activities (for example, the baculovirus pAC373 can express c
  • some vectors contain selectable markers such as the g_p_t (Mulligan and Berg, Proc Natl Acad Sci USA 78 2072-6 1981 ) or neo (Southern and Berg, J Mol Appl Genet 1 327-41 , 1982) bacterial genes These selectable markers permit selection of transfected cells that exhibit stable, long-term expression of the vectors (and therefore the cDNA)
  • the vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses such as papilloma (Sarver et al , Mol Cell Biol 1 486, 1981 ) or Epstein-Barr (Sugden et al , Mol Cell Biol 5 410, 1985)
  • one can also produce cell lines that have integrated the vector into genomic DNA Both of these types of cell lines produce the gene product on a continuous basis
  • the transfer of DNA into eukaryotic, in particular human or other mammalian cells is now a conventional technique
  • the vectors are introduced into the recipient cells as pure DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vander Eb, Virology 52 466, 1973) or strontium phosphate (Brash et al , Mol Cell Biol 7 2013, 1987), electroporation (Neumann et al , EMBO J 1 841 , 1982), hpofection (Feigner et al , Proc Natl Acad Sci USA 84 7413, 1987), DEAE dextran (McCuthan et al , J Natl Cancer Inst 41 351 , 1968), microinjection (Mueller et al , Cell 15 579, 1978), protoplast fusion (Schafner, Proc Natl Acad Sci USA 11 2163-7, 1980), or pellet guns (Klein et al , Nature 327 70, 1987)
  • eukaryotic expression systems can be used for studies of the DLC- 1 gene and mutant forms of this gene, the DLC-1 protein and mutant forms of this protein Such uses include, for example, the identification of regulatory elements located in the 5' region of the DLC-1 gene on genomic clones that can be isolated from human genomic DNA libraries using the information contained in the present invention
  • the eukaryotic expression systems may also be used to study the function of the normal complete protein, specific portions of the protein, or of naturally occurring or artificially produced mutant proteins
  • the expression vectors containing the DLC-1 gene sequence or fragments or variants or mutants thereof can be introduced into human cells, mammalian cells from other species or non-mammalian cells as desired
  • the choice of cell is determined by the pu ⁇ ose of the treatment
  • monkey COS cells Gluzman, Cell 23 175-182, 1981
  • Chinese hamster ovary CHO
  • mouse NIH 3T3 fibroblasts or human fibroblasts or lymphoblasts as described herein
  • Cloning vector pXTI contains the Long Terminal Repeats (LTRs) and a portion of the GAG gene from Moloney Murine Leukemia Virus The position of the viral LTRs allows highly efficient, stable transfection of the region within the LTRs
  • the vector also contains the He ⁇ es Simplex Thymidine Kinase promoter (TK), active in embryonal cells and in a wide variety of tissues in mice, and a selectable neomycin gene conferring G418 resistance
  • TK He ⁇ es Simplex Thymidine Kinase promoter
  • Two unique restriction sites Bglll and Xhol are directly downstream from the TK promoter DLC-1 cDNA including the entire open reading frame for the DLC- 1 protein and the 3' untranslated region of the cDNA is cloned into one of the two unique restriction sites downstream from the promoter
  • the ligated product is transfected into mouse NIH 3T3 cells using Lipofectin (Life Technologies, Inc ) under conditions outlined in the product specification Positive transfectants are selected after growing the transfected cells in 600 ⁇ g ml G418 (Sigma, St Louis, MO)
  • the protein is released into the supernatant and may be purified by standard lmmunoaffinity chromatography techniques using antibodies raised against the DLC-1 protein, as described below
  • DLC- 1 protein in eukaryotic cells may also be used as a source of proteins to raise antibodies
  • the DLC-1 protein may be extracted following release of the protein into the supernatant as described above, or, the cDNA sequence may be inco ⁇ orated into a eukaryotic expression vector and expressed as a chime ⁇ c protein with, for example, ⁇ -globm Antibody to ⁇ -globm is thereafter used to purify the chime ⁇ c protein
  • Corresponding protease cleavage sites engineered between the ⁇ -globin gene and the cDNA are then used to separate the two polypeptide fragments from one another after translation
  • One useful expression vector for generating ⁇ -globm chime ⁇ c proteins is pSG5 (Stratagene) This vector encodes rabbit ⁇ -globin
  • the present invention thus encompasses recombinant vectors which comprise all or part of the DLC-1 gene or cDNA sequences, for expression in a suitable host
  • the DLC-1 DNA is operative
  • EXAMPLE 12 Production of an Antibody to DLC-1 Protein
  • Monoclonal or polyclonal antibodies may be produced to either the normal DLC- 1 protein or mutant forms of this protein Optimally, antibodies raised against the DLC-1 protein would specifically detect the DLC-1 protein That is, such antibodies would recognize and bind the DLC- 1 protein and would not substantially recognize or bind to other proteins found in human cells
  • the determination that an antibody specifically detects the DLC-1 protein is made by any one of a number of standard immunoassay methods, for instance, the Western blotting technique (Sambrook et al , Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989)
  • a given antibody preparation such as one produced in a mouse
  • total cellular protein is extracted from human cells (for example, lymphocytes) and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel
  • the proteins are then transferred to a membrane (for example, nitrocellulose) by Western
  • Substantially pure DLC-1 protein suitable for use as an immunogen is isolated from transfected or transformed cells Concentration of protein in the final preparation is adjusted, for example, by concentration on an A icon filter device, to the level of a few micrograms per milhhter Monoclonal or polyclonal antibody to the protein can then be prepared as follows Monoclonal Antibody Production by Hybridoma Fusion
  • Monoclonal antibodv to epitopes of the DLC- 1 protein identified and isolated as described can be prepared from murine hyb ⁇ domas according to the classical method of Kohler and Milstein (Nature 256 495, 1975) or derivative methods thereof Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein over a period of a few weeks The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopte ⁇ n (HAT media) The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall
  • Polyclonal antiserum containing antibodies to heterogenous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein, which can be unmodified or modified to enhance immunogenicity
  • Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species For example, small molecules tend to be less lmmunogenic than others and may require the use of carriers and adjuvant
  • host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low titer antisera Small doses (ng level) of antigen administered at multiple intradermal sites appears to be most reliable
  • An effective immunization protocol for rabbits can be found in Vaitukaitis et al (J Clin Endocnnol Metab 33 988-91, 1971)
  • Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall See, for example, Ouchterlony et al (In Handbook of Experimental Immunology, Wier, D (ed ) chapter 19, Blackwell ,1973) Plateau concentration of antibody is usually in the range of 0 1 to 0 2 mg/ml of serum (about 12 ⁇ M) Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Immunology, Ch 42, 1980) - • ⁇ ? .
  • a third approach to raising antibodies against the DLC- 1 protein is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the predicted amino acid sequence of the DLC-1 protein
  • Antibodies may be raised against the DLC- 1 protein by subcutaneous injection of a DNA vector which expresses the DLC- 1 protein into laboratory animals, such as mice Deliv ery of the recombinant vector into the animals may be achieved using a hand-held form of the Biohstic system (Sanford et al , Paniculate Sci Technol 5 27-37, 1987) as described by Tang et al ( ⁇ ature 356 152-4, 1992)
  • Expression vectors suitable for this pu ⁇ ose may include those which express the DLC- 1 gene under the transc ⁇ ptional control of either the human ⁇ -actin promoter or the cytomegalovirus (CMV) promoter
  • Antibody preparations prepared according to these protocols are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples, they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample
  • DLC-1 sequence information presented herein is in the area of genetic testing for predisposition to HCC, BC, PC and/or CRC owing to DLC-1 deletion or mutation
  • the gene sequence of the DLC-1 gene, including intron-exon boundaries is also useful in such diagnostic methods
  • Individuals carrying mutations in the DLC-1 gene, or having heterozygous or homozygous deletions of the DLC-1 gene, may be detected at the DNA level with the use of a variety of techniques
  • a biological sample of the subject which biological sample contains either DNA or RNA derived from the subject, is assayed for a mutated or deleted DLC-1 gene
  • Suitable biological samples include samples containing genomic DNA or RNA obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy.
  • the detection in the biological sample of either a mutant DLC-1 gene, a mutant DLC-1 RNA, or a homozygously or heterozygously deleted DLC-1 gene may be performed by a number of methodologies, as outlined below
  • a preferred embodiment of such detection techniques is the polymerase chain reaction amplification of reverse transcribed RNA (RT-PCR) of RNA isolated from lymphocytes followed b direct DNA sequence determination of the products The presence of one or more nucleotide differences between the obtained sequence and the cDNA sequences, and especially, differences in the ORF portion of the nucleotide sequence are taken as indicative of a potential DLC- 1 gene mutation
  • DNA extracted from lymphocytes or other cells av be used directly for amplification
  • the direct amplification from genomic DNA would be appropriate for analysis of the entire DLC- 1 gene including regulatory sequences located upstream and downstream from the open reading frame
  • DLC-1 genes isolated from DLC-1 patients may reveal particular mutations, or deletions, which occur at a high frequency within this population of individuals In this case, rather than sequencing the entire DLC- 1 gene, it may be possible to design DNA diagnostic methods to specifically detect the most common DLC-1 mutations or deletions
  • the detection of specific DNA mutations may be achieved by methods such as hybridization using specific oligonucleotides (Wallace et al , Cold Spring Harbor Symp Quant Biol 51 257-61 , 1986), direct DNA sequencing (Church and Gilbert, Proc Natl Acad Sci USA 81 1991- 5, 1988), the use of restriction enzymes (Flavell et al , Cell 15 25, 1978, Geever et al , Proc Natl Acad Sci USA 78 5081 , 1981), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers and Maniatis, Cold Spring Harbor Symp Quant Biol 51 275-84, 1986), RNase protection (Myers et al , Science 230 1242, 1985), chemical cleavage (Cotton et al , Proc Natl Acad Sci USA 85 4397-401. 1988), and the ligase-mediated detection procedure (Landegren et al , Science 241 1077, 1988)
  • Oligonucleotides specific to normal or mutant sequences are chemically synthesized using commercially available machines, labeled radioactively with isotopes (such as 32 P) or non- radioactively, with tags such as biotin (Ward and Langer et al , Proc Natl Acad Sci USA 78 6633- 57, 1981), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis The presence of these specific sequences are visualized by methods such as autoradiography or fluoromet ⁇ c (Landegren, et al , Science 242 229-37, 1989) or colo ⁇ met ⁇ c reactions (Gebeyehu et al , Nucleic Acids Res 15 4513- 34, 1987) The absence of hybridization would indicate a mutation in the particular region of the gene, or deleted DLC-1 gene Sequence differences between normal and mutant forms of the DLC- 1 gene may also be revealed by the direct DNA sequencing method
  • Sequence alterations may occasionally generate fortuitous restriction enzyme recognition sites or mav eliminate existing restriction sites Changes in restriction sites are revealed by the use of appropriate enzyme digestion followed by conventional gel-blot hybridization
  • Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme, fragments of different sizes are then visualized under UV light m the presence of ethidium bromide after gel electrophoresis
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing reagent
  • Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis
  • a PCR product with small deletions is clearly distinguishable from a normal sequence on an 8% non-denaturing polyacrylamide gel (WO 91/10734, Nagamine et al , Am J Hum Genet 45 337- 9, 1989)
  • DNA fragments of different sequence compositions may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific "partial-melting" temperatures (Myers et al , Science 230 1242, 1985)
  • a method of detecting a mutation comprising a single base substitution or other small change could be based on differential primer length in a PCR
  • an invariant primer could be used in addition to a primer specific for a mutation
  • DNA fragments may also be visualized by methods where the individual DNA samples are not immobilized on membranes
  • the probe and target sequences may be both solution, or the probe sequence may be immobilized (Saiki et al , Proc Nat Acad Sci USA 86 6230-4, 1989)
  • a variety of detection methods such as autoradiography involving radioisotopes, direct detection of radioactive decay (in the presence or absence of sc tillant), spectrophotometry involving calo ⁇ genic reactions and fluorometry involved fluorogenic reactions, may be used to identify specific individual genotypes
  • a system capable of detecting such multiple mutations would be desirable for example, a PCR with multiple, specific oligonucleotide primers and hybridization probes may be used to identify all possible mutations at the same time (Chamberlain et al , Nucl Acids Res 16 1 141-55, 1988) The procedure may involve immobilized sequence-specific oligonucleotides probes (Saiki et al , Proc Nat Acad Sci USA 86 6230-4, 1989) 33 -
  • Blots are prehyb ⁇ dized for 15-30 min at 65° C in 7% sodium dodecyl sulfate (SDS) in 0 5M NaP0 4
  • SDS sodium dodecyl sulfate
  • the blots are hybridized overnight at 65 °C in 7% SDS, 0 5M NaP0 4 with 25-50 ng/ml single stranded probe DNA
  • Post-hybridization washes consist of two 30 mm washes in 5% SDS, 40 mM NaP0 4 at 65 °C, followed by two 30-m ⁇ n washes in 1% SDS, 40 mM NaPQ, at 65 °C
  • the blots are rinsed with phosphate buffered saline (pH 6 8) for 5 min at room temperature and incubated with 0 2% casein in PBS for 5 min
  • the blots are then preincubated for 5- 10 minutes in a shaking water bath at 45° C with hybridization buffer consisting of 6M urea, 0 3M NaCl, and 5X Denhardt's solution (see Sambrook, et al , Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989)
  • the buffer is removed and replaced with 50-75 ⁇ l/cm 2 fresh hybridization buffer plus 2 5 nM of the covalently cross-linked oligonucleotide sequence complementary to the universal primer site (UP-AP, Bio-Rad)
  • the blots are hybridized for 20-30 min at 45 °C and post hybridization washes are incubated at 45 °C as two 10 min washes in 6 M urea, I standard saline citrate
  • An alternative method of diagnosing DLC-1 gene deletion or mutation is to quantitate the level of DLC- 1 protein in the cells of an individual
  • This diagnostic tool would be useful for detecting reduced levels of the DLC-1 protein which result from, for example, mutations in the promoter regions of the DLC- 1 gene or mutations within the coding region of the gene which produced truncated, non-functional polypeptides, as well as from deletions of the entire DLC- 1 gene
  • the determination of reduced DLC- 1 protein levels would be an alternative or supplemental approach to the direct determination of DLC- 1 gene deletion or mutation status by the methods outlined above
  • the availability of antibodies specific to the DLC-1 protein will facilitate the quantitation of cellular DLC-1 protein by one of a number of immunoassay methods which are well known in the art and are presented in Harlow and Lane (Antibodies A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988)
  • a biological sample of the subject which sample includes cellular proteins, is required
  • a biological sample may be obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, ammocentesis samples, surgical specimens and autopsy material, particularly liver cells
  • Quantitation of DLC-1 protein is achieved by immunoassay and compared to levels of the protein found in healthy cells
  • a significant (e g , 50% or greater) reduction in the amount of DLC- 1 protein in the cells of a subject compared to the amount of DLC-1 protein found in normal human cells would be taken as an indication that the subject may have deletions or mutations in the DLC- 1 gene locus
  • liver cells may be removed from a patient having deletions or mutations of the DLC-1 gene, and then transfected with an expression vector containing the DLC-1 cDNA These transfected liver cells will thereby produce functional DLC-1 protein and can be remfroduced into the patient
  • liver cells breast, colorectal, prostate, or other cells may be used, depending on the cancer of interest
  • DLC-1 cDNAs now allows the development of human gene therapy based upon these procedures
  • Immunotherapy of melanoma patients using genetically engineered tumor-infiltrating lymphocytes (TILs) has been reported by Rosenberg et al (N Engl J Med 323 570-8, 1990)
  • a retrovirus vector was used to introduce a gene for neomycin resistance into TILs
  • Retroviruses have been considered the preferred vector for experiments in gene therapy, with a high efficiency of infection and stable integration and expression (Orkin et al , Prog Med Genet 7 130 1988)
  • the full length DLC-1 gene or cDNA can be cloned into a retroviral vector and driven from either its endogenous promoter or from the retroviral LTR (long terminal repeat)
  • Other viral transfection systems may also be utilized for this type of approach

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A cDNA molecule corresponding to a human gene is disclosed. The gene, which is frequently deleted in liver cancer cells and cell lines, is called the DLC-1 gene. Because the gene is frequently deleted in liver cancer cells, it is thought to act as a tumor suppressor. This gene is also frequently deleted in breast and colon cancers, and its expression is decreased or undetectable in many prostate and colon cancers. Also disclosed is the amino acid sequence of the protein encoded by the DLC-1 gene. Methods of using these biological materials in the diagnosis and treatment of hepatocellular cancer, breast cancer, colon cancer, prostate cancer, and adenocarcinomas are presented.

Description

DLC-1 GENE, A PUTATIVE TUMORS SUPPRESSOR GENE
FIELD OF THE INVENTION
The present invention relates to the cloning and sequencing of the human cDNA molecule corresponding to a newly discovered gene, called DLC-1 , which is frequently deleted in liver, breast and colon cancer cells. In addition, lower DLC-1 expression is frequently observed in liver, colon, and prostate cancer cells, compared to normal tissue. The present invention also relates to methods for screening and diagnosis of a genetic predisposition to liver cancer and other cancer types, and methods of gene therapy utilizing recombinant DNA technologies.
BACKGROUND OF THE INVENTION
The isolation of genes involved in human cancer development is critical for uncovering the molecular basis of cancer. One theory of cancer development holds that there are tumor suppressor genes in all normal cells which, when they become non-functional due to mutations, cause neoplastic development (Knudsen et al., Cancer Res. 45: 1482, 1985). Evidence to support this theory has been found in the cases of human retinoblastoma and colorectal tumors (see U.S. Pat. No. 5,330,892 and references cited therein), as well as in connection with breast and ovarian cancers (see U.S. Patent Nos. 5,693,473 and references cited therein).
More particularly, recurrent deletions on the short arm of human chromosome 8 in cases of liver, breast, lung and prostate cancers have raised the possibility of the presence of tumor suppressor genes in that location. For example, loss on the short arm of chromosome 8 in prostrate cancer (PC) cells was described in Brothman (Cancer Genet. Cytogenet. 95: 1 16-21 , 1997). Similar deletions on the short arm of chromosome 8 also have been detected in primary hepatocellular cancer (HCC), non-small cell lung carcinoma (NSCLC) and node-negative breast carcinomas (Isola, Am. J. Pathol. 147:905-1 1, 1995; and Marchio, et al., Genes Chromo. Cane. 18:59-65, 1997).
While recurrent chromosome 8 deletions in malignant tumors support the relevance of this lesion in carcinogenesis, scientists previously have been unable to identify the tumor suppressor genes involved in such deletions. This lack of knowledge concerning the molecular genetic basis of HCC, and other cancers associated with chromosome 8 deletions, has hampered efforts to diagnose the predisposition to such diseases and to develop more effective treatments aimed at curing genetic deficiencies.
Therefore, it is an object of the present invention to provide a human cDNA molecule corresponding to a previously unknown gene located on the short arm of chromosome 8, the deletion of which appears to be closely associated with the development of HCC and other cancers. The cloning and sequencing of such a cDNA molecule enables new and improved methods of diagnosis and treatment of such diseases. SUMMARY OF THE INVENTION
The present invention discloses the discovery of new human gene involved in the pathogenesis of hepatocellular cancer (HCC), the most common primary liver cancer, and one of the most common cancers in the world, with 251,000 new cases reported each year. (Simonetti et al., Dig. Dis. Sci. 36:962-72, 1991 ; Harris et al., Cancer Cells 2: 146-8, 1990; Marchio, et al., Genes
Chromo. Cancer 18:59-65, 1997). More specifically, the present invention discloses the isolation of the full length cDNA and the chromosomal localization of a new gene which is frequently deleted in liver cancer, and hence is named the DLC-1 gene.
The full-length cDNA for DLC-1 is 3850 bp long (Seq. I.D. No. 1), encodes a protein of 1091 amino acids (Seq. I.D. No. 2), and was localized by fluorescence in situ hybridization to chromosome 8 at bands p21.3-22. Because the DLC-1 gene is deleted from a significant percentage of primary HCC tumor cells and cell lines, primary breast cancers (BC), and colorectal cancer (CRC) cell lines, and its expression is decreased or not observed in a significant percentage of HCC cell lines, CRC cell lines and prostate cancer (PC) cell lines, the DLC-1 gene appears to operate as a tumor suppressor in liver cancer and other cancers including PC, CRC and BC.
The object of identifying the hitherto unknown DLC-1 gene has been achieved by providing an isolated human cDNA molecule which is able specifically to correct the cellular defects characteristic of cells from patients with a deleted or mutated DLC-1 gene. Specifically, the invention provides, for the first time, an isolated cDNA molecule which, when transfected into cells derived from a patient with a deleted or mutated DLC-1 gene, can produce the DLC-1 protein believed to be active in suppressing HCC pathogenesis and other cancers, such as breast, colorectal, and prostate cancers. The invention encompasses the DLC-1 cDNA molecule (derived from normal human liver cells), the nucleotide sequence of this cDNA, and the putative amino acid sequence of the DLC-1 protein encoded by this cDNA. Having herein provided the nucleotide sequence of the DLC-1 cDNA, correspondingly provided are the complementary DNA strands of the cDNA molecule and DNA molecules which hybridize under stringent conditions to the DLC- 1 cDNA molecule or its complementary strand. Such hybridizing molecules include DNA molecules differing only by minor sequence changes, including nucleotide substitutions, deletions and additions. Also comprehended by this invention are isolated oligonucleotides comprising at least a segment of the cDNA molecule or its complementary strand, such as oligonucleotides which may be employed as effective DNA hybridization probes or primers useful in the polymerase chain reaction or as hybridization probes. Such probes and primers are particularly useful in the screening and diagnosis of persons genetically predisposed to HCC, and other cancers, as the result of DLC-1 gene deletions. Hybridizing DNA molecules and variants on the DLC-1 cDNA may readily be created by standard molecular biology techniques. Through the manipulation of the nucleotide sequence of the human cDNA provided by this invention by standard molecular biology techniques, variants of the DLC- 1 protein may be made which differ in precise amino acid sequence from the disclosed protein yet which maintain the essential characteristics of the DLC- 1 protein or which are selected to differ in one or more characteristics from this protein Such variants are another aspect of the present invention Also provided by the present invention are recombinant DNA vectors comprising the disclosed DNA molecules, and transgenic host cells containing such recombinant vectors
Having isolated the human DLC- 1 cDNA sequence, the genomic sequence for the gene was determined according to the following method A human genomic library constructed using the PI vector, pADl OSacBII, was transferred from its original E coli host into a second E colt host, strain N3516 following procedures well-known in the art A positive PI clone containing the DLC- 1 gene was then obtained by performing a protocol of PCR-based PI library screening (Sheperd, Proc Natl Acad Sci USA 91 2629-33, 1994, Neuhausen, Hum Mol Genet 3 1919-26, 1994) The PCR primers used in this screening designed from a genomic fragment isolated through Representational Difference Analysis (described more fully below), are listed below PL7-3F 5' GACACCACCATCTCTGTGCTC 3' (Seq I D No 7)
PL7-3R 5' GCAGACTGTCCTTCGTAGTTG 3' (Seq I D No 8) An isolated and purified biological sample of this genomic DLC-1 gene was deposited with the American Type Culture Collection (ATCC) in Manassas, VA, on February 25, 1998, under accession number 98676 The present invention also provides for the use of the DLC-1 cDNA, the corresponding genomic gene and of the DLC-1 protein, and derivatives thereof, in aspects of diagnosis and treatment of HCC, and other cancers including, but not limited to PC, BC and CRC, resulting from DLC-1 deletion or mutation
An embodiment of the present invention is a method for screening a subject to determine if the subject carries a mutant DLC-1 gene, or if the gene has been partially or completely deleted, as is thought to occur in many HCC cases The method comprises the steps of providing a biological sample obtained from the subject, which sample includes DNA or RNA, and providing an assay for detecting in the biological sample the presence of a mutant DLC-1 gene, a mutant DLC-1 RNA, or the absence, through deletion, of the DLC-1 gene and corresponding RNA
The foregoing assay may be assembled in the form of a diagnostic kit and preferably comprises either hybridization with oligonucleotides, PCR amplification of the DLC-1 gene or a part thereof using oligonucleotide primers, RT-PCR amplification of the DLC- 1 RNA or a part thereof using oligonucleotide primers, or direct sequencing of the DLC-1 gene of the subject's genome using oligonucleotide primers The efficiency of these molecular genetic methods should permit a rapid classification of patients affected by deletions or mutations of the DLC- 1 gene A further aspect of the present invention is a method for screening a subject to assay for the presence of a mutant or deleted DLC- 1 gene, comprising the steps of providing a biological sample of the subject which sample contains cellular proteins, and providing an immunoassay for quantitating the level of DLC-1 protein in the biological sample Diagnostic methods for the detection of mutant or deleted DLC-1 genes made possible by this invention will provide an enhanced ability to diagnose susceptibility to HCC and other cancers such as PC, BC and CRC
Another aspect of the present invention is an antibody preparation comprising antibodies that specifically detect the DLC- 1 protein, wherein the antibodies are selected from the group consisting of monoclonal antibodies and polyclonal antibodies
Those skilled in the art will appreciate the utility of this invention is not limited to the specific experimental modes and materials described herein
The foregoing and other features and advantages of the invention w ill become more apparent from the following detailed description and accompanying drawings
BRIEF DESCRIPTION OF DRAWINGS
FIG 1 is a digital image of a Southern blot which compares primary HCC tumor cells (T) with healthy normal liver cells (N), and demonstrates a genomic deletion of the L7-3 clone in the HCC cells Primary tumors 94-25T, 95-03T and 95-06T showed 50% decrease of DNA intensity as compared with normal liver tissues
FIG 2 is a digital image of a Southern blot which compares representative HCC cell lines with healthy liver cells (NL-DNA), and demonstrates a genomic deletion of the L7-3 clone in 9 of 1 1 HCC cell lines Cell lines Sk-Hep-1, PLC/PRF/5, WRL, Focus, HLF, Hep3B, Huh-7, Huh-6, Chang showed reduction of DNA intensity compared with human normal liver genomic DNA
FIG 3 is a digital image of a Southern blot which compares representative primary human breast cancers (T) with healthy normal blood cells (N) from the same patient, and demonstrates a genomic deletion of the DLC- 1 gene in 7 of 15 primary breast cancers A representative 10 of the 15 primary tumors are shown DNA was digested with either (a) Bglll or (b) BamHI Cell lines IC 1 1 T, IC 12T, IC 13T, IC2T, IC6T, and IC7T showed reduction of DNA intensity compared with normal DNA
FIG 4 is a digital image of a Southern blot which compares representative human colon cancer cell lines with normal DNA (lane 1 ), and demonstrates a genomic deletion of the DLC- 1 gene in two out of five colon cancer cell lines Cell lines SW1 1 16 and SW403 (lanes 5 and 6) showed reduction of DNA intensity compared with normal DNA (lane 1)
FIG 5 is a digital image of a Northern blot showing the mRNA expression of the DLC- 1 gene in normal human tissues The DLC- 1 gene is expressed in all normal tissues tested as a 7 5 kb major transcript and a 4 5 kb minor transcript
FIG 6 is a digital image of a Northern blot comparing the mRNA expression of DLC-1 gene in normal human tissues (NL-RNA) and HCC cell lines DLC- 1 mRNA expression was decreased or not detected in the WRL, 7703, Chang and Focus HCC cell lines FIG. 7 is a digital image of a Northern blot comparing the mRNA expression of DLC-1 gene in normal human tissues (CDD33C0) and human colon cancer cell lines. DLC-1 mRNA was expression was decreased or not detected in HCT-15, LS 147T, DLD- 1. HD29, SW1 1 16, T84, SW1417, SW403, SW948, LS180, and SW48 cell lines. FIG. 8 is a digital image of a Northern blot showing the mRNA expression of DLC-1 gene in three human prostate cancer cell lines. DLC-1 mRNA was not detected in the LN-Cap and SP3504 cell lines.
FIG. 9 is a schematic drawing of the human DLC-1 gene. Exons 1-14 are represented by boxes, with introns represented by the lines connecting the boxes. FIG. 10 is a schematic drawing of how the mouse DLC- 1 gene was targeted using homologous recombination. The resulting construct can be used to generate DLC-1 homozygous knock-out mice.
SEQUENCE LISTING The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
Seq. I.D. No. 1 is the nucleotide sequence of the human DLC-1 cDNA. Seq. I.D. No. 2 is the amino acid sequence of the human DLC-1 protein.
Seq. I.D. Nos. 3-4 are oligonucleotide sequences of PCR primers which can be used to amplify the entire DLC-1 cDNA molecule.
Seq. I.D. Nos. 5-6 are oligonucleotide sequences of PCR primers which can be used to amplify the open reading frame of the DLC-1 cDNA molecule. Seq. I.D. Nos. 7-8 are the oligonucleotide sequences of PCR primers used to screen a human genomic library.
Seq. I.D. Nos. 9- 1 1 are the oligonucleotide sequences of the primers used for 5' and 3' RACE.
Seq. I.D. No. 12 is the nucleotide sequence for the L7-3 probe. Seq. I.D. No. 13 is the nucleotide sequence for the P-35 probe.
Seq. I.D. No. 14 is the nucleotide sequence for part of the human genomic DLC-1 sequence.
Seq. I.D. No. 15 is the nucleotide sequence for part of the human genomic DLC- 1 sequence. Seq. I.D. No. 16 is the nucleotide sequence for part of the human genomic DLC- 1 sequence. Seq I D No 17 is the nucleotide sequence for part of the human genomic DLC- 1 sequence Seq I D No 18 is the nucleotide sequence for part of the human genomic DLC- 1 sequence
Seq I D No 19 is the nucleotide sequence for part of the human genomic DLC- 1 sequence
Seq I D No 20 is the nucleotide sequence for part of the mouse genomic DLC-1 sequence
Seq I D No 21 is the nucleotide sequence for part of the mouse genomic DLC-1 sequence
Seq I D No 22 is the nucleotide sequence for part of the mouse genomic DLC- 1 sequence
Seq I D No 23 is the nucleotide sequence for part of the mouse genomic DLC- 1 sequence Seq I D No 24 is the nucleotide sequence for part of the mouse genomic DLC-1 sequence
Seq I D No 25 is the nucleotide sequence for part of the mouse genomic DLC-1 sequence Seq I D No 26 is the nucleotide sequence for a cDNA fragment of the mouse DLC- 1 sequence Seq I D No 27 is the nucleotide sequence for a cDNA fragment of the mouse DLC-1 sequence Seq I D No 28 is the nucleotide sequence for a cDNA fragment of the mouse DLC- 1 sequence Seq I D No 29 is the nucleotide sequence for a cDNA fragment of the mouse DLC-1 sequence
Seq I D No 30 is the nucleotide sequence for a cDNA fragment of the mouse DLC-1 sequence Seq I D No 31 is the nucleotide sequence for a cDNA fragment of the mouse DLC-1 sequence
DETAILED DESCRIPTION OF THE INVENTION
The present invention discloses the isolation of the full length cDNA and the chromosomal localization of a new gene, called the DLC-1 gene As discussed in Examples 1-3 below, deletion of the DLC- 1 gene has been detected in about half of the primary HCC tumor cells and in a majority of the HCC cell lines which were studied In addition, studies of other cancers revealed that DLC-1 was also deleted in 7 of 15 primary breast cancers and in 2 of 5 CRC cell lines Moreover, the DLC- 1 gene was not expressed in 29% of HCC cell lines 64% of CRC cell lines and 67% of PC cell lines These frequent deletions suggest that the DLC- 1 gene is a tumor suppressor gene for HCC as well as PC, BC and CRC
The full-length cDNA for DLC- 1 is 3850 bp long (Seq I D No 1 ) and encodes a protein of 1091 amino acids (Seq I D No 2) Fluorescent in situ hybridization has generally localized the gene on the short arm of chromosome 8 at bands p21 3-22
Further evidence that the DLC-1 gene acts as a tumor suppressor is found in its 86% homology with the rat pl22 RhoGAP gene (Homma and Emoπ, EMBO J 14 286-91 , 1995) The rat pi 22 RhoGAP gene encodes a GTPase activating protein that catalvzes the conversion of the active GTP-bound Rho complex to an inactive GDP-bound one The Rho family proteins, a subfamily of the Ras small GTP binding superfamily, function as important regulators in the organization of actin cytoskeleton (Nobes, et al , Cell 81 53-62, 1995) Rho proteins are also involved in Ras-mediated oncogemc transformation (Khosravi-Far, et al , Adv Cancer Res 69 59- 105, 1997) GAP genes may function as tumor suppressors by down-regulating oncogemc Rho proteins (Quil am, et al Bioessavs 17 395-404, 1995, Wang, et al , Cancer Res 57 2478-84, 1997) Based on its substantial homology with the rat pi 22 RhoGAP gene, it appears likely the DLC- 1 gene is a human RhoGAP gene involved m the suppression of HCC tumors
DEFINITIONS In order to facilitate review of the various embodiments of the invention, the following definition of terms is provided
Breast Carcinoma (BC) breast cancer thought to result, in some instances, from the deletion or mutation of the DLC- 1 tumor suppressor gene cDNA (complementary DNA): a piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences which determine transcription cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells
Colorectal Carcinoma (CRC) colorectal cancer (such as adenocarcmoma) thought to result, in some instances, from the deletion or mutation of the DLC- 1 tumor suppressor gene
Deletion the removal of a sequence of DNA, the regions on either side being joined together
DLC-1 gene: a gene, the mutation of which is associated with hepatocellular, breast, colon and prostate carcinomas, and particularly adenocarcinomas of those organs A mutation of the DLC-1 gene may include nucleotide sequence changes, additions or deletions, including deletion of large portions or all of the DLC-1 gene The term "DLC- 1 gene" is understood to include the various sequence polymorphisms and allelic variations that exist within the population This term relates primarily to an isolated coding sequence, but can also include some or all of the flanking regulatory elements and/or intron sequences DLC-1 cDNA: a mammalian cDNA molecule which when transfected into DLC- 1 cells expresses the DLC-1 protein The DLC- 1 cDNA can be derived by reverse transcription from the mRNA encoded by the DLC-1 gene and lacks internal non-coding segments and transcription regulatory sequences present in the DLC-1 gene DLC-1 protein: the protein encoded by the DLC-1 cDNA, the altered expression or mutation of which can predispose to the development of certain cancers, such as hepatocellular carcinoma This definition is understood to include the various sequence polymorphisms that exist, wherein amino acid substitutions the protein sequence do not affect the essential functions of the protein DNA: deoxyπbonucleic acid DNA is a long chain polymer which comprises the genetic material of most living organisms (some viruses have genes comprising πbonucleic acid (RNA)) The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine, guanine, cytosine and thymine bound to a deoxyπbose sugar to which a phosphate group is attached Triplets of nucleotides, referred to as codons, in DNA molecules code for amino acid in a polypeptide The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed
Hepatocellular carcinoma (HCC): liver cancer thought to result, in some instances, from the deletion or mutation of the DLC-1 tumor suppressor gene Isolated: requires that the material be removed from its original environment For example, a naturally occurring DNA molecule present in a living animal is not isolated, but the same DNA molecule, separated from some or all of the coexisting materials in the natural system, is isolated
Mutant DLC-1 gene: a mutant form of the DLC- 1 gene which in some embodiments is associated with hepatocellular, breast, colon and/or prostate carcinoma
Mutant DLC-1 RNA: the RNA transcribed from a mutant DLC-1 gene Mutant DLC-1 protein: the protein encoded by a mutant DLC-1 gene Oligonucleotide: A linear polynucleotide sequence of up to about 200 nucleotide bases in length, for example a polynucleotide (such as DNA or RNA) which is at least 6 nucleotides, for example at least 15, 50, 100 or even 200 nucleotides long
ORF: open reading frame Contains a series of nucleotide triplets (codons) coding for am o acids without any termination codons These sequences are usually translatable into protein
PCR: polymerase chain reaction Describes a technique in which cycles of denaturation, annealing with primer, and then extension with DNA polymerase are used to amplify the number of copies of a target DNA sequence
Pharmaceutically acceptable carriers The pharmaceutically acceptable carriers useful in this invention are conventional Remington s Pharmaceutical Sciences, by E W Martin Mack Publishing Co , Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed
In general, the nature of the carrier will depend on the particular mode of administration being employed For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle For solid compositions (e g , powder, pill, tablet, or capsule forms) conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose starch or magnesium stearate In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate
Probes and primers Nucleic acid probes and primers may readily be prepared based on the nucleic acids provided by this invention A probe comprises an isolated nucleic acid attached to a detectable label or reporter molecule Typical labels include radioactive isotopes, gands, chemiluminescent agents, and enzymes Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e g , in Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al (Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences, 1987)
Primers are short nucleic acids, for example DNA oligonucleotides 15 nucleotides or more m length Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme Primer pairs can be used for amplification of a nucleic acid sequence, e g , by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art Methods for preparing and using probes and primers are described, for example, in
Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989), Ausubel et al (Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley- Intersciences, 1987), and Innis et al , (PCR Protocols, A Guide to Methods and Applications, Innis et al (eds ), Academic Press, Inc , San Diego, California, 1990) PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0 5, © 1991 , Whitehead Institute for Biomedical Research, Cambridge, MA)
Prostate Carcinoma (PC) prostate cancer (such as prostatic adenocarcinoma) thought to result, in some instances, from the deletion or mutation of the DLC-1 tumor suppressor gene Protein: a biological molecule expressed by a gene and comprised of amino acids Purified: the term "purified" does not require absolute purity, rather, it is intended as a relative term Thus, for example, a purified protein preparation is one in which the protein referred to is more pure than the protein in its natural environment within a cell Recombinant A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherw ise separated segments of sequence This artificial combination is often accomplished by chemical synthesis or, more commonly by the artificial manipulation of isolated segments of nucleic acids e g , by genetic engineering techniques
Representational Difference Analysis (RDA): a PCR-based subtractive hybridization technique used to identify differences in the mRNA transcripts present in closely related cell lines
Sequence identity the similarity between two nucleic acid sequences or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity Sequence identity is frequently measured in terms of percentage identity (or similarity or homology) the higher the percentage, the more similar are the two sequences
Methods of alignment of sequences for comparison are well-known in the art Various programs and alignment algorithms are described in Smith and Waterman, Adv Appl Math 2 482, 1981 , Needleman and Wunsch, J Mol Bio 48 443, 1970, Pearson and Lipman, Methods in Mol Biol 24 307-31 , 1988, Higgins and Sharp, Gene 73 237-44, 1988, Higgins and Sharp, CABIOS 5 151-3, 1989, Corpet et al , Wwc Acids Res 16 10881-90, 1988, Huang et al , Comp Appl BioSct 8 155- 65,1992, and Pearson et al , Meth Mol Biol 24 307-31, 1994
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al , J Mol Biol 215 403-10, 1990) is available from several sources, including the National Center for Biological Information (NBCI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx It can be accessed at http //www ncbi nlm nih gov/BLAST/ A description of how to determine sequence identity using this program is available at http //www ncbi nlm nih gov/BLAST/blast_help html
Homologs of the DLC-1 protein are typically characterized by possession of at least 70% sequence identity counted over the full length alignment with the disclosed amino acid sequence using the NCBI Blast 2 0, gapped blastp set to default parameters Such homologous peptides will more preferably possess at least 75%, more preferably at least 80% and still more preferably at least 90% or 95% sequence identity determined by this method When less than the entire sequence is being compared for sequence identity, homologs will possess at least 75% and more preferably at least 85% and more preferably still at least 90% or 95% sequence identity over short windows of 10-20 amino acids Methods for determining sequence identity over such short windows are described at http //www ncbi nlm nih gov/BLAST blast FAQs html One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only, it is entirely possible that strongly significant homologs or other variants could be obtained that fall outside of the ranges provided The present invention provides not only the peptide homologs that are described above, but also nucleic acid molecules that encode such homologs Transformed: A transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, pofection, and particle gun acceleration
Vector A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication A vector may also include one or more selectable marker genes and other genetic elements known in the art VNTR probes: Variable Number of Tandem Repeat probes These are highly polymorphic DNA markers for human chromosomes The polymorphism is due to variation in the number of tandem repeats of a short DNA sequence Use of these probes enables the DNA of an individual to be distinguished from that derived from another individual Tumor a neoplasm Neoplasm abnormal growth of cells
Cancer malignant neoplasm that has undergone characteristic anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and is capable of metastasis Malignant cells which have the properties of anaplasia invasion and metastasis Normal cells Non-tumor, non-malignant cells Mammal: This term includes both human and non-human mammals Similarly, the term "patient" includes both human and veterinary subjects
Animal Living multicellular vertebrate organisms, a category which includes, for example, mammals and birds
Transgenic Cell: transformed cells which contain foreign, non-native DNA Additional definitions of common terms in molecular biology may be found in Lewm,
B "Genes V" published by Oxford University Press
MATERIALS AND METHODS Primary HCC Samples and HCC Cell Lines All of the primary liver tumor DNAs were obtained from surgical resection of HCC tissues from patients in Qidong, China Each tumor sample was matched with its surrounding non- cancerous liver tissue DNAs were extracted after diagnosis of HCC with or without cirrhosis The tumors were Hepatitis B virus (HBV) positive for HBVsAg and/or PCR detection of HB Vx gene HCC cell lines were obtained from ATCC (Manassas, VA), Qidong Liver Cancer Institute, China, and Dr Curtis C Harris (Laboratory of Human Carcmogenesis, Division of Basic Sciences, National Cancer Institute) (Wang, et al , Chin J Oncol 3 241 -4, 1981) Breast, Prostate and Colorectal Carcinomas
All normal and CRC (adenocarcinomas) cell lines were purchased from ATCC (Manassas, VA) The PC cell lines (also adenocarcinomas) were obtained from The University of Texas M D Anderson Cancer Center (Houston, TX) The DNA from primary breast carcinomas and blood cells were obtained from patients in Iceland
Manipulation of Genetic Material
Unless otherwise specified, manipulation of genetic material was performed according to standard laboratory procedures, such as those described in Sambrook et al (Molecular Cloning A Laboratory Manual. Cold Spring Harbor, New York, 1989) and Ausubel et al (Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Intersciences, 1987)
Representational Difference Analysis (RDA)
One primary HCC, having a homozygous point mutation of the p53 gene, but not in its surrounding, non-cancerous liver tissue, was selected for analysis RDA was performed as originally described in Lisitsyn et al (Proc Natl Acad Sci USA 92 151-5, 1995), with tumor DNA as tester and normal liver DNA as driver Bglll (Promega, Madison, WI) was chosen as the restriction enzyme and its adaptors were used for direct preparation of amphcons and PCR-based subtractive hybridization The final difference products showing distinct bands in agarose gel were recovered after Bglll digestion and ligated into the Bglll site of dephosphorylated pSP72 vector (Promega) The recombinant difference products were then transfected into E coli DH 1 OB
Characterization of RDA Probes
Plasmids with distinct DNA inserts were selected for further analysis DNA sequencing was performed using the Dye Terminator Cycle DNA Sequencing kit (Perkm Elmer, Rockville, MD) Sequencing reaction products were purified by spin columns (Princeton Separations, Adelphia, NJ), and run on a 377 DNA Sequencer (Perkm Elmer/Applied Biosystems, Foster City, CA) The homology analysis was carried out by BLAST search of the GenBank DNA databases (Altschul, et al , J Mol Biol 215 403- 10, 1990) The RDA products that elicited significant homology or appeared in multiple clones, were selected for further Southern blot and/or Northern blot analysis
Conditions for Southern Analysis
Genomic DNA was isolated from tumor and non-tumor cell lysates and digested with restriction enzymes The digested DNA was separated by electrophoresis in a 1% agarose gel and transferred to nylon membrane for hybridization 50 ng of DNA probe was radio-labeled (Prime-It RmT, Stratagene) as per the manufacturers instructions and used for hybridization A probe for beta- actin was used as a standard to control for the amount of DNA loaded. Hybridization was performed at 68°C for 2-4 hours using Quickhybrid solution (Stratagene). Following hybridization, the membranes were washed three times at 37°C for 10 min in 1XSSC solution containing 0.1X SDS. This was followed by a single wash at 62°C for 30 min in 0.1XSSC solution containing 0.1 X SDS. Blots were exposed to a Phospholmager, and analyzed using Software ImageQuant Version 3.3 (Molecular Dynamics, Sunnyvale, CA) for quantitative analysis.
Conditions for Northern Analysis
Total RNA was extracted from cell lysates using TRIzol solution (Gibco-BRL). which was then separated in a 1% agarose gel and transferred to nylon membrane for hybridization. 50 ng of DNA probe was radio-labeled (Prime-It RmT, Stratagene) as per the manufacturers instructions and used for hybridization. A probe for GAPDH or beta-actin was used as a control for the amount of RNA loaded. Hybridization, washing, and analysis was performed as described above for Southern Hybridization.
5 ' and 3' RACE and cDNA Library Screening for cDNA Cloning
5' and 3' RACE (Rapid Amplification of cDNA Ends) were started from a deleted fragment detected with RDA, and performed using human placenta Marathon™ cDNA as template (Clontech, Inc., Palo Alto, CA). The primers used for RACE, generated from the L7-3 sequence (Seq. I.D. No. 12), are as follows:
PrRACE5: 5' CACTCCGGTCCTTGTAGTCTGGAACC 3' (Seq. I.D. No. 9) was used for the first round of PCR for 5' RACE.
PrRACE5N: 5' ATCCTCTTCATGAACTCGGGCACGG 3' (Seq. I.D. No. 10) was used as the nested primer in the second round of 5' RACE. PrRACE3: 5' GATCAAGGTTCTAGACTACAAGGACCG 3' (Seq. I.D. No. 1 1) was used for 3' RACE.
The final 5' RACE product, exhibiting the same band pattern as the deleted fragment in Northern blot hybridization, was labeled with -[32P]-dCTP to screen a 5' Strech cDNA library constructed from human lung tissue (Clontech, Inc.). The lambda DNA of positive clones was converted into plasmid DNA by transfecting lambda DNA into AMI bacterial cells. The full-length cDNA sequencing of positive clones was completed by primer walking and assembled by Sequencher™ 3.1 program.
Fluorescence in situ Hybridization (FISH) Gene Mapping and Comparative Genomic Hybridization (CGH)
A genomic probe isolated from human PI library was labeled with biotin and used for FISH chromosomal localization and CGH analysis. For both analyses, chromosomes prepared from methotrexate-synchronized normal peripheral lymphocyte cultures were used The original CGH protocol, described in Kal oniemi et al (Science 258 818-21 , 1992), was employed with minor modifications The conditions of hx bπdization, the detection of hybridization signals, digital-image acquisition, processing and analysis, and direct fluorescent signal localization on banded chromosomes were performed as previously described in Zimonjic et al (Cancer Genet Cytogenet 80 100-2, 1995)
The following examples are illustrative of the scope of the present invention
EXAMPLE 1
Detection of DLC-1 Deletion in Liver Cancer Cells by RDA
Primary HCC tumor samples, matched with surrounding non-cancerous liver tissue, were obtained as described above and analyzed by RDA Several RDA difference products were observed after the third round of hvbπdization/selection as distinct bands in agarose gel Twenty individual fragments were isolated and analyzed by Southern blot hybridization for deletions One clone, L7-3, of 600 bp (Seq I D No 12), showed loss of heterozygosity (LOH) in the primary tumor (FIG 1 ) BLAST search revealed that the L7-3 clone had homology to rat pi 22 RhoGAP cDNA (Homma and Emoπ, EMBO J 14 286-91 , 1995)
EXAMPLE 2
Southern Analysis HCC Cell Lines
To determine if the L7-3 clone is represented in a region recurrently deleted in HCC, 15 primary HCC tumors and 11 HCC-deπved cell lines were examined using Southern analysis as described above The DNA was digested with Bglll, and probed with L7-3 (Seq I D No. 12)
Seven of the fifteen primary HCC tumors (representatives are shown in FIG 1) and 9 of the 1 1 HCC cell lines (FIG 2) had a genomic deletion of the L7-3 clone compared to no deletions in the normal liver cells
Primary Breast Carcinomas
Using Southern analysis as described above, primary human breast cancer and corresponding patient blood cell DNA was digested with Bglll (FIG 3a) or BamHI (FIG 3b) and probed with full-length DLC-1 cDN A (Seq I D No 1) Genomic deletions of DLC-1 gene were detected in 7 of 15 human primary breast cancers (representatives are shown in FIG 3) Deletions were noted if the DNA intensity of the tumor tissues exhibited at least half the intensity when compared with their normal tissue DNA Samples IC 1 1 T, IC 12T, IC 13T, IC2T. IC6T, IC7T are representative for the genomic deletions in these experiments Southern analysis of these cells resulted in several bands As a control for DNA loading, the bands that remained unchanged in the tumor cells were used
Colon Carcinoma Cell Lines Using Southern analysis as described above, normal genomic DNA (Promega) and the
DNA from five CRC cell lines were digested with EcoRI. and probed with a mixture of L7-3 and P- 35 (Seq I D Nos 12 and 13) which correspond to exon 2 and exon 7 of the human DLC-1 gene (see FIG 9), respectively Genomic deletions of DLC- 1 gene were detected in two of five human CRC cell lines (FIG 4) Cell lines SW403 and SW1 1 16 showed half of the DNA intensity for probe P-35 when compared with normal genomic DNA (compare lanes 5 and 6 with lane 1) Interestingly, the signal was unaltered when the L7-3 probe was used, indicating that this region (exon 2) is not responsible for the development of CRC in these cell lines Therefore, the signal from L7-3 can be used as an internal control for the amount of DNA loaded
EXAMPLE 3
Northern Analysis HCC Cell Lines
Considering the significant DNA sequence homology of the L7-3 clone with rat RhoGAP cDNA, its mRNA expression was examined in both normal human tissues and HCC-deπved cell lines by Northern analysis as described above Analysis of mRNA isolated from several normal human tissues, including liver, demonstrated that the L7-3 clone (Seq I D No 12) hybridized to a 7 5 kb (major) transcript and a 4 5 kb (minor) transcript (FIG 5) that were detected in all normal tissues but not in 4 (WRL, 7703, Chang and Focus ) out of 14 human HCC-deπved cell lines (FIG 6)
Colorectal Carcinomas
Using Northern analysis as described above, RNA from normal and CRC cell lines was prepared and probed with the full-length DLC-1 cDNA (Seq I D No 1) In human CRC cell lines, 1 1 out of 17 (HCT-15, LS147T, DLD-1, HD29, SW1 1 16, T84, SW1417, SW403, SW948, LS180, SW48) showed noticeably decreased or no expression of DLC-1 mRNA (FIG 7) In this experiment, the normal human colon fibroblast cell line CDD33CO was used as a normal control
Prostate Carcinomas
Using Northern analysis as described above, RNA from PC cell lines was prepared and probed with the full-length DLC-1 cDNA (Seq I D No 1) Low levels or no DLC-1 gene expression was demonstrated by in two (LN-Cap and SP3504) out of three human PC cell lines (FIG 8) EXAMPLE 4 Obtaining the DLC-1 cDNA
The cDNA for the clone L7-3 was obtained by 5' RACE and 3' RACE coupled with cDNA library screening as described above The full-length cDNA of DLC-1 gene is 3850 bp long (Seq I D No 1 ) and encodes a protein of 1091 amino acids (Seq I D No 2) T he estimated molecular weight of DLC- 1 protein is 125 kD The untranslated regions of 5' end and 3' end of DLC-1 gene are 324 bp and 250 bp, respectively (Seq I D No 1 )
EXAMPLE 5 Chromosomal Localization of Human DLC-1
The DLC-1 gene was chromosomally localized using the materials and methods described above The majority of metaphases hybridized with biotin or digoxigenin-labeled genomic probe had fluorescent signal at identical sites on both chromatids of the short arm of chromosome 8 The signal was analyzed in 100 metaphases with both homologous labeled Fifty metaphases were examined by imaging of DAPI generated and enhanced G-like banding The fluorescent signals were distributed within region 8p21-22 However, over 50% of doublets were at bands 8p21 3-22, the most likely location of the DLC-1 gene
To further characterize the region harboring the DLC- 1 gene, the primary tumor DNA used as tester in RDA (94-25T) was analyzed by CGH The fluorescence profile for chromosome 8 demonstrated DNA loss on region of 8p23-q 1 1 2 and gain on region of 8q21 1 -q24 3
EXAMPLE 6 Cloning and Characterization of Human DLC-1
The DLC-1 cDN A sequence (Seq I D No 1) described above does not contain the introns, upstream transcπptional promoter or regulatory regions or downstream transcπptional regulatory regions of the DLC- 1 gene It is possible that some mutations in the DLC- 1 gene that may lead to HCC are not included in the cDNA but rather are located in other regions of the DLC- 1 gene Mutations located outside of the open reading frame that encodes the DLC-1 protein are not likely to affect the functional activity of the protein but rather are likely to result in altered levels of the protein in the cell For example, mutations in the promoter region of the DLC-1 gene may prevent transcription of the gene and therefore lead to the complete absence of the DLC-1 protein in the cell
Additionally, mutations within intron sequences in the genomic gene may also prevent expression of the DLC-1 protein Following transcription of a gene containing introns, the intron sequences are removed from the RNA molecule in a process termed splicing prior to translation of the RNA molecule which results in production of the encoded protein When the RNA molecule is spliced to remove the introns, the cellular enzymes that perform the splicing function recognize sequences around the mtron/exon border and in this manner recognize the appropriate splice sites If there is a mutation within the sequence of the intron close to the junction of the intron with an exon, the enzymes may not recognize the junction and ma\ fail to remove the intron If this occurs, the encoded protein will likely be defective Thus, mutations inside the intron sequences within the DLC- 1 gene (termed "splice site mutations") may also lead to the development of HCC However, knowledge of the exon structure and lntronic splice site sequences of the DLC- 1 gene is required to define the molecular basis of these abnormalities The provision herein of the DLC- 1 cDNA sequence (Seq I D No 1 ) enables the cloning of the entire DLC-1 gene (including the promoter and other regulatory regions and the intron sequences) and the determination of its nucleotide sequence With this information in hand, diagnosis of a genetic predisposition to HCC and other cancers based on DNA analysis will comprehend all possible mutagenic events at the DLC-1 locus
The ATCC deposit (98676) of the genomic DLC- 1 gene may be utilized in aspects of the present invention Alternatively, the DLC- 1 gene may be isolated by one or more routine procedures, including PCR-based screening of a human genomic PI library as described above Alternatively, the method described in WO 93/22435 can be utilized For example, a YAC library of human genomic sequences (Monaco and Lehrach, Proc Natl Acad Sci USA 88 4123-7, 1991) is screened for the DLC- 1 gene by the polymerase chain reaction (PCR) The library is arranged in a number (e g , 39) of primary DNA pools, prepared from high-density grids each containing around 300-400 YAC clones Primary pools are screened by PCR to identify a pool which contains a positive clone A secondary PCR screen is then performed on the appropriate set of eight row and 12 column pools, as described by Bentley et al (Genomics 12 534-41 , 1992) PCR primers based on the DLC-1 cDNA sequence are used as a sequence tagged site (STS) for the 3' region of the gene The yeast DNA is then amplified with these primers by PCR for 30 cycles of 94 °C for 1 minute, 60°C for 1 minute and 72°C for 1 minute, with a final 5 minute extension at 72°C Confirmation that positive YAC clones contain the majority of the coding sequence of the DLC- 1 genomic gene is obtained by amplification of an STS from the 5' end of the cDNA Exon boundaries of the DLC-1 gene are then characterized, e g , by the vectorette PCR method This strategy has been described in detail previously (Roberts et al , Genomics 13 942-50, 1992)
With the sequences of the DLC- 1 cDNA and DLC- 1 gene in hand, primers derived from these sequences may be used in diagnostic tests (described below) to determine the presence of mutations in any part of the genomic DLC-1 gene of a patient Such primers will be oligonucleotides comprising a fragment of sequence from the DLC-1 gene (either intron sequence, exon sequence or a sequence spanning an intron-exon boundary) and will comprise at least 15 consecutive nucleotides of the DLC-1 cDNA or gene It will be appreciated that greater specificity may be achieved by using primers of greater lenghts Thus, in order to obtain enhanced specificity, the primers used may comprise 20, 25, 30 or even 50 consecutive nucleotides of the DLC-1 cDNA or gene Furthermore, with the provision of the DLC-1 intron sequence information the analysis of a large and as yet untapped source of patient material for mutations will now be possible using methods such as chemical cleavage of mismatches (Cotton et al Proc Natl Acad Sci U S A 85 4397-401 1988 Montandon et al , Nucleic Acids Res 9 3347-58 1989) and single-strand conformational polymorphism analysis (Oπta et al , Genomics 5 874-879, 1989) Additional experiments may now be performed to identify and characterize regulatory elements flanking the DLC- 1 gene These regulatory elements may be characterized by standard techniques including deletion analyses wherein successive nucleotides of a putative regulatory region are removed and the effect of the deletions are studied by either transient or long-term expression analyses experiments The identification and characterization of regulatory elements flanking the genomic DLC-1 gene may be made by functional experimentation (deletion analyses, etc ) in mammalian cells by either transient or long-term expression analyses
Having provided a genomic clone for the human DLC-1 gene (Seq I D Nos 14-19), it will be apparent to one skilled in the art that either the genomic clone or the cDNA or sequences derived from these clones may be utilized in applications of this invention, including but not limited to, studies of the expression of the DLC-1 gene, studies of the function of the DLC-1 protein, the generation of antibodies to the DLC-1 protein diagnosis and therapy of DLC-1 deleted or mutated patients to prevent or treat the onset of HCC Descriptions of applications describing the use of DLC-1 cDNA are therefore intended to comprehend the use of the genomic DLC-1 gene It will also be apparent to one skilled in the art that homologs of this gene may now be cloned from other species, such as the rat or the mouse, by standard cloning methods Such homologs will be useful in the production of animal models of HCC
To facilitate the detection of point mutations in liver and other cancers that exhibit alteration at region 8p 12-22, the human DLC-1 gene was cloned and the intron/exon sequences characterized (Seq I D Nos 14-19 and FIG 9) Human DLC-1 is approximately 25 kb, and contains 14 exons The largest exon is exon 2, at 1 5 kb, while the remaining exons are less than 300 bp on average (FIG 9)
EXAMPLE 7 Cloning Mouse DLC-1 A full understanding of the function of DLC-1 and its role in cancer development is essential This understanding can be facilitated by the generation of knock-out mice which contain a non-functional DLC-1 gene Prior to generating knock-out mice, the partial cDNA (Seq I D Nos 26-31 ) and partial genomic (Seq I D Nos 20-25) mouse DLC- 1 sequences were determined
Mouse DLC- 1 genomic DNA was cloned and localized to chromosome 8 by FISH (see above for methods) using a mouse DLC- 1 genomic DNA clone as the probe Mouse DLC-1 is in a syntenic region of the human DLC-1 gene The localization of DLC-1 gene in mice may permit studies with in vivo models for carcmogenesis EXAMPLE 8 Generating Transgenic Mice
Methods for generating transgenic mice are described in Gene Targeting A L Joyuner ed , Oxford University Press, 1995 and Watson, J D et al , Recombinant DNA 2nd Ed , W H
Freeman and Co , New York 1992, Chapter 14 To specifically generate transgenic mice containing a functional deletion of the DLC- 1 gene, a 1 5 kb fragment in the front of exon 2 and another 5 5 kb fragment spanning from intron 2 to intron 5 were used as short arm and long arm, respectively Between long arm and short arm, the neo gene was introduced, generating the vector shown in FIG 10, referred to as the knock-out vector herein
Using standard transgenic mouse technology, the vector shown in FIG 10 can be used to generate DLC-1 knock-out mice by homologous recombination The knock-out vector is introduced into embryonic stem cells (ES cells) by standard methods which may include transfection, retroviral infection or electroporation (also see Example 1 1) The transfected ES cells expressing the knock-out vector will grow in medium containing the antibiotic G418 The neomycin resistant ES cells will be microinjected into mouse embryos (blastocysts), which are implanted into the uterus of pseudopregnant mice The litter will be screened for chimeπc mice by observing their coat color Chimeπc mice are ones in which the injected ES cells developed into the germ line, thereby allowing transmission of the gene to their offspring The resulting heterozygotic mice will be mated to generate a homozygous line of transgenic mice functionally deleted for DLC- 1 These homozygous mice will then be screened phenotypically, for example, their predisposition to developing cancer
EXAMPLE 9 Preferred Method of Making the DLC-1 cDNA
The foregoing discussion describes the original means by which the DLC-1 cDNA was obtained and also provides the nucleotide sequence of this clone With the provision of this sequence information, the polymerase chain reaction (PCR) may now be utilized in a more direct and simple method for producing the DLC-1 cDNA Essentially, total RNA is extracted from human cells by any one of a variety of methods routinely used, Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al (In Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences, 1987) provide descriptions of methods for RNA isolation Any human cell line derived from a non-DLC- 1 deleted individual would be suitable, such as the widely used HeLa cell line, or the WI-38 human skin fibroblast cell line available from the American Type Culture Collection, Rockville, MD The extracted RNA is then used as a template for performing the reverse transcπption-polymerase chain reaction (RT-PCR) amplification of cDNA Methods and conditions for RT-PCR are described in Kawasaki et al. (In PCR Protocols. A Guide to Methods and Applications, Innis et al. (eds.), pp. 21-27, Academic Press. Inc., San Diego. California, 1990). The selection of PCR primers will be made according to the portions of the cDNA which are to be amplified. Primers may be chosen to amplify small segments of a cDNA or the entire cDNA molecule. Variations in amplification conditions may be required to accommodate primers of differing lengths; such considerations are well known in the art and are discussed in Innis et al. (PCR Protocols. A Guide to Methods and Applications, Innis et al. (eds.), Academic Press, Inc., San Diego. California, 1990). The entire DLC-1 cDNA molecule may be amplified using the following combination of primers: 5' TAT GGG CTC GAG CGG CCG CCC 3' (Seq. I.D. No. 3)
5' CGC ACA GTC TTA CAT ATT CCA 3' (Seq. I.D. No. 4) The open reading frame of the cDNA molecule may be amplified using the following combination of primers:
5' ATG TGC AGA AAG AAG CCG GAC ACC 3' (Seq. I.D. No.5) 5' CCT AGA TTT GGT GTC TTT GGT TTC 3' (Seq. I.D. No.6)
These primers are illustrative only; it will be appreciated by one skilled in the art that many different primers may be derived from the provided cDNA sequence in order to amplify particular regions of these cDNAs.
EXAMPLE 10 Sequence Variants of DLC-1
The nucleotide sequence of the DLC- 1 cDNA (Seq. I.D. No. 1 ) and the amino acid sequence of the DLC- 1 protein (Seq. I.D. No. 2) which is encoded by that cDNA, respectively are shown in FIG. 5. Having presented the nucleotide sequence of the DLC-1 cDNA and the amino acid sequence of the protein, this invention now also facilitates the creation of DNA molecules, and thereby proteins, which are derived from those disclosed but which vary in their precise nucleotide or amino acid sequence from those disclosed. Such variants may be obtained through a combination of standard molecular biology laboratory techniques and the nucleotide sequence information disclosed by this invention.
Variant DNA molecules include those created by standard DNA mutagenesis techniques, for example. Ml 3 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989, Ch. 15). By the use of such techniques, variants may be created which differ in minor ways from those disclosed. DNA molecules and nucleotide sequences which are derivatives of those specifically disclosed herein and which differ from those disclosed by the deletion, addition or substitution of nucleotides while still encoding a protein which possesses the functional characteristic of the DLC- 1 protein are comprehended by this invention. Also within the scope of this invention are small DNA molecules which are derived from the disclosed DNA molecules. Such small DNA molecules include oligonucleotides suitable for use as hybridization probes or polymerase chain reaction (PCR) primers. As such, these small DNA molecules will comprise at least a segment of the DLC- 1 cDN A molecule or the DLC-1 gene and, for the puφoses of PCR. will comprise at least a 15 nucleotide sequence and, more preferably, a 20-50 nucleotide sequence of the DLC-1 cDNA (Seq. I.D. No. 1 ) or the DLC- 1 gene (Seq. I.D. Nos. 14-19) (i.e., at least 20-50 consecutive nucleotides of the DLC-1 cDNA or gene sequences). DNA molecules and nucleotide sequences which are derived from the disclosed DNA molecules as described above may also be defined as DNA sequences which hybridize under stringent conditions to the DNA sequences disclosed, or fragments thereof. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing DNA used. Generally, the temperature of hybridization and the ionic strength (especially the Na" concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989 ch. 9 and 1 1), herein incoφorated by reference. By way of illustration only, a hybridization experiment may be performed by hybridization of a DNA molecule (for example, a deviation of the DLC-1 cDNA) to a target DNA molecule (for example, the DLC-1 cDNA) which has been electrophoresed in an agarose gel and transferred to a nitrocellulose membrane by Southern blotting (Southern, J. Mol. Biol. 98:503, 1975), a technique well known in the art and described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989). Hybridization with a target probe labeled with [32P]-dCTP is generally carried out in a solution of high ionic strength such as 6xSSC at a temperature that is 20-25°C below the melting temperature, Tm, described below. For such Southern hybridization experiments where the target DNA molecule on the Southern blot contains 10 ng of DNA or more, hybridization is typically carried out for 6-8 hours using 1-2 ng/ml radiolabeled probe (of specific activity equal to 109 CPM/μg or greater). Following hybridization, the nitrocellulose filter is washed to remove background hybridization. The washing conditions should be as stringent as possible to remove background hybridization but to retain a specific hybridization signal. The term Tm represents the temperature above which, under the prevailing ionic conditions, the radiolabeled probe molecule will not hybridize to its target DNA molecule. The 7j_ of such a hybrid molecule may be estimated from the following equation (Bolton and McCarthy, Proc. Nad. Acad. Sci. USA 48: 1390, 1962):
Tm = 81.5°C - 16.6(log10[Na+]) + 0.41(%G+C) - 0.63(% formamide) - (600//) Where / = the length of the hybrid in base pairs.
This equation is valid for concentrations of Na" in the range of 0.01 M to 0.4 M. and it is less accurate for calculations of Tm in solutions of higher [Na+j\ The equation is also primarily valid for DNAs whose G+C content is in the range of 30% to 75%. and it applies to hybrids greater than -99-
100 nucleotides in length (the behavior of oligonucleotide probes is described in detail in Ch 1 1 of Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor. New York 1989)
Thus, by way of example, for a 150 base pair DNA probe derived from the open reading frame of the DLC-1 cDNA ( ith a hypothetical %GC = 45%), a calculation of hybridization conditions required to give particular stringencies may be made as follows
For this example, it is assumed that the filter will be washed in 0 3 xSSC solution following hybridization, thereby
[Na ] = 0 045M
%GC = 45% Formamide concentration = 0
I - 150 base pairs
Tm = 81 5 - 16(logI0[Na-]) + (0 41 x 45) - ^ and so 7m = 74 4°C
The Tm of double-stranded DNA decreases by 1- 1 5 °C with every 1% decrease in homology (Bonner et al , J Mol Biol 81 123, 1973) Therefore, for this given example, washing the filter in 0 3 xSSC at 59 4-64 4CC will produce a stringency of hybridization equivalent to 90%, that is, DNA molecules with more than 10% sequence variation relative to the target DLC- 1 cDNA will not hybridize Alternatively, washing the hybridized filter in 0 3 xSSC at a temperature of 65 4-68 4°C will yield a hybridization stringency of 94%, that is, DNA molecules with more than 6% sequence variation relative to the target DLC-1 cDNA molecule will not hybridize The above example is given entirely by way of theoretical illustration One skilled in the art will appreciate that other hybridization techniques may be utilized and that variations in experimental conditions will necessitate alternative calculations for stringency
In particular embodiments of the present invention, stringent conditions may be defined as those under which DNA molecules with more than 25% sequence variation (also termed
"mismatch") will not hybridize In a more particular embodiment, stringent conditions are those under which DNA molecules with more than 15% mismatch will not hybridize, and more preferably still, stringent conditions are those under which DNA sequences with more than 10% mismatch will not hybridize In another embodiment, stringent conditions are those under which DNA sequences with more than 6% mismatch will not hybridize
The degeneracy of the genetic code further widens the scope of the present invention as it enables major variations in the nucleotide sequence of a DNA molecule while maintaining the ammo acid sequence of the encoded protein For example, the sixteenth amino acid residue of the DLC-1 protein is alanine This is encoded in the DLC-1 cDNA by the nucleotide codon triplet GCC Because of the degeneracy of the genetic code, three other nucleotide codon triplets, GCT, GCG and GCA, also code for alanine Thus, the nucleotide sequence of the DLC-1 cDNA could be changed at -9"
this position to any of these three codons without affecting the amino acid composition of the encoded protein or the characteristics of the protein. The genetic code and variations in nucleotide codons for particular amino acids is presented in Tables 1 and 2. Based upon the degeneracy of the genetic code, variant DNA molecules may be derived from the cDNA molecules disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences. DNA sequences which do not hybridize under stringent conditions to the cDNA sequences disclosed by virtue of sequence variation based on the degeneracy of the genetic code are herein also comprehended by this invention.
The invention also includes DNA sequences that are substantially identical to any of the DNA sequences disclosed herein, where substantially identical means a sequence that has identical nucleotides in at least 75% of the aligned nucleotides, for example 80%, 85%, 90%, 95% or 98% identity of the aligned sequences.
TABLE 1 The Genetic Code
First Third
Position Position
(5' end) Second Position (3' end)
Phe Ser Tyr Cys T Phe Ser Tyr Cys c T Leu Ser Stop (och) Stop A Leu Ser Stop (amb) T G
Leu Pro His Arg T
Leu Pro His Arg c
C Leu Pro Gin Arg A
Leu Pro Gin Arg G
He Thr Asn Ser T lie Thr Asn Ser c A A He Thr Lys Arg A
Met Thr Lys Arg G
Val Ala Asp Gly T Val Ala Asp Gly c G Val Ala Glu Gly A Val (Met) Ala Glu Gly G
"Stop (och)" stands for the ochre termination triplet, and "Stop (amb)" for the amber. ATG is the most common initiator codon; GTG usually codes for valine, but it can also code for methionine to initiate an mRNA chain. TABLE 2
The Degeneracy of the Genetic Code
Number of Total Number of
Synonymous Codons Amino Acid Codons
6 Leu, Ser, Arg 18
4 Gly, Pro, Ala. Val, Thr 20
He ->
2 Phe, Tyr, Cys, His, Gin, 18 Glu, Asn, Asp, Lys 1 Met, Tφ 2
Total number of codons for amino acids 61
Number of codons for termination
Total number of codons in genetic code 64
One skilled in the art will recognize that the DNA mutagenesis techniques described above may be used not only to produce variant DNA molecules, but will also facilitate the production of proteins which differ in certain structural aspects from the DLC-1 protein, yet which proteins are clearly derivative of this protein and which maintain the essential characteristics of the DLC-1 protein. Newly derived proteins may also be selected in order to obtain variations on the characteristic of the DLC-1 protein, as will be more fully described below. Such derivatives include those with variations in amino acid sequence including minor deletions, additions and substitutions. While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at the target codon or region and the expressed protein variants screened for the optimal combination of desired activity. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence as described above are well known. Amino acid substitutions are typically of single residues; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. Obviously, the mutations that are made in the DNA encoding the protein must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure.
Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Table 3 when it is desired to finely modulate the characteristics of the protein. Table 3 shows amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions.
TABLE 3 Original Residue Conservative Substitutions
Ala Ser
Arg Lys
Asn gin, his
Asp Glu
Cys Ser
Gin Asn
Glu Asp
Gly Pro
His asn; gin
He leu, val
Leu ile; val
Lys arg; gin; glu
Met leu; ile
Phe met; leu; tyr
Ser Thr
Thr Ser
Tφ Tyr
Tyr tφ; phe
Val ile; leu
Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 3, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in protein properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine.
The effects of these amino acid substitutions or deletions or additions may be assessed for derivatives of the DLC-1 protein by assays in which DNA molecules encoding the derivative proteins are transfected into DLC-1 cells using routine procedures. The DLC-1 gene, DLC- 1 cDNA, DNA molecules derived therefrom and the protein encoded by the cDNA and derivatives thereof may be utilized in aspects of both the study of HCC and for diagnostic and therapeutic applications related to HCC. Utilities of the present invention include, but are not limited to, those utilities described in the examples presented herein. Those skilled in the art will recognize that the utilities herein described are not limited to the specific experimental modes and materials presented and will appreciate the wider potential utility of this invention
EXAMPLE 11
Expression of DLC-1 cDNA Sequences
With the provision of the DLC-1 cDNA (Seq I D No 1 ), the expression and purification of the DLC- 1 protein b\ standard laboratory techniques is now enabled The purified protein may be used for functional analyses, antibody production, diagnostics and patient therapy Furthermore, the DNA sequence of the DLC- 1 cDNA can be manipulated in studies to understand the expression of the gene and the function of its product Mutant forms of the DLC- 1 may be isolated based upon information contained herein, and may be studied in order to detect alteration in expression patterns in terms of relative quantities, tissue specificity and functional properties of the encoded mutant DLC- 1 protein Partial or full-length cDNA sequences, which encode for the subject protein, may be ligated into bacterial expression vectors Methods for expressing large amounts of protein from a cloned gene introduced into Escherichia coli (E coli) may be utilized for the purification, localization and functional analysis of proteins For example, fusion proteins consisting of amino terminal peptides encoded by a portion of the E coli lacZ or trpE gene linked to DLC-1 proteins may be used to prepare polyclonal and monoclonal antibodies against these proteins Thereafter, these antibodies may be used to purify proteins by lmmunoaffinity chromatography, in diagnostic assays to quantitate the levels of protein and to localize proteins in tissues and individual cells by immunofluorescence
Intact native protein may also be produced in E coli in large amounts for functional studies Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al (In Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989, ch 17) herein incoφorated by reference Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response Native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient πbosome binding site upstream of the cloned gene If low levels of protein are produced, additional steps may be taken to increase protein production, if high levels of protein are produced, purification is relatively easy Suitable methods are presented in Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989) and are well known in the art Often, proteins expressed at high levels are found in insoluble inclusion bodies Methods for extracting proteins from these aggregates are described by Sambrook et al (In Molecular Cloning A Laboratory Manual, Cold Spring Harbor. New York, 1989, ch 17) Vector systems suitable for the expression of lacZ fusion genes include the pUR series of vectors (Ruther and Muller-Hill, EMBO J 2 1791 , 1983), pEXl-3 (Stanley and Luzio, EMBO J 3 1429, 1984) and pMRl OO (Gray et al , Proc Natl Acad Sci US4 79 6598, 1982) Vectors suitable for the production of intact native proteins include pKC30 (Shimatake and Rosenberg, Nature 292 128 1981 ), pKK177-3 (Amann and Brosius, Ge«e 40 183, 1985) and pET-3 (Studiar and Moffatt J Mol Biol 189 1 13, 1986) DLC-1 fusion proteins may be isolated from protein gels, lyophihzed, ground into a powder and used as an antigen The DNA sequence can also be transferred from its existing context in pREP4 to other cloning vehicles, such as other plasmids, bacteπophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al , Science 236 806- 12, 1987) These vectors may then be introduced into a vaπet\ of hosts including somatic cells and simple or complex organisms, such as bacteria, fungi (Timberlake and Marshall, Science 244 1313-7 1989), invertebrates, plants (Gasser and Fraley, Science 244 1293, 1989), and pigs (Pursel et al , Science 244 1281 -8, 1989), which cell or organisms are rendered transgenic by the introduction of the heterologous DLC-1 cDNA
For expression in mammalian cells, the cDNA sequence may be ligated to heterologous promoters, such as the simian virus (SV) 40, promoter in the pSV2 vector (Mulligan and Berg, Proc Natl Acad Sci USA 78 2072-6, 1981), and introduced into cells, such as monkey COS-1 cells (Gluzman, Cell 23 175-182, 1981 ), to achieve transient or long-term expression The stable integration of the chimeπc gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, J Mol Appl Genet 1 327-41 , 1982) and mycophenohc acid (Mulligan and Berg, Proc Natl Acad Sci USA 78 2072-6, 1981)
DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, hgation of synthetic or cloned DNA sequences, site-directed sequence- alteration via single-stranded bacteπophage intermediate or with the use of specific oligonucleotides in combination with PCR
The cDNA sequence (or portions derived from it) or a mini gene (a cDNA with an intron and its own promoter) may be introduced into eukaryotic expression vectors by conventional techniques These vectors are designed to permit the transcription of the cDNA in eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription of the cDNA and ensure its proper splicing and polyadenylation Vectors containing the promoter and enhancer regions of the SV40 or long terminal repeat (LTR) of the Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan and Berg, Proc Natl Acad Sci USA 78 2072-6, 1981 , Gorman et al , Proc Natl Acad Sci USA 78 6777-6781 , 1982) The level of expression of the cDNA can be manipulated with this type of vector, either by using promoters that have different activities (for example, the baculovirus pAC373 can express cDNAs at high levels in S frugiperda cells (Summers and Smith, In Genetically Altered Viruses and the Environment, Fields et al (Eds ) 22 319-328, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1985) or by using vectors that contain promoters amenable to modulation, for example, the glucocorticoid- responsive promoter from the mouse mammary tumor virus (Lee et al , Nature 294 228, 1982) The - 7f
expression of the cDNA can be monitored in the recipient cells 24 to 72 hours after introduction (transient expression)
In addition, some vectors contain selectable markers such as the g_p_t (Mulligan and Berg, Proc Natl Acad Sci USA 78 2072-6 1981 ) or neo (Southern and Berg, J Mol Appl Genet 1 327-41 , 1982) bacterial genes These selectable markers permit selection of transfected cells that exhibit stable, long-term expression of the vectors (and therefore the cDNA) The vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses such as papilloma (Sarver et al , Mol Cell Biol 1 486, 1981 ) or Epstein-Barr (Sugden et al , Mol Cell Biol 5 410, 1985) Alternatively, one can also produce cell lines that have integrated the vector into genomic DNA Both of these types of cell lines produce the gene product on a continuous basis One can also produce cell lines that have amplified the number of copies of the vector (and therefore of the cDNA as well) to create cell lines that can produce high levels of the gene product (Alt et al , J Biol Chem 253 1357, 1978)
The transfer of DNA into eukaryotic, in particular human or other mammalian cells, is now a conventional technique The vectors are introduced into the recipient cells as pure DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vander Eb, Virology 52 466, 1973) or strontium phosphate (Brash et al , Mol Cell Biol 7 2013, 1987), electroporation (Neumann et al , EMBO J 1 841 , 1982), hpofection (Feigner et al , Proc Natl Acad Sci USA 84 7413, 1987), DEAE dextran (McCuthan et al , J Natl Cancer Inst 41 351 , 1968), microinjection (Mueller et al , Cell 15 579, 1978), protoplast fusion (Schafner, Proc Natl Acad Sci USA 11 2163-7, 1980), or pellet guns (Klein et al , Nature 327 70, 1987) Alternatively, the cDNA can be introduced by infection with virus vectors Systems are developed that use, for example, retroviruses (Bernstein et al , Gen Engrg 7 235, 1985), adenoviruses (Ahmad et al , J Virol 57 267, 1986), or Heφes virus (Spaete et al, Cell 30 295. 1982) These eukaryotic expression systems can be used for studies of the DLC- 1 gene and mutant forms of this gene, the DLC-1 protein and mutant forms of this protein Such uses include, for example, the identification of regulatory elements located in the 5' region of the DLC-1 gene on genomic clones that can be isolated from human genomic DNA libraries using the information contained in the present invention The eukaryotic expression systems may also be used to study the function of the normal complete protein, specific portions of the protein, or of naturally occurring or artificially produced mutant proteins
Using the above techniques, the expression vectors containing the DLC-1 gene sequence or fragments or variants or mutants thereof can be introduced into human cells, mammalian cells from other species or non-mammalian cells as desired The choice of cell is determined by the puφose of the treatment For example, monkey COS cells (Gluzman, Cell 23 175-182, 1981 ) that produce high levels of the SV40 T antigen and permit the replication of vectors containing the SV40 oπgin of replication may be used Similarly, Chinese hamster ovary (CHO), mouse NIH 3T3 fibroblasts or human fibroblasts or lymphoblasts (as described herein) may be used
The following is provided as one exemplary method to express DLC- 1 polypeptide from the cloned DLC-1 cDNA sequences in mammalian cells Cloning vector pXTI, commercially available from Stratagene, contains the Long Terminal Repeats (LTRs) and a portion of the GAG gene from Moloney Murine Leukemia Virus The position of the viral LTRs allows highly efficient, stable transfection of the region within the LTRs The vector also contains the Heφes Simplex Thymidine Kinase promoter (TK), active in embryonal cells and in a wide variety of tissues in mice, and a selectable neomycin gene conferring G418 resistance Two unique restriction sites Bglll and Xhol are directly downstream from the TK promoter DLC-1 cDNA including the entire open reading frame for the DLC- 1 protein and the 3' untranslated region of the cDNA is cloned into one of the two unique restriction sites downstream from the promoter
The ligated product is transfected into mouse NIH 3T3 cells using Lipofectin (Life Technologies, Inc ) under conditions outlined in the product specification Positive transfectants are selected after growing the transfected cells in 600 μg ml G418 (Sigma, St Louis, MO) The protein is released into the supernatant and may be purified by standard lmmunoaffinity chromatography techniques using antibodies raised against the DLC-1 protein, as described below
Expression of the DLC- 1 protein in eukaryotic cells may also be used as a source of proteins to raise antibodies The DLC-1 protein may be extracted following release of the protein into the supernatant as described above, or, the cDNA sequence may be incoφorated into a eukaryotic expression vector and expressed as a chimeπc protein with, for example, β-globm Antibody to β-globm is thereafter used to purify the chimeπc protein Corresponding protease cleavage sites engineered between the β-globin gene and the cDNA are then used to separate the two polypeptide fragments from one another after translation One useful expression vector for generating β-globm chimeπc proteins is pSG5 (Stratagene) This vector encodes rabbit β-globin The present invention thus encompasses recombinant vectors which comprise all or part of the DLC-1 gene or cDNA sequences, for expression in a suitable host The DLC-1 DNA is operatively linked in the vector to an expression control sequence in the recombinant DNA molecule so that the DLC-1 polypeptide can be expressed The expression control sequence may be selected from the group consisting of sequences that control the expression of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof The expression control sequence may be specifically selected from the group consisting of the lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of fd coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter of the yeast alpha-mating factors and combinations thereof The host cell which may be transfected with the vector of this invention, may be selected from the group consisting of £ coli, Pseudomonas, Bacillus subtil is. Bacillus stearothermophilus or other bacilli other bacteria, yeast fungi, insect, mouse or other animal or plant hosts or human tissue cells It is appreciated that for mutant or variant DLC-1 DNA sequences, similar systems are employed to express and produce the mutant product
EXAMPLE 12 Production of an Antibody to DLC-1 Protein Monoclonal or polyclonal antibodies may be produced to either the normal DLC- 1 protein or mutant forms of this protein Optimally, antibodies raised against the DLC-1 protein would specifically detect the DLC-1 protein That is, such antibodies would recognize and bind the DLC- 1 protein and would not substantially recognize or bind to other proteins found in human cells The determination that an antibody specifically detects the DLC-1 protein is made by any one of a number of standard immunoassay methods, for instance, the Western blotting technique (Sambrook et al , Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989) To determine that a given antibody preparation (such as one produced in a mouse) specifically detects the DLC-1 protein by Western blotting, total cellular protein is extracted from human cells (for example, lymphocytes) and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel The proteins are then transferred to a membrane (for example, nitrocellulose) by Western blotting, and the antibody preparation is incubated with the membrane After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase, application of the substrate 5-bromo-4-chloro-3-mdolyl phosphate/nitro blue tetrazohum results in the production of a dense blue compound by immuno-localized alkaline phosphatase Antibodies which specifically detect the DLC-1 protein will, by this technique, be shown to bind to the DLC-1 protein band (which will be localized at a given position on the gel determined by its molecular weight) Non-specific binding of the antibody to other proteins may occur and may be detectable as a weak signal on the Western blot The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific antibody-DLC- 1 protein binding
Substantially pure DLC-1 protein suitable for use as an immunogen is isolated from transfected or transformed cells Concentration of protein in the final preparation is adjusted, for example, by concentration on an A icon filter device, to the level of a few micrograms per milhhter Monoclonal or polyclonal antibody to the protein can then be prepared as follows Monoclonal Antibody Production by Hybridoma Fusion
Monoclonal antibodv to epitopes of the DLC- 1 protein identified and isolated as described can be prepared from murine hybπdomas according to the classical method of Kohler and Milstein (Nature 256 495, 1975) or derivative methods thereof Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein over a period of a few weeks The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopteπn (HAT media) The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol 70 419, 1980), and derivative methods thereof Selected positive clones can be expanded and their monoclonal antibody product harvested for use Detailed procedures for monoclonal antibody production are described in Harlow and Lane (Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988)
Polyclonal Antibody Production by Immunization
Polyclonal antiserum containing antibodies to heterogenous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein, which can be unmodified or modified to enhance immunogenicity Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species For example, small molecules tend to be less lmmunogenic than others and may require the use of carriers and adjuvant Also, host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low titer antisera Small doses (ng level) of antigen administered at multiple intradermal sites appears to be most reliable An effective immunization protocol for rabbits can be found in Vaitukaitis et al (J Clin Endocnnol Metab 33 988-91, 1971)
Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall See, for example, Ouchterlony et al (In Handbook of Experimental Immunology, Wier, D (ed ) chapter 19, Blackwell ,1973) Plateau concentration of antibody is usually in the range of 0 1 to 0 2 mg/ml of serum (about 12 μM) Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Immunology, Ch 42, 1980) - }? .
Antibodies Raised against Synthetic Peptides
A third approach to raising antibodies against the DLC- 1 protein is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the predicted amino acid sequence of the DLC-1 protein
Antibodies Raised by Injection of DLC-1 Gene
Antibodies may be raised against the DLC- 1 protein by subcutaneous injection of a DNA vector which expresses the DLC- 1 protein into laboratory animals, such as mice Deliv ery of the recombinant vector into the animals may be achieved using a hand-held form of the Biohstic system (Sanford et al , Paniculate Sci Technol 5 27-37, 1987) as described by Tang et al ( \ature 356 152-4, 1992) Expression vectors suitable for this puφose may include those which express the DLC- 1 gene under the transcπptional control of either the human β-actin promoter or the cytomegalovirus (CMV) promoter
Antibody preparations prepared according to these protocols are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples, they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample
EXAMPLE 13 DNA-Based Diagnosis
One major application of the DLC-1 sequence information presented herein is in the area of genetic testing for predisposition to HCC, BC, PC and/or CRC owing to DLC-1 deletion or mutation The gene sequence of the DLC-1 gene, including intron-exon boundaries is also useful in such diagnostic methods Individuals carrying mutations in the DLC-1 gene, or having heterozygous or homozygous deletions of the DLC-1 gene, may be detected at the DNA level with the use of a variety of techniques For such a diagnostic procedure, a biological sample of the subject, which biological sample contains either DNA or RNA derived from the subject, is assayed for a mutated or deleted DLC-1 gene Suitable biological samples include samples containing genomic DNA or RNA obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy. surgical specimen, ammocentesis samples and autopsy material The detection in the biological sample of either a mutant DLC-1 gene, a mutant DLC-1 RNA, or a homozygously or heterozygously deleted DLC-1 gene, may be performed by a number of methodologies, as outlined below
A preferred embodiment of such detection techniques is the polymerase chain reaction amplification of reverse transcribed RNA (RT-PCR) of RNA isolated from lymphocytes followed b direct DNA sequence determination of the products The presence of one or more nucleotide differences between the obtained sequence and the cDNA sequences, and especially, differences in the ORF portion of the nucleotide sequence are taken as indicative of a potential DLC- 1 gene mutation
Alternatively, DNA extracted from lymphocytes or other cells av be used directly for amplification The direct amplification from genomic DNA would be appropriate for analysis of the entire DLC- 1 gene including regulatory sequences located upstream and downstream from the open reading frame Recent reviews of direct DNA diagnosis have been presented by Caskey (Science 236 1223-8, 1989) and by Landegren et al (Science 242 229-37, 1989)
Further studies of DLC-1 genes isolated from DLC-1 patients may reveal particular mutations, or deletions, which occur at a high frequency within this population of individuals In this case, rather than sequencing the entire DLC- 1 gene, it may be possible to design DNA diagnostic methods to specifically detect the most common DLC-1 mutations or deletions
The detection of specific DNA mutations may be achieved by methods such as hybridization using specific oligonucleotides (Wallace et al , Cold Spring Harbor Symp Quant Biol 51 257-61 , 1986), direct DNA sequencing (Church and Gilbert, Proc Natl Acad Sci USA 81 1991- 5, 1988), the use of restriction enzymes (Flavell et al , Cell 15 25, 1978, Geever et al , Proc Natl Acad Sci USA 78 5081 , 1981), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers and Maniatis, Cold Spring Harbor Symp Quant Biol 51 275-84, 1986), RNase protection (Myers et al , Science 230 1242, 1985), chemical cleavage (Cotton et al , Proc Natl Acad Sci USA 85 4397-401. 1988), and the ligase-mediated detection procedure (Landegren et al , Science 241 1077, 1988)
Oligonucleotides specific to normal or mutant sequences are chemically synthesized using commercially available machines, labeled radioactively with isotopes (such as 32P) or non- radioactively, with tags such as biotin (Ward and Langer et al , Proc Natl Acad Sci USA 78 6633- 57, 1981), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis The presence of these specific sequences are visualized by methods such as autoradiography or fluorometπc (Landegren, et al , Science 242 229-37, 1989) or coloπmetπc reactions (Gebeyehu et al , Nucleic Acids Res 15 4513- 34, 1987) The absence of hybridization would indicate a mutation in the particular region of the gene, or deleted DLC-1 gene Sequence differences between normal and mutant forms of the DLC- 1 gene may also be revealed by the direct DNA sequencing method of Church and Gilbert (Proc Natl Acad Sci USA 81 1991-5, 1988) Cloned DNA segments may be used as probes to detect specific DNA segments The sensitivity of this method is greatly enhanced when combined with PCR (Wπchnik et al , Nucleic Acids Res 15 529-42, 1987 Wong et al , Nature 330 384-386, 1987, Stoflet et al , Science 239 491-4, 1988) In this approach, a sequencing primer which lies within the amplified sequence is used with double-stranded PCR product or single-stranded template generated bv a modified PCR The sequence determination is performed by conventional procedures with radiolabeled nucleotides or by automatic sequencing procedures with fluorescent tags
Sequence alterations may occasionally generate fortuitous restriction enzyme recognition sites or mav eliminate existing restriction sites Changes in restriction sites are revealed by the use of appropriate enzyme digestion followed by conventional gel-blot hybridization
(Southern, J Mol Biol 98 503, 1975) DNA fragments carrying the site (either normal or mutant) are detected by their reduction in size or increase of corresponding restriction fragment numbers Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme, fragments of different sizes are then visualized under UV light m the presence of ethidium bromide after gel electrophoresis
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing reagent Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis For example, a PCR product with small deletions is clearly distinguishable from a normal sequence on an 8% non-denaturing polyacrylamide gel (WO 91/10734, Nagamine et al , Am J Hum Genet 45 337- 9, 1989) DNA fragments of different sequence compositions may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific "partial-melting" temperatures (Myers et al , Science 230 1242, 1985) Alternatively, a method of detecting a mutation comprising a single base substitution or other small change could be based on differential primer length in a PCR For example, an invariant primer could be used in addition to a primer specific for a mutation The PCR products of the normal and mutant genes can then be differentially detected in acrylamide gels
In addition to conventional gel-electrophoresis and blot-hybridization methods, DNA fragments may also be visualized by methods where the individual DNA samples are not immobilized on membranes The probe and target sequences may be both solution, or the probe sequence may be immobilized (Saiki et al , Proc Nat Acad Sci USA 86 6230-4, 1989) A variety of detection methods, such as autoradiography involving radioisotopes, direct detection of radioactive decay (in the presence or absence of sc tillant), spectrophotometry involving caloπgenic reactions and fluorometry involved fluorogenic reactions, may be used to identify specific individual genotypes
If more than one mutation is frequently encountered in the DLC-1 gene, a system capable of detecting such multiple mutations would be desirable For example, a PCR with multiple, specific oligonucleotide primers and hybridization probes may be used to identify all possible mutations at the same time (Chamberlain et al , Nucl Acids Res 16 1 141-55, 1988) The procedure may involve immobilized sequence-specific oligonucleotides probes (Saiki et al , Proc Nat Acad Sci USA 86 6230-4, 1989) 33 -
The following Example describes one method by which deletions of the DLC- 1 gene may be detected
EXAMPLE 14 Two Step Assay to Detect the Presence of DLC-1 Gene in a Sample
Patient liver, breast, prostate and/or colorectal tissue sample is processed according to the method disclosed by Antonarakis, et al (New Eng J Med 313 842-848, 1985), separated through a 1 % agarose gel and transferred to a nylon membrane for Southern blot analysis Membranes are UV cross linked at 150 mJ using a GS Gene Linker (Bio-Rad) A DLC- 1 probe is subcloned into pTZ18U The phagemids are transformed into E coli MV 1 190 infected with
M 13K07 helper phage (Bio-Rad, Richmond, Calif ) Single stranded DNA is isolated according to standard procedures (see Sambrook, et al Molecular Cloning A Laboratory Manual Cold Spring Harbor, New York, 1989)
Blots are prehybπdized for 15-30 min at 65° C in 7% sodium dodecyl sulfate (SDS) in 0 5M NaP04 The methods follow those described by Nguyen, et al (BioTechmques 13 1 16-123,
1992) The blots are hybridized overnight at 65 °C in 7% SDS, 0 5M NaP04 with 25-50 ng/ml single stranded probe DNA Post-hybridization washes consist of two 30 mm washes in 5% SDS, 40 mM NaP04 at 65 °C, followed by two 30-mιn washes in 1% SDS, 40 mM NaPQ, at 65 °C
Next the blots are rinsed with phosphate buffered saline (pH 6 8) for 5 min at room temperature and incubated with 0 2% casein in PBS for 5 min The blots are then preincubated for 5- 10 minutes in a shaking water bath at 45° C with hybridization buffer consisting of 6M urea, 0 3M NaCl, and 5X Denhardt's solution (see Sambrook, et al , Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989) The buffer is removed and replaced with 50-75 μl/cm2 fresh hybridization buffer plus 2 5 nM of the covalently cross-linked oligonucleotide sequence complementary to the universal primer site (UP-AP, Bio-Rad) The blots are hybridized for 20-30 min at 45 °C and post hybridization washes are incubated at 45 °C as two 10 min washes in 6 M urea, I standard saline citrate (SSC), 0 1% SDS and one 10 min wash in 1XSSC, 0 1% Triton® X- 100 The blots are rinsed for 10 min at room temperature with 1XSSC
Blots are incubated for 10 min at room temperature with shaking in the substrate buffer consisting of 0 1 M diethanolamine, 1 mM MgCl,, 0 02% sodium azide, pH 10 0 Individual blots are placed in heat sealable bags with substrate buffer and 0 2 mM AMPPD (3-(2'-spιroadamantane)- 4-methoxy-4-(3'-phosphoryloxy)phenyl-l ,2-dιoxetane, disodium salt, Bio-Rad) After a 20 min incubation at room temperature with shaking, the excess AMPPD solution is removed The blot is exposed to X-ray film overnight Positive bands indicate the presence of the DLC-1 gene Patient samples which show no hybridizing bands lack the DLC-1 gene, indicating the possibility of ongoing cancer, or an enhanced susceptibility to developing cancer in the future EXAMPLE 15 Quantitation of DLC-1 Protein
An alternative method of diagnosing DLC-1 gene deletion or mutation is to quantitate the level of DLC- 1 protein in the cells of an individual This diagnostic tool would be useful for detecting reduced levels of the DLC-1 protein which result from, for example, mutations in the promoter regions of the DLC- 1 gene or mutations within the coding region of the gene which produced truncated, non-functional polypeptides, as well as from deletions of the entire DLC- 1 gene The determination of reduced DLC- 1 protein levels would be an alternative or supplemental approach to the direct determination of DLC- 1 gene deletion or mutation status by the methods outlined above The availability of antibodies specific to the DLC-1 protein will facilitate the quantitation of cellular DLC-1 protein by one of a number of immunoassay methods which are well known in the art and are presented in Harlow and Lane (Antibodies A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988)
For the puφoses of quantitating the DLC-1 protein, a biological sample of the subject, which sample includes cellular proteins, is required Such a biological sample may be obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, ammocentesis samples, surgical specimens and autopsy material, particularly liver cells Quantitation of DLC-1 protein is achieved by immunoassay and compared to levels of the protein found in healthy cells A significant (e g , 50% or greater) reduction in the amount of DLC- 1 protein in the cells of a subject compared to the amount of DLC-1 protein found in normal human cells would be taken as an indication that the subject may have deletions or mutations in the DLC- 1 gene locus
EXAMPLE 16 Gene Therapy A new gene therapy approach for DLC- 1 patients is now made possible by the present invention Essentially, liver cells may be removed from a patient having deletions or mutations of the DLC-1 gene, and then transfected with an expression vector containing the DLC-1 cDNA These transfected liver cells will thereby produce functional DLC-1 protein and can be remfroduced into the patient In addition to liver cells, breast, colorectal, prostate, or other cells may be used, depending on the cancer of interest
The scientific and medical procedures required for human cell transfection are now routine procedures The provision herein of DLC-1 cDNAs now allows the development of human gene therapy based upon these procedures Immunotherapy of melanoma patients using genetically engineered tumor-infiltrating lymphocytes (TILs) has been reported by Rosenberg et al (N Engl J Med 323 570-8, 1990) In that study, a retrovirus vector was used to introduce a gene for neomycin resistance into TILs A similar approach may be used to introduce the DLC-1 cDNA into patients affected by DLC-1 deletions or mutations Retroviruses have been considered the preferred vector for experiments in gene therapy, with a high efficiency of infection and stable integration and expression (Orkin et al , Prog Med Genet 7 130 1988) The full length DLC-1 gene or cDNA can be cloned into a retroviral vector and driven from either its endogenous promoter or from the retroviral LTR (long terminal repeat) Other viral transfection systems may also be utilized for this type of approach, including Adeno-Associated virus (AAV) (McLaughlin et al , J Virol 62 1963, 1988), Vaccinia virus (Moss et al , Annu Rev Immunol 5 305, 1987), Bovine Papilloma virus (Rasmussen et al , Methods Enzymol 139 642, 1987) or members of the heφesvirus group such as Epstein-Barr virus (Margolskee et al , Mol Cell Biol 8 2837-47, 1988) Recent developments in gene therapy techniques include the use of RNA-DNA hybrid oligonucleotides, as described by Cole-Strauss, et al (Science 273 1386-9, 1996) This technique may allow for site-specific integration of cloned sequences, permitting accurately targeted gene replacement
Having illustrated and described the principles of isolating the human DLC-1 cDNA and its corresponding genomic genes, the protein and modes of use of these biological molecules, it should be apparent to one skilled in the art that the invention can be modified in arrangement and detail without departing from such principles We claim all modifications coming within the spirit and scope of the claims presented herein

Claims

We claim:
1. An isolated nucleic acid molecule selected from the group consisting of:
(a) nucleic acid molecules encoding an amino acid sequence as shown in Seq. I.D. No. 2;
(b) nucleic acid molecules which hybridize under stringent conditions to a nucleic acid molecule according to (a), and which encode a protein having an activity of the DLC- 1 protein;
(c) nucleic acid molecules comprising a nucleotide sequence as shown in Seq. I.D. No. 1.
2. An isolated nucleic acid molecule according to claim 1(b) wherein the DNA molecule hybridizes to a DNA molecule according to (a) under conditions wherein DNA molecules with more than 25% mismatch will not hybridize to each other.
3. A recombinant vector including a nucleic acid molecule according to claim 1.
4. A transgenic cell containing a vector according to claim 3.
5. An isolated nucleic acid molecule comprising at least 15 consecutive nucleotides of a DNA sequence shown in Seq. I.D. No. 1.
6. An isolated nucleic acid molecule according to claim 5 wherein the molecule comprises at least 25 consecutive nucleotides of the DNA sequence shown in Seq. I.D. No. 1.
7. A recombinant DNA vector including a DNA molecule according to claim 5.
8. A transgenic cell containing a recombinant DNA vector according to claim 6.
9. A purified protein comprising an amino acid sequence shown in Seq. I.D. No. 2.
10. An antibody capable of specifically binding to a protein according to claim 9.
1 1. The antibody of claim 10 wherein the antibody is a monoclonal antibody.
12. An isolated cDNA molecule encoding a human DLC- 1 protein. 13 A cDNA according to claim 12 wherein the cDNA comprises the nucleic acid sequence depicted as bases 325-3657 of Seq I D No 1
14 A cDNA according to claim 12 wherein the human DLC- 1 protein comprises an amino acid sequence as depicted in Seq I D No 2
15 An isolated oligonucleotide capable of specifically hybridizing to a human DLC- 1 gene
16 An oligonucleotide according to claim 15 wherein the oligonucleotide comprises at least 20 consecutive nucleotides of the sequence shown in Seq I D No 1
17 An oligonucleotide according to claim 15 wherein the oligonucleotide comprises at least 20 consecutive nucleotides of the clone deposited as ATCC 98676
18 A method for detecting the enhanced susceptibility of an individual to cancer, the method comprising detecting the deletion of a DLC- 1 gene in cells of the patient
19 The method of claim 18 wherein the deletion of the DLC-1 gene indicates an enhanced susceptibility to hepatocellular carcinoma
20 A method for detecting the enhanced susceptibility of an individual to cancer, the method comprising detecting the absence of DLC- 1 protein in cells of the patient
21 The method of claim 18 wherein the absence of the DLC-1 protein indicates an enhanced susceptibility to hepatocellular carcinoma
22 A method of detecting a deletion of a DLC-1 gene in a cell, the method comprising
(a) incubating an oligonucleotide according to claim 15 with nucleic acid of the cell under conditions such that the oligonucleotide will specifically hybridize to a DLC-1 gene present in the nucleic acid to form an oligonucleotide DLC- 1 gene complex,
(b) detecting the presence or absence of oligonucleotide DLC-1 complexes, wherein the absence of said complexes indicates deletion of the DLC- 1 gene
23 A method of detecting the presence of DLC-1 protein in a cell, the method comprising (a) incubating an antibody according to claim 10 with proteins of the cell under conditions such that the antibody will specifically bind to a DLC-1 protein present in the cell to form an antibody DLC- 1 protein complex, and
(b) detecting the presence of antibody DLC-1 protein complexes
24 A method of supplying DLC- 1 gene function to a cell which has lost said gene function by virtue of deletion of all or a portion of said gene, comprising introducing a DLC- 1 gene into said cell such that the DLC- 1 gene is expressed in the cell
25 The method of claim 23, wherein the method is a method of detecting cancer
26 The method of claim 25, wherein the cancers which are detected are cancers of the breast colon, prostate or liver
27 The method of claim 26, wherein the cancer is a hepatocellular carcinoma
28 The method of claim 26, wherein the cancer is a prostate cancer
29 The method of claim 26, wherein the cancer is a colorectal cancer
30 The method of claim 26, wherein the cancer is a breast cancer
31 The method of claim 26, wherein the cancer is an adenocarcinoma
32 A purified protein having DLC- 1 protein biological activity, and comprising an amino acid sequence selected from the group of
(a) the ammo acid sequence shown in Seq I D No 2,
(b) am o acid sequences that differ from those specified (a) by one ore more conservative amino acid substitutions, and (c) amino acid sequences having at least 90% sequence identity to the sequence specified in (a)
33 The purified protein of claim 32(c), wherein the ammo acid sequences have at least 95% sequence identity to the sequence specified in 32(a)
34 The purified protein of claim 32(c), wherein the ammo acid sequences have at least 98% sequence identity to the sequence specified in 32(a)
PCT/US1999/004164 1998-02-25 1999-02-25 Dlc-1 gene, a putative tumors suppressor gene WO1999043812A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU28791/99A AU2879199A (en) 1998-02-25 1999-02-25 Dlc-1 gene, a putative tumors suppressor gene
US10/995,914 US7534565B2 (en) 1998-02-25 2004-11-24 DLC-1 gene deleted in cancers
US12/239,581 US20090239220A1 (en) 1998-02-25 2008-09-26 Dlc-1 gene deleted in cancers

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7595298P 1998-02-25 1998-02-25
US60/075,952 1998-02-25

Publications (2)

Publication Number Publication Date
WO1999043812A2 true WO1999043812A2 (en) 1999-09-02
WO1999043812A3 WO1999043812A3 (en) 1999-10-28

Family

ID=22128974

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/004164 WO1999043812A2 (en) 1998-02-25 1999-02-25 Dlc-1 gene, a putative tumors suppressor gene

Country Status (2)

Country Link
AU (1) AU2879199A (en)
WO (1) WO1999043812A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8735082B2 (en) 2008-11-10 2014-05-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Gene signature for predicting prognosis of patients with solid tumors
CN104436162A (en) * 2013-09-24 2015-03-25 中国科学院上海生命科学研究院 Method and preparation for inhibiting bone metastasis due to breast cancer

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CHINEN K. ET AL.: "Isolation of 45 exon-like fragments from 8p22-p21.3, a region that is commonly deleted in hepatocellular, colorectal, and non-small cell lung carcinomas" CYTOGENETICS AND CELL GENETICS, vol. 75, 1 January 1996 (1996-01-01), pages 190-196, XP002084550 ISSN: 0301-0171 *
HOMMA Y. AND EMORI Y.: "A dual function signal mediator showing RhoGAP and phospholipase C-delta stimulating activities." EMBO JOURNAL, vol. 14, no. 2, 1995, pages 286-291, XP002113384 cited in the application *
SYMONS M.: "RHO FAMILY GTPASES: THE CYTOSKELETON AND BEYOND" TIBS TRENDS IN BIOCHEMICAL SCIENCES, vol. 21, 1 May 1996 (1996-05-01), pages 178-181, XP002074622 ISSN: 0968-0004 *
WEI M.-H. ET AL.: "Cloning and molecular characterization of the human ortholog of the rat dual regulator p122RhoGAP." EMBL DATABASE ENTRY AF026219; ACCESSION NUMBER AF026219, 1 November 1997 (1997-11-01), XP002113383 *
YUAN B. Z. ET AL.: "Cloning, characterization, and chromosomal localization of a gene frequently deleted in human liver cancer (DLC-1) homologous to rat RhoGAP." CANCER RESEARCH, vol. 58, no. 10, 15 May 1998 (1998-05-15), pages 2196-2199, XP002113386 *
YUAN B.Z. ET AL.: "Homo sapiens deleted in liver cancer-1 (DCL-1) mRNA, complete cds." EMBL DATABASE ENTRY AF035119; ACCESSION NUMBER AF035119, 2 December 1997 (1997-12-02), XP002113385 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8735082B2 (en) 2008-11-10 2014-05-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Gene signature for predicting prognosis of patients with solid tumors
US9394358B2 (en) 2008-11-10 2016-07-19 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Gene signature for predicting prognosis of patients with solid tumors
CN104436162A (en) * 2013-09-24 2015-03-25 中国科学院上海生命科学研究院 Method and preparation for inhibiting bone metastasis due to breast cancer

Also Published As

Publication number Publication date
AU2879199A (en) 1999-09-15
WO1999043812A3 (en) 1999-10-28

Similar Documents

Publication Publication Date Title
US7534565B2 (en) DLC-1 gene deleted in cancers
US6426198B1 (en) Genes for Niemann-Pick type C disease
US5709999A (en) Linked breast and ovarian cancer susceptibility gene
US5747282A (en) 17Q-linked breast and ovarian cancer susceptibility gene
US5693473A (en) Linked breast and ovarian cancer susceptibility gene
US5710001A (en) 17q-linked breast and ovarian cancer susceptibility gene
EP0705902B2 (en) Nucleic acid probes comprising a fragment of the 17q-linked breast and ovarian cancer susceptibility gene
EP0705903B2 (en) Mutations in the 17q-linked breast and ovarian cancer susceptibility gene
US8551699B2 (en) PCA3, PCA3 genes, and methods of use
AU707636C (en) Materials and methods relating to the identification and sequencing of the BRCA2 cancer susceptibility gene and uses thereof
US5753441A (en) 170-linked breast and ovarian cancer susceptibility gene
US6355782B1 (en) Hypohidrotic ectodermal dyplasia genes and proteins
US7776607B2 (en) Mammalian selenoprotein differentially expressed in tumor cells
US5681942A (en) Fanconi Anemia Type C gene
GB2307477A (en) Materials and methods relating to the identification and sequencing of the BRCA2 cancer susceptibility gene and uses thereof
WO1999043812A2 (en) Dlc-1 gene, a putative tumors suppressor gene
US5952190A (en) cDNA for fanconi anemia complementation group A
WO1999051637A1 (en) Mammalian selenoprotein differentially expressed in tumor cells
WO1999003883A1 (en) Compositions and methods based upon the tuberous sclerosis-1 (tsc1) gene and gene product
JP3241736B2 (en) 17q-linked breast and ovarian cancer susceptibility genes
WO2000029578A9 (en) Cloning and characterization of two m-rna transcription factors
AU1118301A (en) Tumour suppressor genes from chromosome 16
US20050042631A1 (en) Cloning and characterization of two novel m-RNA transcription factors
WO2003064591A2 (en) Abca8 nucleic acids and proteins, and uses thereof
CA2007699A1 (en) Introns and exons of the cystic fibrosis gene and a mutation at i507 of the gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A3

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 09644947

Country of ref document: US

NENP Non-entry into the national phase in:

Ref country code: KR

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
WWE Wipo information: entry into national phase

Ref document number: 10995914

Country of ref document: US