CN104436162A - Method and preparation for inhibiting bone metastasis due to breast cancer - Google Patents
Method and preparation for inhibiting bone metastasis due to breast cancer Download PDFInfo
- Publication number
- CN104436162A CN104436162A CN201310438956.5A CN201310438956A CN104436162A CN 104436162 A CN104436162 A CN 104436162A CN 201310438956 A CN201310438956 A CN 201310438956A CN 104436162 A CN104436162 A CN 104436162A
- Authority
- CN
- China
- Prior art keywords
- dlc1
- albumen
- bone
- breast cancer
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method and preparation for inhibiting bone metastasis due to breast cancer. The negative correlation between the expression level of the GTPases activating protein DLC1 and the bone metastasis due to breast cancer is discovered for the first time, so that a new target can be provided for the effective prevention, control or treatment of bone metastasis due to breast cancer.
Description
Technical field
The invention belongs to biomedicine field; More specifically, the present invention relates to the method and formulation suppressing Bone of Breast Cancer transfer.
Background technology
Breast carcinoma is a kind of malignant disease women's health being formed to very large threat.And breast carcinoma is the lethal main cause of breast carcinoma to the transfer of vitals as bone, lung, brain, liver etc.Can Bone tumour be there is in the advanced breast cancer patient of data display about 70% clinically.Breast carcinoma generation Bone tumour may bring the symptoms such as pain, fracture and hypercalcemia to patient, and this makes quality of life of patients very low.Up to now, FDA has only examined the treatment of two kinds of medicine-zoledronic acid and Denosumab for Bone tumour, and the former is little on survival impact, and the latter's price is high, therefore develops more effective, cheap medicine extremely urgent.And first this need the mechanism of the present inventor to Bone tumour to have more deeply more fully to understand.
Under normal physiological condition, the skeleton of adult is in the poised state that bone matrix dissociates and bone matrix reconstructs.And regulatory factor crucial in this balance is osteoclast and osteoblast.When the osteolysis that osteoclast is brought out is better than the bone reconstruct effect that osteoblast brings out, total effect just shows as molten bone, otherwise then contrary.The breast cancer patients that Bone tumour occurs clinically most of late period presents osteolytic symptom, and fraction patient presents osteogenic symptom.
DLC1 gene is positioned at human chromosome 8p21, is named as Deleted in Liver Cancer-1 at first because it is found to lose in hepatocarcinoma of being everlasting.DLC1 is a kind of GTP hydrolytic enzyme activities activated protein (RhoGTPase Activating Protein, RhoGAPs) of Rho family GTPase albumen (RhoGTPase).RhoGAPs by with guanine nucleotide exchange factor (Guanosine NucleotideExchange Factors, GEFs) and guanyl to dissociate inhibitive factor (Guanine nucleotide dissociationInhibitor, GDI) coordinate, the enzymolysis activity of transfer RhoGTPase.RhoGTPase is one of member of Ras superfamily, when RhoGTPase is in inactivated state, GDI and RhoGTPase-GDP forms stable complex and is present in kytoplasm, after it discharges GDP under GEFs effect, be activated in conjunction with GTP, then act on downstream effect molecule.The biochemical function of RhoGAPs is then activate the intrinsic GTP hydrolytic enzyme activities of RhoGTPase, and hydrolysis GTP becomes GDP, makes GTPase involution in the state of inactivation.Therefore DLC1 is the important negative regulatory factor of Rho path.
It is 7479bp that DLC1 gene has four isoform, isoform1 length at the transcript that NCBI records, 1528 aminoacid of encoding; Isoform2 length is 6044bp, 1091 aminoacid of encoding; Isoform3 length is 2484bp, 463 aminoacid of encoding; Isoform4 length is 5786bp, 1017 aminoacid of encoding.Wherein isoform2 is the common transcript of DLC1.In the protein structure of its translation except the conservative RhoGAP catalytic sequence that all RhoGAPs members have, there is a conservative SAM (Sterile Alpha Motif) domain and FAT (Focal Adhesion Targeting) sequence in its aminoterminal, its c-terminus exists a START (Steroidogenic Acute Regulatory (StAR)-relatedLipid Transfer) domain.
DLC1 is not only found to be lost in hepatoma carcinoma cell of being everlasting, found that it was also lowered in the cancerous tissue at bladder, lung, mammary gland, stomach, intestinal, brain, prostate, position afterwards, the mechanism of downward or the loss of gene or promoter methylate or both have it concurrently.The disappearance of DLC1 can promote tumor growth in hepatocarcinoma mouse model, and raising the expression of DLC1 in esophageal carcinoma, hepatocarcinoma, pulmonary carcinoma or breast cancer cell line can the formation of Tumor suppression, the propagation of cancerous cell and reduce clone's number that tumor cell formed at soft agar.DLC1 suppression hepatoma cell proliferation may be relevant with the apoptosis of its inducing cancer cell.
DLC1 is not only relevant to the propagation of cancerous cell, and some reports further disclose the ability of DLC1 anticancer migration and invasion.The transfer ability of DLC1 remarkable T suppression cell in esophageal carcinoma, breast carcinoma, hepatoma carcinoma cell and lymphoma cell line.In Skin Squamous Cell Carcinoma, carcinoma of prostate, pulmonary carcinoma, DLC1 inhibits the invasive ability of cell.But whether really regulate and control the far-end transfer of cancerous cell about DLC1, relevant research is less, and it is very large that the invasion and attack of cancerous cell and far-end shift in fact difference.And, skeleton is cancer cell metastasis organ the most frequently, large quantity research shows at present, cancerous cell is to the transfer ability of bone, be decided by cancerous cell and the interactional ability of transfer microenvironment more, especially on the impact of broken bone/osteoblast maturation differentiation, and little with the migration invasive ability relation of cancerous cell self.
Mechanism about DLC1 functionating in tumor development mainly contains two kinds of explanations.One, by depending on the mode of GAP domain; Its two, by not relying on the mode of GAP domain.The mode depending on GAP domain mainly through inactivation Rho path to suppress the effector molecule in Rho downstream to realize.Such as in prostate gland cancer cell, the expression of DLC1 by suppressing RhoA and RhoC to raise E-cadherin, the rise of E-cadherin then inhibits the invasive ability of cell.In hepatocarcinoma and other cancerous cell, DLC1 is also proved to be the function by suppressing Rho path to play its antioncogene, although Rho passage downstream comprises different effector molecules as E-cadherin, VEGF, osteopontin, MMP-9 in different models.
The mode not relying on GAP domain then relates to SAM domain, be in motif and START domain between SAM domain and GAP domain.In addition, the invasive ability of approach T suppression cell that is degraded by being in seven amino acid sequence (aa348 – 354) between SAMdomain and GAP domain and impelling it to expose ubiquitination site with Annexin2 competition binding S100A10 of DLC1.And another section of sequence (aa448 – 500) be between SAM domain and GAP domain is found to be combined with Talin and FAK, their combination may mediate the common location of DLC1 and vinculin, then affects the transfer ability of cell.DLC1 can also mediate it by START domain and be combined with caveolin-1.Their the GAP activity of combination to DLC1 has no significant effect, but but have impact on transfer ability and the tumor Forming ability of lung carcinoma cell.
But the tumor in view of different tissues orga-nogenesis has different features, cannot expect that outside the tumor type of above reported in literature, the tumor also for which type has inhibit feature, therefore those skilled in the art still need and further study.Bone is the modal transfer site of breast carcinoma, but the mechanism of Bone of Breast Cancer transfer is illustrated not yet completely.
Summary of the invention
The object of the present invention is to provide the method and formulation suppressing Bone of Breast Cancer transfer.
In a first aspect of the present invention, provide the purposes of a kind of DLC1 albumen or its encoding gene or adjustment on it, for the preparation of the compositions (as medicine) suppressing Bone of Breast Cancer transfer.
In a preference, described DLC1 albumen suppresses osteoclast cell maturation and suppresses PTHLH up-regulated by suppressing Rho active, thus suppresses Bone of Breast Cancer transfer.
In another preference, described compositions is used for:
Suppress Rho active;
To lower in Smad3 the phosphorylation level of the 204th and 208 upper serines;
PTHLH is suppressed to express;
Suppress osteoclast cell maturation.
In another preference, the upper adjustment of described DLC1 albumen comprises: the function fragment of DLC1 albumen; The plasmid of recombinant expressed DLC1 albumen or its function fragment.
In another preference, described recombinant expressed DLC1 albumen or the plasmid of its function fragment comprise: pBabepuro-DLC1.
In another aspect of this invention, provide the purposes of a kind of DLC1 albumen or its encoding gene, for screening the potential material suppressing Bone of Breast Cancer transfer.
In another aspect of this invention, a kind of method of screening the potential material suppressing Bone of Breast Cancer transfer is provided, comprises the following steps:
A candidate substances contacts with the system expressing DLC1 albumen by ();
B () detects expression or the activity of DLC1 albumen, if described candidate substances improves (as improved more than 20% statistically; More preferably improve more than 40%; More preferably improve more than 60%) expression of DLC1 albumen or activity, then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
In a preference, step (a) comprising: in test group, in the system expressing DLC1 albumen, add candidate substances; In step (b), detect expression or the activity of DLC1 albumen, and compare with matched group, wherein said matched group is the system of not adding described candidate substances, expressing DLC1 albumen; If the expression of DLC1 albumen or activity improve statistically in test group, just show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
In another preference, in step (a), in described system, also express Rho albumen; In step (b), detect the interaction of DLC1 albumen and Rho albumen, compared with matched group (not adding the expression DLC1 albumen of candidate substances and the system of Rho albumen), if interact both test group candidate substances promotes and make the activity of Rho albumen lower (lower than matched group, as reduced by more than 20% statistically; More preferably reduce by more than 40%; More preferably reduce by more than 60%), then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
In another preference, in step (a), in described system, also express PTHLH albumen; In step (b), detect the regulation and control to PTHLH RNA or protein expression of DLC1 albumen, compared with matched group (system of the expression DLC1 albumen not adding candidate substances and PTHLH RNA or albumen), if candidate substances promotes DLC1 to the downward effect of PTHLH RNA or albumen and makes the expression of PTHLH RNA or albumen lower (lower than matched group, as reduced by more than 20% statistically; More preferably reduce by more than 40%; More preferably reduce by more than 60%), then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
In another preference, in step (a), in described system, also express Smad3 albumen; In step (b), detect the impact of DLC1 albumen for the phosphorylation level of SMAD3 albumen, compared with matched group (not adding the expression DLC1 albumen of candidate substances and the system of Smad3 albumen), if candidate substances makes the phosphorylation level of Smad3 albumen the 204th and 208 serines lower (lower than matched group, as reduced by more than 20% statistically; More preferably reduce by more than 40%; More preferably reduce by more than 60%), then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
In another preference, described system is selected from: solution system, cell system, organizational framework, organ systems or animal system.Preferably, described system is cell system; More preferably described cell system is breast cancer cell, Bone of Breast Cancer transitional cell (as SCP cell) etc.
In another preference, described candidate substances includes, but is not limited to: for the micromolecular compound, recombinant expression carrier etc. of described DLC1 protein design.
In another aspect of this invention, provide the purposes of a kind of DLC1 albumen or its encoding gene, for the preparation of the reagent of Bone of Breast Cancer transfer prognosis.
In another aspect of this invention, provide the purposes of the reagent of specific recognition DLC1 albumen or its encoding gene or its encoding gene, for the preparation of reagent or the test kit of Bone of Breast Cancer transfer prognosis.
In a preference, described specific recognition DLC1 albumen or the reagent of its encoding gene are selected from:
The primer of specific amplification DLC1 protein coding gene;
The probe of specific recognition DLC1 protein coding gene; Or
The antibody of specific binding DLC1 albumen or part.
In another preference, for patient with breast cancer, when the low expression of testing result display DLC1 albumen, the risk that indication Bone tumour occurs is higher.
In another aspect of this invention, a kind of test kit for Bone of Breast Cancer transfer prognosis is provided, contains in described test kit: the reagent of specific recognition DLC1 albumen or its encoding gene.
In another aspect of this invention, Rho is provided to be correlated with curling spiralization protein kinase (ROCK) inhibitor in the purposes preparing prevention, alleviation or treat in the medicine of Bone of Breast Cancer transfer disease.
In another preference, described ROCK inhibitor is not Y27632.
In another preference, described Rho curling spiralization kinases inhibitor of being correlated with is Fasudil.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Accompanying drawing explanation
In Fig. 1, breast cancer cell line, DLC1 expression and its Bone tumour ability are negative correlativing relation, but do not associate with Lung metastases ability.(A) DLC1 expression in the MDA-MB-231 subbreed of different Bone tumour ability.(B) DLC1 expression in the MDA-MB-231 subbreed of different Lung metastases ability.
Fig. 2, DLC1 process LAN is on the impact of SCP2 Bone tumour ability.(A) foundation surely transfered from one department to another of the DLC1 process LAN of qPCR and Western blot analysis verification SCP2.(B) by injection of heart, the DLC1 process LAN of SCP2 surely being transfered from one department to another cell transplantation enters in Mice Body, then utilizes small animal living body imaging analysis (BLI) to carry out detection by quantitative to the Bone tumour of SCP2 cell.(C) representative graph of BLI and Bone tumour H/E staining analysis.Scale, 100 μm.(D) survival rate of mice after injection of heart DLC1 process LAN SCP2 cell.
Fig. 3, DLC1 strike the low impact on SCP28 Bone tumour ability.(A) DLC1 of qPCR and Western blot analysis verification SCP28 strikes the low foundation surely transfered from one department to another.(B) by detection by quantitative that small animal living body imaging analysis (BLI) shifts to bones of limbs SCP28 in Mice Body.(C) representative graph of BLI, X-ray check and Bone tumour H/E staining analysis.Scale, 100 μm.(D) DLC1 strikes the low impact on the osteolytic area territory area that SCP28 causes.(E) injection of heart DLC1 strikes the survival rate of mice after low SCP28 cell.
Fig. 4, Dlc1 process LAN is on the impact of 4T1 Bone tumour ability.(A) foundation surely transfered from one department to another of the Dlc1 process LAN of qPCR and Western blot analysis verification 4T1.(B) detection of the mice bones of limbs metastasis quantity after 4T1 is injected.(C) representational H/E picture.Scale, 100 μm.(D) survival rate of mice after injection of heart Dlc1 process LAN 4T1 cell.
Fig. 5, DLC1 strike low or process LAN and have no significant effect breast cancer cell line Lung metastases ability.(A) by venule injection, the DLC1 of SCP28 being struck the low cell transplantation that surely transfers from one department to another enters in Mice Body, then utilizes small animal living body imaging analysis (BLI) to carry out detection by quantitative to the Lung metastases of SCP28 cell.(B) representative graph of BLI analysis and H/E staining analysis.Scale, 100 μm.(C) venule injection DLC1 strikes the survival rate of mice after low SCP28 cell.(D) the representative H/E picture of Pulmonary metastasis focuses after tail vein injection Dlc1 process LAN 4T1 cell.Scale, 100 μm.(E) Dlc1 process LAN is on the impact of 4T1 Pulmonary metastasis focuses quantity.(F) survival rate of mice after venule injection Dlc1 process LAN 4T1 cell.
Fig. 6, DLC1 strike low or process LAN to the impact of SCP2 or SCP28 cell Rho pathway activity.(A) DLC1 strikes low or process LAN to the impact of Rho or CDC42 protein active and downstream molecules phosphorylation thereof in SCP2 and SCP28 cell.(B) DLC1 strikes the impact that low or process LAN is formed stress fiber in SCP2 and SCP28 cell.Scale, 10 μm.
Fig. 7, GTPase path has mediated the function of DLC1 in Bone of Breast Cancer transfer process.(A) DLC1GAP inactive mutant R718E loses the function suppressing Rho and CDC42.(B-D) functional analysis of R718E mutant in Bone of Breast Cancer transfer.(B) small animal living body imaging analysis (BLI) detects the growth of nude mice bones of limbs metastatic tumor; (C) representative graph that BLI analyzes and H/E dyes.Scale, 50 μm.(D) injection of heart expresses the survival rate of mice after the SCP28 cell of R718E.
Fig. 8, DLC1 echo across the function in endothelium invasive procedure at the inner skin cell viscosity of breast cancer cell.(A) DLC1 strikes low or process LAN to the impact adhered between SCP28 and SCP2 cell and bone endotheliocyte HBMEC-60.(B) DLC1 strikes low or process LAN to the impact of SCP28 and SCP2 across bone endothelial cell invasion.(C) DLC1 strikes low or process LAN to the impact adhered between SCP28 and SCP2 and lung endotheliocyte ST1.6R.(D) DLC1 strikes low or process LAN to the impact of SCP28 and SCP2 across lung endothelial cell invasion.
Fig. 9, DLC1 function in breast cancer cell induction differentiation of osteoclast maturation process.(A) through SCP28 cell and the mouse primary medullary cell Dual culture of TGF β process, inducing bone marrow cell is divided into mature osteoclast.Be illustrated as the process LAN of DLC1 in SCP28 to the impact of its inducibility.(B) SCP2 cell gets its conditioned medium (CM) after TGF β process, and analyzes the ability of CM inducing bone marrow cell to differentiation of osteoclast.Be illustrated as DLC1 and strike the low impact on SCP2CM inducibility.(C) TRAP dyeing representative graph during SCP2CM induces differentiation of osteoclast to analyze, arrow indication is the mature osteoclast of TRAP stained positive.(D) representative graph of metastatic tumor of bone position cancer-bone interface osteoclast density that formed in Mice Body of TRAP staining analysis SCP28.(E) DLC1 strikes the low impact on cancer in metastatic tumor of bone in body-bone interface unit length amount of osteoclast.Scale, 100 μm of .*P<0.05; * P<0.01.
Figure 10, DLC1 play function by suppressing Rho path in breast cancer cell induction osteoclast cell maturation process.(A) DLC1 strikes low SCP28 stimulates through TGF β, and with its conditioned medium (CM) after Rho inhibitor (C3) or ROCK inhibitor (Y27632) process, analyzes the capacity variation of CM inducing bone marrow cell to differentiation of osteoclast.(B) SCP2 of DLC1 process LAN stimulates through TGF β, and with RhoA mutant RhoA(63L), get its CM after C3 or Y27632 process, analyze the change that CM induces differentiation of osteoclast ability.Meanwhile, directly process bone marrow differentiation system with C3 or Y27632, as the negative control of experiment.(C) in the SCP2 cyton being derived from process LAN DLC1 or R718E, H/E or TRAP of metastatic tumor of bone dyes picture.(D) cancer-bone interface unit length amount of osteoclast is analyzed.Scale, 100 μm of .*P<0.05; * P<0.01.
Figure 11, DLC1 affect the regulation and control of TGF β to its part expression of target gene.(A) by DLC1 reverse by TGF β regulate and control the expression thermal map of gene after DLC1 process LAN.(B) the downstream target gene group (fingerprint gene) being raised or lower by TGF β when DLC1 process LAN whether the integral level GSEA that regulates and controls by TGF β analyze.(C) C3 process can reverse DLC1 regulates and controls PTHLH expression impact on TGF β.Be illustrated as with utilizing Western blotting to detect PTHLH level of (CM) in cell after C3 or TGF β process DLC1 process LAN or compared with control cells.(D) Western blotting is utilized to detect the level of PTHLH in born of the same parents or outside born of the same parents after striking low or compared with control cells with C3 or TGF β process DLC1.
Figure 12, PTHLH have mediated the function of DLC1 in Bone tumour process.(A) PTHLH inhibitor 6-TG can cover the function that DLC1 regulates and controls Bone tumour in cancerous cell body.Be illustrated as and analyze with the small animal living body imaging analysis (BLI) of SCP2DLC1 overexpressing cell Bone tumour after 6-TG process mice.(B) representational BLI picture.(C) the Immunohistochemical analysis of PTHLH and SMAD3 phosphorylation (Ser425) level in metastatic tumor of bone.Scale, 50 μm.(D) 6-TG and DLC1 process LAN is on the impact of the zooperal mouse survival rate of Bone tumour.(E) Western blotting confirms that in 4T1, Pthlh and Dlc1 double expression(DE) stable cell lines is successfully established (sample is the conditioned medium of cell through TGF β process).(F) quantitative analysis of the molten Bone tumour region area that 4T1 cell causes after Pthlh and Dlc1 double expression(DE).
Figure 13, TGF β-Smad path has mediated the regulation and control that DLC1 expresses PTHLH.(A) inhibitor of other various paths does not affect the impact that DLC1 expresses PTHLH.Be illustrated as the expression with various inhibitor treatment S CP2 cell post analysis PTHLH.(B) in SCP2 cell, low SMAD4 is struck.What be illustrated as SMAD4 strikes poor efficiency.(C) SMAD4 strikes the low impact expressed PTHLH.
The regulation and control that the mediated phosphorylation of Figure 14, Smad3 upper Ser204 and Ser208 DLC1 expresses PTHLH.(A) process LAN of C3, TGF-β process and DLC1 is on the impact of Ser204, Ser208 and Ser425 site phosphorylation on SMAD3.(B) TGF β is on the impact of RHOA activity in SCP2.(C) TGF β process, normal SMAD3 and Smad3Ser204 of process LAN and Ser208 phosphorylation site mutant (EPSM), SMAD4 strike low and DLC1 process LAN to the impact of PTHLH promoter activity.(D) by the interaction of chromatin immune co-precipitation-quantitative PCR analysis SMAD3 and PTHLH promoter.
Figure 15, clinical data display DLC1 expression shifts relevant to Bone of Breast Cancer.(A) the DLC1 high expressed sample group calculated by NKI clinical database and the Bone tumour risk analysis of DLC1 low expression sample group.(B) the DLC1 high expressed group calculated by NKI clinical data and the Lung metastases risk analysis of the low expression group of DLC1.(C) breast carcinoma cancer beside organism, without transfer prognosis cancerous tissue, have lung or a Bone tumour prognosis breast cancer tissue in the expression of DLC1.(D) the associating of DLC1 with PTHLH expression in breast cancer tumour sample.(E) immunohistochemical analysis of the DLC1 expression of breast cancer orthotopic cancer, Metastasis Lymph Node and metastatic tumor of bone.
The efficacy analysis of Figure 16, targeting Rho-ROCK path treatment Bone of Breast Cancer transfer.(A) small animal living body imaging analysis (BLI) detect with after PBS, Fasudil or Y27632 process mice on the impact on SCP2 Bone tumour.(B) representational BLI picture and H/E picture.(C) X-ray check injects the impact that PBS or Fasudil grows 4T1 Bone tumour.
Detailed description of the invention
The present inventor is through extensive and deep research, by the gene expression analysis to the cell line and clinical breast cancer tumor sample with different Bone tumour ability, expression and the Bone tumour of a kind of GTPases activator protein of Late Cambrian DLC1 albumen are inclined to negative correlation, provide new target drone for effectively preventing, controlling or treat Bone of Breast Cancer transfer.
DLC1 albumen and Rho-ROCK path and interaction thereof
Present invention is disclosed one based on the closely-related new target drones of Bone tumour such as breast carcinoma.The present inventor, by Knockdown and process LAN analysis, finds that DLC1 suppresses the Bone tumour ability of breast cancer cell.And the enforcement of this function depends on its inactivation Rho-ROCK path (Rho/Rho be correlated with curling spiralization protein kinase (Rho associated coiled coil forming protein kinase, ROCK)), then suppresses
the Smad3linker region phosphorylation of induction, hinders the suppression of the latter
the PTHLH induced transcribes." vicious cycle " in final obstruction Bone tumour.
DLC1 not can have the effect of regulation and control to the transfer of all target organs, do not have regulating and controlling effect in the research display Lung metastases process of Lung metastases.Further research shows that DLC1 passes through regulate the phosphorylation of the Smad3linker region of Rho regulation and control and lowered the expression of PTHLH.If the present inventor finds that DLC1 is silenced simultaneously, breast tumor cell accepts TGF β stimulates rear Rho activity to raise, and Rho increased activity then can raise the phosphorylation of Smad3linker region, thus promotes the expression of PTHLH.The silence of DLC1 may be quite important to this self-activating mechanism of TGF β, because when DLC1 process LAN, stimulate even if breast tumor cell accepts TGF β, Rho activity also has no remarkable rise.And the present inventor finds that not only finding that in Mouse Bone metastatic tumor PTHLH expresses significantly is suppressed by DLC1 in experiment in vivo, in metastatic tumor of bone, upper 425th the serine phosphorylation level of Smad3 is also suppressed by DLC1, and the Smad3 expression in the experiment in vitro of the present inventor in tumor cell is not lowered by DLC1.In metastatic tumor of bone, upper 425th the serine phosphorylation level of Smad3 is likely by the reason that DLC1 suppresses and causes because DLC1 inhibits the maturation of osteoclast TGF β release in less bone matrix to cause.PTHLH and TGF β is medium albumen important in bone metastaes " vicious cycle ", and DLC1 slows down to as car an ancient spear " vicious cycle " to their regulation and control.Therefore the new mechanism that DLC1 does not rely on the Tumor suppression transfer regulating cell migration is not only illustrated in this discovery first, also illustrates the mechanism that there is deceleration in " vicious cycle " process simultaneously.The present inventor finds, the phosphoric acid of Smad3linker region (Ser204/208) turns to the beta induced PTHLH of TGF, and to transcribe institute required, simultaneously the phosphorylation in Smad3 this site upper be also TGF other target genes beta induced transcribe required.
Based on the new discovery of the present inventor, the invention provides DLC1 albumen Bone of Breast Cancer transfer disease in the mechanism of action and purposes, shift the medicine of disease for the preparation of prevention, improvement or treatment Bone of Breast Cancer, or shift the potential material of disease for screening prevention, improvement or treatment Bone of Breast Cancer.
Any applicable DLC1 albumen all can be used for the present invention.Described DLC1 albumen comprises their sequence form or its bioactive fragment.Preferably, the aminoacid sequence of described DLC1 albumen can be substantially the same with the sequence shown in NCBI Reference Sequence:NM_006094.3.But in view of the conservative of DLC1 albumen in different animals, the DLC1 albumen coming from other animal is also in the present invention involved.Also shown by result of study of the present invention, the expression characteristic of DLC1 albumen in Mus (as rat, mice) body in people source is close, plays identical function, as seen its versatility in people, Mus or other animal.
The aminoacid sequence of the DLC1 albumen formed through the replacement of one or more amino acid residue, disappearance or interpolation is also included within the present invention, as long as it retains the function of full-length proteins.DLC1 albumen or their bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence of replacing through aminoacid does not affect its activity or remains the activity of its part.Suitable replacement aminoacid is technology well known in the art, and described technology can be implemented easily and guarantee not change the biological activity of gained molecule.These technology make those skilled in the art recognize, in general, change single amino acids substantially can not change biological activity in the unwanted regions of a peptide species.
The bioactive fragment of any one DLC1 albumen can be applied in the present invention.Here, the implication of the bioactive fragment of DLC1 albumen refers to as a peptide species, and it still can keep all or part of function of full-length proteins.Under normal circumstances, described bioactive fragment at least keeps the activity of the full-length proteins of 50%.Under still more preferential conditions, described active fragment can keep the activity of 60%, 70%, 80%, 90%, 95%, 99% or 100% of full-length proteins.
The regulator of DLC1 albumen
As used herein, described " upper adjustment ", " promoter ", " agonist ", " activator " are used interchangeably.Described " rise ", " promotion " includes " rise ", " promotion " of protein active or " rise ", " promotion " of protein expression.The stability of the expression of any DLC1 of rise albumen or activated state, promotion DLC1 protein maturation and shearing, lifting DLC1 albumen, extend DLC1 albumen effective acting time or regulate the material of transcribing or translating of (raisings) DLC1 albumen all to can be used for the present invention, as the active substance of the medicine that preparation suppresses Bone of Breast Cancer to shift.
As optimal way of the present invention, the agonist of described DLC1, promoter or upper adjustment include, but is not limited to: artificial recombination DLC1 albumen, the recombinant expression plasmid can expressing DLC1 albumen, activation or promote the specific polypeptide of DLC1 function or activity, can promote DLC1 and Rho pathway protein generation specific binding or interactional material.
In view of " upper adjust ", " promoter ", " agonist " of above-mentioned DLC1 albumen, " activator " are for the facilitation of DLC1 albumen, they can be used to prepare the compositions suppressing Bone of Breast Cancer transfer.
Screening suppresses the method for the potential material of Bone of Breast Cancer transfer
The generation that Bone of Breast Cancer shift of DLC1 albumen described in cicada or development influence after, multiple method well known in the art can be adopted to screen the potential material suppressing Bone of Breast Cancer to shift.The material that can be used for preparing the medicine suppressing Bone of Breast Cancer transfer can be found from described potential material.
Therefore, the invention provides a kind of method of screening the potential material suppressing Bone of Breast Cancer transfer, comprise the following steps: candidate substances contacts with the system expressing DLC1 albumen by (a); B () detects expression or the activity of DLC1 albumen, if described candidate substances improves expression or the activity of DLC1 albumen statistically, then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
In view of the dependency that described DLC1 albumen and Rho albumen occur to interact and Bone of Breast Cancer shifts, described screening technique can be undertaken by the interaction of both observations.The method comprises: detect DLC1 albumen and Rho protein-interacting situation, if described candidate substances makes both interact and make the activity of Rho albumen lower statistically, then show that this candidate substances is prevention, the potential material improving or treat Bone of Breast Cancer transfer.
Lower PTHLH in view of described DLC1 albumen and express the dependency shifted with Bone of Breast Cancer, described screening technique can carry out the regulation and control of PTHLH by observing DLC1 albumen.The method comprises: detect DLC1 albumen to the regulation and control situation on PTHLH mRNA or protein level, if described candidate substances makes the expression of PTHLH mRNA or albumen lower statistically, then show that this candidate substances is prevention, the potential material improving or treat Bone of Breast Cancer transfer.
In view of the dependency that described DLC1 albumen and Smad3 albumen occur to interact and Bone of Breast Cancer shifts, described screening technique can be undertaken by the interaction of both observations.The method comprises: detect DLC1 albumen and Smad3 protein-interacting situation, if described candidate substances makes both interact and make the phosphorylation level of Smad3 albumen the 204th and 208 serines lower statistically, then show that this candidate substances is prevention, the potential material improving or treat Bone of Breast Cancer transfer.
In the present invention, described system is selected from (but being not limited to): solution system, cell system, subcellular fraction system, organizational framework, organ systems or animal system.
As the preferred embodiments of the present invention, described cell system is selected from (but being not limited to): breast cancer cell, Bone of Breast Cancer transitional cell (as SCP cell) etc.
Can containing endogenous or recombinant expressed Rho signaling pathway protein in described system, for adding candidate substances wherein, observing candidate substances and Rho signaling pathway protein being expressed or the impact of activity.
As optimal way of the present invention, described method also comprises: carry out further cell experiment and/or animal experiment to the potential material obtained, to select further and to determine for the really useful material of prevention, alleviation or the transfer for the treatment of Bone of Breast Cancer.
On the other hand, present invention also offers the potential material of the suppression Bone of Breast Cancer transfer adopting described screening technique to obtain.The material that these Preliminary screening go out can form a screening storehouse, so that people finally can therefrom filter out can shift useful material for prevention or treatment Bone of Breast Cancer.
Prognostic agent or test kit
Although DLC1 is considered prognostic factor in a lot of class malignant tumor, but the relation of its expression and target organ transspecific was not studied by people.The present inventor finds after analyzing the data delivered and the clinical breast cancer tumor sample gathered voluntarily, and the expression of DLC1 and Bone of Breast Cancer metastasis tendency present the relation of negative correlation, are inclined to uncorrelated with Lung metastases.The expression of prompting DLC1 perhaps as the prognostic indicator of breast carcinoma organ specificity transfer, and then can provide foundation for breast carcinoma individualized treatment.
Based on the above-mentioned new discovery of the present inventor, can using the mark of DLC1 as diagnosing mammary cancer Bone tumour: (i) carries out Differential Diagnosis and/or the susceptibility analysis of Bone of Breast Cancer transfer; (ii) assess the Bone of Breast Cancer transfer medicine of correlated crowd, curative effect of medication, prognosis, and select suitable Therapeutic Method; (iii) earlier evaluations correlated crowd Bone of Breast Cancer transfer risk, early monitoring early prevention and treatment.Such as, the separable crowd going out to cause Bone of Breast Cancer to shift by DLC1 abnormal gene expression, thus can treat more targetedly.
Therefore, the invention provides the purposes of DLC1 gene or albumen, for the preparation of prognostic agent or the test kit of Bone of Breast Cancer transfer.
To the existence detecting DLC1 whether and express or active situation can adopt various technology known in the art, these technology all comprise in the present invention.Such as can by existing technology as Southern blotting, western blot method, DNA sequence analysis, PCR etc., these methods can be combined.
Present invention also offers for analyze in thing detect DLC1 existence whether and the reagent of expression.Preferably, when carrying out the detection of gene level, the primer of specific amplification DLC1 can be adopted; Or whether the probe of specific recognition DLC1 determines the existence of DLC1; When carrying out the detection of protein level, the antibody of specific binding DLC1 albumen or part can be adopted to determine the expression of DLC1 albumen.
Technology well known in the art for the primer of DLC1 or the design of specific probe, such as, prepare a kind of probe, its can with specific site generation specific binding on DLC1 gene, and other gene specific not beyond DLC1 gene is combined, and described probe is with detectable signal.
The method utilizing the antibody of specific binding DLC1 albumen to carry out DLC1 protein expression situation in detect analytes is also technology well known in the art.
Present invention also offers for analyze in thing detect DLC1 existence whether and the test kit of expression, this test kit comprises: the primer of specific amplification DLC1 gene; The probe of specific recognition DLC1 gene; Or the antibody of specific binding DLC1 albumen or part.
In addition, also can comprising in described test kit for extracting the required various reagent such as DNA, PCR, hybridization, colour developing, including but not limited to: extract, amplification liquid, hybridization solution, enzyme, contrast liquid, nitrite ion, washing liquid etc.
In addition, also operation instructions and/or Nucleotide Sequence Analysis Software etc. can be comprised in described test kit.
The purposes of ROCK inhibitor
The present inventor finds in this research, and ROCK inhibitor (as Y27632 and Fasudil) inhibits the growth of Bone of Breast Cancer metastatic tumor significantly.Be preferably Fasudil, its cost spent under identical depression effect is less, merits attention.In addition Fasudil is also the medicine of U.S. FDA approval listing, and the advantage of these aspects makes Fasudil be more suitable for being used to carry out clinical experiment.
The ROCK inhibitor that other and Fasudil have similar working mechanism is also in the present invention involved, for the preparation of the medicine suppressing Bone of Breast Cancer transfer.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, conveniently condition such as J. Pehanorm Brooker etc. is write usually, Molecular Cloning: A Laboratory guide, the third edition, Science Press, the condition described in 2002, or according to the condition that manufacturer advises.
Materials and methods
One, experiment material
Antibody, reagent
Mouse anti-human DLC1 is purchased from Becton, Dickinson and Company, Rabbitanti-human RHOA, RHOB, RHOC, phospho-PAK4 (Ser474), SMAD3 is purchased from CellSignaling Technology company, anti-human PTHLH is purchased from AOGMA company, anti-humanphospho-SMAD3 (Ser425) is purchased from Abcam company, anti-human phospho-Vimentin (Ser71) is purchased from MBL International Corporation company), anti-human β-actin antibody is purchased from Merck company, anti-human GAPDH antibody is purchased from Proteingroup company, the goat antimouse IgG of HRP labelling, goat anti rabbit IgG, donkey anti goat IgG antibody is purchased from Pierce company, anti-human SMAD3pSer204 and anti-human SMAD3pSer208 is provided by Rutgers university of the U.S..
Rho inhibitor C 3 is purchased from Cytoskeleton company, CDC42 inhibitor is meet 17-32 amino acids sequence (Rajnicek corresponding to one section of CDC42 albumen after the one section of sequence (GRKKRRQRRRPPQC) promoting that cell internalizing absorbs, A.M etc., J Cell Sci119,1723-1735 (2006)), this little peptide is synthesized by gill biochemical corp, Shanghai.RAC1 inhibitor NSC23766 is purchased from Santa Cruz company, and PTHLH inhibitor 6-thioguanine (6-TG) is purchased from Sigma.ROCK inhibitor Y27632 and Fasudil is purchased from Selleck company.ERK inhibitor PD98059, P38 inhibitor P38MAPKinase inhibitor, jnk inhibitor JNK inhibitor II and PI3K inhibitor LY294002 is purchased from Calbiochem company.
Human insulin is purchased from Roche company; Human EGF is purchased from Invitrogen company; Hydrocortisone is purchased from Merck company; Choleratoxin is purchased from Enzo company; BCA protein content detection kit and ECL luminescent solution are purchased from Pierce company; Protein size ladder is purchased from Fermentas company; 4%Agarose gel is purchased from Invitrogen company; BD Matrigel Basement MembraneMatrix is purchased from BD bioscience company; Puromycin DiHCl Cell Culture-Tested is purchased from Merck company; Polyethylenimine available from Sigma; Tetracycline hydrochloride available from Sigma, Crystal Violet is purchased from BBI company; Para formaldehyde (PFA) available from Sigma; Trichloroacetic acid (trichloroacetic acid, TCA), acetone, ethanol etc. are purchased from Shanghai traditional Chinese medicines company.
Molecular cloning related reagent: T4DNA ligase, Pfu polymerase, RT-PCR, Real time PCRkit are purchased from Takara; Restricted enzyme is purchased from NEB.
Cell culture related reagent: DMEM culture fluid, F12 culture fluid, basal medium199, basalmedium200, hyclone, penicillin and streptomycin, pancreatin etc. are purchased from Invitrogen.
Two, experimental technique
1, plasmid construction
The expression plasmid (pBabepuro-DLC1 and pBabepuro-DLC1 (R718E)) that people DLC1 and DLC1 the 718th arginine sports glutamic acid GAP Domain inactive mutant (R718E) is provided by NorthCarolina university of the U.S..RhoA mutant expression plasmid RhoA (63L) of sustained activation is provided by Fudan University Dr.Lan Ma.Smad reporter gene expression plasmid (SBE) and SMAD4knockdown expression plasmid are provided by Princeton university Kang Yi shore laboratory.MluI and the XhoI site that PTHLH isoform3promoter (-309bp ~ 100bp) inserts pGL3-basic vector builds PTHLH isoform3promoter reporter gene.PTHLH isoform3promoter mutant reporter plasmid is obtained after the Smad3 binding sequence AGACAG (-57 ~-52bp) of this report plasmid is mutated into sequence GATACC.XhoI and the HpaI site that mice Dlc1CDS district is cloned into carrier pMSCV-puro (purchased from ClonTech) is constructed Dlc1 expression plasmid.The Bgl II and the Xho I site that mice Pthlh CDS district are cloned into carrier pMSCV-hygro (purchased from ClonTech) construct Pthlh expression plasmid.
The shRNA expression plasmid surely transfered from one department to another for the preparation of KD1DLC1knockdown adopts pSuper-Retro-puro as carrier (purchased from OligoEngine), after HindIII and BglII double digestion, access endonuclease bamhi.As follows according to RNA disturbance-proof design principle synthesis aim sequence:
Surely transfer from one department to another for the preparation of KD1DLC1knockdown:
KD1: forward sequence (5 ' → 3 '): gatctccCCTTGACTGGAATATGTAAttcaagagaTTACATATTCCAGTCAAGGtt tttggaaa (SEQ ID NO:1);
KD1: reverse sequence (5 ' → 3 '): agcttttccaaaaaCCTTGACTGGAATATGTAAtctcttgaaTTACATATTCCAGT CAAGGgga (SEQ ID NO:2).
Surely transfer from one department to another for the preparation of KD2DLC1knockdown:
KD2: forward sequence (5 ' → 3 '): gatctccCCCGATTGCAAATAGTGATttcaagagaATCACTATTTGCAATCGGGtt tttggaaa (SEQ ID NO:3);
KD2: reverse sequence (5 ' → 3 '): agcttttccaaaaaCCCGATTGCAAATAGTGATtctcttgaaATCACTATTTGCAA TCGGGgga (SEQ ID NO:4).
2, cell culture
MCF10 series (10A, 10AT, CA1a, CA1h) 10 μ g/ml Insulin are added according to DMEM/F12,20ng/ml EGF, 0.5 μ g/ml Hydrocortisone, 100ng/ml Cholera Toxin, 5% horse serum, the culture fluid of 100U/mL penicillin and 100 μ g/mL streptomycins is placed in the CO of 37 DEG C
2cultivate in incubator.RAW264.7, C2C12, MDA-MB-231 cell and various SCPs (single-cell-derivedprogenies): SCP2, SCP4, SCP6, SCP46, SCP28, SCP26, SCP25, SCP21,1833,4173,4175,4142,4180,3481 cells, thered is provided by Kang Yi shore, Princeton University laboratory, the culture fluid using DMEM to add 10% hyclone, 100U/mL penicillin and 100 μ g/mL streptomycins is placed in the CO of 37 DEG C
2cultivate in incubator.The laggard row zoopery of cell amplification within each 10 generations of surely transfering from one department to another to go down to posterity.Lung endotheliocyte ST1.6R is placed in the CO of 37 DEG C according to the culture fluid that basal medium199 adds 20% hyclone and 50 μ g/mL endothelial growth factor supplements (Sigma)
2cultivate in incubator.Bone endotheliocyte HBMEC-60 adds 20% hyclone with basal medium200 and 1 × low serum growth supplements (Invitrogen) does culture fluid, is placed in the CO of 37 DEG C
2cultivate in incubator.
3、RT-PCR
1. Total RNAs extraction
Generally speaking, cell 1ml Trizol cracking.Concussion 30s.Add 0.2ml chloroform, acutely shake 30s, room temperature 2min.13000rpm, 4 DEG C centrifugal, 15min.Suct the colourless aqueous phase of layer, move in another EP pipe.Add equal-volume isopropyl alcohol ,-20 DEG C, 30min.13000rpm, 4 DEG C centrifugal, 10min.Abandon supernatant, add 75% ethanol 1ml, vibration.13000rpm, 4 DEG C centrifugal, 5min.Abandon supernatant, exhaust residual liquid, drying at room temperature 5min.Precipitation is dissolved in 40-100 μ l DEPC water.Take out 1 μ l and survey its OD260/OD280.-80 DEG C of preservations.
2. reverse transcription synthesis cDNA
Reaction system is as follows: 5 × RT Buffer2 μ l; RNase Free dH
2o complements to 10 μ l; DNTPMixture (each 2.5mM) 2 μ l; RNase Inhibitor0.25 μ l; Reverse Transcriptase0.25 μ l; Oligo dT0.5 μ l; Random6primer0.5 μ l; RNA500ng; Reaction condition is: 42 DEG C of 10min, 95 DEG C of 2min.
4、Real time PCR
PCR reaction system: ddH
2o1.0 μ l; Template cDNA3.0 μ l;
premix Ex Taq
tM5 μ l; Forward primer (10 μMs) 0.4 μ l; Downstream primer (10 μMs) 0.4 μ l; ROX0.2 μ l.
Reaction condition: Step1:50 DEG C 2min; Step2:95 DEG C of 10min; Step3:95 DEG C of 15sec; Step4:60 DEG C of 1min; Step5:95 DEG C of 15sec; Step6:60 DEG C of 15sec; Step7:95 DEG C of 15sec.Wherein Step3, Step4 carry out follow-up Step5 after carrying out 40 circulations again.
Primer is as follows:
People DLC1 F:CCGTGCTTGATGTGCAGAAAG (SEQ ID NO:5)
R:ACCAGTTGCCCGTAGCCAAT(SEQ ID NO:6)
Mice Dlc1 F:CGGACACCATGATCCTAACA (SEQ ID NO:7)
R:ATACTGGGGGAAACCAGTCA(SEQ ID NO:8)
People PTHLH F:ACAGTTGGAGTAGCCGGTTG (SEQ ID NO:9)
R:CCCTTGTCATGGAGGAGCTG(SEQ ID NO:10)
People IL11 F:AGCGGACAGGGAAGGGTTA (SEQ ID NO:11)
R:CTGTATCTGGCCACAGGCTC(SEQ ID NO:12)
People CTGF F:CCTGCAGGCTAGAGAAGCAG (SEQ ID NO:13)
R:TGGAGATTTTGGGAGTACGG(SEQ ID NO:14)
People JAG1 F:ATGGGCCCCGAATGTAACAG (SEQ ID NO:15)
R:ATCACAGTACAGGCCTTGCC(SEQ ID NO:16)
People Smad4 F:CCATCCAGCATCCACCAAGT (SEQ ID NO:17)
R:GGCCCTGATGCTATCTGCAA(SEQ ID NO:18)
People CDKN1A F:AGTCAGTTCCTTGTGGAGCC (SEQ ID NO:19)
R:CATTAGCGCATCACAGTCGC(SEQ ID NO:20)
As the human PTHLH primer of ChIP-qPCR
F:CCCACCAGAGGAGGTAGACA(SEQ ID NO:21)
R:CCTTTCGTTCCAGAGCCACT(SEQ ID NO:22)
As the primer reference list of references Lee that mouse OPG and RANKL mRNA is quantitative, J.H., etal.The Journal of biological chemistry284,13725-13734 (2009) and Bishop, K.A. etc., The Journal of biological chemistry286,20880-20891 (2011).
5, plasmid transfection and viral infection
H29 (human retrovirus packing line with dox control) cell is provided by Princeton university Kang Yi shore laboratory, adds Tetracycline (working concentration: 1 μ g/ml) cultivate according to Nostoc commune Vanch liquid.In order to do chemiluminescence analysis in animal body, relevant cell system all infects with containing GFP and firefly luciferase double labeling gene retroviral (plasmid is provided by Dr.Yibin Kang).PEI transfection method is according to molecular cloning.Collect the retroviral of over-expression and knock down, after infection cell 3-4 time, when the cell infected reach 80% converge rate after, the Antibiotic medium screening containing variable concentrations is used surely to transfer from one department to another, polyclone selects rear amplification, carries out corresponding RT-qPCR and Western Blotting and verifies.
6, Conditioned media (CM) collects
Cell goes down to posterity after closely merging, counting 2.5-5.0 × 10
6cell is inoculated, and adherent rear PBS rinses residual FBS, uses serum-free medium (CM) instead, collects 24-72h serum-free medium, the centrifugal 10min of 1500rpm, with the membrane filtration of 0.2 μm, and-80 DEG C of preservations.
Collect conditioned media (CM) supernatant, get 1ml in EP pipe.Add the 100%TCA of 1/9 volume, put upside down 10 mixings.Sample is placed in ice bath and is greater than 1 hour, 15000g, centrifugal 20 minutes.Visible have brownish black to precipitate, and outwells supernatant, and removing remains in the liquid of the mouth of pipe.Add the acetone of 200 μ l pre-coolings, 15000g, centrifugal 20 minutes, repeat 3 times.Add 50 μ l Loading buffer, 100 DEG C are heated 5 minutes, and-80 DEG C save backup.
7, immunoblotting (Western Blotting)
Get at least 20 μ g albumen of equivalent, 10%SDS-Page gel electrophoresis is used to be separated, transferring film, (after the albumen transferring film of CM precipitation, determining that whether protein content is identical with Ponceaux Ponceau S dyeing), 5% defatted milk powder room temperature closes 1 hour, and corresponding primary antibodie 4 DEG C is hatched 3h or spends the night.TBST washes film 5 minutes, totally 3 times, and add the anti-incubated at room of HRP labelling two 1 hour, TBST washes 5 minutes, totally 3 times.ECL develops the color.
8, colony formation (Colony formation assay)
Prepare agaropectin: melt 4%soft agar with 75 DEG C of water-baths, 42 DEG C of constant temperature keep it to melt, and by conventional medium, 4%soft agar are diluted to the concentration of 0.6% and 0.3%.0.6%soft agar is laid on 24 orifice plates as lower floor's glue, and 5000 or 10000 cells are inoculated in 0.5ml0.3%soft agar, on the lower floor's glue being then laid on 0.6%.In hole, added 100 μ l culture medium every four days, after 2 weeks, counting is containing the clone more than 50 cells, takes pictures, experiment repetition 3 times.
9, cell scratch experiment (Wound healing assay)
Growth of Cells cultivates 12h to the DMEM used instead after converging containing 0.5%FBS, with new rifle head gently between single-layer culturing cell, draw four parallel vestiges, cut crosses via hole, rifle head as far as possible with the bottom vertical of plate hole, do not tilt.After cut, with culture medium cleaning plate hole gently 3 times.Took pictures every 4 or 6 hours subsequently, the speed that statistics cell is creeped, experiment repetition 3 times.
10, cell invasion experiment (Invasion assay)
Prepare: before Matrigel matrigel uses, 4h is transferred to 4 DEG C from-20 DEG C and treats that it dissolves naturally, and liquid-transfering sucker etc. are-20 DEG C of pre-coolings all on pretreatment.
Preparation Matrigel gel coating (operating on ice): dilute Matrigel glue (final concentration 3mg/ml) with the cold cell culture medium DMEM of serum-free, getting 40 μ l dilution glue is added on 24well transwell in room, hatches transwell1-2h for 37 DEG C.
Prepare cell suspension: go down to posterity after cell closely merges, counting 0.5 × 10
5or 1.0 × 10
5cell, upper room adds 200 μ l cell suspension, adds the cell culture medium of 350 μ l containing 10%FBS, hatch for 37 DEG C, 12 hours in lower room--and 24 hours.
Dyeing and counting: remove transwells, with PBS fine laundering cell in 24 new orifice plates, then one group of cell is placed in the new well containing 500 μ l0.1% crystal violets, and take out after 30min, PBS cleans.Take a picture, the trypsinization of another group well cell, in the centrifugal 4min of 1000rpm, removes supernatant, with 100 μ lPBS re-suspended cells, and counts with hemacytometer the tumor cell that this group well crosses over cell, experiment repetition 3 times.
11, Active Rho and Cdc42 detects
When Growth of Cells to 80% converges rate, the TBS cleaning of cell pre-cooling once, then ActiveRho and Cdc42Detection Kits (Pierce is used, No.16116 and 16119) the lysate cell lysis that provides, collect lysate, in 16000g at 4 DEG C of centrifugal 15min, collect supernatant, the protocol detection of active Rho provided according to kits and Cdc42.
12, Stress fiber dyes
When Growth of Cells to 40% converges rate, the DMEM hungry 24h of cell containing 0.5%BSA, sop up former culture medium afterwards, wash with PBS and once then fix 15min with 10% formalin, with 0.1%Triton X-100 process 10min, and then to dye 20min with 5U/mL rhodamine phalloidin (Invitrogen).Color card confocal laser scanning microscope, each sample random selecting 6 visuals field are used as the statistics of Stress fiber intensity, and statistics software I mage-Pro Plus5.1 carries out.
13, endothelial adhesion detects
When the endotheliocyte of 24 orifice plates grow to 100% converge rate time, continue cultured cell 6h by the culture medium containing 10ng/mL TNFa, wash endotheliocyte twice with PBS afterwards, then add 2 × 10
5the tumor cell of luciferase labelling is on endodermis, after 1 hour, the tumor cell twice of endodermis is joined with PBS washing, stick to the tumor cell of endothelium again with trypsinization, finally detect chemiluminescence intensity and the record cell suspension volume of the unit volume inner tumour cell digested.Processed group and the matched group tumor cell number of adhesion is calculated again by the chemiluminescence intensity standard curve of the tumor cell number set up in advance-unit volume inner tumour cell.
14, detect across endothelial migration
By the little indoor of endothelial cell seeding at transwell, when endothelial cell growth to 100% converges rate, with PBS, endothelium is washed once, then by 5 × 10
4tumor cell plants the cell of paving endothelium, M199 or M200 of 350 μ l containing 10ng/mL EGF is added below cell, after cultivating 24h, digest the tumor cell of little outdoor face, then calculate the tumor cell number of the leap endothelium of each well with the method for above-mentioned cell invasion experiment counting.
15, the chemiluminescence detection of Luciferase catalysis
Genes of interest reporter plasmid and Renilla luciferase reference plasmid are with Lipofectamine
tM2000 medium cotransfection target cells.After 24h, exhaust culture medium, in 24 orifice plates, every hole adds 50 μ L lysis buffers, then by 24 orifice plates at room temperature jog 1h, respectively take out 10 μ L cell pyrolysis liquids afterwards successively to mix with 30 μ L firefly luciferin Substrate cocktail or 30 μ L renilla luciferase Substrate cocktail, record the chemiluminescence intensity of sample with Lumat LB9507luminometer (Berthold).
16, gene expression chip analysis
Express the SCP2 cell of zero load or DLC1 respectively with solvent or 10ng/Ml TGF β process 24h, use Trizol extracting total RNA afterwards, then four groups of RNA are served extra large chip companies (ShanghaiBiotechnology Corporation) and adopt Affymetrix U133plus2.0arrays to carry out gene expression analysis.If certain gene of SCP2 of expression zero load is gene expression dose ratio >2 or <0.5 under TGF β treatment conditions and under solvent treatment conditions, this gene is just defined as TGF β-responsive genes, in TGF β-responsive genes, if the SCP2 cell of expressing DLC1 is similar to solvent process expression under TGF β treatment conditions, then belonged to A group; If the SCP2 cell of expressing DLC1 is greater than 2 with the ratio of expressing the unloaded expression of SCP2 cell under TGF β treatment conditions, then belonged to B group.
17, chromatin immune co-precipitation
Express SCP2 cell that is unloaded or DLC1 and SMAD3 (being provided by Rutgers University Dr.Fang Liu) or SMAD3 mutant (EPSM) (being provided by Rutgers University Dr.Fang Liu) transfection are provided respectively, after 24h, respectively with solvent or 10ng/mL TGF β process 24h, use 1% formaldehyde crosslinking cell 10min afterwards, then stop formaldehyde effect with 125mM Glycine process 5min.Use trypsin digestion cell 20min, after centrifugal 4min, the PBS washing once of 2000rpm afterwards, add 8ml cell lysis buffer solution cracking 20min on ice, 8ml cell lysis buffer solution cracking 20min on ice is again added after the centrifugal 5min of 5000rpm, the centrifugal 5min of 5000rpm, abandons supernatant, adds 200 μ L nuclei lysis buffer to precipitation, allow nucleus cracking 10min, in lysate, add 300 μ L dilution buffers again, then supersound process, make genome by the length interrupted as about about 500bp.Then, with the centrifugal 10min of the rotating speed of 13300rpm, get supernatant 100 μ L successively and manage in two 1.5ml EP, respectively add 400 μ L dilution buffers, add smad3 antibody and Rabbit IgG overnight incubation afterwards.Second day, by this mixed liquor with hatch 4h with the protein A beads that salmon sperm dna and BSA blockaded, the centrifugal 2min of 800g afterwards, wash twice with dialysis buffer liquid, then wash twice with lavation buffer solution, then hatch 30min with 200 μ L extraction buffers at 67 DEG C, centrifuging and taking supernatant, add RNase A and 0.3M NaCl and hatch 5h at 67 DEG C, afterwards with the dehydrated alcohol precipitation DNA of-80 DEG C of pre-coolings, finally use DNAkit (TIANGEN) purify DNA.
18, osteoclast cell maturation
By 5ng/mL TGF β 1.0 μ g/mL C3 or 10 μM Y27632 also, or unloaded group of 10 μMs of 6-TG process or processed group cell 72h, or first use RhoA (63L) virus (plasmid of expressing RhoA (63L) is provided by Fudan University Dr.Lan Ma) to infect the SCP2 cell 48h expressing unloaded or DLC1, afterwards with the cell 72h that 5ng/mL TGF β process viral infection is crossed, collection culture medium is stand-by.By 4 to 6 week large mices to crane one executions, get its hind leg immediately, peeling meat, goes out bone marrow with ɑ-MEM under aseptic condition, the centrifugal 4min of 1000rpm, re-suspended cell, and medullary cell is placed in 24 orifice plates cultivations, every porocyte number is 100 ten thousand.Above-mentioned culture medium being added to plant with the concentration of 10 times of dilutions is implanted with in 24 orifice plates of medullary cell, and add the M-CSF (PeproTech) that concentration is 25ng/mL, osteoclast cell maturation is observed in the protocol dyeing provided according to TRAP staining kit (Sigma387A) after six days, and cell dyeing presents the positive and is defined as ripe osteoclast containing being no less than 3 nuclear cells.
In addition, be the target cell of a nearly step determination conditioned medium effect, 10
5rAW264.7 is independent or plant in 48 orifice plates with same number of together with the C2C12 of WNT3a induced maturation, afterwards 5ng/mLTGF β process is expressed the culture medium after 4T1 cell (the U.S. Karmanos ICR Fred doctor Miller provides) 72h of unloaded or Dlc1 to make an addition to the final concentration of ten times of dilutions and kind be implanted with in the orifice plate of RAW264.7, observe the maturation of osteoclast with above-mentioned same procedure.
19, animal feeding
The Balb/c nude nude mice in 4-8 week, purchased from Shanghai Si Laike animal center, to be raised in SPF level barrier system (relative humidity of 22-25 DEG C, 40-60%, the day-night cycle of 12h and food and water freely absorb).
20, mice left ventricle injection
Anesthesia: 1% pentobarbital sodium intraperitoneal injection of anesthesia, every nude mice calculates required anesthetics dosage respectively by the amount of 30-40mg/kg.
Before 75% ethanol, thoracic wall sterilization, touches apex beat with hands and the most obviously locates, between the left other 3mm second rib of breastbone, aiming at center with health is 45 degree of inserting needles, pumpback, has scarlet blood ejection if can see, oneself enters left ventricle then to represent pin, after slowly being pushed by cell suspension, pulls out pin rapidly.
Injection cell concentration is: by 1.0 × 10
6cell/ml, 0.1ml/ only.By dosage optical fundus injection D-luciferin (nude mice intravenous injection is identical therewith) of 75mg/kg, Berthold Imaging System imaging weekly, takes pictures.Continue after injection to raise, ad lib, observe nude mice animation and ordinary circumstance; Inject vital sign and the state of latter 24 hours planted agent's close observation nude mices.
Tumor cell injection the 3rd day, experimentally need, (50mg/kg is dissolved in 100 μ L PBS for processed group injection Y27632 (8mg/kg is dissolved in 100 μ L PBS, 1 time/2 days, lumbar injection) or Fasudil, 1 time/1 day, subcutaneous injection) or 6-TG (1.0mg/kg is dissolved in 100 μ L PBS, 1 time/1 day, subcutaneous injection), matched group injection solvent, drug exposure times is 4-8 week.
21, mouse mainline
Hg lamp irradiation mice distends the blood vessels, inserting needle after fixing.Before inserting needle, pinpoint inclined plane upwards, and a hand-held firmly another hand-held pin of tail, with the slow inserting needle in the direction that needle tubing is parallel with vein blood vessel, can know after lunging 2-3mm and see pinpoint inclined plane, now slowly try to inject, see along vein white line and enter mouse body, injection cell concentration is: by 2.0 × 10
6cell/ml, 0.1ml/ only.After injection, the withdraw of the needle, pins and pulls out pin fast into note position, and pressing hemostasis in a moment.
22, fat pad in-situ injection
Cell density 2.0 × 10
7cell/ml, mixes with Matrigel1:1 and places on ice.Dissect after mouse anesthesia and expose fat pad, be only injected in No. 4 fat pads on the left of abdominal part by 10 μ L/.
23, the detection of Metastasis in Breast Cancer stove
When macroscopic bone injury appears in the mice being injected into tumor cell, mice is taken out and does x-ray inspection.Dissect afterwards and take out Bone tumour stove, process two weeks with 10% neutral EDTA in 4 DEG C after fixing, carry out conventional embedded section afterwards and do H & E and immunohistochemical staining.For the focus of Lung metastases, be then after tumor cell tail vein injection, dissect mices four-six weeks win lung and do conventional embedded section and be H & E.
24, clinical sample analysis
Bos etc. and (Bos, P.D., et al.Nature459, the 1005-1009 (2009) such as van ' t Veer; Minn, A.J., et al.Nature436,518-524 (2005); Van ' t Veer, L.J., et al.Nature415,530-536 (2002)) its DLC1 expression intermediate value of sample evidence of describing is divided into two groups: DLC1 expression group and the reticent group of DLC.Then the Cox survival curve of two groups is compared.In addition, obtain 64 routine breast cancer orthotopic tumor specimen from Shandong Qilu Hospital, be extracted the total serum IgE of specimen with Trizol, done DLC1mRNA and PTHLH mRNA qPCR quantitative analysis, done their expression correlation analysis further.Breast cancer orthotopic cancer sample, lymph no metastasis sample and Bone of Breast Cancer metastasis sample is also obtained from Shanghai Long March Hospital.These samples analyze the expression of its DLC1 through conventional IHC, and result is with 0, and 1,2,3 represent.0 represents that DLC1 does not express; 1 represents DLC1 low expression level; 2 represent that DLC1 expresses with medium level; 3 represent DLC1 high level expression.
25, data analysis
Difference in experiment in vitro between matched group and experimental group uses two tails or single tail student ' s t to check.P value is less than 0.05 and is considered to have significant difference.BLI curve adopts ANOVA to analyze and compares, and the survival curve negotiating Log-rank test of animal or patient checks its significance of difference.
Embodiment 1, DLC1 are Bone of Breast Cancer tumor metastasis suppressor genes
(the Kang such as Yibin Kang, Y., et al.Cancer Cell3,537-549 (2003)) by screening in body and the external method verified in monoclonal of choosing from MDA-MB-231 cell screening to the Cell subline with Different Organs metastasis tendency, the DLC1 expression of these subbreed is shown in Fig. 1.
As can be seen from Figure 1 the expression of DLC1 in various subbreed only with its Bone tumour ability inverse correlation (Figure 1A), there is no obvious relation between persistence (Figure 1B) with its Lung metastases ability.Therefore the present inventor focuses on the function of DLC1 in Bone of Breast Cancer transfer and the research of mechanism.
First the present inventor process LAN DLC1 (application pBabepuro-DLC1) (Fig. 2 A) in the processus styloideus radii transfer cell line SCP2 of DLC1 silence, and by process LAN DLC1 with unloaded surely transfer from one department to another to be injected in Female nude mice body by left ventricle to observe the impact of DLC1 process LAN on Bone tumour.At the 6th week, the average BLI value of process LAN group is less than matched group more than 10 times (Fig. 2 B), the Bone tumour stove size of pathological section display process LAN group is significantly less than matched group (Fig. 3 C), the mice of process LAN group without Bone tumour survival rate apparently higher than matched group (Fig. 2 D).
Afterwards, for whether the silence inquiring into DLC1 is for needed for breast cancer cell Bone tumour ability increases, the two strain knockdown that the SCP28 cell line with medium Bone tumour ability of the present inventor DLC1 high expressed constructs the different sequence area of targeting DLC1 surely transfer from one department to another KD1, KD2 and zero load is surely transfered from one department to another (unloaded is pSuper-Retro-puro) (Fig. 3 A).To DLC1knockdown be crossed by similar method and unloaded surely transfer from one department to another to be injected in Female nude mice body by left ventricle to observe the impact of DLC1knockdown on SCP28 Bone tumour.At the 5th week, the average BLI value of KD1 or KD2 group exceeds more than 10 times (Fig. 3 B) than matched group, in the Bone tumour stove of pathological section and X-ray display KD1 or KD2 group, tumor cell is obviously better than matched group (Fig. 3 C and 3D) to the infringement of bone, and the mice of KD1 or KD2 group is starkly lower than matched group (Fig. 3 E) without Bone tumour survival rate.
Secondly, whether affect by immune for inquiring into the function of DLC1 in Bone tumour further, the present inventor's process LAN in the breast cancer cell 4T1 being derived from mice (has proceeded to pMSCV-puro) Dlc1 (Fig. 4 A) of mice, then observes process LAN Dlc1 to the impact of 4T1 Bone tumour by similar method.The present inventor finds, at the 5th week, the Bone tumour stove number of process LAN group is fewer than matched group more than 5 times (Fig. 4 B), in pathological section display process LAN group Bone tumour stove, tumor cell is obviously lighter than matched group (Fig. 4 C) to the infringement of bone, process LAN group mice without Bone tumour survival rate also apparently higher than matched group (Fig. 4 D).
In view of DLC1 is the important negative regulatory factor of Rho path, report in the past shows that DLC1 also plays negative regulation effect (Ko in the process of cancerous cell to Lung metastases, F.C., et al.Nature communications4,1618 (2013) and Goodison, S., et al.Cancer Res65,6042-6053 (2005)), therefore the present inventor also observes the effect of DLC1 in breast carcinoma Lung metastases process simultaneously in SCP28 and 4T1.No matter result display is analyze (Fig. 5 A, B, D, E) from BLI or pathological section, or analyzes (Fig. 5 C, F) from survival curve, the Pulmonary metastasis focuses of processed group and control group mice form number and size substantially very nearly the same.The above results shows that DLC1 is the negative regulatory factor of breast carcinoma organ (bone) transspecific.
The suppression of embodiment 2, Rho activity has mediated the function of DLC1 in Bone tumour
Although the DLC1 negative regulatory factor that to be Rho path important, but DLC1 activity itself is also subject to the regulation and control of other albumen, also exist in the cell model of the present inventor DLC1 inactivation may, therefore the present inventor have detected the impact of DLC1 on the activity of some albumen in Rho path and downstream.
Analysis of Phosphorylation that is active by Rho and downstream albumen finds, DLC1 still can inactivation Rho albumen in SCP2 and SCP28, and the activation of downstream albumen is also presented to the phenomenon (Fig. 6 A) of suppression; Under condition in position, DLC1 also inhibits the formation (Fig. 6 B) of the stress fiber that mark RhoA activates.
Whether the present inventor and the suppression exploring Rho activity mediate the function of DLC1 in Bone tumour.Construct the SCP2 that a strain contains DLC1GAP inactive mutant process LAN before the present inventor when the SCP2 building DLC1 process LAN surely transfers from one department to another (application pBabepuro-DLC1) simultaneously and surely transfer from one department to another (R718E) (application pBabepuro-DLC1 (R718E)), these successful foundation surely transfered from one department to another are by detecting the active confirmation (Fig. 7 A) of Rho and Cdc42.This two strains cell line and compared with control cells system inject in nude mouse by the mode that left ventricle is injected, afterwards the situation of their formation Bone tumour of Continuous Observation.Find at the 6th week, matched group exceeds more than 15 times than process LAN group (SCP2 of DLC1 process LAN surely transfers from one department to another) BLI value, but with GAP inactive mutant group difference little (Fig. 7 B), in pathological section display process LAN group Bone tumour stove, tumor cell is obviously lighter than GAP inactive mutant group and matched group to the infringement of bone, but without significant difference (Fig. 7 C) between the latter two, process LAN group mice without Bone tumour survival rate also apparently higher than GAP inactive mutant group and matched group, also without significant difference (Fig. 7 D) between the latter two.Illustrate that the suppression of Rho activity has mediated the function of DLC1 in Bone tumour.
Embodiment 3, DLC1 hinder the maturation of osteoclast to the suppression of Rho path
The above results shows, DLC1 mediates the role of its negative regulatory factor in Bone tumour by the suppression of Rho path.And remarkable at the function effect to DLC1 in the process of Lung metastases, this makes the present inventor explore the mechanism of DLC1 suppression breast carcinoma organ specificity transfer further.Because the adhesion of cancerous cell and target organ endothelium is that cancerous cell forms the essential step shifted, first the present inventor have detected DLC1 on the adhesion of SCP2 and SCP28 and bone endothelium and lung endotheliocyte and they are across the impact of the transfer ability of endothelium.Result display DLC1 all inhibits the adhesion (Fig. 8 A and C) of breast cancer cell and bone and lung endothelium, and tumor cell across the ability of two class endotheliums similarly by DLC1 suppression (Fig. 8 B and D).
Obviously be not enough to explain that DLC1 suppresses breast cancer cell to the transfer of bone specifically from tumor cell and adhering to of endothelium merely.Therefore, the present inventor then inquires into the impact that DLC1 clones at bone formation breast carcinoma.Because osteoclast has critical effect in the process of cancerous cell formation Bone tumour, the present inventor have detected the effect of DLC1 in breast cancer cell promotion osteoclast cell maturation process.In addition, in view of the pivotal role of TGF β in Bone tumour, the present inventor, just with TGF β process breast cancer cell, then goes osteoclast precursor in inducing mouse bone marrow ripe by culture medium.Bone marrow cells in mice shows in the cultivation of tumor cell condtioned medium, and the DLC1 of tumor cell significantly suppress the maturation of osteoclast (Fig. 9 A-C), and suppression ratio is greater than 50%; And in SCP28 metastatic tumor of bone, the osteoclast number in DLC1 silence group tumor-bone interface unit length is then 3 times to 5 times (Fig. 9 D-E) of matched group.
Afterwards, whether the suppression that the present inventor continues again to inquire into Rho path has mediated the effect of DLC1 in osteoclast cell maturation process.(RhoA (63L) is subcloned into Bgl II and the Xho I site of pMSCV-hygro to the reversion virus that the present inventor expresses with the inhibitor C 3 of Rho path and the mutant of Y27632 or RhoA sustained activation, then with this plasmid transfection H29) process tumor cell, the tumor cell then crossed with above-mentioned identical experimental technique check processing is on the impact of osteoclast cell maturation.RAP dyes display: Rho pathway inhibitor C3 and Y27632 has saved the promotion (Figure 10 A) of DLC1knockdown to osteoclast cell maturation, and they are similar to the impact (Figure 10 B) of DLC1 process LAN on the maturation of osteoclast to the impact of the maturation of osteoclast; In SCP2 metastatic tumor of bone, decrease the osteoclast number about 9 times in unit tumor-bone interface length compared to the process LAN of matched group DLC1, but DLC1GAP inactive mutant process LAN is not on the osteoclast number impact in SCP2 tumor-bone interface unit length significantly (Figure 10 C-D).These results show that the suppression of Rho path has mediated the effect of DLC1 in osteoclast cell maturation process.
The PTHLH up-regulated that embodiment 4, DLC1 suppress TGF beta induced
Although DLC1 inhibits the maturation of tumor cell induction osteoclast, its mechanism is not bright.In view of TGF β has crucial regulating and controlling effect (Chen in Bone tumour process, Y.C. etc., Breast Cancer Res12, 215 (2010)), crosstalk (the Kamaraju and Rho path and TGF β path have also been in the news, A.K etc., The Journal of biological chemistry280, 1024-1036 (2005)), therefore the present inventor has done four groups of sample process: express unloaded (pBabepuro, available from Addgene) or the SCP2 cell of DLC1 (pBabepuro-DLC1) respectively with solvent or 10ng/mL TGF β process 24h, then extracting total serum IgE send chip companies to do gene expression chip analysis.Expression chip result shows the beta induced expression of its path target gene of TGF, also find that DLC1 has regulated and controled two groups and regulated the gene of expressing by TGF β: A group gene simultaneously, regulate by TGF β in non-loaded cells and express, expression is similar to solvent process expression under DLC1 process LAN with TGF β treatment conditions; B group gene, regulates and express, but the SCP2 cell of expressing DLC1 is greater than 2 (Figure 11 A-B) with the ratio of expressing the unloaded expression of SCP2 cell under TGF β treatment conditions in non-loaded cells by TGF β.That in A group gene, discovery makes number one is PTHLH, expresses being inhibit about 3.2 times by DLC1 compared to PTHLH in matched group DLC1 group.The present inventor demonstrates DLC1 to the regulation and control that PTHLH expresses under TGF β treatment conditions with Western blot, and result is homogenic, and chip is consistent, and finds that this regulation and control depend on Rho path (Figure 11 C-D).
In view of the importance of PTHLH in Bone tumour, the present inventor studies PTHLH further and whether has mediated the role of DLC1 in Bone tumour, devise two groups of experiments: one, be injected into the nude mice of stably express DLC1 and unloaded SCP2 with the regular quantitatively subcutaneous injection of PTHLH inhibitor 6-TG, observe the application of 6-TG to the impact of their formation Bone tumour; They are two years old, the present inventor is stably express mice Pthlh (being expressed by carrier pMSCV-hygro) and zero load (pMSCV-hygro) again in the 4T1 and non-loaded cells system of stably express Dlc1, they injected in female mice body by left ventricle injection afterwards, the Bone tumour observing them is formed.These two groups of experimental result displays, the application of 6-TG makes stably express DLC1 form the ability of Bone tumour almost consistent (Figure 12 A-D) with unloaded SCP2, and the expression of Pthlh in the 4T1 of stably express DLC1 and zero load makes this two strain 4T1 subbreed form the ability close (Figure 12 E-F) of Bone tumour.The above results illustrates that PTHLH has mediated the function of DLC1 in Bone of Breast Cancer transfer process.
The PTHLH up-regulated that embodiment 5, DLC1 suppress TGF beta induced by the phosphorylation of regulation and control Smad3linker region
Although DLC1 has regulated and controled the expression of PTHLH, but it is that how to regulate and control the expression of PTHLH unknown, in order to address this problem, first the present inventor uses the inhibitor treatment S CP2 of other the multiple paths affected by TGF β path, finds the expression substantially unaffected (Figure 13 A) of PTHLH.Then the present inventor's reticent Smad4 (application SMAD4knockdown expression plasmid) in SCP2, find the expression of PTHLH be more or less the same in DLC1 and the unloaded SCP2 expressed and with without the expression under TGF β treatment conditions close (Figure 13 B-C).This illustrates that the expression of DLC1 regulation and control PTHLH is that Smad relies on.
Had bibliographical information Rho path can regulate and control the phosphorylation of Smad3 in the past, the present inventor have detected the impact of DLC1 on the phosphorylation of Smad3.Result display DLC1 has lowered the phosphorylation level (Figure 14 A) of upper 204 and 208 the upper serines of Smad3.In view of the report TGF β such as Jungeun Lee also can activate Rho path (Lee, J., Moon etc., J Biol Chem285,26618-26627 (2010)), so the present inventor then detects after SCP2 accepts the stimulation of TGF β, whether RhoA activity raises.After with the TGF β process 24h of 10ng/ml, detect discovery by active Rho kits (purchased from Pierce), the active remarkable rise of matched group RhoA, but process LAN group has no RhoA activity generation significantly change.This illustrates DLC1 at suppression TGF β to playing inundatory effect (Figure 14 B) in the rise of RhoA activity.Then the present inventor goes up mutant (EPSM) or wild type Smad3 expression plasmid and PTHLH promoter reporter plasmid that mutant serines are the Smad3 of alanine or the PTHLH promoter reporter plasmid cotransfection suddenlyd change containing Smad3 binding sequence with 204 and 208.The phosphorylation of the upper serine of transfection results display 204 and 208 is that by Smad3 binding sequence medium, it activates PTHLH promoter activity necessary (Figure 14 C) to Smad3, because PTHLH promoter activity is similar with the activity of Smad3 corotation to DLC1 after Smad3204 is alanine with 208 mutant serines, all far below the PTHLH promoter activity after matched group only Smad3 transfection.Further ChIP analyzes and shows that DLC1 is almost identical with the zero load group of a transfection EPSM with the PTHLH promoter fragment copy number got off by immunoprecipitation in conjunction with PTHLH promoter because of Smad3 after Smad3 or EPSM corotation, all few at least 2.6 times than the zero load group of only transfection Smad3.The phosphorylation of the upper serine of this hint 204 and 208 strengthens the interaction of Smad3 and PTHLH promoter, and the phosphorylation in these two sites is that PTHLH transcribes necessary (Figure 14 D).
DLC1 expression and PTHLH expression and Bone tumour prognosis negative correlation in embodiment 6, clinical breast cancer sample
On the basis of cell model, the present inventor analyzes the mechanism that DLC1 regulation and control PTHLH finally affects Bone tumour, analyzes the relation of DLC1 expression and PTHLH expression and Bone tumour prognosis in clinical breast cancer sample further.
First the present inventor utilizes the NKI microarray data (Bos, P.D., et al.Nature459, the 1005-1009 (2009) that have delivered; Minn, A.J., et al.Nature436,518-524 (2005); Van ' tVeer, L.J., et al.Nature415,530-536 (2002)) analyze the relation of DLC1 and bone and Lung metastases in tumor sample, analysis result shows: in sample, DLC1 expression becomes the relation of negative correlation with Bone tumour prognosis, uncorrelated with Lung metastases prognosis (Figure 15 A-B).
Afterwards, the present inventor obtains 64 routine breast cancer in situ tumor samples from hospital, and the present inventor has extracted its RNA and analyzed discovery with DLC1 expression in the patient's sample recurred with Bone tumour form significantly lower than not recurring or recurring the DLC1 expression (Figure 15 C) in patient's sample with Lung metastases form by qPCR.The present inventor finds that DLC1 expression and PTHLH expression are negative correlation (Figure 15 D) in this 64 routine breast cancer in situ tumor sample simultaneously, and correlation coefficient is-0.32.
In addition, the present inventor also analyzes the expression of DLC1 in the 9 routine breast cancer in situ and 8 routine Bone of Breast Cancer metastatic tumour samples being derived from another hospital, and in IHC result display metastatic tumor of bone, the level of DLC1 will well below breast cancer in situ (Figure 15 E).
The transfer of embodiment 7, targeting ROCK path treatment Bone of Breast Cancer
Above-mentioned experimental result confirms the linker region phosphorylation of the Smad3 that DLC1 inhibits ROCK to mediate, and this causes PTHLH expression to be suppressed, and therefore the present inventor imagines the Drug therapy Bone of Breast Cancer transfer with targeting ROCK.SCP2 and 4T1 injects in nude mice and Balb/c Mice Body in the mode that left ventricle is injected by the present inventor respectively, then treats mice with ROCK inhibitor Y27632 or Fasudil.The observation display of the 4th week, inhibit 103 and 92 times (Figure 16 A) by Y27632 and Fasudil respectively relative to the growth of matched group metastatic tumor of bone.The application that IHC shows inhibitor reduces the expression of metastasis PTHLH and the number (Figure 16 B-C) of osteoclast to a great extent.X-ray examination display Fasudil group metastatic tumor has lacked about 1.9 times (Figure 16 D) the area ratio matched group that bone is encroached on.
Embodiment 8, take DLC1 as the screening technique of the potential material of the suppression Bone of Breast Cancer transfer of target spot
Method 1:
Cell model: the SCP2 expressing DLC1 surely turns cell.
Test group: with the culture of the above-mentioned cell of candidate substances process;
Matched group: without the culture of the above-mentioned cell of candidate substances process.
Detect situation in two groups.If compared with matched group, the expression of the DLC1 albumen in test group significantly raises more than 20%, then illustrate that this candidate substances is the material that potential alleviation suppresses Bone of Breast Cancer transfer.
Method 2:
Cell model: the SCP2 expressing DLC1 and Rho pathway protein surely turns cell.
Test group: with the culture of the above-mentioned cell of candidate substances process;
Matched group: without the culture of the above-mentioned cell of candidate substances process.
Detect situation in two groups.If compared with matched group, the expression of the DLC1 albumen in test group significantly raises more than 20%, and makes Rho pathway protein specific activity matched group significantly lower, then illustrate that this candidate substances is the material that potential alleviation suppresses Bone of Breast Cancer transfer.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (14)
1. a purposes for DLC1 albumen or its encoding gene or adjustment on it, for the preparation of the compositions suppressing Bone of Breast Cancer transfer.
2. purposes as claimed in claim 1, is characterized in that, described DLC1 albumen suppresses osteoclast cell maturation and suppresses PTHLH up-regulated by suppressing Rho active, thus suppresses Bone of Breast Cancer transfer.
3. purposes as claimed in claim 1, it is characterized in that, described compositions is used for:
Suppress Rho active;
To lower in Smad3 the phosphorylation level of the 204th and 208 upper serines;
PTHLH is suppressed to express; Or
Suppress osteoclast cell maturation.
4. purposes as claimed in claim 1, it is characterized in that, the upper adjustment of described DLC1 albumen comprises: the function fragment of DLC1 albumen; The plasmid of recombinant expressed DLC1 albumen or its function fragment.
5. a purposes for DLC1 albumen or its encoding gene, for screening the potential material suppressing Bone of Breast Cancer transfer.
6. screen a method for the potential material suppressing Bone of Breast Cancer transfer, it is characterized in that, comprise the following steps:
A candidate substances contacts with the system expressing DLC1 albumen by ();
B () detects expression or the activity of DLC1 albumen, if described candidate substances improves expression or the activity of DLC1 albumen statistically, then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
7. method as claimed in claim 6, it is characterized in that, step (a) comprising: in test group, in the system expressing DLC1 albumen, add candidate substances;
In step (b), detect expression or the activity of DLC1 albumen, and compare with matched group, wherein said matched group is the system of not adding described candidate substances, expressing DLC1 albumen; If the expression of DLC1 albumen or activity improve statistically in test group, just show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
8. method as claimed in claims 6 or 7, is characterized in that, in step (a), also express Rho albumen in described system;
In step (b), detect the interaction of DLC1 albumen and Rho albumen, compared with matched group, if both test group candidate substances promotions interact and make the activity of Rho albumen lower statistically, then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
9. method as claimed in claims 6 or 7, is characterized in that, in step (a), also express PTHLH albumen in described system;
In step (b), detect the regulation and control to PTHLH RNA or protein expression of DLC1 albumen, compared with matched group, if candidate substances promotes DLC1 to the downward effect of PTHLH RNA or albumen and makes the expression of PTHLHRNA or albumen lower statistically, then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
10. method as claimed in claims 6 or 7, is characterized in that, in step (a), also express Smad3 albumen in described system;
In step (b), detect the impact of DLC1 albumen for the phosphorylation level of SMAD3 albumen, compared with matched group, if candidate substances makes the phosphorylation level of Smad3 albumen the 204th and 208 serines lower statistically, then show that this candidate substances suppresses the potential material of Bone of Breast Cancer transfer.
The purposes of 11. 1 kinds of DLC1 albumen or its encoding gene, for the preparation of the reagent of Bone of Breast Cancer transfer prognosis.
The purposes of the reagent of 12. specific recognition DLC1 albumen or its encoding gene or its encoding gene, for the preparation of reagent or the test kit of Bone of Breast Cancer transfer prognosis.
13.Rho is correlated with curling spiralization kinases inhibitor in the purposes preparing prevention, alleviation or treat in the medicine of Bone of Breast Cancer transfer disease.
14. purposes as claimed in claim 13, is characterized in that, described Rho curling spiralization kinases inhibitor of being correlated with is Fasudil.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310438956.5A CN104436162A (en) | 2013-09-24 | 2013-09-24 | Method and preparation for inhibiting bone metastasis due to breast cancer |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310438956.5A CN104436162A (en) | 2013-09-24 | 2013-09-24 | Method and preparation for inhibiting bone metastasis due to breast cancer |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104436162A true CN104436162A (en) | 2015-03-25 |
Family
ID=52883421
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310438956.5A Pending CN104436162A (en) | 2013-09-24 | 2013-09-24 | Method and preparation for inhibiting bone metastasis due to breast cancer |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104436162A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110585443A (en) * | 2019-09-04 | 2019-12-20 | 中国人民解放军陆军军医大学第一附属医院 | Compound for inhibiting invasive growth of glioma and application thereof |
CN114196620A (en) * | 2022-02-14 | 2022-03-18 | 广东省农业科学院动物科学研究所 | In-vitro culture method for breast tissue of sow |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999043812A2 (en) * | 1998-02-25 | 1999-09-02 | The United States Of America, Represented By The Secretary, Department Of Health & Human Services, National Institutes Of Health | Dlc-1 gene, a putative tumors suppressor gene |
US20050106616A1 (en) * | 1998-02-25 | 2005-05-19 | The Government Of The Usa As Represented By The Secretary Of The Dept. Of Health & Human Services | DLC-1 gene deleted in cancers |
WO2008104543A2 (en) * | 2007-02-26 | 2008-09-04 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Method for predicting the occurrence of metastasis in breast cancer patients |
-
2013
- 2013-09-24 CN CN201310438956.5A patent/CN104436162A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999043812A2 (en) * | 1998-02-25 | 1999-09-02 | The United States Of America, Represented By The Secretary, Department Of Health & Human Services, National Institutes Of Health | Dlc-1 gene, a putative tumors suppressor gene |
US20050106616A1 (en) * | 1998-02-25 | 2005-05-19 | The Government Of The Usa As Represented By The Secretary Of The Dept. Of Health & Human Services | DLC-1 gene deleted in cancers |
WO2008104543A2 (en) * | 2007-02-26 | 2008-09-04 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Method for predicting the occurrence of metastasis in breast cancer patients |
Non-Patent Citations (5)
Title |
---|
刘宇飞等: "DLC-1基因与乳腺癌", 《生命的化学》, vol. 28, no. 05, 15 October 2008 (2008-10-15) * |
吴平平等: "Rho A蛋白通路在DLC-1基因调控人结肠癌HT29细胞周期中的作用及其机制", 《东南大学学报(医学版)》, vol. 28, no. 04, 25 August 2009 (2009-08-25) * |
宋金鑫等: "DLC1在乳腺癌中的肿瘤抑制作用机理", 《生命的化学》, vol. 31, no. 02, 31 December 2011 (2011-12-31) * |
蔡杰等: "抑癌基因DLC-1在肿瘤发生中的作用及其表达调控研究进展", 《中国现代普通外科进展》, vol. 12, no. 07, 15 July 2009 (2009-07-15) * |
金月玲等: "抑癌基因DLC-1的研究进展", 《现代生物医学进展》, vol. 6, no. 11, 28 November 2006 (2006-11-28) * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110585443A (en) * | 2019-09-04 | 2019-12-20 | 中国人民解放军陆军军医大学第一附属医院 | Compound for inhibiting invasive growth of glioma and application thereof |
CN114196620A (en) * | 2022-02-14 | 2022-03-18 | 广东省农业科学院动物科学研究所 | In-vitro culture method for breast tissue of sow |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Fransvea et al. | Targeting transforming growth factor (TGF)‐βRI inhibits activation of β1 integrin and blocks vascular invasion in hepatocellular carcinoma | |
Bellahcène et al. | Small integrin-binding ligand N-linked glycoproteins (SIBLINGs): multifunctional proteins in cancer | |
Zhou et al. | BMP receptor-integrin interaction mediates responses of vascular endothelial Smad1/5 and proliferation to disturbed flow | |
Kang et al. | EGFL7 is an intercellular EGFR signal messenger that plays an oncogenic role in glioma | |
Stucker et al. | Bone angiogenesis and vascular niche remodeling in stress, aging, and diseases | |
CN101432010A (en) | Compositions and methods for the stimulation or enhancement of bone formation and the self-renewal of cells | |
Ray et al. | Regulation of EGFR protein stability by the HECT-type ubiquitin ligase SMURF2 | |
CN109971756A (en) | The siRNA and its precursor that inhibit EGFR to express and application | |
Hasselhof et al. | Morphological and molecular characterization of human dermal lymphatic collectors | |
Xing et al. | Small interfering RNA targeting ILK inhibits metastasis in human tongue cancer cells through repression of epithelial-to-mesenchymal transition | |
Wang et al. | RhoC is essential for angiogenesis induced by hepatocellular carcinoma cells via regulation of endothelial cell organization | |
Zeng et al. | ILK regulates MSCs survival and angiogenesis partially through AKT and mTOR signaling pathways | |
Yang et al. | Adipose-derived stem cells modified by BDNF gene rescue erectile dysfunction after cavernous nerve injury | |
CN110257515A (en) | A kind of molecular marker and its application for breast cancer diagnosis | |
Qin et al. | FUT7 promotes the malignant transformation of follicular thyroid carcinoma through α1, 3-fucosylation of EGF receptor | |
CN104736709A (en) | Compositions and treatments based on cadherin modulation | |
CN104774929A (en) | Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer | |
CN104436162A (en) | Method and preparation for inhibiting bone metastasis due to breast cancer | |
CN114921552B (en) | Human brain glioma marker hsa_circ_0000512 and application thereof | |
Baker | Rethinking carcinogenesis: The detached pericyte hypothesis | |
Lu et al. | A new model of multi-visceral and bone metastatic prostate cancer with perivascular niche targeting by a novel endothelial specific adenoviral vector | |
Zhang et al. | Mst1 Inhibition As A Cellular Mediator: Prevention Of Anoikis In mBMSCs Through Activating ITGα5β1/FAK Signaling Pathway | |
Namusamba et al. | BAP31 Promotes Angiogenesis via Galectin-3 Upregulation in Neuroblastoma | |
CN111481666B (en) | Application of inhibitor capable of inhibiting CALB2 protein expression and liver cancer medicine | |
Xue et al. | Effect of IL-8 on hepatocellular carcinoma-associated metastasis by targeting MMP9 in mice |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150325 |