WO1999038965A1 - Human hairless gene, protein and uses thereof - Google Patents
Human hairless gene, protein and uses thereof Download PDFInfo
- Publication number
- WO1999038965A1 WO1999038965A1 PCT/US1999/002128 US9902128W WO9938965A1 WO 1999038965 A1 WO1999038965 A1 WO 1999038965A1 US 9902128 W US9902128 W US 9902128W WO 9938965 A1 WO9938965 A1 WO 9938965A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- human
- protein
- compound
- cell
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/60—Sugars; Derivatives thereof
- A61K8/606—Nucleosides; Nucleotides; Nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q7/00—Preparations for affecting hair growth
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q7/00—Preparations for affecting hair growth
- A61Q7/02—Preparations for inhibiting or slowing hair growth
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/70—Biological properties of the composition as a whole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
- A61K2800/86—Products or compounds obtained by genetic engineering
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the human hair follicle is a dynamic structure which generates hair through a complex and highly regulated cycle of growth and remodeling. Hardy, 1992, Trends Genet . 8:159; Rosenquist and Martin, 1996, Dev. Dynamics 205:379.
- the follicle is initially formed as a downgrowth of the overlying surface ectoderm in response to an initial dermal message to the ectoderm dictating the formation of an appendage.
- an epidermal message passes from the epithelial cells in the follicle bud to an underlying cluster of dermal mesenchymal cells, known as dermal papilla cells.
- the dermal papilla functions as the signaling center which plays a central role in regulating the subsequent development and activity of the hair follicle.
- a second dermal message is transmitted from the dermal papilla cells to the overlying epithelial cells of the hair plug, now known as the "hair matrix,” stimulating them to divide rapidly, to form the mature hair follicle. Id.
- the follicle As the follicle develops, morphologically, it appears as a bulbous structure with a rounded base (the hair bulb) from - 2 - which a long neck extends upward that connects it to the skin surface.
- the hair bulb surrounds the underlying dermal papilla, and contains a highly proliferative cell population, the hair matrix, whose progeny are gradually displaced upward toward the surface. As they traverse the keratogenous zone at the top of the hair bulb at the base of the neck, the cells begin to differentiate into at least six different cell types that are organized in concentric layers.
- the three innermost layers form the medullary, cortical and cuticular layers of the emerging hair, and the three sequentially more peripheral outer layers form the inner root sheath, which extends part of the distance up and is shed into the neck of the follicle. As the hair elongates, it passes through the skin surface, through the pilary canal. Id.
- Hair Growth Cycle Hair growth is typically described as having three distinct phases.
- the first phase known as anagen
- the follicle is generated and a new hair grows.
- the second stage known as catagen
- the follicle enters the stage where elongation ceases and the follicle regresses because the matrix cells stop proliferating.
- the lower, transient, half of the follicle is eliminated as a result of terminal differentiation and keratinization, and programmed cell death. Rosenquist and Martin, 1996, Dev. Dynamics 205:379.
- the dermal papilla remains intact, it undergoes several remodeling events, including degradation of the elaborate extracellular matrix which is deposited during anagen.
- the catagen stage occurs at a genetically predetermined time which is specific for each hair type in a species.
- the third stage known as telogen, is characterized by the follicle entering a quiescent phase, during which the hair is usually shed.
- a knock-out mouse with targeted ablation of the fibroblast growth factor 5 (FGF5) gene provides evidence that FGF5 is an inhibitor of hair elongation.
- FGF5 fibroblast growth factor 5
- the FGF5 gene was also deleted in the naturally occurring mouse model, angora, to determine the effect FGF5 expression on hair growth and development. Hebert, et al . , 1994, Cell 78:1017.
- FGF7 Another member of the FGF family, FGF7 or keratinocyte growth factor, was disrupted by gene targeting, and the resultant mouse had hair with a ⁇ greasy matted appearance, similar in phenotype to the rough mouse. Guo, et al . , 1996, - 4 -
- the Alopecias The Hereditary Nature Of Hair Loss.
- hereditary human hair loss known collectively as alopecias, which may represent a dysregulation of the hair cycle.
- the molecular basis of the alopecias is unknown. Rook and Dawber, 1991, Diseases of the Hair and Scalp (Blackwell Press, Oxford, UK, - 5 - ed. 2,) pp. 136-166.
- the most common form of hair loss, known as androgenetic alopecia (male pattern baldness) is believed by some to represent a dominantly inherited allele affecting 80% of the population. Bergfeld, 1995, Am. J. Med. 98:95S-98S.
- Alopecia areata is a common dermatologic disease affecting approximately 2.5 million individuals in the U.S., which presents with round, patchy hair loss on the scalp and has been postulated to have an underlying autoimmune component to its pathomechenism. Rook and Dawber, 1991, Diseases of the Hair and Scalp (Blackwell Press, Oxford, UK, ed. 2,) pp. 136-166; Bergfeld, 1995, Am. J. Med. 98:95S-98S. Alopecia areata can progress to involve hair loss of the entire scalp, and is referred to as alopecia totalis. Alopecia universalis is the term for the most extreme example of disease progression, resulting in complete absence of scalp and body hair. Id.
- alopecia areata is a "complex" genetic disorder resulting from more than one gene.
- a simple, recessively inherited form also exists, known as "congenital alopecia universalis or "congenital atrichia”.
- congenital alopecia universalis or "congenital atrichia”.
- the precise etiology of this disorder is unknown, and prior to the present invention, no autoantigen or causative gene has been identified. Muller et al., 1980, Br. J. Dermatol . 102:609.
- the present invention provides an isolated nucleic acid which encodes a wildtype human hairless protein.
- the present invention further provides an isolated nucleic acid which encodes mutant human hairless proteins.
- the present invention further provides an isolated wildtype human hairless protein and also provides an isolated mutant human hairless protein.
- the present invention provides a method of isolating a nucleic acid encoding a wildtype human hairless- related protein in a sample containing nucleic acid comprising (a) contacting the nucleic acid in the sample with the nucleic acid probe provided herein, under conditions permissive to the formation of a hybridization complex between the nucleic acid probe and the nucleic acid; (b) isolating the complex formed; and (c) separating the nucleic acid probe and the nucleic acid, thereby isolating the nucleic acid encoding a wildtype human hairless protein in the sample.
- the present invention provides a method for identifying a compound which is capable of enhancing or inhibiting expression of a human hairless protein comprising:
- step (c) comparing the level of expression of the human hairless protein determined in step (b) with the level determined in the absence of the compound, thereby identifying a compound capable of inhibiting or enhancing expression of the human hairless protein.
- the present invention also provides a method for identifying a binding compound which is capable of forming a complex with a human hairless protein comprising: (a) contacting the human hairless protein and the compound; and (b) determining the - 7 - formation of a complex between the human hairless protein and the compound, thereby identifying a binding compound which is capable of forming a complex with a human hairless protein.
- the present invention additionally provides a method for identifying an inhibitory compound which is capable of interfering the capacity of a human hairless protein to form a complex with the binding compound comprising: (a) contacting the complex and the compound; (b) measuring the level of the complex; and (c) comparing the level of complex in the presence of the compound with the amount of the complex in the absence of the complex, a reduction in level of complex thereby identifying an inhibitory compound which is capable interfering the capacity of a human hairless protein to form a complex with the binding compound.
- the present invention provides a transgenic non-human animal comprising a nucleic acid encoding a human hairless protein (wildtype or mutant) .
- the present invention provides a method for identifying whether a compound is capable of ameliorating a human hairless condition in an animal comprising: (a) administering the compound to a transgenic animal wherein the animal exhibits a human hairless condition; (b) determining the level of expression of the protein of human hairless protein (wildtype or mutant) ; and (c) comparing the level expression of the human hairless protein (wildtype or mutant) determined in step (b) with the level of expression determined in the animal in the absence of the compound so as to identify whether the compound is capable of ameliorating the human hairless condition in the animal.
- the present invention also further provides a transgenic non- human knockout animal whose cells do not express a gene encoding the human hairless protein (wildtype or mutant) . - 8 -
- This invention further provides a method for identifying a compound capable of restoring normal phenotype to the animal provided herein comprising (a) administering the compound to the animal, wherein the animal exhibits a human hairless condition; (b) comparing the exhibition of the condition in the animal in the presence of the compound with the exhibition of the condition in the animal in the absence of the compound so as to identify whether the compound is capable of restoring normal phenotype to the animal .
- This invention also provides a pharmaceutical composition which comprises a compound identified by the methods disclosed herein and a pharmaceutically acceptable carrier.
- the present invention additionally provides a method for treating a human hairless condition in a subject comprising administering to the subject an amount of the pharmaceutical composition disclosed herein, effective to treat the human hairless condition in the subject.
- the present invention also provides an antibody which binds specifically to the human hairless protein (wildtype or mutant) or portion thereof.
- the present invention provides a cell producing the antibody provided herein.
- the present invention further provides a method of identifying the human hairless protein (wildtype or mutant) in a sample comprising
- the present invention provides a method of inhibiting hair growth, comprising administering to the subject an amount of the pharmaceutical composition provided -9- herein, effective to inhibit hair growth in the subject .
- Figure 1 The pedigree of the Alopecia universalis (AU) family over six generations. Black circles and squares represent affected females and males, respectively, and figures with a black dot at the center represent heterozygous carriers.
- the grey shaded box beneath the pedigree characters indicates the haplotype on chromosome 8p that cosegregates with the disease. The order of the markers is indicated in the lower right corner.
- Lanes 1 to 8 show heart, brain, placenta, lung, liver skeletal muscle, kidney, and pancreas, respectively. Substantial expression is noted only in the brain (lane 2) , with trace expression elsewhere (lanes 1 and 3 to 8) .
- Figures 6 The nucleic acid sequence of nucleic acid encoding human hairless wildtype protein (Seq. ID.No. : 1 and Seq. ID.No. :2) .
- the upper panel reveals the homozygous wild-type whn sequence in exon 5, from an unrelated, unaffected control individual.
- the middle panel contains DNA sequence from a heterozygous carrier of the mutation R255X. Note the double T+C peak directly beneath the arrow.
- the lower panel represents the homozygous mutant R255X sequence. Note the presence of the mutant T only beneath the arrow, leading to a C-to-T transition and a substitution of an arginine residue by a nonsense mutation CGA-to-TGA, possibly due to spontaneous demethylation at the CpG dinucleotide .
- the mutation introduced a new restriction site for Bsrl , and after digestion of the 184 bp PCR product containing exon 5, the product generated from the mutant allele should cleave into two bands of 120 and 64 bp in size.
- the clinically unaffected parents and brother revealed three bands of 184 bp, 120 bp, and 64 bp (lanes 1, 2 and 6, upper panel) , indicating that they were heterozygous carriers of the mutation R255X.
- Both patients revealed only the two digested bands of 120 bp and 64 bp in size (lanes 3 and 4) , consistent with the presence of the mutation in the homozygous state.
- C Evidence for long-term engraftment of the BMT.
- Gender determination of the family members revealed a genotypically XX pattern of an undigested 300 bp band in the mother (lane 1) and affected patients (lanes 3 and 4), and a genotypically XY pattern consisting of the 300 bp band and two additional bands of 216 and 84 bp, indicative of the Y chromosome in the brother (lane 2) and the father (lane 6) .
- Lane 5 contains peripheral blood leukocyte from the patient after BMT, demonstrating an XY genotype and the presence of the normal whn allele, providing evidence for fraternal chimerism and persistence of the graft.
- Lane 1 contains spleen mRNA; lane 3, prostrate; lane 4, testis; lane 5, ovary; lane 6, small intestine; lane 7, colon without mucosa; and lane 8, peripheral blood leukocyte.
- (D) Northern analysis of skin fibroblasts (lane 1) and epidermal keratinocytes (lane 2) reveals strong expression of whn in keratinocytes and - 15 - negligible expression in fibroblasts (upper panel) , despite marked overloading of the fibroblast mRNA in lane 1 as ascertained by GAPDH signal as internal control (lower panel) . There is a faint, minor transcript present in the keratinocyte RNA that is not observed in thymus RNA.
- whn mRNA expression is localized to the basal cell layer of the outer root sheath (ORS) (arrow).
- C The innermost cell layer of the ORS is always highly whn mRNA positive (arrows) .
- D In the proximal portion of the hair bulb, whn mRNA is localized to the differentiating cells of the hair matrix (HM) and the innermost ORS cell layer (arrowhead) , while the dermal papilla (DP) fibroblasts and inner root sheath (arrow) remain whn mRNA negative.
- FIG. 12A-12B Antibodies which bind specifically to the human hairless protein.
- A Total protein lysates of 293T cells transiently transfected with either control plasmid or plasmid containing the Hr cDNA FLAG-tagged at the amino-terminus, were used in immuno precipitation experiments using either anti-FLAG antibodies or an Hr immune serum. Immuno precipitates were separated by SDS-PAGE and immunoblot analysis was done using anti-FLAG antibodies. Both the anti-FLAG and Hr immune serum are able to specifically immuno precipitate Hr proteins.
- B Total protein lysates of 293T cells transiently transfected with either control plasmid or plasmid containing the Hr cDNA, were separated by SDS-PAGE.
- Immunoblot analysis was done using 4 serial dilutions of either pre-immune serum or an immune serum generated against the Hr protein.
- the Hr immune serum specifically detects a 122kD protein, which corresponds to the predicted molecular weight of the Hr protein.
- the present invention provides an isolated nucleic acid which encodes a wildtype human hairless protein.
- the present invention further provides an isolated nucleic acid which encodes a mutant human hairless protein.
- the present invention further provides an isolated wildtype human hairless protein and also provides isolated mutant human hairless proteins.
- the nucleic acid is DNA. In another embodiment of this invention, the nucleic acid is RNA. In still another embodiment the nucleic acid is cDNA. In yet another embodiment, the nucleic acid is genomic DNA. In an embodiment of the invention the nucleic acid comprises a nucleic acid having a sequence substantially the same as the sequence designated SEQ. ID. No.: 1. In still another embodiment, the nucleic acid comprises a nucleic acid (Seq. ID.No. :2) having the sequence of SEQ. ID.
- the nucleic acid comprises a nucleic acid having a sequence substantially the same as the sequence designated SEQ. ID. No.: 1 and wherein a nucleotide transition occurs at a threonine (T) residue at position 1022 (ACA) converting the threonine residue to an alanine (A) residue as indicated for the human sequence (H) in Figure 1.
- the nucleic acid comprises a nucleic acid having a sequence substantially the same as the sequence designated SEQ. ID. No. : 1 and wherein a nucleotide transition occurs at a threonine (T) residue at position 1022 (ACA) converting the threonine to a different amino acid residue.
- the nucleic acid comprises a nucleic acid having a sequence substantially the same as the sequence designated SEQ. ID. No. 1 wherein the nucleotide transition occurs at a residue for hairlessness converting the amino acid residue - 18 - in the region to a different amino acid.
- An embodiment of this invention is a vector comprising the nucleic acid molecule.
- the vector is a virus, cosmid, yeast artificial chromosome
- An embodiment of this invention is a host vector system for the production of a human hairless protein which comprises the vector in a suitable host .
- the suitable host is a bacterial cell or a eukaryotic cell.
- the suitable host is a mammalian cell, yeast or insect cell.
- nucleic acid probe comprising a nucleic acid of at least 11 nucleotides capable of specifically hybridizing with a unique sequence of nucleotides within the nucleic acid encoding wildtype or mutant human hairless protein.
- the nucleic acid probe is DNA or RNA.
- the nucleic acid is in the antisense orientation to the coding strand of the nucleic acid encoding the mutant or wildtype human hairless protein.
- Another embodiment of the present invention is the isolated human hairless wildtype protein having substantially the same amino acid sequence as the human amino acid sequence shown in Figure 4 and designated herein as SEQ. ID.NO.: 3.
- Yet another embodiment of the present invention is the isolated human hairless mutant protein having substantially the same amino acid sequence as the human amino acid sequence shown in Figure 4 except the threonine (T) at position 1022 is replaced by alanine (A) and is designated herein as SEQ. ID.NO.: 4.
- the protein having substantially the same amino acid sequence as the human amino acid sequence (H) shown in Figure 4 (SEQ. ID.NO.: 3).
- the protein - 19 - having substantially the same amino acid sequence as the human amino acid sequence (H) shown in Figure 4 (SEQUENCE ID NO. : 3) except the threonine (T) at position 1022 is replaced by alanine (A) and is designated herein as SEQ.
- Still another embodiment is the protein having substantially the same amino acid sequence as the human amino acid sequence (H) shown in Figure 4 (SEQUENCE ID NO. : 3) except the threonine (T) at position 1022 is replaced by an amino acid other than alanine.
- the present invention provides a method of isolating a nucleic acid encoding a wildtype human hairless- related protein in a sample containing nucleic acid comprising (a) contacting the nucleic acid in the sample with the nucleic acid probe provided herein, under conditions permissive to the formation of a hybridization complex between the nucleic acid probe and the nucleic acid; (b) isolating the complex formed; and (c) separating the nucleic acid probe and the nucleic acid from the isolated complex resulting from step (b) , thereby isolating the nucleic acid encoding a wildtype human hairless-related protein in the sample .
- the isolated wildtype human whn protein has a homozygous arginine to a premature termination codon transition (C-to-T) at nucleotide position 792 leading to a mutation at amino acid position 255 of the protein.
- An embodiment of this invention is further comprising (a) amplifying the nucleic acid in the sample under conditions permissive to polymerase chain reaction; and (b) detecting the presence of a polymerase chain reaction product, the presence of polymerase chain reaction product identifying the presence of a nucleic acid encoding a human hairless-related protein in the sample.
- An embodiment of this invention is the nucleic acid isolated by this method.
- Yet another embodiment is the detection of the polymerase chain reaction product which comprises contacting the nucleic acid molecule - 20 - from the sample with the nucleic acid probe described herein, wherein the nucleic acid probe is labeled with a detectable marker.
- the detectable marker is a radiolabeled molecule, a fluorescent molecule, an enzyme, a ligand, or a magnetic bead.
- the present invention provides a method for identifying a compound which is capable of enhancing or inhibiting expression of a human hairless protein comprising:
- step (c) comparing the level of expression of the human hairless protein determined in step (b) with the level determined in the absence of the compound, thereby identifying a compound capable of inhibiting or enhancing expression of the human hairless protein.
- step (a) comprises contacting a nucleic acid which expresses the human hairless protein in a cell-free expression system and the compound.
- An embodiment of this invention is a compound, not previously known, identified by this method.
- the cell is a dermal papilla cell, an epithelial cell, a follicle cell, a hair matrix cell, a hair bulb cell, a keratinocyte, an epidermal keratinocyte, a fibroblast, a cuticle cell, a medullary cell, a cortical cell or a thymic cell .
- the compound is a peptide, a peptidomimetic, a nucleic acid, a polymer, or a small molecule.
- the compound is bound to a solid support.
- the present invention also provides a method for identifying a binding compound which is capable of forming a complex with a human hairless protein comprising: (a) contacting the human hairless protein and the compound; and (b) determining the - 21 - formation of a complex between the human hairless protein and the compound, thereby identifying a binding compound which is capable of forming a complex with a human hairless protein.
- An embodiment of this invention is a compound, not previously known, identified by this method, capable of forming a complex with a human hairless protein.
- the present invention additionally provides a method for identifying an inhibitory compound which is capable of interfering the capacity of a human hairless protein to form a complex with the binding compound comprising: (a) contacting the complex and the compound; (b) measuring the level of the complex; and (c) comparing the level of complex in the presence of the compound with the amount of the complex in the absence of the complex, a reduction in level of complex thereby identifying an inhibitory compound which is capable interfering the capacity of a human hairless protein to form a complex with the binding compound.
- An embodiment of this invention is a compound, not previously known, identified by the method described, capable of interfering with the capacity of a human hairless protein to form a complex with the identified binding compound.
- the present invention provides a transgenic non-human animal comprising a nucleic acid encoding wildtype or mutant human hairless protein.
- An embodiment of this invention is a transgenic non-human animal whose somatic and germ cells contain and express a gene encoding the human hairless protein (wildtype or mutant) or the whn protein, the gene having been introduced into the animal or an ancestor of the animal at an embryonic stage and wherein the gene may be operably linked to an inducible promoter element.
- the animal is a mouse.
- the present invention provides a method for - 22 - identifying whether a compound is capable of ameliorating a human hairless condition in an animal comprising: (a) administering the compound to a transgenic animal wherein the animal exhibits a human hairless condition; (b) determining the level of expression of the protein of human hairless protein (wildtype or mutant) ; and (c) comparing the level expression of the human hairless protein (wildtype or mutant) determined in step (b) with the level of expression determined in the animal in the absence of the compound so as to identify whether the compound is capable of ameliorating the human hairless condition in the animal.
- An embodiment of this invention is a compound, not previously known, identified by this method, capable of ameliorating a human hairless condition in an animal.
- the human hairless condition is Androgenetic Alopecia (male pattern baldness) , Alopecia Areata , Alopecia Totalis, Alopecia Universalis, Congenital Alopecia Universalis or Congenital Alopecia and Severe - T-Cell Immunodeficiency.
- the present invention also further provides a transgenic non- human knockout animal whose cells do not express a gene encoding a mutant or wildtype human hairless protein.
- An embodiment of this invention is a transgenic non-human knockout animal whose somatic and germ cells do not express a gene encoding the human hairless protein (wildtype or mutant), the gene(s) having been deleted or incapacitated in the animal or an ancestor of the animal at an embryonic stage.
- the animal is a mouse .
- This invention further provides a method for identifying a compound capable of restoring normal phenotype to the animal provided herein comprising (a) administering the compound to the animal, wherein the animal exhibits a human hairless condition; (b) comparing the exhibition of the condition in the animal in the presence of the compound with the - 23 - exhibition of the condition in the animal in the absence of the compound so as to identify whether the compound is capable of restoring normal phenotype to the animal .
- An embodiment of this invention is a compound, not previously known, identified by this method capable of restoring normal phenotype to the animal.
- the human hairless condition is Androgenetic Alopecia (male pattern baldness) , Alopecia Areata, Alopecia Totalis, Alopecia Universalis, Congenital Alopecia Universalis or Congenital Alopecia and Severe T-Cell Immunodeficiency.
- This invention also provides a pharmaceutical composition which comprises a compound identified by the methods disclosed herein and a pharmaceutically acceptable carrier.
- the carrier is a diluent, an aerosol, a topical carrier, an aqueous solution, a nonaqueous solution or a solid carrier.
- the present invention additionally provides a method for treating a human hairless condition in a subject comprising administering to the subject an amount of the pharmaceutical composition disclosed herein, effective to treat the human hairless condition in the subject.
- the human hairless condition is Androgenetic Alopecia (male pattern baldness) , Alopecia Areata, Alopecia Totalis or Alopecia Universalis, Congenital Alopecia Universalis or Congenital Alopecia and Severe T-Cell Immunodeficiency.
- the present invention also provides an antibody which binds specifically to the human hairless protein (wildtype or mutant) or portion thereof.
- the present invention provides a cell producing the antibody provided herein.
- the present invention further provides a method of identifying the human hairless protein (wildtype or mutant) in a sample comprising
- the antibody is human or mouse.
- the antibody is a monoclonal antibody.
- An embodiment of this invention also provides a cell producing the antibody which binds specifically to a mutant or wildtype human hairless protein.
- An embodiment of this invention further provides a method of method of identifying a mutant or wildtype human hairless protein comprising: (a) contacting the sample with the antibody under conditions permissive to the formation of a complex between the antibody and the protein; (b) determining the amount of complex formed; and (c) comparing the amount of complex formed with the amount of complex formed in the absence of the sample, the presence of an increased amount of complex formed in the presence of the sample indicating identification of the protein in the sample .
- the present invention provides a method of inhibiting hair growth, comprising administering to the subject an amount of the pharmaceutical composition provided herein, effective to inhibit hair growth in the subject.
- human hairless protein shall mean polypeptides encoded by the human polypeptide sequence marked (H) set forth in Figure 4 and designated herein as
- human hairless polynucleotide shall mean: (1) polynucleotides encoded by the polynucleotide sequence set forth in Figure 6 and designated herein as Seq. ID.No. : 1, (2) any polynucleotide sequence which encodes for a human hairless protein or (3) any polynucleotide - 25 - sequence which hybridizes to the polynucleotide sequences of (1) and (2), above, under stringent hybridization conditions.
- stringent hybridization conditions are 5 those hybridizing conditions that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015M sodium citrate/0.1% SDS at 50°C; (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum 0 albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/ 50mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate) 5 x Denhardt ' s solution, sonicated salmon sperm DNA (50 g/ml) , 0.1% SDS, and 10% 5 dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC and 0.1% SDS.
- formamide for example, 50% (vol/
- substantially amino acid homology shall mean molecules having a sequence homology of approximately 85% or 0 more, preferably greater than or equal to 90% and more preferably greater than or equal to 95%.
- the present invention relates to the human polypeptide and polynucleotide molecules and sequences which correspond to 5 a factor implicated in the development of the hair follicle and in the hair cycle.
- This factor designated the human hairless protein, and specifically, the expression of mutated forms of this factor, are related to abnormal hair growth, including alopecias. -0
- the present invention is further directed to methods for manipulating the expression of the human hairless protein to interrupt the hair cycle, either by manipulating hair follicle development or one of the stages of the hair growth 5 cycle. Such methods may be useful to inhibit hair growth.
- methods and compositions which rely upon the manipulation of the signal peptide which - 26 - corresponds to the human hairless protein.
- the compositions are applied topically to the area in which hair growth is sought to be regulated.
- the practice of the present invention may include expression of biologically active human hairless protein.
- the nucleotide sequence coding for the protein, or a functional equivalent may be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence .
- a variety of host-expression vector systems may be utilized to express the human hairless coding sequence. These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the human hairless coding sequence; yeast transformed with recombinant yeast expression vectors containing the human hairless coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the Human hairless coding sequence; plant cell systems infected with O " /3896S _ 2 7 _ PCT/US99/02128
- recombinant virus expression vectors e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV
- recombinant plasmid expression vectors e.g., Ti plasmid
- animal cell systems infected with recombinant virus expression vectors e.g., adenovirus, vaccinia virus, human tumor cells (including HT-1080)
- cell lines engineered to contain multiple copies of the Human hairless DNA either stably amplified (CHO/dhfr) or unstably amplified in double-minute chromosomes (e.g., murine cell lines).
- the expression elements of these systems vary in their strength and specificities. Depending on the host/vector system utilized, any of a number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used in the expression vector.
- inducible promoters such as pL of bacteriophage (plac, ptrp, ptac
- promoterp-lac hybrid promoter and the like may be used; when cloning in insect cell systems, promoters such as the baculovirus polyhedrin promoter may be used; when cloning in plant cell systems, promoters derived from the genome of plant cells (e.g., heat shock promoters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein) or from plant viruses (e.g., the 35S RNA promoter of CaMV; the coat protein promoter of TMV) may be used; when cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter) may be used; when generating cell lines that contain multiple copies of the Human hairless DNA SV40-, BPV- and EBV-based
- a number of expression vectors may be - 28 - advantageously selected depending upon the use intended for the expressed Human hairless.
- vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
- Such vectors include but are not limited to the E. coli expression vector pUR278 (Ruther et al . , 1983, EMBO J. 2:1791), in which the Human hairless coding sequence may be ligated into the vector in frame with the lac Z coding region so that a hybrid AS-lac Z protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res.
- pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST) .
- GST glutathione S-transferase
- fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety.
- yeast a number of vectors containing constitutive or inducible promoters may be used.
- Current Protocols in Molecular Biology Vol. 2, 1988, Ed. Ausubel et al . , Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, in Methods in Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y., Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL Press, Wash., D.C., Ch.
- the expression of the Human hairless coding sequence may be driven by any of a number of promoters.
- viral promoters such as the 35-S RNA and 19S RNA promoters of CaMV (Brisson et al., 1984, Nature 310:511-514), or the coat protein promoter of TMV (Takamatsu et al., 1987, EMBO J. 3:1671-1680; Brogue et al .
- An alternative expression system which could be used to express Human hairless is an insect system.
- baculovirus may be used as a vector to express foreign genes. The virus then grows in the insect cells.
- the Human hairless coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of a Baculovirus promoter. These recombinant viruses are then used to infect insect cells in which the inserted gene is expressed. (E.g., see Smith et al . , 1983, J. Viol. 46:584; Smith, U.S. Patent No. 4,215,051) .
- the Human hairless coding sequence may be ligated to an adenovirus - 30 - transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
- This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing Human hairless in infected hosts. See e.g., Logan & Shenk, 1984, Proc.
- the vaccinia 7.5K promoter may be used. See, e.g., Mackett et al., 1982, Proc. Natl. Acad. Sci. (USA) 79:7415-7419; Mackett et al . , 1984, J. Virol. 49:857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. 79:4927-4931.
- the Human hairless sequence is expressed in human tumor cells, such as HT-1080, which have been stably transfected with calcium phosphate precipitation and a neomycin resistance gene.
- Specific initiation signals may also be required for efficient translation of inserted Human hairless coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire Human hairless gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the Human hairless coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the Human hairless coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. See e.g., - 31 -
- a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
- Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cells lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
- eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
- mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, WI38, HT-1080 etc.
- cell lines which stably express Human hairless may be engineered.
- host cells can be transformed with Human hairless DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
- expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
- engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
- the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. - 32 -
- a number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy, et al . , 1980, Cell 22:817) genes can be employed in tk ⁇ , hgprt or aprt cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Proc. Natl. Acad. Sci.
- ODC ornithine decarboxylase
- 2- (difluoromethyl) -DL-ornithine 2- (difluoromethyl) -DL-ornithine
- DFMO McConlogue, 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.
- a transgenic animal may be generated.
- One means available for generating a transgenic animal is as follows: Female mice are mated, and the resulting fertilized eggs are dissected out of their oviducts. The eggs are stored in an appropriate medium such as M2 medium (Hogan B. et al . Manipulating the Mouse Embryo, A Laboratory Manual, Cold Spring Harbor Laboratory (1986) ) . DNA or cDNA encoding a vertebrate hairless protein is purified from a vector by methods well known in the art . Inducible promoters may be fused with the coding region of the DNA to provide an experimental means to regulate expression of the trans-gene.
- tissue specific regulatory elements may be fused with the coding region to permit tissue-specific expression of the trans-gene.
- the DNA in an appropriately buffered solution, is put into a microinjection needle (which may be made from capillary tubing using a pipet puller) and the egg to be injected is put in a depression slide.
- the needle is inserted into the pronucleus of the egg, and the DNA solution is injected.
- the injected egg is then transferred into the oviduct of a pseudopregnant mouse (a mouse stimulated by the appropriate hormones to maintain pregnancy but which is not actually pregnant), where it proceeds to the uterus, implants, and develops to term.
- pseudopregnant mouse a mouse stimulated by the appropriate hormones to maintain pregnancy but which is not actually pregnant
- an "therapeutically effective amount” is an amount which is capable of inhibiting hairlessness or T-cell deficiency. Accordingly, the effective amount will vary with the subject being treated, as well as the condition to be treated.
- the methods of administration are to include, but are not limited to, administration cutaneously, subcutaneously, intravenously, parenterally, orally, topically, or by aerosol.
- suitable pharmaceutically acceptable carrier encompasses any of the standard pharmaceutically accepted carriers, such as phosphate buffered saline solution, water, emulsions such as an oil/water emulsion or a triglyceride emulsion, various types of wetting agents, tablets, coated tablets and capsules.
- a triglyceride emulsion useful in intravenous and intraperitoneal administration of the - 34 - compounds is the triglyceride emulsion commercially known as Intralipid ® .
- Such carriers typically contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid, talc, vegetable fats or oils, gums, glycols, or other known excipients.
- excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid, talc, vegetable fats or oils, gums, glycols, or other known excipients.
- Such carriers may also include flavor and color additives or other ingredients.
- compositions capable of inhibiting neurotoxicity together with suitable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers.
- suitable diluents e.g., Tris-HCl., acetate, phosphate
- emulsifiers emulsifiers
- adjuvants and/or carriers e.g
- solubilizing agents e.g., glycerol, polyethylene glycerol
- anti-oxidants e.g., ascorbic acid, sodium metabisulfite
- preservatives e.g., Thimerosal, benzyl alcohol, parabens
- bulking substances or tonicity modifiers e.g., lactose, mannitol
- covalent attachment of polymers such as polyethylene glycol to the compound, complexation with metal ions, or incorporation of the compound into or onto particulate preparations of polymeric compounds such as polylactic acid, polglycolic acid, hydrogels, etc, or onto liposomes, micro emulsions, micelles, unilamellar or multi lamellar vesicles, erythrocyte ghosts, or spheroplasts .
- Such compositions will influence the physical state
- Controlled or sustained release compositions include formulation in lipophilic depots (e.g., fatty acids, waxes, oils) .
- particulate compositions coated with polymers e.g., poloxamers or poloxamines
- the compound coupled to antibodies directed - 35 - against tissue-specific receptors, ligands or antigens or coupled to ligands of tissue-specific receptors e.g., IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, antigens or coupled to ligands of tissue-specific receptors.
- Other embodiments of the compositions of the invention incorporate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral.
- Such modifications may also increase the compound's solubility in aqueous solution, eliminate aggregation, enhance the physical and chemical stability of the compound, and greatly reduce the immunogenicity and reactivity of the compound.
- the desired in vivo biological activity may be achieved by the administration of such polymer-compound adducts less frequently or in lower doses than with the unmodified compound.
- PEG polyethylene glycol
- Attachment of polyethylene glycol (PEG) to compounds is particularly useful because PEG has very low toxicity in mammals (Carpenter et al . , 1971) .
- a PEG adduct of adenosine deaminase was approved in the United States for use in humans for the treatment of severe combined immunodeficiency syndrome.
- a second advantage afforded by the conjugation of PEG is that of effectively reducing the immunogenicity and antigenicity of heterologous compounds.
- a PEG adduct of a human protein might be useful -36- for the treatment of disease in other mammalian species without the risk of triggering a severe immune response.
- the carrier includes a microencapsulation device so as to reduce or prevent an host immune response against the compound or against cells which may produce the compound.
- the compound of the present invention may also be delivered microencapsulated in a membrane, such as a liposome.
- Polymers such as PEG may be conveniently attached to one or more reactive amino acid residues in a protein such as the alpha-amino group of the amino terminal amino acid, the epsilon amino groups of lysine side chains, the sulfhydryl groups of cysteine side chains, the carboxyl groups of aspartyl and glutamyl side chains, the alpha-carboxyl group of the carboxy-terminal amino acid, tyrosine side chains, or to activated derivatives of glycosyl chains attached to certain asparagine, serine or threonine residues.
- a protein such as the alpha-amino group of the amino terminal amino acid, the epsilon amino groups of lysine side chains, the sulfhydryl groups of cysteine side chains, the carboxyl groups of aspartyl and glutamyl side chains, the alpha-carboxyl group of the carboxy-terminal amino acid, tyrosine side chains, or to activated derivatives of
- PEG reagents for reaction with protein amino groups include active esters of carboxylic acid or carbonate derivatives, particularly those in which the leaving groups are N-hydroxysuccinimide, p- nitrophenol, imidazole or l-hydroxy-2-nitrobenzene-4- sulfonate.
- PEG derivatives containing maleimido or haloacetyl groups are useful reagents for the modification of protein free sulfhydryl groups.
- PEG reagents containing amino hydrazine or hydrazide groups are useful for reaction with aldehydes generated by periodate oxidation of carbohydrate groups in proteins.
- Example 1 Identification of the human hairless gene.
- a Pakistani kindred with congenital alopecia universalis segregating as a single abnormality without associated ectodermal defects was identified and studied. This kindred was comprised of 4 affected males and 7 affected females ( Figure 1) .
- Figure 1 At birth, the hair usually appears normal on the scalp, but never regrows after ritual shaving usually performed a week after birth.
- Skin biopsy from the scalp of an affected person revealed very few hair follicles, dilated, and without hairs. Affected persons are born completely devoid of eyebrows and eyelashes, and never develop axillary and pubic hair.
- the pedigree is strongly suggestive of autosomal recessive inheritance, and various consanguineous loops account for all affected persons being homozygous for the abnormal allele.
- microsatellite markers were visualized by exposure of " the gel to autoradiography, and genotypes were assigned by visual inspection.
- a hairless mouse has been previously reported, as set forth in Brooke, 1924, J. Hered. 15:173. This mouse was studied as a potential model for human alopecias. To this end, work was conducted to clone the human homolog of hairless using PCR primers based on the available murine cDNA sequence (GenBank accession #Z32675) , as reported in Cachon-Gonzalez et al., 1994, Proc . Natl . Acad Sci . U. S. A. , 91:7717.
- RT-PCR amplification of a segment corresponding to exons 13-18 in the murine sequence using human skin fibroblast mRNA as template was performed, and delineated the corresponding intron/exon borders in the human sequence. More specifically, for RT-PCR of human hairless cDNA sequences, total RNA was extracted from cultured skin fibroblasts from a control individual according to standard methods, as set forth in Sambrook, et a-Z . , 1989, Molecular Cloning, A Laboratory Manual , (Cold Spring Harbor Laboratory, Bold Spring Harbor, NY ed. 2, 1989) .
- Human hairless mRNAs were reverse transcribed with MMLV reverse transcriptase (Gibco, BRL) , using an oligo-dT primer (Pharmacia) .
- PCR was carried out using the following primers, constructed on the basis of the mouse hairless sequence (GenBank #z32675) : sense: 5'TGAGGGCTCTGTCCTCCTGC3' (Seq. ID .No . : 7 ) ; antisense 5'GCTGGCTCCCTGGTGGTAGA3' (Seq. ID.No . 6) .
- PCR conditions were 95°C, 5 minutes, followed by 35 cycles of 95 C, 1 minute; 55°C, 1 minute; 72°C, 1 minute, using AmpliTaq Gold DNA polymerase (Perkin-Elmer) .
- exon-based primers were designed and used to amplify genomic DNA sequences at both the 5' donor and 3' acceptor splice junctions.
- the human hairless sequence has been deposited in GenBank and accorded accession number AF039196.
- the murine hairless gene resides on mouse chromosome 14
- PCR conditions were 95°C, 5 minutes, followed by 35 cycles of 95 C, 1 minute; 55°C, 1 minute; 72 °C, 1 minute, using AmpliTaq Gold DNA polymerase (Perkin-Elmer) .
- PCR primers specifically amplified human hairless, and did not cross-hybridize with the hamster DNA used in the radiation hybrid panel.
- SHGC Stanford University
- exon 15 revealed a homozygous A-to-G transition in all affected individuals, which was not present in the heterozygous state in obligate carriers within the family, and not found in unaffected family members.
- the G-to-A transition occurred at the first base of a threonine residue (ACA) , leading to a missense mutation and converting it to an alanine residue (GCA) .
- ACA threonine residue
- GCA alanine residue
- the mutation created a new cleavage site for the restriction endonuclease Hgal (GACGC) , which was used to confirm the presence of the mutation in genomic DNA, in addition to direct sequencing.
- PCR primers were designed to amplify individual exons from genomic DNA, and each exon was directly sequenced from affected individuals and compared to unaffected, unrelated controls. Primers for specific amplification of exon 15 were: sense: 5'AGTGCCAGGATTACAGGCGT 3' (Seq. ID.No.: 10); and antisense: 5' CTGAGGAGGAAAGAGCGCTC3' (Seq. ID.No.: 11); to generate a PCR fragment. PCR fragments were purified on Centriflex columns (ACGT, Inc.) and sequenced directly using
- the mutation was screened for by a combination of heteroduplex analysis.
- Direct sequencing and restriction digestion in a control population consisting of 142 unrelated, unaffected individuals, 87 of whom were of - 43 -
- the hairless mouse hr/hr was first described in the literature in 1924 (Brooke, 1924, J. Hered. 15:173), and was later found to have arisen from spontaneous integration of an endogenous murine leukemia provirus into intron 6 of the hr gene (Stoye, et al . , 1988, Cell 54:383), resulting in aberrant splicing and only about 5% normal mRNA transcripts present in hr/hr mice.
- the protein encoded by the hr gene contains a single zinc finger domain, and is therefore thought to function as a transcription factor ( Id. ) , with structural homology to the GATA family (Arceci, et al . , 1993, Mol . Cell . Biol . 13:2235) and to TSGA, a gene expressed in rat testis (Morrissey, et al . , 1980, J. Immunol . 125:1558).
- the hr/hr mouse exhibits a number of phenotypic effects no observed in the AU family, including defective differentiation of thymocytes ( i'd.
- hr is not expressed in thymus, yet it is highly expressed in the cerebellum of developing post-natal rat brain, where its significance remains unknown. Thompson, 1996, J. Neurosci . 16:7832. hr is directly induced by thyroid hormone receptor, which regulates its expression in CNS development, but not in skin. Thompson, et al . , 1997, -44 -
- Example 2 Antibodies specific for the human hairless protein.
- Antibodies which bind to the Human hairless protein are prepared using an intact polypeptide or fragments containing small peptides of interest as the immunizing antigen.
- the polypeptide or a peptide used to immunize an animal can be derived from translated cDNA or chemical synthesis which can be conjugated to a carrier protein, if desired.
- Such commonly used carriers which are chemically coupled to the peptide include keyhole limpet hemocyanin (KLH) , thyroglobulin, bovine serum albumin (BSA) , and tetanus toxid.
- KLH keyhole limpet hemocyanin
- BSA bovine serum albumin
- tetanus toxid tetanus toxid.
- the coupled peptide is then used to immunize the animal (e.g., a mouse, a rat or a rabbit) .
- polyclonal or monoclonal antibodies can be - 45 - further purified, for example, by binding to and elution from a matrix to which the polypeptide or a peptide to which the antibodies were raised is bound.
- a matrix to which the polypeptide or a peptide to which the antibodies were raised is bound.
- an anti-idiotypic monoclonal antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region which is the "image" of the epitope bound by the first monoclonal antibody.
- antibodies may be generated by using a computer-selected peptide such as amino acids of hairless mouse having identity with at least 12 human hairless amino acids .
- PCR techniques may also be used to subclone an EcoRl/Notl fragment corresponding to exons 13-19 of hairless into the EcoRl/Notl site of pGEX4T. This permits the production of copious quantities of the carboxyterminus of hairless in E. Coli. Protein then may be purified using affinity chromatography, and the GST tag will be cleaved from • hairless by thrombin. The protein will be purified, and injected into rabbits. - 46 -
- the carboxy-terminal region of the Human hairless protein into an E. Coli may also be subcloned and an expression vector, allowing the expression of a recombinant fusion protein between the Human hairless protein and a GST tag identified.
- the presence of the GST tag allows the easy purification of the protein by affinity chromatography. Nilsson et al, 1985, EMBOJ, 4, 4,1075. The GST tag will then be removed with thrombin, and the resultant untagged Human hairless protein will be injected into rabbits. Sera will be by Western analysis against E. Coli expressed protein and extracts prepared from normal and mutant mice.
- Example 3 Identification Of Regulatory Sequences and Targets of Human hairless protein.
- the minimal 5' upstream regions of the Human hairless protein promoter required for faithful and abundant expression in mouse dermal keratinocytes may be identified. These regions can then be used to identify, clone and characterize transacting factors that bind to these regions.
- mice may be constructed that possess these DNAs, and sequences that confer appropriate epidermal expression to the beta galactosidase reporter gene will be identified.
- fibroblasts and keratinocytes from wild-type and hairless (hr/hr) mice may be cultured.
- RNA will be extracted, cDNA will be prepared from these sources and cDNAs from mutant tissue will be removed from wild-type tissue.
- Chomezynski an Sacchi . 1987, Anal. Biochem. 162,156; the techniques described in Maniatis et al . , 1989, Molecular Cloning a Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel et al . , 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y.
- nucleotides which encode proteins that rescue the hr/hr phenotype, and are therefore downstream targets of the Human hairless protein and necessary for its function, such - 48 - proteins and nucleotides will be assayed further.
- Example 4 Antisense Regulation of Human hairless protein Activity
- a therapeutic approach using antisense to human hairless can be used to directly interfere with the translation of Human hairless protein messenger RNA into protein is possible.
- antisense nucleic acid or ribozymes could be used to bind to the Human hairless protein mRNA or to cleave it.
- Antisense RNA or DNA molecules bind specifically with a targeted gene's RNA message, interrupting the expression of that gene's protein product. See, Weintraub, Scientific American, 262:40, 1990. The antisense molecule binds to the messenger RNA forming a double stranded molecule which cannot be translated by the cell.
- Antisense oligonucleotides of about 15-25 nucleotides are preferred since they are easily synthesized and have an inhibitory- effect just like antisense RNA molecules. Molecular analogs of oligonucleotide may also be used for this purpose and have the added advantages of stability, distribution or limited toxicity that are advantageous in a pharmaceutical product. In addition, chemically reactive groups, such as iron-linked ologonucleodtide, causing cleavage of the RNA at the site of hybridization. These and other uses of antisense methods to inhibit the in vi tro translation of genes are well known in the art (Marcus-Sakura, Anal., Biochem, 172:289, 1988).
- a recombinant expression vector such as a chimeric virus or a colloidal dispersion system.
- viral vectors which can be utilized for gene therapy as taught herein include adenovirus, herpes virus, vaccinia, or, preferable, an RNA virus such as a retrovirus.
- the retroviral vectors is a derivative of a murine or avian retrovirus. Examples retroviral vectors in which a single foreign gene can be inserted include, but are not limited to: Moloney murine leukemia virus (MoMuLV) .
- MoMuLV Moloney murine leukemia virus
- HaMuSV Harvey murine - 49 - sarcoma virus
- MuMTV murine mammary tumor virus
- RSV dRous Sarcoma Virus
- a number of additional retroviral vectors can incorporate multiple genes. All of these vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated. By inserting a polynucleotide sequence of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a desired specific target cell, for example, can make the vector target specific.
- Retroviral vectors can be made target specific by inserting, for example, a polynucleotide encoding a protein or proteins such that the desired ligand is expressed on the surface of the viral vector.
- ligand may be glycolipid carbohydrate or protein in nature.
- Preferred targeting may also be accomplished by using an antibody to target the retroviral vector.
- recombinant retroviruses are typically replication defective, they require assistance in order to produce infectious vector particles.
- This assistance can be provided, for example, by using helper cell lines that contain plasmids encoding all of the structural genes of the retrovirus under the control of regulatory sequences within the LTR. These plasmids are missing a nucleotide sequence which enables the packaging mechanism to recognize an RNA transcript for encapsulation.
- Helper cell lines which have deletions of the packaging signal may used. These cell lines produce empty virions, since no genome is packaged. If a retroviral vector is introduced into such cells in which packaging signal is intact, but the structural genes are replaced by other genes of interest, the vector can be packaged and vector virion produced. - 50 -
- NIH 3T3 or other tissue culture cells can be directly transfected with plasmids encoding the retroviral structural genes gag, pol and env, by conventional calcium phosphate transfection. These cells are then transfected with the vector plasmid containing the genes of interest . The resulting cells release the retroviral vector into the culture medium.
- colloidal dispersion systems as a method for accomplishing targeted delivery of an antisense polynucleotides
- these systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid- based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
- the preferred colloidal system of this invention is a liposome.
- Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vi tro and in vivo . It has been shown that large unilamellar vesicles (LUV) , which range in size from 0.2-4.0 urn can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules .
- LUV large unilamellar vesicles
- RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al . , Trends Biochem. Sci., 6 . : 77, 1981).
- liposomes In addition to mammalian cells, liposomes have been used for delivery of polynucleotides in plant, yeast and bacterial cells. In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present:
- the composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition- - 51 - temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used.
- the physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Examples of lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol , phosphatidylcholine, phosphatidyiserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides .
- diacylphosphatidylglycerols where the lipid moiety contains from 14-18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
- Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidycholine and distearoylphosphatidylcholine .
- the targeting of liposomes has been classified based on anatomical and mechanistic factors.
- Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle- specific.
- Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries.
- RES reticulo-endothelial system
- Active targeting involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs or cells types other that the naturally occurring sites of localization.
- a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein
- the surface of the targeted delivery system may be modified in a variety of ways.
- lipid groups can be incorporated in the lipid bilayer of the liposome on order to maintain the targeting ligand in stable association with the liposomal bilayer.
- Various linking groups can be used for joining the lipid chains to the targeting ligand.
- the - 52 - compounds bound to the surface of the targeted delivery system to find and "home in" on the desired cells.
- a ligand may be any compound of interest which will bind to another compound, such as growth factor.
- T lymphocytes are present in mormal or reduced number, but specific T cell functions are dysregulated.
- We found suggestive evidence of linkage to the whn locus on human chromosome 17 (Z max l .32) , and identified a homozygous nonsense mutation in the human whn gene in affected individuals .
- the human whn gene encodes a forkhead/winged helix transcription factor with restricted expression in the thymus, epidermis, and hair follicle.
- Severe combined immunodeficiencies represent the most severe group of primary immunodeficiencies, whose overall frequency is about one in 75,000 births. Fischer, A., et al. (1997) Annu . Rev. Immunol . 15:93; Kokron, CM., et al . (1997) Clin . Immunol . 17:109; Fischer, A. (1992) Curr. Opin . Immunol . 8:445; Arnaiz-Villena, A., (1992) Immunol 13:259. These inherited diseases include a wide spectrum of clinically and genetically heterogeneous disorders affecting either the differentiation or the cell activation process.
- SCIDs The most severe form is usually lethal in the first year of life due to severe immunological impairment and life threatening infections.
- the clinical course of a few cases of SCIDs with a predominant qualitative T-cell defect is milder, and is characterized by a wide range of clinical features caused either directly or indirectly by the - 54 - underlying disease.
- the clinical and immunological heterogeneity of the SCIDs reflects an underlying genetic heterogeneity.
- T-)(B-)SCID phenotype characterized by hypereosinophilia, erythrodermia, and severe liver disease. Fischer, A., et al .
- lymphocytes are predominatly of the Th2 phenotype and exhibit a limited usage of the TCR repertoire. Fisher, A., et al . (1997) Annu . Rev. Immunol . 15:93; Kokron, CM., et al .
- the persistence of the generalized alopecia following successful BMT suggested tha t it was not acquired in nature, but instead was related to the immunodeficiency.
- the severe immunodeficiency in both children was characterized by a decrease of mature T lymphocytes, mainly due to a low number of helper T cells, whereas the number of suppressor/cytotoxic T cells was relatively normal.
- the patients had a normal number of overall circulating lymphocytes due to the predominance of mature B-lymphocytes .
- NK cells in both patients were unaffected.
- T- cell immunodeficiency was qualitative in nature, in that peripheral blood T cells failed to undergo mitogen-induced - 57 - activation and cell-cycle progression.
- Pignata C Et al . (1996) Am. J. Med. Genet . 65:167.
- B cell machinery arppeared to be intact, insofar as allohemagglutinins were detected, as expected, B lymphocytes were unable to produce specific antibodies against T dependent antigens.
- Pignata and colleagues recognized that the association between alopecia and immunodeficiency in their patients was not serendipitous, and might in fact be related to a common gene defect.
- DNA samples from the original family members from a small village in southern Italy were obtained. Each family member from whom DNA was obtained was examined and the clinical phenotype of the affected individual is characterized - 58 - by a severe, complete alopecia involving the scalp, eyebrows and eyelashes. Four children in a different branch of the family were reported anamnestically to have been affected with the same disorder, and died in early childhood. Linkage analysis was performed using microsatellite markers near the whn locus on chromosome 17, as deduced from the published map of the syntenic region on mouse chromosome 11. Blood samples were also collected from 17 members of the family, according to local informed consent procedures.
- the genetic model assumed for the analysis was a fully penetrant recessive model with a disease - 59 - allele frequency of 0.0001. Marker allele frequencies were estimated using founders' alleles. Boehnke, 1991, Am. J. Hum. Genet . 48:22.
- Multipoint analysis did not improve the scores at markers D17S798 and D17S1800 as the markers were already fully informative in this family.
- the observation of an unaffected individual with two recombination events allowed localization of the whn gene within a 10.4 cM interval between the markers D17S98 and D17S1857 ( Figure 7) .
- Primer pairs were developed to amplify all exons and flanking splice sites based on the cDNA structure of the human sequence, Schorpp, et al . , 1997, Immunogenetics 46: 509, (GenBank accession number Y11739) .
- a mutation detection strategy was developed based on PCR amplification of all whn exons. For amplification of exon 5 of the whn gene in this study, the following primers were used:
- PCR amplification resulted in a product 184 bp in size, containing 7 bp of intron 4,131 bp of exon 5, and 46 bp of intron 5.
- PCR was carried out on genomic DNA from the patients, all family members, and the control individuals according to the following program: 95° C for 5 minutes; followed by 35 cycles of 95° C for 45 seconds, 55 C for 45 seconds, and 72° C for 1 minute; followed by°72 C for 7 minutes, in a Stratagene RoboCycler Gradient 96 thermal cycler - 60 -
- PCR products were run on a 2% agarose gel and purified in a first step using the High Pure PCR product purification kit (Boehringer Mannheim) .
- PCR fragments were purified on Edge Centriflex columns (Edge BioSystems, Gaithersburg, MD) and sequenced directly with POP-6 polymer using an ABI Prism 310 Genetic Analyzer from Applied Biosystems Inc. (Perkin Elmer) .
- the mutation was verified by restriction enzyme digestion using Bsrl, according to the manufacturer's guidelines (New England Biolabs) .
- Genotyping of the extended family members revealed eight individuals who are clinically unaffected heterozygous carriers of the mutation, consistent with the segregation of the disease-associated haplotype ( Figure 7) .
- the mutation was not identified in 102 unaffected, unrelated Northern European control individuals, indicating that R255X is not a common polymorphism.
- the nonsense mutation identified in this invention results in a premature termination codon (PTC) at amino acid residue 255 of the whn protein, within exon 5.
- PTCs result in dramatic reductions in the steady-state level of cytoplasmic mRNA, due to nonsense-mediated mRNA decay, Cooper, 1993, Ann. Med. 85:11; Maquat, 1995, RNA 1:453, thereby predicting an absence of functional protein.
- the proband' s BMT was derived from her brother, the - 61 - leukocyte DNA from the proband and her brother were examined before and after grafting for the presence of fraternal chimerism.
- gender determination was performed by restriction analysis of simultaneously amplified ZFX and ZFY sequences as previously described in Chong, et al., 1993, Hum. Molec . Genet . 2:1187. Genotyping revealed that the brother was a carrier of the mutant maternal whn allele and the wild-type paternal whn allele ( Figure 7) . Genotyping of the proband before BMT revealed that her leukocyte DNA was homozygous for the mutant haplotype only
- the forward primer (nt 1284-1305) was 5' CTCTCCCCACCACTGCACTCACT3 ' (Seq. ID.No .: 14) and the reverse primer (nt 1597-1618) was 5 ' TCCAGGTCAGTGCCAAGGTCTC3 ' (Seq. ID.No .: 15) .
- the human whn sense-probe was used as a negative control. Sections were washed after hybridization at 50 C under high stringency conditions for 5h. Prior to immunodetection of the in si tu hybridization signal, the slides where incubated with normal sheep serum (Sigma, St. Louis, MO, USA) in the presence of levamisol (Sigma, St. Louis, MO, USA) and blocking solution
- This keratinocyte layer is characterized by a unique differentiation pathway, and is morphologically and immunologically distinct from the other ORS keratinocytes, however, its function and origin are still a subject of controversy. Rothnagel and Roop, 1995, J. Invest . Dermatol . 104:42S; Panteleyev, et al . , 1997, J. Invest . Dermatol . 108:324. Weak whn expression was found also in the basal keratinocytes of the upper ORS portion starting from the level of sebaceous gland ( Figure 10B) .
- the protein encoded by the human, mouse and rat nude gene encodes a member of the forkhead/winged helix class of transcription factors, which are developmentally regulated, and direct tissue-and cell-type specific transcription and cell fate decisions.
- the hallmark of this group of transcription factors is a highly conserved DNA binding domain, encompassing a region of about 110 amino acids containing a modified helix-turn- helix motif, first identified in the Drosophila gene forkhead and in rat hepatocyte nuclear factor 3(HNF-3) .
- the DNA binding domain spanning amino acid residues 271 to 362 is encoded by exons 5, 6 and 7.
- the whn proteins contain an evolutionarily conserved and functionally indispensable acidic transcriptional activation domain, located in the C-terminus of the protein. This transactivation domain extends from residues 509 to 563, and is encoded by exons 8 and 9.
- Schuddekopf et al., 1996, Proc. Natl . Acad. Sci . USA 93:9661; Schlake, et al., 1997, Proc . Natl . Acad. Sci . USA 94:3842.
- the nonsense mutation in the family under study resides in exon 5, upstream of both the DNA-binding and the - 66 - transactivation domain of whn genes consist o eight coding exons and utilization of two alternative first (non-coding) exons in a tissue-specific manner.
- Heterologous reporter assays have demonstrated promoter activity upstream of both first exons, and although both promoters are active in the skin at variable levels, only the upstream promoter is active in the thymus, suggesting that whn may be subject to complex cell-type specific transcriptional regulation. Schorpp, et al., 1997, Immunogenetics 46:509.
- Whn othologs are highly conserved through evolution, and have been cloned from eight different species, including human, mouse, rat, pufferfish, zebrafish, shark, lamprey and amphioxus .
- the extent of homology correlates with evolutionary distance, yet the conservation between the two most distant relatives, human and amphioxus, is nearly 80% identical at the amino acid level, demonstrating a remarkable degree of conservation over more than 500 million evolutionary years.
- whn expression persists in thymic epithelial cells throughout life, it may be required not only for the initiation of differentiation but also for maintenance of the differentiated phenotype. For these reasons, it has been speculated that the human whn gene might be a good candidate gene for human thymomas and for human thymic dysplasia disorders, such as Nezelof syndrome.
- the formation and maintenance of the epidermis and hair follicle also requires a balance between epithelial growth and differentiation.
- nude mice appear to be completely naked, the dermis actually contains a normal number of hair follicles compared to a wild-type mouse, however, the follicles are abnormal and incompletely developed.
- impaired keratinization of. the hair follicles leads to short, bent hairs that only rarely emerge from the epidermis.
- Mouse mutations have become an important genetic tool for the identification of specific human genes encoding diseases with clinical features resembling those observed in mutant mice, in particular, for visible phenotypes affecting the fur coat and skin of mice. Sundber and King, 1996, Invest. Dermatol . 106:368; Copeland, et al., 1993, Science 262.
- the mapping of inherited human alopecia (MIM 203655) to chromosome 8p21, - 68 - using insights provided by the hairless mouse model, enabled cloning of the human hairless gene and identification of mutations in several families with atrichia.
- the discovery of a human alopecia with mutations in the whn gene extends the body of evidence implicating single genes in hair cycle regulation.
- TTF-2 human thyroid transcription factor 2 gene
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU25724/99A AU2572499A (en) | 1998-01-29 | 1999-01-29 | Human hairless gene, protein and uses thereof |
EP99905596A EP1053315A4 (en) | 1998-01-29 | 1999-01-29 | Human hairless gene, protein and uses thereof |
CA002362320A CA2362320A1 (en) | 1998-01-29 | 1999-01-29 | Human hairless gene, protein and uses thereof |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US7304398P | 1998-01-29 | 1998-01-29 | |
US60/073,043 | 1998-01-29 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1999038965A1 true WO1999038965A1 (en) | 1999-08-05 |
Family
ID=22111367
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1999/002128 WO1999038965A1 (en) | 1998-01-29 | 1999-01-29 | Human hairless gene, protein and uses thereof |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1053315A4 (en) |
AU (1) | AU2572499A (en) |
CA (1) | CA2362320A1 (en) |
WO (1) | WO1999038965A1 (en) |
Cited By (23)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001085964A2 (en) * | 2000-05-11 | 2001-11-15 | University Of Sheffield | Over expression of the whn protein |
US6348348B1 (en) | 1998-04-07 | 2002-02-19 | The Carnegie Institution Of Washington | Human hairless gene and protein |
WO2002070743A2 (en) * | 2001-03-07 | 2002-09-12 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Identification and use of inhibitors of hair growth |
WO2002083891A3 (en) * | 2001-04-13 | 2002-12-12 | Univ Columbia | Nucleic acids for inhibiting hairless protein expression and methods of use thereof |
EP1399579A1 (en) * | 2001-06-26 | 2004-03-24 | Anaderm Research Corporation | Fkbp51/52 and cyp40-mediated mammalian hair growth |
WO2005050201A2 (en) * | 2003-11-13 | 2005-06-02 | The Procter & Gamble Company | Hairless protein-interacting partner complexes and methods thereof for the beautification and/or improvement of mammalian skin |
US7169564B1 (en) | 2001-06-26 | 2007-01-30 | Anaderm Research Corporation | FKBP51/52 and CyP40-mediated mammalian hair growth |
US7745610B2 (en) | 2002-11-14 | 2010-06-29 | Dharmacon, Inc. | siRNA targeting cyclin dependent kinase 11 (CDK11) |
US7807819B2 (en) | 2002-11-14 | 2010-10-05 | Dharmacon, Inc. | siRNA targeting survivin |
US8013145B2 (en) | 2002-11-14 | 2011-09-06 | Dharmacon, Inc. | SiRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B) |
US8168600B2 (en) | 2004-04-23 | 2012-05-01 | Isis Pharmaceuticals, Inc. | Compositions and methods for topical delivery of oligonucleotides |
US8329667B2 (en) | 2004-04-23 | 2012-12-11 | The Trustees Of Columbia University In The City Of New York | Inhibition of hairless protein mRNA |
WO2014022655A1 (en) * | 2012-08-01 | 2014-02-06 | The Trustees Of Columbia University In The City Of New York | Methods for regulating hair growth disorders |
EP2735303A1 (en) * | 2012-11-23 | 2014-05-28 | Pilosciences | Hair growth compositions and methods |
US9228186B2 (en) | 2002-11-14 | 2016-01-05 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US9719092B2 (en) | 2002-11-14 | 2017-08-01 | Thermo Fisher Scientific Inc. | RNAi targeting CNTD2 |
US9719094B2 (en) | 2002-11-14 | 2017-08-01 | Thermo Fisher Scientific Inc. | RNAi targeting SEC61G |
US9771586B2 (en) | 2002-11-14 | 2017-09-26 | Thermo Fisher Scientific Inc. | RNAi targeting ZNF205 |
US9839649B2 (en) | 2002-11-14 | 2017-12-12 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US9879266B2 (en) | 2002-11-14 | 2018-01-30 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US10011836B2 (en) | 2002-11-14 | 2018-07-03 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
WO2019161805A1 (en) * | 2018-02-26 | 2019-08-29 | Biocytogen Jiangsu Co., Ltd. | Hr knockout non-human animal |
CN113717975A (en) * | 2021-09-01 | 2021-11-30 | 中国农业大学 | miRNA marker related to pig hairless trait and application thereof |
-
1999
- 1999-01-29 AU AU25724/99A patent/AU2572499A/en not_active Abandoned
- 1999-01-29 EP EP99905596A patent/EP1053315A4/en active Pending
- 1999-01-29 CA CA002362320A patent/CA2362320A1/en not_active Abandoned
- 1999-01-29 WO PCT/US1999/002128 patent/WO1999038965A1/en not_active Application Discontinuation
Non-Patent Citations (4)
Title |
---|
AHMAD W., ET AL.: "ALOPECIA UNIVERSALIS ASSOCIATED WITH A MUTATION IN THE HUMAN HAIRLESS GENE.", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 279., 30 January 1998 (1998-01-30), US, pages 720 - 724., XP000971022, ISSN: 0036-8075, DOI: 10.1126/science.279.5351.720 * |
CICHON S., ET AL.: "CLONING, GENOMIC ORGANIZATION, ALTERNATIVE TRANSCRIPTS AND MUTATIONAL ANALYSIS OF THE GENE RESPONSIBLE FOR AUTOSOMAL RECESSIVEUNIVERSAL CONGENITAL ALOPECIA.", HUMAN MOLECULAR GENETICS, OXFORD UNIVERSITY PRESS, GB, vol. 07., no. 11., 1 October 1998 (1998-10-01), gb, pages 1671 - 1679., XP000971023, ISSN: 0964-6906, DOI: 10.1093/hmg/7.11.1671 * |
See also references of EP1053315A4 * |
SPRECHER E., ET AL.: "ATRICHIA WITH PAPULAR LESIONS MAPS TO 8P IN THE REGION CONTAINING THE HUMAN HAIRLESS GENE.", AMERICAN JOURNAL OF MEDICAL GENETICS, WILEY, NEW YORK,NY, US, vol. 80., no. 05., 28 December 1998 (1998-12-28), US, pages 546 - 550., XP000978264, ISSN: 0148-7299, DOI: 10.1002/(SICI)1096-8628(19981228)80:5<546::AID-AJMG28>3.0.CO;2-I * |
Cited By (49)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7416731B2 (en) | 1998-04-07 | 2008-08-26 | The Carnegie Institution Of Washington | Human hairless antibodies |
US6348348B1 (en) | 1998-04-07 | 2002-02-19 | The Carnegie Institution Of Washington | Human hairless gene and protein |
WO2001085964A3 (en) * | 2000-05-11 | 2002-03-28 | Univ Sheffield | Over expression of the whn protein |
WO2001085964A2 (en) * | 2000-05-11 | 2001-11-15 | University Of Sheffield | Over expression of the whn protein |
WO2002070743A2 (en) * | 2001-03-07 | 2002-09-12 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Identification and use of inhibitors of hair growth |
WO2002070743A3 (en) * | 2001-03-07 | 2003-04-17 | Max Planck Gesellschaft | Identification and use of inhibitors of hair growth |
US7468246B2 (en) | 2001-03-07 | 2008-12-23 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | Identification and use of inhibitors of hair growth |
WO2002083891A3 (en) * | 2001-04-13 | 2002-12-12 | Univ Columbia | Nucleic acids for inhibiting hairless protein expression and methods of use thereof |
US8008471B2 (en) | 2001-04-13 | 2011-08-30 | The Trustees Of Columbia University In The City Of New York | Nucleic acids for inhibiting hairless protein expression and methods of use thereof |
EP2327784A3 (en) * | 2001-04-13 | 2012-11-28 | The Trustees of Columbia University in the City of New York | Nucleic acids for inhibiting hairless protein expression and methods of use thereof |
US7423022B2 (en) | 2001-04-13 | 2008-09-09 | The Trustees Of Columbia University In The City Of New York | Nucleic acids for inhibiting hairless protein expression and methods of use thereof |
EP1399579A1 (en) * | 2001-06-26 | 2004-03-24 | Anaderm Research Corporation | Fkbp51/52 and cyp40-mediated mammalian hair growth |
US7169564B1 (en) | 2001-06-26 | 2007-01-30 | Anaderm Research Corporation | FKBP51/52 and CyP40-mediated mammalian hair growth |
EP1399579A4 (en) * | 2001-06-26 | 2006-04-19 | Anaderm Res Corp | Fkbp51/52 and cyp40-mediated mammalian hair growth |
US8039610B2 (en) | 2002-11-14 | 2011-10-18 | Dharmacon, Inc. | siRNA targeting superoxide dismutase 1 (SOD1) |
US9839649B2 (en) | 2002-11-14 | 2017-12-12 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US7807819B2 (en) | 2002-11-14 | 2010-10-05 | Dharmacon, Inc. | siRNA targeting survivin |
US7833989B2 (en) | 2002-11-14 | 2010-11-16 | Dharmacon, Inc. | siRNA targeting connective tissue growth factor (CTGF) |
US7855186B2 (en) | 2002-11-14 | 2010-12-21 | Dharmacon, Inc. | siRNA targeting TIE-2 |
US7897754B2 (en) | 2002-11-14 | 2011-03-01 | Dharmacon, Inc. | SiRNA targeting ras-related nuclear protein RAN |
US7745610B2 (en) | 2002-11-14 | 2010-06-29 | Dharmacon, Inc. | siRNA targeting cyclin dependent kinase 11 (CDK11) |
US8013145B2 (en) | 2002-11-14 | 2011-09-06 | Dharmacon, Inc. | SiRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B) |
US8022198B2 (en) | 2002-11-14 | 2011-09-20 | Dharmacon, Inc. | siRNA targeting histamine receptor H1 |
US8022199B2 (en) | 2002-11-14 | 2011-09-20 | Dharmacon, Inc. | SiRNA targeting myeloid differentiation primary response gene (88) (MYD88) |
US11198870B2 (en) | 2002-11-14 | 2021-12-14 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US10765695B2 (en) | 2002-11-14 | 2020-09-08 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US8222395B2 (en) | 2002-11-14 | 2012-07-17 | Dharmacon, Inc. | siRNA targeting kinase insert domain receptor (KDR) |
US8304528B2 (en) | 2002-11-14 | 2012-11-06 | Dharmacon, Inc. | SiRNA targeting fructose-1, 6-bisphosphatase 1 (FBP1) |
US10696968B2 (en) | 2002-11-14 | 2020-06-30 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US10233449B2 (en) | 2002-11-14 | 2019-03-19 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US10011836B2 (en) | 2002-11-14 | 2018-07-03 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US9879266B2 (en) | 2002-11-14 | 2018-01-30 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US9777270B2 (en) | 2002-11-14 | 2017-10-03 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US9771586B2 (en) | 2002-11-14 | 2017-09-26 | Thermo Fisher Scientific Inc. | RNAi targeting ZNF205 |
US9228186B2 (en) | 2002-11-14 | 2016-01-05 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US9719092B2 (en) | 2002-11-14 | 2017-08-01 | Thermo Fisher Scientific Inc. | RNAi targeting CNTD2 |
US9719094B2 (en) | 2002-11-14 | 2017-08-01 | Thermo Fisher Scientific Inc. | RNAi targeting SEC61G |
EP2208997A3 (en) * | 2003-11-13 | 2010-09-01 | The Procter & Gamble Company | Hairless protein-interacting partner complexes and methods thereof for the beautification and/or improvement of mammalian skin |
WO2005050201A2 (en) * | 2003-11-13 | 2005-06-02 | The Procter & Gamble Company | Hairless protein-interacting partner complexes and methods thereof for the beautification and/or improvement of mammalian skin |
WO2005050201A3 (en) * | 2003-11-13 | 2006-03-23 | Procter & Gamble | Hairless protein-interacting partner complexes and methods thereof for the beautification and/or improvement of mammalian skin |
US8946402B2 (en) | 2004-04-23 | 2015-02-03 | The Trustees Of Columbia University In The City Of New York | Inhibition of hairless protein mRNA |
US8329667B2 (en) | 2004-04-23 | 2012-12-11 | The Trustees Of Columbia University In The City Of New York | Inhibition of hairless protein mRNA |
US8168600B2 (en) | 2004-04-23 | 2012-05-01 | Isis Pharmaceuticals, Inc. | Compositions and methods for topical delivery of oligonucleotides |
WO2014022655A1 (en) * | 2012-08-01 | 2014-02-06 | The Trustees Of Columbia University In The City Of New York | Methods for regulating hair growth disorders |
WO2014080015A3 (en) * | 2012-11-23 | 2014-07-24 | Pilosciences | Hair growth compositions and methods |
EP2735303A1 (en) * | 2012-11-23 | 2014-05-28 | Pilosciences | Hair growth compositions and methods |
WO2019161805A1 (en) * | 2018-02-26 | 2019-08-29 | Biocytogen Jiangsu Co., Ltd. | Hr knockout non-human animal |
CN113717975A (en) * | 2021-09-01 | 2021-11-30 | 中国农业大学 | miRNA marker related to pig hairless trait and application thereof |
CN113717975B (en) * | 2021-09-01 | 2023-09-26 | 中国农业大学 | miRNA marker related to pig hairless character and application thereof |
Also Published As
Publication number | Publication date |
---|---|
AU2572499A (en) | 1999-08-16 |
CA2362320A1 (en) | 1999-08-05 |
EP1053315A1 (en) | 2000-11-22 |
EP1053315A4 (en) | 2003-07-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO1999038965A1 (en) | Human hairless gene, protein and uses thereof | |
US5776677A (en) | Methods of detecting cystic fibrosis gene by nucleic acid hybridization | |
EP0489058B1 (en) | Cystic fibrosis gene | |
JP2001509378A (en) | Mutations in the myostatin gene that cause double masulation in mammals | |
US20060015954A1 (en) | GPR54 knock-out mammals and screening methods using them | |
US6372490B1 (en) | Nucleic acid encoding the MDM interacting protein | |
US5843652A (en) | Isolation and characterization of Agouti: a diabetes/obesity related gene | |
JP2004534504A (en) | Human genes essential for fertility | |
US20040010812A1 (en) | Human hyaluronan receptor | |
US6528634B1 (en) | Aiolos gene | |
US7196170B2 (en) | Aiolos, Helios, Daedalos and Ikaros: genes, polypeptides, regulatory elements and uses thereof | |
US20080152642A1 (en) | Aiolos, Helios, Daedalos and Ikaros: genes, polypeptides, regulatory elements and uses thereof | |
JP2004533229A (en) | Human genes essential for fertility | |
US20020042926A1 (en) | Ovary-specific genes and proteins | |
JPH11512284A (en) | Monoclonal lymphocytes and methods of use | |
JP2001522229A (en) | Antioxidant protein 2, genes and methods of using them | |
US6890534B1 (en) | Aiolos gene | |
US20030082650A1 (en) | Great gene and protein | |
US7148004B1 (en) | Oligonucleotides of the OB-R isoforms and methods of diagnosing body weight | |
AU647408C (en) | Cystic fibrosis gene | |
AU774642B2 (en) | Ovary-specific genes and proteins | |
US20030106076A1 (en) | Methods for identifying genes expressed in selected lineages, and a novel genes identified using the methods | |
WO2001085964A2 (en) | Over expression of the whn protein | |
JP2002504357A (en) | Helios gene | |
US20090233986A1 (en) | Methods and compositions for using sax2 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU CA JP MX US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 09628131 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1999905596 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1999905596 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2362320 Country of ref document: CA Ref country code: CA Ref document number: 2362320 Kind code of ref document: A Format of ref document f/p: F |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1999905596 Country of ref document: EP |