WO2019161805A1

WO2019161805A1 - Hr knockout non-human animal

Info

Publication number: WO2019161805A1
Application number: PCT/CN2019/076192
Authority: WO
Inventors: Yuelei SHEN; yang BAI; Rui Huang; Chengzhang SHANG; Meiling Zhang; Jiawei Yao; Chaoshe GUO; Yanan GUO
Original assignee: Biocytogen Jiangsu Co., Ltd.; Beijing Biocytogen Co., Ltd.
Priority date: 2018-02-26
Filing date: 2019-02-26
Publication date: 2019-08-29

Abstract

The genetically modified non-human animals that have a disruption at the endogenous HR gene (e.g., HR knockout), and methods of use thereof are provided.

Description

HR KNOCKOUT NON-HUMAN ANIMAL

CLAIM OF PRIORITY

This application claims the benefit of Chinese Patent Application App. No. 201810163134.3, filed on February 26, 2018, and Chinese Patent Application App. No. 201811543165.8, filed on December 17, 2018. The entire contents of the foregoing are incorporated herein by reference.

TECHNICAL FIELD

This disclosure relates to genetically modified animals that have a disruption at the endogenous HR gene (e.g., HR knockout) , and methods of use thereof.

BACKGROUND

Immunodeficient animals are very important for disease modeling and drug developments. In recent years, immunodeficient mice are routinely used as model organisms for research of the immune system, cell transplantation strategies, and the mechanisms of diseases. They have also been extensively used as hosts for normal and malignant tissue transplants, and are widely used to test the safety and efficacy of therapeutic agents.

In many experiments that involve immunodeficient animals (e.g., mice) , bioluminescence and fluorescence imaging are often used to observe the transplanted cells (e.g., tumor cells) . However, hair on the animal may interfere with the measurement and observation. There is a need for hairless immunodeficient animal models.

SUMMARY

This disclosure is related to genetically modified animals that have a disruption at the endogenous HR gene (e.g., HR knockout) , and methods of making and use thereof.

In one aspect, the disclosure relates to a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous HR lysine demethylase and nuclear receptor corepressor (HR) gene. In some embodiments, the disruption of the endogenous HR gene comprises deletion of one or more exons of the endogenous HR gene.

In some embodiments, the disruption of the endogenous HR gene comprises deletion of one or more exons selected from exon 3, exon 4, exon 5, exon 6, and exon 7 of the endogenous HR gene.

In some embodiments, the disruption of the endogenous HR gene comprises deletion of exon 3, exon 4, exon 5, exon 6, and exon 7 of the endogenous HR gene.

In some embodiments, the disruption of the endogenous HR gene further comprises deletion of one or more exons or part of exons selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, and exon 20 of the endogenous HR gene.

In some embodiments, the disruption of the endogenous HR gene comprises deletion of one or more introns of the endogenous HR gene.

In some embodiments, the disruption of the endogenous HR gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, and intron 19 of the endogenous HR gene.

In some embodiments, the disruption consists of deletion of at least 10 nucleotides in intron 2; deletion of the entirety of exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, and exon 7; and deletion of at least 10 nucleotides in intron 7.

In some embodiments, the animal is homozygous with respect to the disruption of the endogenous HR gene. In some embodiments, the animal is heterozygous with respect to the disruption of the endogenous HR gene.

In some embodiments, the disruption prevents the expression of functional HR protein.

In some embodiments, the length of the remaining exon sequences at the endogenous HR gene locus is less than 70%of the total length of all exon sequences of the endogenous HR gene. In some embodiments, the length of the remaining sequences at that the endogenous HR gene locus is less than 65%of the full sequence of the endogenous HR gene.

In one aspect, the disclosure relates to a genetically-modified, non-human animal, wherein the genome of the animal does not have one or more exons of HR gene at the animal’s endogenous HR gene locus.

In some embodiments, the genome of the animal does not have one or more exons or part of exons selected from the group consisting of exon 3, exon 4, exon 5, exon 6, and exon 7.

In some embodiments, the genome of the animal does not have one or more introns or part of introns selected from the group consisting of intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7.

In one aspect, the disclosure relates to a HR knockout non-human animal, wherein the genome of the animal comprises from 5’ to 3’ at the endogenous HR gene locus, (a) a first DNA sequence; optionally (b) a second DNA sequence comprising an exogenous sequence; (c) a third DNA sequence. In some embodiments, the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked.

In some embodiments, the first DNA sequence comprises an endogenous HR gene sequence that is located upstream of intron 2, the second DNA sequence can have a length of 0 nucleotides to 100 nucleotides, and the third DNA sequence comprises an endogenous HR gene sequence that is located downstream of intron 7.

In some embodiments, the first DNA sequence comprises a sequence that has a length (5’ to 3’) of from 10 to 1500 nucleotides.

In some embodiments, the length of the sequence refers to the length from the first nucleotide in exon 1 of the HR gene to the last nucleotide of the first DNA sequence.

In some embodiments, the first DNA sequence comprises at least 10 nucleotides from intron 2 of the endogenous HR gene.

In some embodiments, the first DNA sequence comprise exon 1 and exon 2 of the endogenous HR gene.

In some embodiments, the third DNA sequence comprises a sequence that has a length (5’ to 3’) of from 10 to 11000 nucleotides.

In some embodiments, the length of the sequence refers to the length from the first nucleotide in the third DNA sequence to the last nucleotide in the last exon of the endogenous HR gene.

In some embodiments, the third DNA sequence comprises at least 10 nucleotides from intron 7 of the endogenous HR gene.

In some embodiments, the third DNA sequence comprises exons 8-20, and introns 8-19.

In one aspect, the disclosure relates to a genetically-modified, non-human animal produced by a method comprising knocking out one or more exons of endogenous HR gene by using (1) a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in intron 2 of the endogenous HR gene, and (2) a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in intron 7 of the endogenous HR gene.

In some embodiments, the nuclease is CRISPR associated protein 9 (Cas9) .

In some embodiments, the target sequence in intron 2 of the endogenous HR gene is set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7, and the target sequence in intron 7 of the endogenous HR gene is set forth in SEQ ID NO: 8, 9, 10, 11, 12, 13, or 14.

In some embodiments, the first nuclease comprises a sgRNA that targets SEQ ID NO: 4 and the second nuclease comprises a sgRNA that targets SEQ ID NO: 10.

In some embodiments, the animal does not express a functional HR protein.

In some embodiments, the animal does not express a functional interleukin-2 receptor.

In some embodiments, the animal has one or more of the following characteristics:

(a) the percentage of T cells (CD3+ cells) is less than 5%, 2%, 1.5%, 1%, 0.7%, or 0.5%of leukocytes in the animal;

(b) the percentage of B cells (e.g., CD3-CD19+ cells) is less than 1%, 0.1%or 0.05%of leukocytes in the animal;

(c) the percentage of NK cells (e.g., CD3-CD49b+ cells) is less than 5%, 2%or 1.5%of leukocytes in the animal;

(d) the percentage of CD4+ T cells is less than 1%, 0.5%, 0.3%, or 0.1%of T cells;

(e) the percentage of CD8+ T cells is less than 1%, 0.5%, 0.3%, or 0.1%of T cells;

(f) the percentage of CD3+ CD4+ cells, CD3+ CD8+ cells, CD3-CD19+ cells is less than 5%, 1%or 0.5%of leukocytes in the animal;

(g) the percentage of T cells, B cells, and NK cells is less than 5%, 4%, 3%, 2%or 1%of leukocytes in the animal.

In some embodiments, the animal after being engrafted with human hematopoietic stem cells to develop a human immune system has one or more of the following characteristics:

(a) the percentage of human CD45+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes of the animal;

(b) the percentage of human CD3+ cells about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes in the animal;

(c) the percentage of human CD19+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes in the animal.

In some embodiments, the animal does not have hair.

(a) the animal has no functional T-cells and/or no functional B-cells;

(b) the animal exhibits reduced macrophage function relative to a NOD/scid mouse;

(c) the animal exhibits no NK cell activity;

(d) the animal exhibits reduced dendritic function relative to a NOD/scid mouse; and

(e) the animal does not have xenogeneic GVHD.

In some embodiments, the animal is a mammal, e.g., a monkey, a rodent, a rat, or a mouse.

In some embodiments, the animal is a C57 mouse, a C57BL mouse, a BALB/c mouse, a NOD/scid mouse, or a NOD/scid nude mouse, or a NOD-Prkdc ^scid IL-2rγ ^null mouse.

In some embodiments, the animal is an immune deficient animal. In some embodiments, the animal is not an immune deficient animal.

In some embodiments, the animal further comprises a sequence encoding a human or chimeric protein. In some embodiments, the human or chimeric protein is programmed cell death protein 1 (PD-1) , PD-L1, IL3, IL6, IL15, CSF1, or CSF2. In some embodiments, the animal further comprises a disruption in the animal’s endogenous Beta-2-Microglobulin (B2M) gene.

In one aspect, the disclosure relates to methods of determining effectiveness of an agent or a combination of agents for the treatment of cancer. The methods involve engrafting tumor cells to the animal as described herein, thereby forming one or more tumors in the animal; administering the agent or the combination of agents to the animal; and determining the inhibitory effects on the tumors.

In some embodiments, before engrafting the tumor cells to the animal, human peripheral blood cells (hPBMC) or human hematopoietic stem cells are injected to the animal.

In some embodiments, the tumor cells are from cancer cell lines. In some embodiments, the tumor cells are from a tumor sample obtained from a human patient.

In some embodiments, the inhibitory effects are determined by measuring the tumor volume in the animal.

In some embodiments, the tumor cells are melanoma cells, lung cancer cells, primary lung carcinoma cells, non-small cell lung carcinoma (NSCLC) cells, small cell lung cancer (SCLC) cells, primary gastric carcinoma cells, bladder cancer cells, breast cancer cells, and/or prostate cancer cells.

In some embodiments, the agent is an anti-PD-1 antibody. In some embodiments, the agent is an anti-PD-L1 antibody.

In some embodiments, the combination of agents comprises one or more agents selected from the group consisting of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel, and capecitabine.

In one aspect, the disclosure relates to methods of producing an animal comprising a human hemato-lymphoid system. The methods involve engrafting a population of cells comprising human hematopoietic cells or human peripheral blood cells into the animal as described herein.

In some embodiments, the human hemato-lymphoid system comprises human cells selected from the group consisting of hematopoietic stem cells, myeloid precursor cells, myeloid cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, lymphocytes, and platelets.

In some embodiments, the methods further comprise irradiating the animal prior to the engrafting.

In one aspect, the disclosure relates to methods of producing a HR knockout mouse. The methods involve:

(a) transforming a mouse embryonic stem cell or a fertilized egg with a gene editing system that targets endogenous HR gene, thereby producing a transformed embryonic stem cell;

(b) introducing the transformed embryonic stem cell or fertilized egg into a mouse blastocyst;

(c) implanting the mouse blastocyst into a pseudopregnant female mouse; and

(d) allowing the blastocyst to undergo fetal development to term,

thereby obtaining the HR knockout mouse.

In one aspect, the disclosure relates to methods of producing a HR knockout mouse. The methods involve

(b) implanting the transformed embryonic cell or the fertilized egg into a pseudopregnant female mouse; and

(c) allowing the transformed embryonic cell to undergo fetal development to term, thereby obtaining the HR knockout mouse.

In some embodiments, the gene editing system comprises a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in intron 2 of the endogenous HR gene, and a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in intron 7 of the endogenous HR gene.

In some embodiments, the nuclease is CRISPR associated protein 9 (Cas9) .

In some embodiments, the mouse embryonic stem cell or the fertilized egg has a C57 background, a C57BL background, a BALB background (e.g., BALB/c background) , a NOD/scid background, a NOD/scid nude, or a NOD-Prkdc ^scid IL-2rγ ^null background.

In some embodiments, the mouse embryonic stem cell or the fertilized egg comprises a sequence encoding a human or chimeric protein.

In some embodiments, the human or chimeric protein is PD-1 or CD137.

In some embodiments, the mouse embryonic stem cell or the fertilized egg has a genome comprising a disruption in the animal’s endogenous B2M gene.

In another aspect, the disclosure relates to a non-human mammalian cell, comprising a disruption, a deletion, or a genetic modification as described herein.

In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is a germ cell. In some embodiments, the cell is a blastocyst.

In another aspect, the disclosure relates to methods for establishing a HR knockout animal model. The methods include the steps of:

(a) providing the cell with a disruption in the endogenous HR gene, and

preferably the cell is a fertilized egg cell;

(b) culturing the cell in a liquid culture medium;

(c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;

(d) identifying the germline transmission in the offspring of the pregnant female in step (c) .

In some embodiments, the establishment of a HR knockout animal involves a gene editing technique that is based on CRISPR/Cas9.

In some embodiments, the non-human mammal is a mouse. In some embodiments, the non-human mammal in step (c) is a female with false pregnancy.

In another aspect, the disclosure relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein.

The disclosure also relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal.

The disclosure further relates to the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal.

In another aspect, the disclosure relates to a tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

The disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the development of a product related to an immunization processes of human cells, the manufacture of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

The disclosure also relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.

The disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the methods as described herein, in the screening, verifying, evaluating or studying the HR gene function, and the drugs for immune-related diseases and antitumor drugs.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

DESCRIPTION OF DRAWINGS

FIGS. 1A-1B are bar graphs showing activity testing results for sgRNA1-sgRNA14 (NC is a negative control; PC is a positive control) .

FIG. 2 is a schematic diagram showing pT7-sgRNA G2 plasmid map.

FIG. 3 shows PCR identification results for samples collected from tails of F0 generation mice (WT is a NOD-Prkdc ^scid IL-2rg ^null (B-NDG) mouse) . Among them, F0-1, F0-4, F0-18, F0-21, F0-28, F0-35, F0-37, F0-38, F0-41, and F0-45 are positive.

FIG. 4 shows PCR identification results for samples collected from tails of F1 generation mice (offspring of F0-18 and a B-NDG mouse) . M is the Marker; WT is B-NDG mouse, + is a positive control, H ₂O is a negative control.

FIG. 5 shows PCR identification results for samples collected from tails of F1 generation mice (offspring of F0-28 and a B-NDG mouse) . M is the Marker; WT is B-NDG mouse, + is a positive control, H ₂O is a negative control.

FIG. 6 is an image of a HR knockout mouse with NOD-Prkdc ^scid IL-2rg ^null mutations.

FIG. 7 is an image of a NOD-Prkdc ^scid IL-2rg ^null (B-NDG) mouse.

FIG. 8 is an image of HR knockout mouse with NOD-Prkdc ^scid IL-2rg ^null mutations (B-NDG background) with human tumor cells.

FIG. 9 is a diagram showing the mouse HR locus.

DETAILED DESCRIPTION

This disclosure relates to HR knockout non-human animals, and methods of use thereof.

Immunodeficient animals are an indispensable research tool for studying the mechanism of diseases, and methods of treating such diseases. They can easily accept exogenous cells or tissues due to their immunodeficiency, and have been widely used in the research. The commonly used immunodeficient animals include e.g., NOD-Prkdc ^scid IL-2rγ ^nul mice, NOD-Rag 1 ^-/--IL2rg ^-/- (NRG) , Rag 2 ^-/--IL2rg ^-/- (RG) , NOD/SCID (NOD-Prkdc ^scid) , and NOD/SCID nude mice. Among them, NOD-Prkdc ^scid IL-2rγ ^nul mice may be the best recipient mice for transplantation. These immunodeficient mice are described in detail e.g., in Ito et al. "Current advances in humanized mouse models. " Cellular &molecular immunology 9.3 (2012) : 208, which is incorporated herein by reference in its entirety.

Before experiments can be performed on these immunodeficient animals (e.g., mice) or some other transgenic animals, usually hair needs to be removed, e.g., before exogenous cells or tissues are implanted to these animals. If hair removal is incomplete or the hair removal causes some skin damage, it may interfere with subsequent observations or studies, e.g., bioluminescence and fluorescence imaging and measuring tumor size. Furthermore, the skin of hairless animals (e.g., mice) is similar to human skin. Thus, it can also be used to test cosmetics, and various therapeutic agents to heal wounds.

Unless otherwise specified, the practice of the methods described herein can take advantage of the techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology. These techniques are explained in detail in the following literature, for examples: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989) ; DNA Cloning, Volumes I and II (D.N. Glovered., 1985) ; Oligonucleotide Synthesis (M.J. Gaited., 1984) ; Mullisetal U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B.D. Hames&S.J. Higginseds. 1984) ; Transcription And Translation (B.D. Hames&S.J. Higginseds. 1984) ; Culture Of Animal Cell (R.I. Freshney, Alan R. Liss, Inc., 1987) ; Immobilized Cells And Enzymes (IRL Press, 1986) ; B. Perbal, A Practical Guide To Molecular Cloning (1984) , the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds. -in-chief, Academic Press, Inc., New York) , specifically, Vols. 154 and 155 (Wuetal. eds. ) and Vol. 185, “Gene Expression Technology” (D. Goeddel, ed. ) ; Gene Transfer Vectors For Mammalian Cells (J.H. Miller and M.P. Caloseds., 1987, Cold Spring Harbor Laboratory) ; Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987) ; Hand book Of Experimental Immunology, Volumes V (D.M. Weir and C.C. Blackwell, eds., 1986) ; and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986) ; each of which is incorporated herein by reference in its entirety.

HR Lysine demethylase and nuclear receptor corepressor (HR)

Hair is maintained through a cyclic process that includes periodic regeneration of hair follicles in a stem-cell-dependent manner. The hair cycle consists of three defined stages: growth (anagen) , followed by regression (catagen) and rest (telogen) . Growth of a new hair requires reentry into anagen, a process involving activation of multipotent epithelial stem cells residing in a specialized part of the follicle outer root sheath (ORS) . Activating signals emanate from adjacent mesenchymal cells (dermal papilla) , directing epithelial stem cells to migrate and differentiate to regenerate the hair bulb. Multiple signaling pathways, including Wnts, Sonic hedgehog (Shh) , and TGF-β family members have been shown to promote anagen initiation.

Disruption of Hairless (HR) gene function causes a complex skin phenotype that includes a specific defect in hair follicle regeneration in both humans and mice. In Hr mutant mice, hair follicle morphogenesis and initial hair growth is normal. However, after the follicles regress (catagen) and the hair is shed, around postnatal day (P) 17, telogen stage follicles never reenter anagen, and no new hair is produced, resulting in alopecia. Alternatively, the defect in anagen initiation may reflect a loss of the relevant epithelial stem cell population or an inability to generate and/or interpret the necessary signals.

The Hairless (also known as HR, HR lysine demethylase and nuclear receptor corepressor, or lysine-specific demethylase hairless) gene can encode an approximately 130 kDa nuclear transcription factor. The HR protein contains functional domains that include a nuclear localization signal domain, a nuclear matrix targeting motif, a putative zinc-finger, and a Jumonji C (JmjC) domain.

HR can directly interact with several nuclear transcription factors and chromatin modulators. Rodent Hr has been shown to interact with thyroid hormone receptors TRα and TRβ and with RAR-related orphan receptors (RORs) , especially RORα to repress their transactivation activity. Human and rodent HRs have also been shown to undergo direct protein-protein interactions with the vitamin D receptor VDR. Regions in HR which mediate interactions with nuclear receptors include four motifs of hydrophobic amino acids, two of the form LXXLL (where L is leucine and X is any amino acid) and two ΦXXΦΦ motifs (where Φ can be leucine, isoleucine or valine) . These four hydrophobic motifs are also referred to as interaction domains (IDs) . HR has been shown to interact with RORα and TRs via the LXXLL motif pair and the ΦXXΦΦ motif pair respectively, whereas all four motifs participate in interactions with VDR as revealed by coimmunoprecipitation and functional studies. Through its interactions with TRs, HR has also been implicated as playing a role in mammalian CNS development. Similarly, HR interactions with RORα have been shown to be important in cerebellar development.

HR may regulate epidermal homeostasis via direct control of a set of target genes that includes KDSR, MAGI2, and CSNK2A. Moreover, HR mutations D1020N and V1056M from patients with atrichia with papular lesions (APL) markedly diminished the HDM activity compared to wild-type HR. Such findings provide positive evidence that the disruption of the HR JmjC domain is relevant to hair cycling and skin maintenance.

A detailed description of HR and its function can be found, e.g., in Liu et al., "Hairless is a histone H3K9 demethylase. " The FASEB Journal 28.4 (2014) : 1534-1542; Maatough et al., "Human hairless protein roles in skin/hair and emerging connections to brain and other cancers. " Journal of cellular biochemistry 119.1 (2018) : 69-80; Beaudoin, et al. "Hairless triggers reactivation of hair growth by promoting Wnt signaling. " Proceedings of the National Academy of Sciences 102.41 (2005) : 14653-14658; Liu et al. "Molecular basis for hair loss in mice carrying a novel nonsense mutation (Hrrh-R) in the hairless gene (Hr) . " Veterinary pathology 47.1 (2010) : 167-176; each of which is incorporated herein by reference in its entirety.

In human genomes, HR gene (Gene ID: 55806) is located on chromosome 8, and has 19 exons. The nucleotide sequence for human HR mRNA is NM_005144.4, and the amino acid sequence for human HR is NP_005135.2.

In mice, HR gene locus has 20 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, and exon 20 (FIG. 9) . The nucleotide sequence for mouse HR cDNA is NM_021877.3 (SEQ ID NO: 26) , the amino acid sequence for mouse HR is NP_068677.2 (SEQ ID NO: 27) . The location for each exon in the mouse HR nucleotide sequence and amino acid sequence is listed below:

Table 1

The mouse HR gene (Gene ID: 15460) is located in Chromosome 14 of the mouse genome, which is located from70554056 to 70573548 of NC_000080.6 (GRCm38. p4 (GCF_000001635.24) ) . The 5’-UTR is from 70, 554, 056 to 70, 554, 112 and 70, 554, 512 to 70, 555, 107 and 70, 556, 348 to 70, 556, 388, exon 1 is from 70, 554, 056 to 70, 554, 112, the first intron is from 70, 554, 113 to 70, 554, 511, exon 2 is from 70, 554, 512 to 70, 555, 107, the second intron is from 70, 555, 108 to 70, 556, 347, exon 3 is from 70, 556, 348 to 70, 557, 000, the third intron is from 70, 557, 001 to 70, 557, 628, exon 4 is from 70, 557, 629 to 70, 558, 409, the fourth intron is from 70, 558, 410 to 70, 559, 638, exon 5 is from 70, 559, 639 to 70, 559, 789, the fifth intron is from 70, 559, 790 to 70, 559, 872, exon 6 is from 70, 559, 873 to 70, 560, 063, the sixth intron is from 70, 560, 064 to 70, 561, 811, exon 7 is from 70, 561, 812 to 70, 561, 976, the seventh intron is from 70, 561, 977 to 70, 563, 328, exon 8 is from 70, 563, 329 to 70, 563, 418 , the eighth intron is from 70, 563, 419 to 70, 563, 566, exon 9 is from 70, 563, 567 to 70, 563, 682, the ninth intron is from 70, 563, 683 to 70, 565, 301, exon 10 is from 70, 565, 302 to 70, 565, 383, the tenth intron is from 70, 565, 384 to 70, 566, 028, exon 11 is from 70, 566, 029 to 70, 566, 192, the eleventh intron is from 70, 566, 193 to 70, 566, 309, exon 12 is from 70, 566, 310 to 70, 566, 546, the twelfth intron is from 70, 566, 547 to 70, 566, 779, exon 13 is from 70, 566, 780 to 70, 566, 945, the thirteenth intron is from 70, 566, 946 to 70, 567, 148, exon 14 is from 70, 567, 149 to 70, 567, 218, the fourteenth intron is from 70, 567, 219 to 70, 567, 501, exon 15 is from 70, 567, 502 to 70, 567, 632, the fifteenth intron is from 70, 567, 633 to 70, 567, 775, exon 16 is from 70, 567, 776 to 70, 567, 895, the sixteenth intron is from 70, 567, 896 to 70, 567, 976, exon 17 is from 70, 567, 977 to 70, 568, 092, the seventeenth intron is from 70, 568, 093 to 70, 571, 377, exon 18 is from 70, 571, 378 to 70, 571, 542, the eighteenth intron is from 70, 571, 543 to 70, 571, 907, exon 19 is from 70, 571, 908 to 70, 572, 036, the nineteenth intron is from 70, 572, 037 to 70, 572, 241, exon 20 is from 70, 572, 242 to 70, 573, 548, the 3’-UTR is from 70, 572, 305 to 70, 573, 548, based on transcript NM_021877.3. All relevant information for mouse HR locus can be found in the NCBI website with Gene ID: 15460, which is incorporated by reference herein in its entirety.

Other HR genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for HR in Rattus norvegicus is 60563, the gene ID for HR in Macaca mulatta (Rhesus monkey) is 574164, the gene ID for HR in Sus scrofa (pig) is 397617. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database.

The present disclosure provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous HR gene, wherein the disruption of the endogenous HR gene comprises deletion of one or more exons, or part of the one or more exons, wherein the one or more exons are selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, and exon 20 of the endogenous HR gene. Thus, the disclosure provides a genetically-modified, non-human animal that does not have one or more exons that are selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, and exon 20 of the endogenous HR gene. In some embodiments, the animals do not have exons 3-7.

As used herein, the term “deletion of an exon” refers to the deletion the entire exon. For example, deletion of exon 2 means that all sequences in exon 2 are deleted.

As used herein, the term “deletion of part of an exon” refers to at least one nucleotide, but not all nucleotides in the exon is deleted. In some embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides in the exon are deleted.

In some embodiments, the disruption comprises deletion of one or more introns, or part of the one or more introns, wherein the one or more introns are selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, and intron 19 of the endogenous HR gene. Thus, the disclosure provides a genetically-modified, non-human animal does not have one or more introns that are selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, and intron 19 of the endogenous HR gene. In some embodiments, the animal does not have part of intron 2, intron 3, intron 4, intron 5, intron 6, and/or part of intron 7.

As used herein, the term “deletion of an intron” refers to the deletion the entire intron. For example, deletion of intron 3 means that all sequences in intron 3 are deleted.

As used herein, the term “deletion of part of an intron” refers to at least one nucleotide, but not all nucleotides in the intron is deleted. In some embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, or 3000 nucleotides in the intron are deleted.

In some embodiments, the disruption of the endogenous HR gene comprises deletion of one or more exons selected from the group consisting of exon 3, exon 4, exon 5, exon 6, and exon 7 of the endogenous HR gene. In some embodiments, the disruption of the endogenous HR gene further comprises deletion of exon 1, exon 2, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, and/or exon 20 of the endogenous HR gene.

In some embodiments, the entire sequence of mouse exon 3, exon 4, exon 5, exon 6, and exon 7 are deleted.

In some embodiments, a “region” or “portion” of mouse exons or introns of HR gene are deleted. The term “region” or “portion” can refer to e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, or 3000 nucleotides.

In some embodiments, the “region” or “portion” can be at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, or intron 19. In some embodiments, a region, a portion, or the entire sequence of exon 3, exon 4, exon 5, exon 6, and/or exon 7 are deleted. In some embodiments, a region, a portion, or the entire sequence of mouse intron 2, intron 3, intron 4, intron 5, intron 6, and/or intron 7 are deleted.

In some embodiments, the disruption comprises or consists of deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides in exon 3, exon 4, exon 5, exon 6, and/or exon 7. In some embodiments, the disruption comprises or consists of deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, or 3000 nucleotides in intron 2, intron 3, intron 4, intron 5, intron 6, and/or intron 7.

In some embodiments, the disruption comprises or consists of deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, or 1000 in intron 2; deletion of the entirety of exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, and exon 7; and/or deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, or 1000 nucleotides in intron 7.

In some embodiments, the length of the remaining exon sequences at the endogenous HR gene locus is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the total length of all exon sequences of the endogenous HR gene. In some embodiments, the length of the remaining exon sequences at the endogenous HR gene locus is about or at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the total length of all exon sequences of the endogenous HR gene.

In some embodiments, the length of the remaining sequences at that the endogenous HR gene locus is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the full sequence of the endogenous HR gene. In some embodiments, the length of the remaining sequences at that the endogenous HR gene locus is about or at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the full sequence of the endogenous HR gene.

In some embodiments, the sequence starts from the first nucleotide of exon 1. In some embodiments, the sequence ends at the last nucleotide of the last exon.

The present disclosure further relates to the genomic DNA sequence of a HR knockout animal (e.g., a rodent, a mouse) . In some embodiments, the genome of the animal comprises from 5’ to 3’ at the endogenous HR gene locus, (a) a first DNA sequence; optionally, (b) a second DNA sequence comprising an exogenous sequence; (c) a third DNA sequence, wherein the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked.

The second DNA sequence can have a length of 0 nucleotides to 1000 nucleotides (e.g., at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides) . In some embodiments, the second DNA sequence has only 0 nucleotides, which means that there is no extra sequence between the first DNA sequence and the third DNA sequence. In some embodiments, random or exogenous sequences are added. In some embodiments, the second DNA sequence has a length of 1 nucleotide to 100 nucleotides (e.g., 1 to 20 nucleotides) .

In some embodiments, the second DNA sequence has about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides. In some embodiments, the second DNA sequence has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides.

In some embodiments, the first DNA sequence comprises an endogenous HR gene sequence that is located upstream of intron 2, and can include all or just part of sequences that is located upstream of intron 2. In some embodiments, the first DNA sequence comprises an endogenous HR gene sequence that is located upstream of exon 2.

In some embodiments, the first DNA sequence comprises a sequence that has a length (5’ to 3’) of from 10 to 1500 nucleotides (e.g., from 10 to 100 nucleotides, from 100 to 500 nucleotides, from 500 to 1000 nucleotides, from 1000 to 1500 nucleotides, from 1000 to 2000 nucleotides, or from 1400 to 1500 nucleotides) starting from the first nucleotide in exon 1 of the HR gene to the last nucleotide of the first DNA sequence. In some embodiments, the first DNA sequence comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides from exon 1, exon 2, or the combination of exon 1 and exon 2. In some embodiments, the first DNA sequence has at most , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, or 700 nucleotides from exon 1, exon 2, or the combination of exon 1 and exon 2.

In some embodiments, the third DNA sequence comprises an endogenous HR gene sequence that is located downstream of intron 7, and can include all or just part of sequences that is located downstream of intron 7. In some embodiments, the third DNA sequence comprises a sequence that has a length (5’ to 3’) of from 1 to 1351 nucleotides (e.g., from 1 to 1000 nucleotides, or from 500 to 1300 nucleotides) starting from the first nucleotide in the third DNA sequence to the last nucleotide in the intron 7 (e.g., intron 7 in mouse) of the endogenous HR gene. In some embodiments, the third DNA sequence comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, or 1300 nucleotides from intron 7. In some embodiments, the third DNA sequence has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, or 1350 nucleotides from intron 7.

In some embodiments, the third DNA sequence comprises an endogenous HR gene sequence that is located downstream of the last intron (e.g., intron 19 in mouse) , and can include all or just part of sequences that is located downstream of intron 19. In some embodiments, the third DNA sequence comprises a sequence that has a length (5’ to 3’) of from 10 to 11000 nucleotides (e.g., from 100 to 11000 nucleotides, from 1000 to 11000 nucleotides, or from 5000 to 11000 nucleotides) starting from the first nucleotide in the third DNA sequence to the last nucleotide in the last exon (e.g., exon 20 in mouse) of the endogenous HR gene. In some embodiments, the third DNA sequence comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or 11000 nucleotides. In some embodiments, the third DNA sequence has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or 11000 nucleotides.

In some embodiments, the third DNA sequence comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, or 1300 nucleotides from the last exon (e.g., exon 20 in mouse) . In some embodiments, the third DNA sequence has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, or 1306 nucleotides from the last exon (e.g., exon 20 in mouse) .

In some embodiments, the HR gene sequence at the endogens HR locus is set forth in SEQ ID NO: 32 (70554056-70573548 of NC_000080.6) . In some embodiments, 70555486-70562742 of NC_000080.6 (SEQ ID NO: 33) is deleted. In some embodiments, 70555492-70562744 of NC_000080.6 (SEQ ID NO: 34) is deleted. In some embodiments, the genetic modified non-human animal comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical or 100%identical to SEQ ID NO: 28. In some embodiments, the genetic modified non-human animal comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical or 100%identical to SEQ ID NO: 35.

In some embodiments, the sequence is located at the endogenous HR locus.

The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein (e.g., exon sequences, intron sequences, the remaining exon sequences, the deleted sequences) , and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein (e.g., amino acid sequences encoded by exons) . In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or 11000 nucleotides. In some embodiments, the amino acid sequence is less than , 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400 or 1500 amino acid residues.

In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.

In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.

To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . The length of a reference sequence aligned for comparison purposes is at least 80%of the length of the reference sequence, and in some embodiments is at least 90%, 95%, or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For purposes of the present disclosure, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

Cells, tissues, and animals (e.g., mouse) are also provided that comprise a disruption of the endogenous HR gene as described herein, as well as cells, tissues, and animals (e.g., mouse) that have any nucleic acid sequence as described herein.

Genetically modified animals

As used herein, the term “genetically-modified non-human animal” refers to a non-human animal having a modified sequence (e.g., deletion of endogenous sequence or insertion of exogenous sequence) in at least one chromosome of the animal’s genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the modified sequence in its genome. The cell having the modified sequence can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a disruption or a deletion at the endogenous HR locus. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.

In some embodiments, the genetically-modified non-human animal does not express HR (e.g., intact or functional HR protein) . Because HR is involved in hair growth and hair follicle regeneration, the genetically-modified non-human animal does not have hair. In some embodiments, the hair coverage of the genetically-modified non-human animal is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.

In some embodiments, the genetically-modified non-human animal is an immunodeficient animal. In some embodiments, the animal is a NOD-Prkdc ^scid IL-2rγ ^nul, NOD-Rag 1 ^-/--IL2rg ^-/- (NRG) , Rag 2 ^-/--IL2rg ^-/- (RG) , NOD/SCID (NOD-Prkdc ^scid) , NOD/SCID nude, or NOD-Prkdc ^scid IL-2rg ^null animal (e.g., a rodent, a rat, or a mouse) . In some embodiments, the genetically-modified non-human animal is not an immunodeficient animal.

In some embodiments, the genetically-modified non-human animal lack functional T cells, B cells, and/or NK cells.

In some embodiments, the animal can have one or more of the following characteristics:

(a) the percentage of T cells (CD3+ cells) is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%or 0.1%of leukocytes in the animal;

(b) the percentage of B cells (e.g., CD3-CD19+ cells) is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%or 0.01%of leukocytes in the animal;

(c) the percentage of NK cells (e.g., CD3-CD49b+ cells) is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, or 0.5%of leukocytes in the animal;

(d) the percentage of CD4+ T cells (CD3+ CD4+ cells) is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%of T cells;

(e) the percentage of CD8+ T cells (CD3+ CD8+ cells) is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%of T cells;

(f) the percentage of CD3+ CD4+ cells, CD3+ CD8+ cells, CD3-CD19+ cells is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%of leukocytes in the animal;

(g) the percentage of T cells (CD3+ cells) and NK cells (CD3-CD49b+ cells) is less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%of leukocytes in the animal.

As used herein, the term “leukocytes” or “white blood cells” include neutrophils, eosinophils (acidophilus) , basophils, lymphocytes, and monocytes. All leukocytes have nuclei, which distinguishes them from the anucleated red blood cells (RBCs) and platelets. CD45, also known as leukocyte common antigen (LCA) , is a cell surface marker for leukocytes. Among leukocytes, monocytes and neutrophils are phagocytic.

Lymphocytes is a subtype of leukocytes. Lymphocytes include natural killer (NK) cells (which function in cell-mediated, cytotoxic innate immunity) , T cells, and B cells.

In some embodiments, the variations among individual mice are very small. In some embodiments, the standard deviations of the percentages are less than 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%or 0.01%.

In some embodiments, the genetically-modified non-human animal has a NOD-Prkdc ^scid IL-2rg ^null background. The genetically-modified animal can also have one or more of the following characteristics:

(a) the genetically-modified mouse has no functional T-cells and/or no functional B-cells;

(b) the genetically-modified mouse exhibits reduced macrophage function relative to a NOD/scid mouse, or a NOD/scid nude mouse;

(c) the genetically-modified mouse exhibits no NK cell activity;

(d) the genetically-modified mouse exhibits reduced dendritic function relative to a NOD/scid mouse, or a NOD/scid nude mouse; and

(e) the genetically-modified mouse has an enhanced engraftment capacity of exogenous cells relative to a NOD/scid mouse, or a NOD/scid nude mouse.

The genetically modified non-human animal can also be various other animals, e.g., a rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) . For the non-human animals where suitable genetically modifiable ES cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.

In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiment, the rodent is selected from the superfamily Muroidea. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) . In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat. In one embodiment, the non-human animal is a mouse.

In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129/SvEv-and C57BL/6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains. In some embodiment, the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB/c-50%12954/Sv; or 50%C57BL/6-50%129) .

In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

The animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the HR knockout animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor) , can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and/or genetic modification (e.g., knocking out one or more genes) .

Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD/SCID mice, nude mice, NOD/SCID nude mice, NOD-Prkdc ^scid IL-2rγ ^null, and Rag1 and/or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a disruption of the endogenous non-human HR locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD/SCID mice, nude mice, NOD-Prkdc ^scid IL-2rγ ^null mice, Rag1 and/or Rag2 knockout mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961; and PCT/CN2018/079365, which are incorporated herein by reference in the entirety.

Although genetically modified cells are also provided that can comprise the modifications (e.g., disruption) described herein (e.g., ES cells, somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous HR locus in the germline of the animal.

Furthermore, the genetically modified animal can be homozygous with respect to the disruption of the endogenous HR gene. In some embodiments, the animal can be heterozygous with respect to the disruption of the endogenous HR gene.

The present disclosure further relates to a non-human mammal generated through the methods as described herein. In some embodiments, the genome thereof contains human gene (s) .

In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse) .

The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains a disruption of the HR gene in the genome of the animal.

Genetic, molecular and behavioral analyses for the non-human mammals described above can be performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.

The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cell can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The disruption of HR gene can be detected by a variety of methods.

There are also many analytical methods that can be used to detect DNA expression, including methods at the level of RNA (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) . Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels of wildtype HR can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human proteins.

Vectors

The disclosure also provides vectors for constructing a HR animal model. In some embodiments, the vectors comprise sgRNA sequence, wherein the sgRNA sequence target HR gene, and the sgRNA is unique on the target sequence of the HR gene to be altered. In some embodiments, the sequence meets the sequence arrangement rule of 5’-NNN (20) -NGG3’ or 5’-CCN-N (20) -3’; and in some embodiments, the targeting site of the sgRNA in the mouse HR gene is located on the exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, and exon 20, intron 1, intron 2, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, intron 19, upstream of exon 1, or downstream of exon 20 of the mouse HR gene.

In some embodiments, the 5’ targeting sequence for the knockout sequence is shown as SEQ ID NOs: 1-7, and the sgRNA sequence recognizes the 5’ targeting site. In some embodiments, the 3’ targeting sequence for the knockout sequence is shown as SEQ ID NOs: 8-14 and the sgRNA sequence recognizes the 3’ targeting site.

Thus, the disclosure provides sgRNA sequences for constructing a HR knockout animal model. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 15-22.

In some embodiments, the disclosure relates to a plasmid construct (e.g., pT7-sgRNA) including the sgRNA sequence, and/or a cell including the construct.

In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the sgRNA construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.

In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell.

Methods of making genetically modified animals

Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., "Delivery technologies for genome editing, " Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.

Thus, in some embodiments, the disclosure provides knocking out in at least one cell of the animal, at an endogenous HR gene locus, one or more exons (e.g., about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 exons) and/or one or more introns (e.g., about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 introns) of the endogenous HR gene. In some embodiments, the modification occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can also be inserted into an enucleated oocyte.

In some embodiments, cleavages at the upstream and the downstream of the knockout sequence by a nuclease (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strands break, and non-homologous end joining (NHEJ) occurs and ligates the break ends, thereby knocking out the sequence of interest. NHEJ typically utilizes short homologous DNA sequences called microhomologies to guide repair. These microhomologies are often present in single-stranded overhangs on the ends of double-strand breaks. When the overhangs are perfectly compatible, NHEJ usually repairs the break accurately. When the break ends located at the upstream and the downstream of the target sequence are ligated, imprecise repair occurs, and in some cases, leading to loss of nucleotides or insertion of random nucleotides.

Zinc finger proteins, TAL-effector domains, or single guide RNA (sgRNA) DNA-binding domains can be designed to target the upstream and the downstream of the knockout sequence. SEQ ID NOs: 1-14 are exemplary target sequences for the modification. Among them, SEQ ID NOs: 1-7 are located within intron 2 of mouse endogenous HR gene. SEQ ID NOs: 8-14 are located within intron 7 of mouse endogenous HR gene. After the zinc finger proteins, TAL-effector domains, or single guide RNA (sgRNA) DNA-binding domains bind to the target sequences, the nuclease cleaves the genomic DNA, and triggers NHEJ. In some embodiments, the nuclease is CRISPR associated protein 9 (Cas9) .

Thus, the methods of producing a HR knockout mouse can involve one or more of the following steps: transforming a mouse embryonic stem cell with a gene editing system that targets endogenous HR gene, thereby producing a transformed embryonic stem cell; introducing the transformed embryonic stem cell into a mouse blastocyst; implanting the mouse blastocyst into a pseudopregnant female mouse; and allowing the blastocyst to undergo fetal development to term.

In some embodiments, the transformed embryonic cell is directly implanted into a pseudopregnant female mouse instead, and the embryonic cell undergoes fetal development.

In some embodiments, the gene editing system can involve zinc finger proteins, TAL-effector domains, or single guide RNA (sgRNA) DNA-binding domains.

The present disclosure further provides a method for establishing a HR gene knockout animal model, involving the following steps:

(a) providing the cell (e.g. a fertilized egg cell) with the genetic modification based on the methods described herein;

(b) culturing the cell in a liquid culture medium;

(d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .

In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 mouse, a NOD/scid mouse, a NOD/scid nude mouse, or a NOD-Prkdc ^scid IL-2rγ ^null mouse) . In some embodiments, the non-human mammal is a NOD/scid mouse. In the NOD/scid mouse, the SCID mutation has been transferred onto a non-obese diabetic (NOD) background. Animals homozygous for the SCID mutation have impaired T and B cell lymphocyte development. The NOD background additionally results in deficient natural killer (NK) cell function. In some embodiments, the non-human mammal is a NOD/scid nude mouse. The NOD/scid nude mouse additionally has a disruption of FOXN1 gene on chromosome 11 in mice. In some embodiments, the animal can comprise an additional disruption in the animal’s endogenous Beta-2-Microglobulin (B2M) gene.

In some embodiments, the fertilized eggs for the methods described above are NOD/scid fertilized eggs, NOD/scid nude fertilized eggs, or NOD-Prkdc ^scid IL-2rγ ^null fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, C57BL/6 fertilized eggs, FVB/N fertilized eggs, BALB/c fertilized eggs, DBA/1 fertilized eggs and DBA/2 fertilized eggs.

Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the method described above.

The genetically modified animals (e.g., mice) generated by the methods described herein can have several advantages. For example, the genetically modified mice do not require backcrossing, and thus have a more defined background (e.g., less genetic variations among individual subjects) as compared to some other HR knockout or immunodeficient mice. A defined background or a pure background is beneficial to obtain consistent experiment results. In some embodiments, the genetic variation among the mice across the entire genome (e.g., autosomes) among different individuals is less than 3%, 2%, 1%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%or 0.01%. The methods to determine the genetic variations are known in the art. For example, the genetic variations can be measured or determined by sequencing, whole genome sequencing, exome sequencing, detecting variations at some selected sites (e.g., by using SNP microarrays, by detecting copy number variations) etc. In some embodiments, the mice have a genome (e.g., autosomes) that is about or at least 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99%identical to NOD-Prkdc ^scid IL-2rγ ^null mice (e.g., B-NDG mice) except for certain mutations (e.g., the HR knockout mutation) . In some embodiments, the mice have a genome (e.g., autosomes) that is about or at least 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99%identical to NOD/SCID mice (or NOD-Prkdc ^scid mice) except for certain mutations (e.g., the HR knockout mutation and/or IL-2rγ mutation) . In some embodiments, the mice have a genome (e.g., autosomes) that is about or at least 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99%identical to NOD mice except for certain mutations (e.g., the HR knockout mutation, the SCID mutation, and/or IL-2rγ mutation) .

Furthermore, despite the immunodeficiency, these mice are also relatively healthy, and in some cases, they have a relatively long life span (e.g., about or at least 1 year, 1.5 years, 2 years, 2.5 years, or 3 years) .

Methods of using genetically modified animals

Genetically modified animals with a disruption at endogenous HR gene can provide a variety of uses that include, but are not limited to, observing tumor growth, testing various therapeutic agents (e.g., to treat tumors, wounds, and various skin diseases) , and testing cosmetics.

In some embodiments, the animal is an immunodeficient animal, e.g., a NOD-Prkdc ^scid IL-2rγ ^nul, NOD-Rag 1 ^-/--IL2rg ^-/- (NRG) , Rag 2 ^-/--IL2rg ^-/- (RG) , NOD/SCID (NOD-Prkdc ^scid) , NOD/SCID nude, or NOD-Prkdc ^scid IL-2rg ^null animal (e.g., a rodent, a rat, or a mouse) . In some embodiments, the animal further comprises an additional disruption in the animal’s endogenous Beta-2-Microglobulin (B2M) gene.

In some embodiments, the hairless immunodeficient animal can be used to establish a human hemato-lymphoid animal model, develop therapeutics for human diseases and disorders, and assess the efficacy of these therapeutic agents in the animal models.

In some embodiments, the genetically modified animals can be used for establishing a human hemato-lymphoid system. The methods involve engrafting a population of cells comprising human hematopoietic cells (CD34+ cells) or human peripheral blood cells into the genetically modified animal described herein. In some embodiments, the methods further include the step of irradiating the animal prior to the engrafting. The human hemato-lymphoid system in the genetically modified animals can include various human cells, e.g., hematopoietic stem cells, myeloid precursor cells, myeloid cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, lymphocytes, and platelets.

The genetically modified animals described herein are also an excellent animal model for establishing the human hemato-lymphoid system. In some embodiments, the animal after being engrafted with human hematopoietic stem cells or human peripheral blood cells to develop a human immune system has one or more of the following characteristics:

(a) the percentage of human CD45+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes or CD45+ cells of the animal;

(b) the percentage of human CD3+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes or CD45+ cells in the animal; and

(c) the percentage of human CD19+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes or CD45+ cells in the animal.

In some embodiments, the genetically modified animals described herein are less likely to develop graft-versus-host disease (GVHD) or xenogeneic graft-versus-host disease (X-GVHD) .

In some embodiments, after being engrafted with human hematopoietic stem cells or human peripheral blood cells, the genetically modified animals described herein can live for about or at least 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days.

In some embodiments, the genetically modified animals described herein do not have a NSG or NOG background. In some embodiments, the genetically modified animals described herein are better animal models for establishing the human hemato-lymphoid system (e.g., having a higher percentage of human leukocytes, human T cells, human B cells, or human NK cells) . A detailed description of the NSG mice and NOD mice can be found, e.g., in Ishikawa et al. "Development of functional human blood and immune systems in NOD/SCID/IL2 receptor γ chainnull mice. " Blood 106.5 (2005) : 1565-1573; Katano et al. "NOD-Rag2null IL-2Rγnull mice: an alternative to NOG mice for generation of humanized mice. " Experimental animals 63.3 (2014) : 321-330, both of which are incorporated herein by reference in the entirety.

In some embodiments, the genetically modified animals can be used to determine the effectiveness of an agent or a combination of agents for the treatment of cancer. The methods involve engrafting tumor cells to the animal as described herein, administering the agent or the combination of agents to the animal; and determining the inhibitory effects on the tumors.

In some embodiments, the tumor cells are from a tumor sample obtained from a human patient. These animal models are also known as patient derived xenografts (PDX) models. PDX models are often used to create an environment that resembles the natural growth of cancer, for the study of cancer progression and treatment. Within PDX models, patient tumor samples grow in physiologically-relevant tumor microenvironments that mimic the oxygen, nutrient, and hormone levels that are found in the patient’s primary tumor site. Furthermore, implanted tumor tissue maintains the genetic and epigenetic abnormalities found in the patient and the xenograft tissue can be excised from the patient to include the surrounding human stroma. As a result, PDX models can often exhibit similar responses to anti-cancer agents as seen in the actual patient who provide the tumor sample.

While the genetically modified animals do not have functional T cells or B cells, the genetically modified animals still have functional phagocytic cells, e.g., neutrophils, eosinophils (acidophilus) , basophils, or monocytes. Macrophages can be derived from monocytes, and can engulf and digest cellular debris, foreign substances, microbes, cancer cells. Thus, the genetically modified animals described herein can be used to determine the effect of an agent (e.g., anti-CD47 antibodies or anti-SIRPa antibodies) on phagocytosis, and the effects of the agent to inhibit the growth of tumor cells.

In some embodiments, human peripheral blood cells (hPBMC) or human hematopoietic stem cells are injected to the animal to develop human hematopoietic system. The genetically modified animals described herein can be used to determine the effect of an agent in human hematopoietic system, and the effects of the agent to inhibit tumor cell growth or tumor growth. Thus, in some embodiments, the methods as described herein are also designed to determine the effects of the agent on human immune cells (e.g., human T cells, B cells, or NK cells) , e.g., whether the agent can stimulate T cells or inhibit T cells, whether the agent can upregulate the immune response or downregulate immune response. In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., cancer, or autoimmune diseases.

In some embodiments, the tested agent or the combination of tested agents is designed for treating various cancers. As used herein, the term “cancer” refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term “tumor” as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. In some embodiments, the agents described herein are designed for treating or diagnosing a carcinoma in a subject. The term “carcinoma” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.

In some embodiments, the tested agent is designed for the treating melanoma, primary lung carcinoma, non-small cell lung carcinoma (NSCLC) , small cell lung cancer (SCLC) , primary gastric carcinoma, bladder cancer, breast cancer, and/or prostate cancer.

In some embodiments, the injected tumor cells are human tumor cells. In some embodiments, the injected tumor cells are melanoma cells, primary lung carcinoma cells, non-small cell lung carcinoma (NSCLC) cells, small cell lung cancer (SCLC) cells, primary gastric carcinoma cells, bladder cancer cells, breast cancer cells, and/or prostate cancer cells.

The inhibitory effects on tumors can also be determined by any methods known in the art. In some embodiments, the tumor cells can be labeled by a luciferase gene. Thus, the number of the tumor cells or the size of the tumor in the animal can be determined by an in vivo imaging system (e.g., the intensity of fluorescence) . In some embodiments, the inhibitory effects on tumors can also be determined by measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGI _TV) . The tumor growth inhibition rate can be calculated using the formula TGI _TV (%) = (1 –TVt/TVc) x 100, wherein TVt and TVc are the mean tumor volume (or weight) of treated and control groups.

In some embodiments, the tested agent can be one or more agents selected from the group consisting of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel, and capecitabine.

In some embodiments, the tested agent can be an antibody, for example, an antibody that binds to CD47, PD-1, CTLA-4, LAG-3, TIM-3, BTLA, PD-L1, 4-1BB, CD27, CD28, CD47, TIGIT, CD27, GITR, or OX40. In some embodiments, the antibody is a human antibody.

The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.

HR knockout animal model with additional genetic modifications

The present disclosure further relates to methods for generating genetically modified animal models described herein with some additional modifications (e.g., human or chimeric genes or additional gene knockout) .

In some embodiments, the animal can comprise a disruption at the endogenous HR gene and a sequence encoding a human or chimeric protein. In some embodiments, the human or chimeric protein can be programmed cell death protein 1 (PD-1) , TNF Receptor Superfamily Member 9 (4-1BB or CD137) , cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , LAG-3, T-cell immunoglobulin and mucin-domain containing-3 (TIM-3) , B And T Lymphocyte Associated (BTLA) , Programmed Cell Death 1 Ligand 1 (PD-L1) , CD27, CD28, CD47, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , Glucocorticoid-Induced TNFR-Related Protein (GITR) , or TNF Receptor Superfamily Member 4 (TNFRSF4; or OX40) .

In some embodiments, the animal can further comprise a disruption (e.g., knockout) at one or more of the following endogenous genes, e.g., IL6, IL15, colony stimulating factor (CSF) , colony stimulating factor 1 (CSF1) , colony stimulating factor 2 (CSF2 or GM-CSF) , colony stimulating factor 3 (CSF3) , signal regulatory protein alpha (SIRPA) , B2M, and KIT proto-oncogene receptor tyrosine kinase (C-KIT) genes. In some embodiments, the animal can comprise a disruption at the endogenous CD132 gene (interleukin-2 receptor subunit gamma) . In some embodiments, the animal can comprise a disruption at some other endogenous genes (e.g., Forkhead Box N1 (Foxn1) ) . In some embodiments, the animal can comprise a disruption at the endogenous B2M gene.

The methods of HR knockout animal model with additional genetic modifications (e.g., humanized genes or additional gene knockout) can include the following steps:

(a) using the methods as described herein to obtain a HR knockout animal;

(b) mating the HR knockout animal with another genetically modified non-human animal with the desired genetic modifications, and then screening the progeny to obtain a HR animal with the desired genetic modifications.

In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric PD-1, CTLA-4, LAG-3, TIM-3, BTLA, PD-L1, 4-1BB, CD27, CD28, CD47, TIGIT, GITR, or OX40, or an animal with NOD-Prkdc ^scid IL-2rγ ^null mutation and/or B2M mutation.

Some of these genetically modified non-human animals are described, e.g., in PCT/CN2017/090320, PCT/CN2017/099577, PCT/CN2017/099575, PCT/CN2017/099576, PCT/CN2017/099574, PCT/CN2017/106024, PCT/CN2018/079365; PCT/CN2019/072406; each of which is incorporated herein by reference in its entirety.

In some embodiments, the HR knockout can be directly performed on a genetically modified animal having a human or chimeric PD-1, CTLA-4, LAG-3, BTLA, TIM-3, PD-L1, 4-1BB, CD27, CD28, CD47, TIGIT, GITR, or OX40 gene, or an animal with NOD-Prkdc ^scid IL-2rγ ^null mutation and/or B2M mutation. In some embodiments, the mouse further has a disruption of B2M gene (e.g., deletion of one or more exons or part of exons selected from the group consisting of exon 1, exon 2, exon 3, or exon 4 of the endogenous B2M gene) .

In some embodiments, the HR knockout can be directly performed on a CD132 knockout mouse or a Foxn1 knockout mouse.

As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The HR knockout animal model, and/or the HR knockout animal model with additional genetic modifications can be used for determining effectiveness of a combination therapy.

In some embodiments, the combination of agents can include one or more agents selected from the group consisting of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel, and capecitabine.

In some embodiments, the combination of agents can include one or more agents selected from the group consisting of campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and methotrexate.

In some embodiments, the combination of agents can include one or more antibodies that bind to CD47, PD-1, CTLA-4, LAG-3, BTLA, TIM-3, PD-L1, 4-1BB, CD27, CD28, CD47, TIGIT, GITR, and/or OX40.

Alternatively or in addition, the methods can also include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor (s) , from the subject.

CD132 knockout non-human animal

Interleukin-2 (IL-2) is a 15.5 kDa type 1 four α-helical bundle cytokine produced primarily by CD4+ T cells following their activation by antigen. IL-2 was the first type 1 cytokine cloned and the first cytokine for which a receptor component was cloned. Three different IL-2 receptor chains exist that together generate low, intermediate, and high affinity IL-2 receptors. The ligand-specific IL-2 receptor α chain (IL-2Rα, CD25, Tac antigen) , which is expressed on activated but not non-activated lymphocytes, binds IL-2 with low affinity (Kd ～ 10 ^-8 M) ; the combination of IL-2Rβ (CD122) and IL-2Rγ (CD132) together form an IL-2Rβ/γc complex mainly on memory T cells and NK cells that binds IL-2 with intermediate affinity (Kd ～ 10 ^-9 M) ; and when all three receptor chains are co-expressed on activated T cells and Treg cells, IL-2 is bound with high affinity (Kd ～ 10 ^-11 M) .

For the high affinity receptor, the three dimensional structure of the quaternary complex supports a model wherein IL-2 initially bind IL-2Rα, then IL-2Rβ is recruited, and finally IL-2Rγ. The intermediate and high affinity receptor forms are functional, transducing IL-2 signals.

CD132 is also an essential component shared by the receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21.

IL-2Rγ is encoded by the gene, IL2RG (CD132) , that is mutated in humans with X-linked severe combined immunodeficiency (XSCID) and physically recruits JAK3, which when mutated also causes an XSCID-like T-B+NK-form of SCID. In XSCID and JAK3-deficient SCID, the lack of signaling by IL-7 and IL-15, respectively, explains the lack of T and NK cell development, whereas defective signaling by IL-4 and IL-21 together explain the non-functional B cells and hypogammaglobulinemia.

A detailed description of CD132 and its function can be found, e.g., in Liao et al. "IL-2 family cytokines: new insights into the complex roles of IL-2 as a broad regulator of T helper cell differentiation, " Current opinion in immunology 23.5 (2011) : 598-604; Noguchi et al. "Interleukin-2 receptor gamma chain: a functional component of the interleukin-7 receptor, " Science 262.5141 (1993) : 1877-1880; Henthorn et al. "IL-2Rγ gene microdeletion demonstrates that canine X-linked severe combined immunodeficiency is a homologue of the human disease, " Genomics 23.1 (1994) : 69-74; and US Patent No. 7145055; each of which is incorporated herein by reference in its entirety.

In human genomes, CD132 gene (Gene ID: 3561) is located on X chromosome, and has eight exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8. The CD132 protein also has an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for human CD132 mRNA is NM_000206.2, and the amino acid sequence for human CD132 is NP_000197.1.

Similarly, in mice, CD132 gene locus has eight exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8. The CD132 protein also has an extracellular region, a transmembrane region, and a cytoplasmic region, and the signal peptide is located at the extracellular region of CD132. The nucleotide sequence for mouse CD132 cDNA is NM_013563.4 (SEQ ID NO: 29) , the amino acid sequence for mouse CD132 is NP_038591.1 (SEQ ID NO: 30) . The location for each exon and each region in the mouse CD132 nucleotide sequence and amino acid sequence is listed below:

Table 2

The mouse CD132 gene (Gene ID: 16186) is located in Chromosome X of the mouse genome, which is located from 101, 268, 255 to 101, 264, 385 of NC_000086.7 (GRCm38. p4 (GCF_000001635.24) ) . The 5’-UTR is from 101, 268, 255 to 101, 268, 170, exon 1 is from 101, 268, 255 to 101, 268, 055, the first intron (intron 1) is from 101, 268, 054 to 101, 267, 865, exon 2 is from 101, 267, 864 to 101, 267, 711, the second intron (intron 2) is from 101, 267, 710 to 101, 267, 496, exon 3 is from 101, 267, 495 to 101, 267, 311, the third intron (intron 3) is from 101, 267, 310 to 101, 267, 121, exon 4 is from 101, 267, 120 to 101, 266, 978, the fourth intron (intron 4) is from 101, 266, 977 to 101, 266, 344, exon 5 is from 101, 266, 343 to 101, 266, 181, the fifth intron (intron 5) is from 101, 266, 180 to 101, 265, 727, exon 6 is from 101, 265, 726 to 101, 265, 630, the sixth intron (intron 6) is from 101, 265, 629 to 101, 265, 443, exon 7 is from 101, 265, 442 to 101, 265, 376, the seventh intron (intron 7) is from 101, 265, 375 to 101, 265, 038, exon 8 is from 101, 265, 037 to 101, 264, 378, and the 3’-UTR is from 101, 264, 851 to 101, 264, 378, based on transcript NM_013563.4. All relevant information for mouse CD132 locus can be found in the NCBI website with Gene ID: 16186, which is incorporated by reference herein in its entirety.

CD132 genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for CD132 in Rattus norvegicus is 140924, the gene ID for CD132 in Macaca mulatta (Rhesus monkey) is 641338, the gene ID for CD132 in Sus scrofa (pig) is 397156. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database.

The present disclosure provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous CD132 gene, wherein the disruption of the endogenous CD132 gene comprises deletion of one or more exons, or part of the one or more exons, wherein the one or more exons are selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 of the endogenous CD132 gene. Thus, the disclosure provides a genetically-modified, non-human animal that does not have one or more exons that are selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 of the endogenous CD132 gene. In some embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides in the exon of CD132 are deleted.

In some embodiments, the disruption comprises deletion of one or more introns, or part of the one or more introns, wherein the one or more introns are selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7 of the endogenous CD132 gene. Thus, the disclosure provides a genetically-modified, non-human animal does not have one or more introns that are selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7 of the endogenous CD132 gene.

In some embodiments, the disruption of the endogenous CD132 gene comprises deletion of exon 2 of the endogenous CD132 gene. In some embodiments, the disruption of the endogenous CD132 gene further comprises deletion of exon 1, or part of exon 1 of the endogenous CD132 gene.

In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 are deleted. In some embodiments, the signal peptide region, extracellular region, transmembrane region, and/or cytoplasmic region of CD132 are deleted.

In some embodiments, a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7, signal peptide region, extracellular region, transmembrane region, and/or cytoplasmic region are deleted.

In some embodiments, the “region” or “portion” can be at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7, signal peptide region, extracellular region, transmembrane region, or cytoplasmic region of CD132. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or exon 8 of CD132 are deleted. In some embodiments, a region, a portion, or the entire sequence of mouse intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and/or intron 7 are deleted.

In some embodiments, the disruption comprises or consists of deletion of more than 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides in exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or exon 8. In some embodiments, the disruption comprises or consists of deletion of more than 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, or 1000 nucleotides in intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and/or intron 7.

In some embodiments, the disruption comprises or consists of deletion of more than 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (e.g., about 150 or 160 nucleotides) in exon 1; deletion of the entirety of intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7; and/or deletion of more than 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides (e.g., about 200, 250 or 270 nucleotides) in exon 8.

In some embodiments, the length of the remaining exon sequences at the endogenous CD132 gene locus is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, or 50%of the total length of all exon sequences of the endogenous CD132 gene. In some embodiments, the length of the remaining exon sequences at the endogenous CD132 gene locus is more than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, or 50%of the total length of all exon sequences of the endogenous CD132 gene.

In some embodiments, the length of the remaining sequences at that the endogenous CD132 gene locus is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, or 50%of the full sequence of the endogenous CD132 gene. In some embodiments, the length of the remaining sequences at that the endogenous CD132 gene locus is more than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, or 50%of the full sequence of the endogenous CD132 gene.

The present disclosure further relates to the genomic DNA sequence of a CD132 knockout mouse. In some embodiments, the genome of the animal comprises from 5’ to 3’ at the endogenous CD132 gene locus, (a) a first DNA sequence; optionally (b) a second DNA sequence comprising an exogenous sequence; (c) a third DNA sequence, wherein the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked.

The second DNA sequence can have a length of 0 nucleotides to 300 nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 nucleotides) . In some embodiments, the second DNA sequence has only 0 nucleotides, which means that there is no extra sequence between the first DNA sequence and the third DNA sequence. In some embodiments, the second DNA sequence has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 nucleotides. In some embodiments, the second DNA sequence has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 nucleotides.

In some embodiments, the first DNA sequence comprises an endogenous CD132 gene sequence that is located upstream of intron 1, and can include all or just part of sequences that is located upstream of intron 1. In some embodiments, the first DNA sequence comprises an endogenous CD132 gene sequence that is located upstream of exon 1. In some embodiments, the first DNA sequence comprises a sequence that has a length (5’ to 3’) of from 10 to 200 nucleotides (e.g., from 10 to 100 nucleotides, or from 10 to 20 nucleotides) starting from the first nucleotide in exon 1 of the CD132 gene to the last nucleotide of the first DNA sequence. In some embodiments, the first DNA sequence comprises at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, or 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides from exon 1. In some embodiments, the first DNA sequence has at most 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, or 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides from exon 1.

In some embodiments, the third DNA sequence comprises an endogenous CD132 gene sequence that is located downstream of the last intron (e.g., intron 7 in mouse) , and can include all or just part of sequences that is located downstream of intron 7. In some embodiments, the third DNA sequence comprises a sequence that has a length (5’ to 3’) of from 200 to 600 nucleotides (e.g., from 300 to 400 nucleotides, or from 350 to 400 nucleotides) starting from the first nucleotide in the third DNA sequence to the last nucleotide in the last exon (e.g., exon 8 in mouse) of the endogenous CD132 gene. In some embodiments, the third DNA sequence comprises at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides from the last exon (e.g., exon 8 in mouse) . In some embodiments, the third DNA sequence has at most 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides from the last exon (e.g., exon 8 in mouse) .

Thus, in one aspect, the disclosure relates to a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous CD132 gene, wherein the disruption of the endogenous CD132 gene comprises deletion of exon 2 of the endogenous CD132 gene.

In some embodiments, the disruption of the endogenous CD132 gene further comprises deletion of exon 1 of the endogenous CD132 gene. In some embodiments, the disruption of the endogenous CD132 gene comprises deletion of part of exon 1 of the endogenous CD132 gene.

In some embodiments, the disruption of the endogenous CD132 gene further comprises deletion of one or more exons or part of exons selected from the group consisting of exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 of the endogenous CD132 gene. In some embodiments, the disruption of the endogenous CD132 gene comprises deletion of exons 1-8 of the endogenous CD132 gene.

In some embodiments, the disruption of the endogenous CD132 gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7 of the endogenous CD132 gene.

In some embodiments, the disruption consists of deletion of more than 150 nucleotides in exon 1; deletion of the entirety of intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7; and deletion of more than 250 nucleotides in exon 8.

In some embodiments, the animal is homozygous with respect to the disruption of the endogenous CD132 gene. In some embodiments, the animal is heterozygous with respect to the disruption of the endogenous CD132 gene.

In some embodiments, the disruption prevents the expression of functional CD132 protein.

In some embodiments, the length of the remaining exon sequences at the endogenous CD132 gene locus is less than 30%of the total length of all exon sequences of the endogenous CD132 gene. In some embodiments, the length of the remaining sequences at that the endogenous CD132 gene locus is less than 15%of the full sequence of the endogenous CD132 gene.

In another aspect, the disclosure relates to a genetically-modified, non-human animal, wherein the genome of the animal does not have exon 2 of CD132 gene at the animal’s endogenous CD132 gene locus.

In some embodiments, the genome of the animal does not have one or more exons or part of exons selected from the group consisting of exon 1, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8. In some embodiments, the genome of the animal does not have one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7.

In one aspect, the disclosure also provides a CD132 knockout non-human animal, wherein the genome of the animal comprises from 5’ to 3’ at the endogenous CD132 gene locus, (a) a first DNA sequence; optionally (b) a second DNA sequence comprising an exogenous sequence; (c) a third DNA sequence, wherein the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked, wherein the first DNA sequence comprises an endogenous CD132 gene sequence that is located upstream of intron 1, the second DNA sequence can have a length of 0 nucleotides to 300 nucleotides, and the third DNA sequence comprises an endogenous CD132 gene sequence that is located downstream of intron 7.

In some embodiments, the first DNA sequence comprises a sequence that has a length (5’ to 3’) of from 10 to 100 nucleotides (e.g., approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 nucleotides) , wherein the length of the sequence refers to the length from the first nucleotide in exon 1 of the CD132 gene to the last nucleotide of the first DNA sequence.

In some embodiments, the first DNA sequence comprises at least 10 nucleotides from exon 1 of the endogenous CD132 gene. In some embodiments, the first DNA sequence has at most 100 nucleotides from exon 1 of the endogenous CD132 gene.

In some embodiments, the third DNA sequence comprises a sequence that has a length (5’ to 3’) of from 200 to 600 nucleotides (e.g., approximately 200, 250, 300, 350, 400, 450, 500, 550, 600 nucleotides) , wherein the length of the sequence refers to the length from the first nucleotide in the third DNA sequence to the last nucleotide in exon 8 of the endogenous CD132 gene.

In some embodiments, the third DNA sequence comprises at least 300 nucleotides from exon 8 of the endogenous CD132 gene. In some embodiments, the third DNA sequence has at most 400 nucleotides from exon 8 of the endogenous CD132 gene.

In some embodiments, the genetic modified non-human animal comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical or 100%identical to the following sequence: aggaaatgtatggtggggagggcttgtgggagagctaagtttcgatttcctgtcccatgtaactgcttttctgttccatatgccctact tgagagtgtcccttgccctctttccctgcacaagccctcccatgcccagcctaacacctttccactttctttgaagagagtcttaccct gtagcccagggtggctgggagctcactatgtaggccaggttggcctccaactcacaggctatcctcccacctctgcctcataaga gttggggttactggcatgcaccaccacacccagcatggtccttctcttttataggattctccctccctttttctacctatgattcaactgt ttccaaatcaacaagaaataaagtttttaaccaatgatca (SEQ ID NO: 31) . In some embodiments, the sequence is located at the endogenous CD132 locus.

In one aspect, the disclosure also relates to a genetically-modified, non-human animal produced by a method comprising knocking out one or more exons of endogenous CD132 gene by using (1) a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in exon 1 of the endogenous CD132 gene or upstream of exon 1 of the endogenous CD132 gene, and (2) a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in exon 8 of the endogenous CD132 gene.

In some embodiments, the nuclease is CRISPR associated protein 9 (Cas9) . In some embodiments, the target sequence is in exon 1 of the endogenous CD132 gene or upstream of exon 1 of the endogenous CD132 gene. In some embodiments, the target sequence is in exon 8 of the endogenous CD132 gene.

In some embodiments, the animal does not express a functional CD132 protein. In some embodiments, the animal does not express a functional interleukin-2 receptor.

In some embodiments, the animal further comprises a disruption in the animal’s endogenous Beta-2-Microglobulin (B2m) gene and/or a disruption in the animal’s endogenous Forkhead Box N1 (Foxn1) gene.

In one aspect, the disclosure is also related to methods of producing a CD132 knockout mouse. The methods involve

(a) transforming a mouse embryonic stem cell with a gene editing system that targets endogenous CD132 gene, thereby producing a transformed embryonic stem cell;

(b) introducing the transformed embryonic stem cell into a mouse blastocyst;

(c) implanting the mouse blastocyst into a pseudopregnant female mouse; and

(d) allowing the blastocyst to undergo fetal development to term, thereby obtaining the CD132 knockout mouse.

In another aspect, the disclosure also provides methods of producing a CD132 knockout mouse. The methods include the steps of

(b) implanting the transformed embryonic cell into a pseudopregnant female mouse; and

(c) allowing the transformed embryonic cell to undergo fetal development to term, thereby obtaining the CD132 knockout mouse.

In some embodiments, the gene editing system comprises a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in exon 1 of the endogenous CD132 gene or upstream of exon 1 of the endogenous CD132 gene, and a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in exon 8 of the endogenous CD132 gene.

In some embodiments, the mouse embryonic stem cell has a Nod/scid background, or a NOD/scid nude background.

In some embodiments, the mouse embryonic stem cell has a genome comprising a disruption in the animal’s endogenous Beta-2-Microglobulin (B2m) gene and/or a disruption in the animal’s endogenous Forkhead Box N1 (Foxn1) gene.

In another aspect, the disclosure relates to methods for establishing a CD132 knockout animal model. The methods include the steps of:

(a) providing the cell with a disruption in the endogenous CD132 gene, and

preferably the cell is a fertilized egg cell;

(b) culturing the cell in a liquid culture medium;

In some embodiments, the establishment of a CD132 knockout animal involves a gene editing technique that is based on CRISPR/Cas9.

In some embodiments, the non-human mammal is mouse. In some embodiments, the non-human mammal in step (c) is a female with false pregnancy.

EXAMPLES

The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

Materials and Methods

The following materials were used in the following examples.

NOD-Prkdc ^scid IL-2rg ^null (B-NDG) mice were obtained from Beijing Biocytogen Co., Ltd (Catalog number: B-CM-002) .

Ambion ^TM in vitro transcription kit was purchased from Ambion, Inc. The catalog number is AM1354.

E. coli TOP10 competent cells were purchased from the Tiangen Biotech (Beijing) Co. The catalog number is CB104-02.

EcoRI, BamHI, and BbsI were purchased from NEB. The catalog numbers are R3101M, R3136M, and R0539L.

Kanamycin was purchased from Amresco. The catalog number is 0408.

Cas9 mRNA was obtained from SIGMA. The catalog number is CAS9MRNA-1EA.

UCA kit was obtained from Beijing Biocytogen Co., Ltd. The catalog number is BCG-DX-001.

pHSG299 plasmids were purchased from Takara. The catalog number is 3299.

EXAMPLE 1: sgRNAs for HR

The target sequence determines the targeting specificity of small guide RNA (sgRNA) and the efficiency of Cas9 cleavage at the target site. Therefore, target sequence selection is important for sgRNA vector construction.

Several sgRNAs were designed for the mouse HR gene (NCBI Gene ID: 15460) . The target sequences for these sgRNAs are shown below:

sgRNA1 target sequence (SEQ ID NO: 1) : 5’-acccgacaggctcgagtcactgg-3’

sgRNA2 target sequence (SEQ ID NO: 2) : 5’-cctggcactgccgtcgggcttgg -3’

sgRNA3 target sequence (SEQ ID NO: 3) : 5’-ccccagagagacgcaagcgaggg-3’

sgRNA4 target sequence (SEQ ID NO: 4) : 5’-cgctgctaactgaagcccggagg-3’

sgRNA5 target sequence (SEQ ID NO: 5) : 5’-ttccctcgcttgcgtctctctgg -3’

sgRNA6 target sequence (SEQ ID NO: 6) : 5’-ggtgccctggcactgccgtcggg-3’

sgRNA7 target sequence (SEQ ID NO: 7) : 5’-cccagtgactcgagcctgtcggg-3’

sgRNA8 target sequence (SEQ ID NO: 8) : 5’-ggtgctagggaccggaacgtagg-3’

sgRNA9 target sequence (SEQ ID NO: 9) : 5’-aaacaggaggacctacgttccgg-3’

sgRNA10 target sequence (SEQ ID NO: 10) : 5’-gcaatgtttaagtcgagccaggg-3’

sgRNA11 target sequence (SEQ ID NO: 11) : 5’-gcatgtatgacggtcagatttgg-3’

sgRNA12 target sequence (SEQ ID NO: 12) : 5’-tgcacgtgcacgcatgccctcgg-3’

sgRNA13 target sequence (SEQ ID NO: 13) : 5’-tctacattaacatcgtgaaatgg-3’

sgRNA14 target sequence (SEQ ID NO: 14) : 5’-attcagtccgatccttctcaagg-3’

sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA5, sgRNA6, and sgRNA7 target the 5’-end target site and sgRNA8, sgRNA9, sgRNA10, sgRNA11, sgRNA12, sgRNA13, and sgRNA14 target the 3’-end target site. The target sites for sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA5, sgRNA6, and sgRNA7 are located within intron 2 of the mouse endogenous HR gene (Gene ID: 15460) . The target sites for sgRNA8, sgRNA9, sgRNA10, sgRNA11, sgRNA12, sgRNA13, and sgRNA14 are located within intron 7 of HR (based on the sequence of NM_021877.3→NP_068677.2) .

EXAMPLE 2. sgRNA selection

The UCA kit was used to detect the activities of sgRNAs (FIG. 1 and Table 4) . The results show that the sgRNAs had different activities. Two of them (sgRNA4 and sgRNA10) were selected for further experiments.

Single strand oligonucleotides were synthesized for sgRNA4 and sgRNA10. TAGG was first added to the 5’ end of the upstream sequence of sgRNA4 and sgRNA10 target sequences to obtain a forward oligonucleotide sequence, and AAAC was added to the 5’ end of the complementary strand to obtain a reverse oligonucleotide sequence.

Table 3. Oligonucleotide sequences for sgRNA4 and sgRNA10

Table 4. sgRNA activities

EXAMPLE 3. Construction of pT7-sgRNA G2 vector

pT7-sgRNA G2 vector map is shown in FIG. 2. The DNA fragment containing T7 promoter and sgRNA scaffold was synthesized, and linked to the backbone vector pHSG299 by restriction enzyme digestion (EcoRI and BamHI) and ligation. The plasmid sequences were confirmed by sequencing.

The DNA fragment containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 23) is shown below:

EXAMPLE 4. Construction of pT7-HR-4 and pT7-HR-10 vectors

After annealing the oligonucleotides obtained in Example 2, the product was ligated into the pT7-sgRNA G2 plasmid (the plasmid was first treated by BbsI restriction enzyme) .

Table 5. The ligation reaction conditions (10μL)

Double stranded fragment	1μL (0.5μM)
pT7-sgRNA G2 vector	1μL (10 ng)
T4 DNA Ligase	1μL (5U)
10×T4 DNA Ligase buffer	1μL
50%PEG4000	1μL
H ₂O	Add to 10μL

The ligation reaction was carried out at room temperature for 10 to 30 minutes. The ligation product was then transferred to 30 μL of TOP10 competent cells. The cells were then plated on a petri dish with Kanamycin, and then cultured at 37 ℃ for at least 12 hours and then two clones were selected and added to LB medium with Kanamycin (5 ml) , and then cultured at 37 ℃ at 250 rpm for at least 12 hours.

Clones were randomly selected and sequenced to verify their sequences. The pT7-HR-4 and pT7-HR-10 vectors with correct sequences were selected for subsequent experiments.

EXAMPLE 5. Microinjection and embryo transfer

The pre-mixed Cas9 mRNA, in vitro transcription products of pT7-HR-4 and pT7-HR-10 plasmids were injected into the cytoplasm or nucleus of B-NDG mouse fertilized eggs with a microinjection instrument (using Ambion in vitro transcription kit to carry out the transcription according to the method provided in the product instruction) . The embryo microinjection was carried out according to the method described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003. The injected fertilized eggs were then transferred to a culture medium to culture for a short time and then was transplanted into the oviduct of the recipient mouse to produce the genetically modified mice (F0 generation) . The mouse population was further expanded by cross-mating and self-mating to establish stable mouse lines.

EXAMPLE 6. Genotype verification

1. Genotype identification for F0 generation mice

In order to confirm the genotype of the F0-generation Hr gene knockout heterozygous mouse, genomic DNA was extracted from the tail of the F0 generation mice obtained in Example 5. PCR was performed with the primer MSD-F (SEQ ID NO: 24) and MSD-R (SEQ ID NO: 25) . MSD-F is located on the left of the sgRNA4 target site. MSD-R is located on the right of the sgRNA10 target site. The length of PCR amplification products in the wildtype (WT) mice should be about 7859 bp. In the knockout mice, the length of the PCR amplification products should be about 610 bp. The sequence for the primers are shown below:

MSD-F (SEQ ID NO: 24) : 5’-gctcacgtacatccatccctcttgg -3’

MSD-R (SEQ ID NO: 25) : 5’-tagaattcttgtttttggaacgcaga -3’

The PCR reaction conditions are shown in the tables below. The results are shown in FIG. 3.

Table 6. The PCR reaction system (20 μL)

2× PCR buffer	10 μL
dNTP (2 mM)	4 μL
Upstream primer (10μM)	0.6μL
Downstream primer (10μM)	0.6μL
Mouse tail genomic DNA	100ng
KOD-FX (1U/μL)	0.4μL
H ₂O	Add to 20μL

Table 7. The PCR reaction conditions

Sequencing was performed on the PCR amplification products of the mice that were tested positive. The sequencing results for F0 generation mice (Table 8) confirmed that several Hr knockout mice were obtained by the method described herein, and they had different mutations.

Table 8. Genotype verification for F0 generation mice

Label	Sex	Results
F0-1	M	△7258
F0-4	M	△7252
F0-18	M	△7253
F0-21	M	in15△7248
F0-28	M	△7257
F0-35	F	△7265
F0-37	F	in1△7254

F0-38	F	in4△7263
F0-41	F	△7252

△ indicates knockout, e.g., △7258 indicates a deletion of 7258bp, and △7252 indicates a deletion of 7252bp. In indicates random insertion, e.g., in15 indicates a random insertion of 15bp of nucleotides and in1 a random insertion of 1bp of nucleotide. In F0-28, a sequence of 7257 nucleotides (SEQ ID NO: 33) at the endogens HR locus is deleted. The mouse has a sequence that is identical to SEQ ID NO: 28 at the endogens HR locus. In F0-18, a sequence of 7253 nucleotides (SEQ ID NO: 34) at the endogens HR locus is deleted. The mouse has a sequence that is identical to SEQ ID NO: 35 at the endogens HR locus.

2. Genotype identification for F1 generation mice

F0 generation mice were then mated with B-NDG mice to obtain F1 generation mice. Both F0-18 and F0-28 were mated with wild-type B-NDG mice, and their offspring were tested. Gene identification showed that a total of six F1 generation mice were positive. The PCR results were shown in FIGS. 4 and 5. The mice labeled with F1-2, F1-3 and F1-7 were F0-18 offspring. The mice labeled with F1-10, F1-11, F1-12 were offspring of F0-28. The six mice were further sequenced and verified, and the sequencing results are shown in Table 9. The results indicate that the method can be used to make a Hr knockout mouse.

Table 9. Genotype identification for F1 generation mice

These F1 generation mice were mated with each other. Homozygous F2 generation mice having a hairless phenotype were identified. The results are shown in FIG. 6. In contrast, FIG. 7 shows B-NDG mice that have wildtype Hr genes.

EXAMPLE 8. Construction of Human Immune System in Immunodeficient Mice

In the mice obtained by the methods as described herein, a human immune system was constructed by engraftment with human peripheral blood cells (hPBMC) .

Three immunodeficient HR knockout mice were selected and 5 x 10 ⁶ human peripheral blood cells (hPBMCs) were injected into the tail vein of each mouse. Blood was taken 24 days later for flow cytometry analysis. The flow cytometry results showed that cells expressing human leukocyte surface molecular markers (human CD45) were detected in all three mice.

The results show that human peripheral blood cells engraftment on these mice can create a humanized mouse model with the human immune system. Furthermore, human tumor cells were injected into these mice (FIG. 8) . These mice can be used to screen new drugs, and test drug efficacy.

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

A genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous HR lysine demethylase and nuclear receptor corepressor (HR) gene, wherein the disruption of the endogenous HR gene comprises deletion of one or more exons of the endogenous HR gene.
The animal of claim 1, wherein the disruption of the endogenous HR gene comprises deletion of one or more exons selected from exon 3, exon 4, exon 5, exon 6, and exon 7 of the endogenous HR gene.
The animal of claim 1, wherein the disruption of the endogenous HR gene comprises deletion of exon 3, exon 4, exon 5, exon 6, and exon 7 of the endogenous HR gene.
The animal of any one of claims 1-3, wherein the disruption of the endogenous HR gene further comprises deletion of one or more exons or part of exons selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, and exon 20 of the endogenous HR gene.
The animal of any one of claims 1-4, wherein the disruption of the endogenous HR gene comprises deletion of one or more introns of the endogenous HR gene.
The animal of any one of claims 1-5, wherein the disruption of the endogenous HR gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, and intron 19 of the endogenous HR gene.
The animal of any one of claims 1-6, wherein the disruption consists of

deletion of at least 10 nucleotides in intron 2,

deletion of the entirety of exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, and exon 7; and

deletion of at least 10 nucleotides in intron 7.
The animal of any one of claims 1-7, wherein the animal is homozygous with respect to the disruption of the endogenous HR gene.
The animal of any one of claims 1-7, wherein the animal is heterozygous with respect to the disruption of the endogenous HR gene.
The animal of any one of claims 1-9, wherein the disruption prevents the expression of functional HR protein.
The animal of any one of claims 1-10, wherein the length of the remaining exon sequences at the endogenous HR gene locus is less than 70%of the total length of all exon sequences of the endogenous HR gene.
The animal of any one of claims 1-10, wherein the length of the remaining sequences at that the endogenous HR gene locus is less than 65%of the full sequence of the endogenous HR gene.
A genetically-modified, non-human animal, wherein the genome of the animal does not have one or more exons of HR gene at the animal’s endogenous HR gene locus.
The animal of claim 13, wherein the genome of the animal does not have one or more exons or part of exons selected from the group consisting of exon 3, exon 4, exon 5, exon 6, and exon 7.
The animal of claim 13, wherein the genome of the animal does not have one or more introns or part of introns selected from the group consisting of intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7.
A HR knockout non-human animal, wherein the genome of the animal comprises from 5’ to 3’ at the endogenous HR gene locus, (a) a first DNA sequence; optionally (b) a second DNA sequence comprising an exogenous sequence; (c) a third DNA sequence, wherein the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked,

wherein the first DNA sequence comprises an endogenous HR gene sequence that is located upstream of intron 2,

the second DNA sequence can have a length of 0 nucleotides to 100 nucleotides, and the third DNA sequence comprises an endogenous HR gene sequence that is located downstream of intron 7.
The animal of claim 16, wherein the first DNA sequence comprises a sequence that has a length (5’ to 3’) of from 10 to 1500 nucleotides, wherein the length of the sequence refers to the length from the first nucleotide in exon 1 of the HR gene to the last nucleotide of the first DNA sequence.
The animal of claim 16 or 17, wherein the first DNA sequence comprises at least 10 nucleotides from intron 2 of the endogenous HR gene.
The animal of any one of claims 16-18, wherein the first DNA sequence comprise exon 1 and exon 2 of the endogenous HR gene.
The animal of any one of claims 16-19, wherein the third DNA sequence comprises a sequence that has a length (5’ to 3’) of from 10 to 11000 nucleotides, wherein the length of the sequence refers to the length from the first nucleotide in the third DNA sequence to the last nucleotide in the last exon of the endogenous HR gene.
The animal of any one of claims 16-20, wherein the third DNA sequence comprises at least 10 nucleotides from intron 7 of the endogenous HR gene.
The animal of any one of claims 16-19, wherein the third DNA sequence comprises exons 8-20, and introns 8-19.
A genetically-modified, non-human animal produced by a method comprising knocking out one or more exons of endogenous HR gene by using (1) a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in intron 2 of the endogenous HR gene, and (2) a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in intron 7 of the endogenous HR gene.
The animal of claim 23, wherein the nuclease is CRISPR associated protein 9 (Cas9) .
The animal of claim 23, wherein the target sequence in intron 2 of the endogenous HR gene is set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7, and the target sequence in intron 7 of the endogenous HR gene is set forth in SEQ ID NO: 8, 9, 10, 11, 12, 13, or 14.
The animal of claim 23, wherein the first nuclease comprises a sgRNA that targets SEQ ID NO: 4 and the second nuclease comprises a sgRNA that targets SEQ ID NO: 10.
The animal of any one of claims 1-26, wherein the animal does not express a functional HR protein.
The animal of any one of claims 1-27, wherein the animal does not express a functional interleukin-2 receptor.
The animal of any one of claims 1-28, wherein the animal has one or more of the following characteristics:

(a) the percentage of T cells (CD3+ cells) is less than 5%, 2%, 1.5%, 1%, 0.7%, or 0.5%of leukocytes in the animal;

(b) the percentage of B cells (e.g., CD3-CD19+ cells) is less than 1%, 0.1%or 0.05%of leukocytes in the animal;

(c) the percentage of NK cells (e.g., CD3-CD49b+ cells) is less than 5%, 2%or 1.5%of leukocytes in the animal;

(d) the percentage of CD4+ T cells is less than 1%, 0.5%, 0.3%, or 0.1%of T cells;

(e) the percentage of CD8+ T cells is less than 1%, 0.5%, 0.3%, or 0.1%of T cells;

(f) the percentage of CD3+ CD4+ cells, CD3+ CD8+ cells, CD3-CD19+ cells is less than 5%, 1%or 0.5%of leukocytes in the animal;

(g) the percentage of T cells, B cells, and NK cells is less than 5%, 4%, 3%, 2%or 1%of leukocytes in the animal.
The animal of any one of claims 1-28, wherein the animal after being engrafted with human hematopoietic stem cells to develop a human immune system has one or more of the following characteristics:

(a) the percentage of human CD45+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes of the animal;

(b) the percentage of human CD3+ cells about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes in the animal;

(c) the percentage of human CD19+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes in the animal.
The animal of any one of claims 1-28, wherein the animal does not have hair.
The animal of any one of claims 1-28, wherein the animal has one or more of the following characteristics:

(a) the animal has no functional T-cells and/or no functional B-cells;

(b) the animal exhibits reduced macrophage function relative to a NOD/scid mouse;

(c) the animal exhibits no NK cell activity;

(d) the animal exhibits reduced dendritic function relative to a NOD/scid mouse; and

(e) the animal does not have xenogeneic GVHD.
The animal of any one of claims 1-32, wherein the animal is a mammal, e.g., a monkey, a rodent, a rat, or a mouse.
The animal of any one of claims 1-32, wherein the animal is a C57 mouse, a C57BL mouse, a BALB/c mouse, a NOD/scid mouse, or a NOD/scid nude mouse, or a NOD-Prkdc ^scid IL-2rγ ^null mouse.
The animal of any one of claims 1-34, wherein the animal further comprises a sequence encoding a human or chimeric protein.
The animal of claim 35, wherein the human or chimeric protein is programmed cell death protein 1 (PD-1) , PD-L1, IL3, IL6, IL15, CSF1, or CSF2.
The animal of any one of claims 1-36, wherein the animal further comprises a disruption in the animal’s endogenous Beta-2-Microglobulin (B2M) gene.
A method of determining effectiveness of an agent or a combination of agents for the treatment of cancer, comprising:

engrafting tumor cells to the animal of any one of claims 1-37, thereby forming one or more tumors in the animal;

administering the agent or the combination of agents to the animal; and

determining the inhibitory effects on the tumors.
The method of claim 38, wherein before engrafting the tumor cells to the animal, human peripheral blood cells (hPBMC) or human hematopoietic stem cells are injected to the animal.
The method of claim 38, wherein the tumor cells are from cancer cell lines.
The method of claim 38, wherein the tumor cells are from a tumor sample obtained from a human patient.
The method of claim 38, wherein the inhibitory effects are determined by measuring the tumor volume in the animal.
The method of claim 38, wherein the tumor cells are melanoma cells, lung cancer cells, primary lung carcinoma cells, non-small cell lung carcinoma (NSCLC) cells, small cell lung cancer (SCLC) cells, primary gastric carcinoma cells, bladder cancer cells, breast cancer cells, and/or prostate cancer cells.
The method of claim 38, wherein the agent is an anti-PD-1 antibody.
The method of claim 38, wherein the agent is an anti-PD-L1 antibody.
The method of claim 38, wherein the combination of agents comprises one or more agents selected from the group consisting of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel, and capecitabine.
A method of producing an animal comprising a human hemato-lymphoid system, the method comprising:

engrafting a population of cells comprising human hematopoietic cells or human peripheral blood cells into the animal of any one of claims 1-37.
The method of claim 47, wherein the human hemato-lymphoid system comprises human cells selected from the group consisting of hematopoietic stem cells, myeloid precursor cells, myeloid cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, lymphocytes, and platelets.
The method of claim 47, further comprising: irradiating the animal prior to the engrafting.
A method of producing a HR knockout mouse, the method comprising the steps of:

(a) transforming a mouse embryonic stem cell or a fertilized egg with a gene editing system that targets endogenous HR gene, thereby producing a transformed embryonic stem cell;

(b) introducing the transformed embryonic stem cell or the fertilized egg into a mouse blastocyst;

(c) implanting the mouse blastocyst into a pseudopregnant female mouse; and

(d) allowing the blastocyst to undergo fetal development to term, thereby obtaining the HR knockout mouse.
A method of producing a HR knockout mouse, the method comprising the steps of:

(a) transforming a mouse embryonic stem cell or a fertilized egg with a gene editing system that targets endogenous HR gene, thereby producing a transformed embryonic stem cell;

(b) implanting the transformed embryonic cell or the fertilized egg into a pseudopregnant female mouse; and

(c) allowing the transformed embryonic cell to undergo fetal development to term, thereby obtaining the HR knockout mouse.
The method of claim 50 or claim 51, wherein the gene editing system comprises a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in intron 2 of the endogenous HR gene, and a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in intron 7 of the endogenous HR gene.
The method of claim 52, wherein the nuclease is CRISPR associated protein 9 (Cas9) .
The method of claim 52, wherein the target sequence in intron 2 of the endogenous HR gene is set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7, and the target sequence in intron 7 of the endogenous HR gene is set forth in SEQ ID NO: 8, 9, 10, 11, 12, 13, or 14.
The method of claim 52, wherein the mouse embryonic stem cell or the fertilized egg has a C57 background, a C57BL background, a BALB/c background, a NOD/scid background, a NOD/scid nude, or a NOD-Prkdc ^scid IL-2rγ ^null background.
The method of claim 52, wherein the mouse embryonic stem cell or the fertilized egg comprises a sequence encoding a human or chimeric protein.
The method of claim 56, wherein the human or chimeric protein is PD-1 or CD137.
The method of claim 52, wherein the mouse embryonic stem cell or the fertilized egg has a genome comprising a disruption in the animal’s endogenous B2M gene.