WO1999027093A2 - Famille nip3 de proteines - Google Patents

Famille nip3 de proteines Download PDF

Info

Publication number
WO1999027093A2
WO1999027093A2 PCT/IB1998/001959 IB9801959W WO9927093A2 WO 1999027093 A2 WO1999027093 A2 WO 1999027093A2 IB 9801959 W IB9801959 W IB 9801959W WO 9927093 A2 WO9927093 A2 WO 9927093A2
Authority
WO
WIPO (PCT)
Prior art keywords
nip3
cells
nix
bcl
cell
Prior art date
Application number
PCT/IB1998/001959
Other languages
English (en)
Other versions
WO1999027093A3 (fr
Inventor
Arnold H. Greenberg
Original Assignee
University Of Manitoba
Manitoba Cancer Treatment & Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Manitoba, Manitoba Cancer Treatment & Research Foundation filed Critical University Of Manitoba
Priority to AU12559/99A priority Critical patent/AU1255999A/en
Priority to CA002311170A priority patent/CA2311170A1/fr
Priority to EP98955851A priority patent/EP1034263A1/fr
Publication of WO1999027093A2 publication Critical patent/WO1999027093A2/fr
Publication of WO1999027093A3 publication Critical patent/WO1999027093A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention is in the field of gene therapy to induce program cell death in tumorogenic cells.
  • bcl-2 is the best understood gene in a cell death pathway and functions as a cell death repressor.
  • Apoptosis is a term used to refer to the process (es) of programmed cell death and has been described in several cell types (Waring et al . (1991) ed. Res. Rev. 11: 219; Williams G.T. (1991) Cell 65: 1097; Williams G.T. (1992) Trends Cell Biol. 2: 263; Yonisch-Rouach et al . (1991) Nature 352: 345) .
  • Apoptosis is likely involved in controlling the amount of and distribution of certain differentiated cell types, such as lymphocytes and other cells of the hematopoietic lineage.
  • the mechanism (s) by which apoptosis is produced in cells is incompletely understood, as are the regulatory pathways by which the induction of apoptosis occurs.
  • Apoptosis was first described as a morphologic pattern of cell death characterized by cell shrinkage, membrane blebbing and chromatin condensation culminating in cell fragmentation (Kerr et al . , 1992).
  • One hallmark pattern early in the process of cell death is internucleosomal DNA cleavage (Wyllie, 1980) .
  • the death-sparing effects of interrupting RNA and protein synthesis and the stereotyped patterns of cell death during development were consistent with a cell autonomous genetic program for cell death (Wyllie et al . (1980) Int. Rev. Cytol . 68: 251; Sulston, J. and Horvitz, H. (1977) Develop. Biol. 56: 110; Abrams et al.
  • This pattern of morphologic cell death is characterized by a dramatic plasma membrane blebbing, cell volume contraction, nuclear pyknosis, and internucleosomal DNA degradation following the activation of an endonuclease.
  • Over expression of mitochondrial bcl-2 appears to function as an antidote to this process and has the unique function of blocking programmed cell death independent of promoting proliferation.
  • the maintenance of homeostasis in normal tissue in many respects, reflects a simple balanced equation of input (cellular proliferation and renewal) versus output (cell death) . This is most easily envisioned for encapsulated organs, such as the prostate, but is also true of the recirculating hematopoietic lineages.
  • Programmed cell death represents a cell autonomous suicide pathway that helps restrict cell numbers. The well-defined loss of specific cells is crucial during embryonic development as part of organogenesis . In the mature tissues, genetically programmed demise regulates the volume of cells. A morphologically distinct and temporally regulated cell death entitled apoptosis has been identified by Wyllie A. H. : “Apoptosis: Cell death in tissue regulation”. J. Pathol 153: 313, 1987. Cells dying by apoptosis display marked plasma membrane blebbing, volume contraction, nuclear condensation, and the activation of an endonuclease that cleaves DNA into nucleosomal length fragments.
  • the genetic regulation of cell death is thought to be a central mechanism of cellular homeostasis and development (White, 1996; Chinnaiyan and Dixit, 1996; Jacobson et al . , 1997; Nagata, S. 1997).
  • the Bcl-2 family of genes (White, 1996; Oltvai, et al . , 1994), which are related to ced-9 of C. elegans (Hengartner, et al . , 1994), were originally identified as repressors of cell death. It is known that both pro- and anti-apoptotic Bcl-2 homologs exist, however their exact biochemical function has not been determined.
  • Ced-9 and Bcl-2/Bcl-X L may physically interact with proteins that are required for the execution of apoptosis, Ced-3 and Ced-4 (Chinnaiyan, et al., 1997; Wu, et al . , 1997; Spector, et al . , 1997), however these proteins have not been isolated and purified.
  • Ced-3 is a protease which in mammals is represented by a large family of cysteine proteases which cleave after aspartic acid, now called caspases (Nagata, 1997; Martin, et al . , 1995).
  • Bcl-2 family members bear C-terminal transmembrane domains that allow their association with the outer mitochondrial membrane (Krajewski, et al . , 1993) and this mitochondrial localization is important for the suppressive function of Bcl-2 (Tanaka, et al . , 1993; Zhu, et al . , 1996) .
  • the protein encoded by the bcl-2 proto- oncogene has been reported to be capable of inhibiting apoptosis in many hematopoietic cell systems.
  • the proto- oncogene bcl-2 was isolated and characterized as a result of its frequent translocation adjacent to the immunoglobulin heavy chain enhancer in the t(14;18) chromosome translocation present in more than 80% of human follicular lymphomas (Chen-Levy et al . (1989) Mol. Cell. Biol. 9: 701; Clearly et al . (1986) Cell 47: 19).
  • neoplasias are characterized by an accumulation of mature resting B cells presumed to result from a block of apoptosis which would normally cause turnover of these cells.
  • Transgenic mice expressing bcl-2 under the control of the E ⁇ enhancer similarly develop follicular lymphomas which have a high incidence of developing into malignant lymphomas (Hockenbery et al . (1990) Nature 348: 334; McDonnell T.J. and Korsmeyer S.J. (1991) Nature 349: 254; Strasser et al . (1991) Cell 67: 889).
  • the capacity of bcl-2 to enhance cell survival is related to its ability to inhibit apoptosis initiated by several factors, such as cytokine deprivation, radiation exposure, glucocorticoid treatment, and administration of anti-CD-3 antibody (Nunez et al . (1990) op.cit; Hockenbery et al. (1990) op.cit; Vaux et al . (1988) op.cit; Alnemri et al. (1992) Cancer Res. 52: 491; Sentman et al . (1991) Cell 67: 879; Strasser et al . (1991) op.cit).
  • Upregulation of bcl-2 expression also inhibits apoptosis of EBV-infected B- cell lines (Henderson et al . (1991) Cell 65: 1107).
  • the expression of bcl-2 has also been shown to block apoptosis resulting from expression of the positive cell growth regulatory proto-oncogene, c-myc, in the absence of serum or growth factors (Wagner et al . (1993) Mol. Cell. Biol. 13: 2432).
  • the precise mechanism(s) by which bcl- 2 is able to inhibit apoptosis is not yet fully defined.
  • bcl-2 proto-oncogene is rather unique among cellular genes in its ability to block apoptotic deaths in multiple contexts (Korsmeyer, S. (1992) Blood 80: 879). Overexpression of bcl-2 in transgenic models leads to accumulation of cells due to evasion of normal cell death mechanisms (McDonnell et al . (1989) Cell 57: 79). Induction of apoptosis by diverse stimuli, such as radiation, hyperthermia, growth factor withdrawal, glucocorticoids and multiple classes of chemotherapeutic agents is inhibited by bcl-2 in vitro models (Vaux et al .
  • bcl-2 expression is highly suggestive of a role in the regulation of cell survival in vivo (Hockenbery et al . (1991) Proc. Natl. Acad. Sci. USA 88: 6961; LeBrun et al - (1993) Am. J. Pathol. 142: 743).
  • the bcl-2 protein seems likely to function as an antagonist of a central mechanism operative in cell death. Additionally, it would be beneficial to identify genes which could be generally utilized to induce programmed cell death.
  • bcl-2 cell death pathway While identifying the bcl-2 cell death pathway is significant, a way of regulating the bcl-2 pathway has not been discovered.
  • the ability to down-regulate the effect of bcl-2 would be advantageous in cancer therapy, in controlling hyperplasias such as benign prostatic hypertrophy (BPH) and eliminating self reactive clones in autoimmunity by favoring death effector molecules.
  • BPH benign prostatic hypertrophy
  • Up- regulating the effect of bcl-2 and favoring death repressor molecules would be beneficial in the treatment and diagnosis of immunodeficiency diseases, including AIDs, and in neurodegenerative and ischemic cell death.
  • neoplasia is characterized by a clonally derived cell population which has a diminished capacity for responding to normal cell proliferation control signals.
  • Oncogenic transformation of cells leads to a number of changes in cellular metabolism, physiology, and morphology.
  • One characteristic alteration of oncogenically transformed cells is a loss of responsiveness to constraints on cell proliferation and differentiation normally imposed by the appropriate expression of cell growth regulator genes.
  • Neurodegenerative diseases e.g., amyotrophic lateral sclerosis
  • HIV-1 pathogenesis have been associated with free radial formation and toxicity, and apoptotic events may be involved in their disease etiologies (Meyaard et al . (1992) Science 257: 217).
  • bcl-2 renders the cell highly resistant to various chemical and physical agents.
  • bcl-2 renders cancer cells more resistant to chemotherapeutic agents.
  • various cellular and viral gene products have been identified that share a similar structure or activity with bcl-2.
  • bcl-2 Despite the similarity of bcl-2 to these bcl-2-related proteins, however, no structural feature of the bcl-2 protein has been identified that lends a clue to its mechanism of regulating apoptosis.
  • agents which can modify the activity (ies) of the bcl-2 protein so as to modulate cell proliferation, differentiation, and/or apoptosis for therapeutic or prophylactic benefit can serve as commercial research reagents for control of cell proliferation, differentiation, and/or apoptosis in experimental applications, and/or for controlled proliferation and differentiation of predetermined hematopoietic stem cell or neuronal cell populations in vitro, in ex vivo therapy, or in vivo . It would therefore be useful to develop a treatment of cancers which is based on susceptibility of tumor cell lines to the induction of programmed cell death caused by transfection of the Nip, Nix and Nox proteins.
  • an isolated and purified Nip, Nix and Nox proteins there is also provided a method for inducing apoptosis in cells by transfecting a cell with a Nip, Nix and Nox proteins. Additionally, there is provided a method for inducing apoptosis in cells by creating antibodies which recognize a specific Nip, Nix and Nox proteins in a muscle or skin of a patient. A method for inducing apoptosis in cells by creating transgenes overexpressing the genes for the Nip, Nix and Nox proteins is also provided. A transgenic animal and progeny thereof is provided having an expression factor consisting essentially of a Nip, Nix and Nox proteins selected from the group consisting essentially of Seq. ID No : 1 through 6.
  • Figure IA depicts the Nip3 mRNA of 1535 bp with the open reading frame boxed with the predicted protein of 194 amino acids, the putative transmembrane domain between amino acids 164 and 184 of Nip3 protein is shaded, also a mutant lacking the transmembrane sequence was constructed by truncation at amino acid 163 and is called Nip3 163 ;
  • FIG. 2A shows an in vi tro Nip3 is expressed as a homodimer, after in vi tro transcription and translation of Nip3 the 35S-labelled protein was separated on SDS-PAGE (lanes 1 and 2) under reducing (R, lane 1) and nonreducing (NR, lane 2) conditions, Nip3 runs as two bands at 60 and 30 kD; Nip3 163 is a truncated mutant in which the terminal 31 amino acids from 164 to 194 containing the putative transmembrane domain have been removed (lanes 3 and 4) and the truncated Nip3163 is expressed as a major band at 29 kD and a minor band at 28 kD under both reducing (lane 3) and nonreducing (lane 4) conditions;
  • Figure 2B shows a comparative peptide mapping of in vi tro translated 35S-labeled 60-kD Nip3 and 28-kD Nip3163 protein; After in vi tro translation, Nip3 and Nip3163 were immunoprecipitated, the 60- and 28-kD bands recovered after SDS-PAGE then trypsin digested, the resulting peptides were separated on the same plate by electrophoresis at pH 1.9
  • Nip3 and Nip3163 are marked by arrows, three
  • [35S] methionine-labeled peptides predicted from the trypsin digest are circled and labeled A, B, and C (Nip3) and A9 , B9, and C9 (Nip3163 ); Peptide A and A9 , amino acids 1-45; B and B9, amino acids 140-146; C and C9, 147-152; All three peptides are represented in both Nip3 and Nip3163, minor spots are similar in the two proteins and likely are partially digested fragments;
  • Figure 2C shows Nip3 homodimerization as identified by the yeast two-hybrid system;
  • Plasmids encoding full- length Nip3 and the COOH-terminal truncated mutant Nip3163 fused to the GAL4 DNA-binding domain were cotransformed with plasmids encoding Nip3 , Nip3163 or empty vector sequences fused to the GAL4 transcriptional activation domain;
  • Protein-protein interactions were determined by growth of yeast in the absence of leucine, tryptophan and histidine;
  • Growth in the absence of leucine and tryptophan is shown as a control, the results are representative of 3 independent experiments;
  • Figure 3 shows the subcellular localization of Nip3 and Nip3163;
  • Rat-1 cells were transfected with HA-Nip3 and stained with anti-HA antibody using FITC
  • A the mitochondrial protein marker anti-HSP60 antibody using Cy3
  • B the stained images were combined to compare the staining pattern of both proteins
  • C and their coincidence is indicated by the conversion of green FITC and red Cy3 stain to yellow throughout the cell cytoplasm, HA-Nip3163 was expressed in Rat-1 cells then stained with anti-HA antibody;
  • D or anti-HSP60 antibody;
  • E and shown as a combined image using antibodies;
  • F as described above;
  • FIG. 4A shows that overexpression of Nip3 but not Nip3163 induces apoptosis
  • Rat-1 or MCF-7 (left) cells were transfected with T7-tagged Nip3 then at different times cells harvested and stained with anti-T7 antibody and FITC anti-mouse IgG antibody to identify cells expressing Nip3 , the frequency of apoptotic cells was quantitated by Hoechst dye staining;
  • Rat-1 cells (right) were then transfected and apoptotic cells expressing (filled circles) and not expressing (hollow circles) Nip3 were quantitated.
  • Rat-1 cells expressing (filled triangles) or not expressing (hollow triangles) Nip3163 were analyzed in the same manner, at least 200 cells were counted in each sample; All assays were repeated three to seven times with identical results;
  • Figure 4B shows a Western blot of Rat-1 cells transfected with T7-Nip3 (left) or T7-Nip3163 (right) , cells were harvested at the times indicated and Western blots developed with anti-T7 antibody;
  • Nip3 sensitizes Rat-1 cells to drug-induced apoptosis; Rat-1 cells were transfected withT7-tagged Nip3 then 12 h later treated with increasing amounts of etoposide, camptothecin or granzyme B and perforin, cells expressing Nip3 were identified by anti-T7 antibody and the nucleus stained with Hoechst dye, apoptotic cells expressing Nip3 (Nip3 1) or cells not expressing Nip3 (Nip3 2) were enumerated; Figure 6 shows that Nip3 overcomes Bcl-2 suppression of apoptosis; (A) (Left) Rat-1 and Rat-l/Bcl-2 cells were transfected with T7-Nip3 and at in-creasing time the cells were harvested and Nip3 -expressing apoptotic cells quantitated as described in Figure 4; (Right) The Rat-1 and Rat-l/Bcl-2 cells were treated with granzyme B as shown at a constant
  • Figure 7A shows the alignment of predicted murine and human Nip3 and Nix proteins; regions of identity with hNix are shaded, Human Nix and murine Nix are 97% identical, hNip3 and mNip3 are 56 and 53% identical to hNix; The predicted transmembrane domains of aligned hNix and mNix from amino acids 196 to 216 are underlined;
  • Figure 7B shows a Northern blot analysis of murine and human and Nix;
  • Human erythroleukemia cells (HEL) (lane 2) and mouse kidney tissue (lane 4) reveal a major 4.5 kb and minor 1.4 kb transcript (arrows);
  • Corresponding ethidium bromide stained total RNA (lanes 1,3) are shown adjacent to the respective Northern blot;
  • Figure 8A depicts an in vi tro transcription and translation of Nix and Nip3 ; 35 S-labelled mNix (lanes 1,2), hNix (lanes 3,4), and mNip3 (lanes 5,6) were electrophoresed on Tris- Tricine SDS PAGE under reducing (R) (Lanes 2,4,6) and non reducing (NR) (lanes 1,3,5) conditions as described herein; Figure 8B shows the mNix expression in vivo; Rat-1 cells were transfected with C-terminally T7-tagged mNix (left) then lysates electrophoresed in Tris-Tricine buffer (see Methods) and Western blotted with anti-T7 antibody; Rat-1 cells treated with the proteasome inhibitor lactacystin were transfected with mNix-T7 in parallel (right) ;
  • Figure 9(A,B) depicts subcellular localization of Nix and the mitochondrial matrix protein HSP60; MCF-7 cells transiently transfected with mNix-T7 were stained with mouse monoclonal anti-T7 antibody and FITC-labeled rabbit anti-mouse IgG (left) and rabbit anti-HSP60 antibody followed by Cy3-conjugated donkey anti-rabbit IgG antibody
  • Hoechst dye (right) , note the condensed chromatin in the nucleus in the mNix expressing cells (arrows) ;
  • Figure 10 shows the time course of induction of apoptosis following mNix-T7 (A) or hNip3 (B) transient transfection of MCF-7 (l,D) and Rat-1 ( ⁇ ,0) cells, each tumor cell was transfected in three independent experiments and apoptotic cells quantitated at the times indicated by counting the percentage of apoptotic nuclear morphology by Hoechst staining of Nix or Nip3 expressing cells; Cells transfected with mNix or hNip3 ( ⁇ , • ) were identified by immunofluorescent staining of anti-T7 antibody, Apoptosis of non-transfected cells ( ,O) was also enumerated; (C)
  • B Transfection of mNix into two cell lines TX5 and TX22 overexpressing Bcl-X L compared to the parental 10T1/2 cell line TC, at different times following transfection, Nix expressing cells (TC-Nix, TX22-Nix, TX5-Nix) undergoing apoptosis were quantitated as described above, cells not expressing Nix (TC-Con, TX22- Con, TX5-Con) were also counted for apoptotic morphology;
  • C Apoptosis of the TC, TX5 and TX22 cells lines following staurosporine treatment at the doses indicated for 5 hours, experiments were repeated three times and the mean and SE are shown;
  • D Western blot of Bcl-X L (arrow) in cell lines TC,
  • the present invention provides a method of producing purified Nip, Nix and Nox proteins, Seq. ID No : 1 through 6, and functional analogs thereof. Also, provided is a method of inducing apoptosis in cells by transfecting a cell with a Nip, Nix and Nox proteins. A detailed description of the isolation protocols and its properties are set forth in the Experimental Section.
  • an analog will generally be at least 70% homologous over any portion that is functionally relevant. In more preferred embodiments the homology will be at least 80% and can approach 95% homology to the Nip, Nix and Nox proteins.
  • the amino acid sequence of an analog may differ from that of the Nip, Nix and Nox proteins when at least one residue is deleted, inserted or substituted. Differences in glycosylation can provide analogs.
  • the molecular weight of the Nip, Nix and Nox proteins can vary between the analog and the present invention due to carbohydrate differences.
  • transfection it is meant infection by viral nucleic acid.
  • transfection it is meant infection by viral nucleic acid.
  • Cloning techniques are provided by the present invention. In general, recombinant Nip, Nix and Nox proteins are superior to the native lysosomal enzymes for these applications.
  • Immunoassays are also provided by the present invention.
  • ELISAs are the preferred immunoassays employed to assess a specimen. Both polyclonal and moloclonal antibodies can be used in the assays. The specific assay to be used can be determined by one skilled in the art.
  • Antibody production is provided by the present invention.
  • Antibodies may be prepared against the immunogen, or any portion thereof, for example a synthetic peptide based on the sequence. As stated above, antibodies are used in assays and are therefore used in determining if the appropriate enzyme has been isolated. Antibodies can also be used for removing enzymes from red cell suspensions after enzymatic conversion. Immunogens can be used to produce antibodies by standard antibody production technology well known to those skilled in the art as described generally in Harlow and Lane, Antibodies : A Labora tory Manual , Cold Springs Harbor Laboratory, Cold Spring Harbor, NY, 1988 and Borrebaeck, Antibody Engineering - A Practical Guide, W.H. Freeman and Co., 1992.
  • Antibody fragments may also be prepared from the antibodies and include Fab, F(ab') 2 , and Fv by methods known to those skilled in the art.
  • Nip3 (Nineteen kDa interacting £rotein-3) is an ElB 19K and Bcl-2 binding protein of unknown function.
  • the adenovirus ElB 19K protein is functionally similar to Bcl-2 as a survival factor (White, 1996) .
  • a two hybrid screen of proteins that interact with ElB 19K in the yeast Saccharomyces cerevisiae identified several unique cDNAs named Nipl, Nip2 and Nip3 (Boyd, et al . , 1994).
  • Nip3 is detected as both a 60 kDa and 30 kDa protein in vivo and in vi tro and exhibits strong homologous interaction in a yeast two-hybrid system indicating that it can homodimerize .
  • Nip3 is expressed in mitochondria and a mutant (Nip3 163 ) lacking the putative transmembrane domain and C-terminus does not dimerize or localize to mitochondria.
  • Nip3 Transient transfection of epitope-tagged Nip3 in Rat-1 fibroblasts and MCF-7 breast carcinoma induces apoptosis within 12 hours while cells transfected with the Nip3 163 mutant have a normal phenotype, suggesting that mitochondrial localization is necessary for induction of cell death.
  • Nip3 overexpression increases the sensitivity to apoptosis induced by granzyme B and topoisomerase I and II inhibitors. Following transfection, both Nip3 and Nip3 163 protein levels decrease steadily over 48 hours indicating that the protein is rapidly degraded and this occurs in the absence of cell death.
  • Bcl-2 overexpression initially delays the onset of apoptosis induced by Nip3 but the resistance is completely overcome in longer periods of incubation.
  • Nip3 protein levels are much higher and persist longer in Bcl-2 expressing cells.
  • Nip3 is an apoptosis-inducing dimeric mitochondrial protein that can overcome Bcl-2 suppression.
  • Nix is a homolog of the ElB 19K/Bcl-2 binding and pro- apoptotic protein Nip3 and is isolated using the same method described for the Nip3 protein.
  • Human and murine Nix have a 56% and 53% amino acid identity to human and murine Nip3 , respectively.
  • Nix encodes a 23.8 kD protein but it is expressed as a 48 kD protein suggesting that it homodimerizes similar to Nip3.
  • the carboxy terminus of Nix, including a transmembrane domain, is highly homologous to Nip3 but it bears a longer and distinct asparagine/proline rich N-terminus.
  • Nix colocalizes with the mitochondrial matrix protein HSP60 and removal of the extreme carboxy terminus including the putative transmembrane domain (TM) results in general cytoplasmic and nuclear expression. Comparisons of the Nip3 , Nix, and Nox proteins are shown in Figures 12 A and B. Further, when transiently expressed, Nix rapidly activates apoptosis and can overcome the apoptosis suppressors Bcl-2 and Bcl-X L although very high levels of Bcl-X L expression will inhibit apoptosis. Removal of the Nix TM domain ( ⁇ TM) had no effect on its ability to induce apoptosis unlike Nip3 ⁇ TM, which is inactive. Following transfection, Nix protein undergoes progressive proteolysis to a 11 kD C-terminal fragment, which is blocked by the proteasome inhibitor lactacystin.
  • the proteins can deliver an apoptotic signal to cancer cells or other cells that one wishes targeted for elimination. It can be delivered ex vivo (bone marrow), by direct intratumoral delivery or via a targeting vector in vivo. Delivery by viral vector or possibly raw DNA, or by small peptides (or molecular derivatives) based on the protein structure can also be done.
  • Nip3 mutant The anti-apoptotic action of the Nip3 mutant (s) can be used for tissue (eg. bone marrow) protection during chemotherapy or immunotherapy .
  • Ischemic diseases eg. myocardial infraction, stroke
  • Nip3 It can be used in organ or tissue transplantations where implanted tissues can be first treated with the gene to prevent subsequent immune attack.
  • Nip3 was originally described by its ability to physically interact with a protein from adenovirus called
  • ElB 19K which is an apoptosis inhibitor similar to Bcl-2.
  • Nip3 is induced in cells as a consequence of virus infection and this is the mechanism by which some viruses kill cells. Accordingly, the inhibitory protein can also have a potential in control of virally induced cell death.
  • Nip3 family genes Another use for the Nip3 family genes is to enhance adenovirus based cell death mechanisms which can be used as anti-tumor therapy.
  • the antibodies recognize a gene product (protein) in muscle and skin of mice and humans .
  • Nip3 is expressed in skin and muscle.
  • the Nix and Nox EST sequences were identified in fetal cDNA libraries and the protein can also be important for fetal development .
  • Transgenics overexpressing the genes are made according to techniques generally known in the art, as well as making mice deficient in the gene expression by homologous recombination (knockout) or by dominant negative transgenes. These mice are models of disease and/or of developmental abnormalities.
  • transgenics are constructed using standard methods known in the art and as set forth in United States Patents 5,487,992, 5,464,764, 5,387,742, 5,360,735, 5,347,075, 5,298,422, 5,288,846, 5,221,778, 5,175,385, 5,175,384,5,175,383, 4,736,866 as well as Burke and Olson (1991) , Capecchi (1989) , Davies et al. (1992), Dickinson et al . (1993), Duff and Lincoln (1995), Huxley et al . (1991), Jakobovits et al . (1993), Lamb et al . (1993), Pearson and Choi (1993), Rothstein (1991), Schedl et al . (1993), Strauss et al . (1993). Further, patent applications WO 94/23049, WO 93/14200, WO 94/06908, WO 94/28123 also provide information.
  • ELISAs are the preferred immunoassays employed to assess a specimen.
  • ELISA assays are well known to those skilled in the art. Both polyclonal and monoclonal antibodies can be used in the assays. Where appropriate other immunoassays, such as radioimmunoassays
  • Antibodies may be either monoclonal, polyclonal or recombinant. Conveniently, the antibodies may be prepared against the immunogen or portion thereof for example a synthetic peptide based on the sequence, or prepared recombinantly by cloning techniques or the natural gene product and/or portions thereof may be isolated and used as the immunogen. Immunogens can be used to produce antibodies by standard antibody production technology well known to those skilled in the art as described generally in Harlow and Lane, Antibodies : A Labora tory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988 and Borrebaeck, Antibody Engineering - A Practical Guide, W.H. Freeman and Co., 1992. Antibody fragments may also be prepared from the antibodies and include Fab, F(ab') 2 , and Fv by methods known to those skilled in the art.
  • polyclonal antibodies For producing polyclonal antibodies a host, such as a rabbit or goat, is immunized with the immunogen or immunogen fragment, generally with an adjuvant and, if necessary, coupled to a carrier; antibodies to the immunogen are collected from the sera. Further, the polyclonal antibody can be absorbed such that it is monospecific . That is, the sera can be absorbed against related immunogens so that no cross-reactive antibodies remain in the sera rendering it monospecific .
  • the technique involves hyperimmunization of an appropriate donor with the immunogen, generally a mouse, and isolation of splenic antibody producing cells. These cells are fused to a cell having immortality, such as a myeloma cell, to provide a fused cell hybrid which has immortality and secretes the required antibody. The cells are then cultured, in bulk, and the monoclonal antibodies harvested from the culture media for use .
  • a cell having immortality such as a myeloma cell
  • monoclonal antibodies harvested from the culture media for use .
  • messenger RNAs from antibody producing B- lymphocytes of animals, or hybridoma are reverse- transcribed to obtain complimentary DNAs (CDNAs) .
  • Antibody cDNA which can be full or partial length, is amplified and cloned into a phage or a plasmid.
  • the cDNA can be a partial length of heavy and light chain cDNA, separated or connected by a linker.
  • the antibody, or antibody fragment is expressed using a suitable expression system to obtain recombinant antibody.
  • Antibody cDNA can also be obtained by screening pertinent expression libraries.
  • the antibody can be bound to a solid support substrate or conjugated with a detectable moiety or be both bound and conjugated as is well known in the art.
  • a solid support substrate for a general discussion of conjugation of fluorescent or enzymatic moieties see Johnstone & Thorpe, I muno chemistry in Practice, Blackwell Scientific Publications, Oxford, 1982.
  • the binding of antibodies to a solid support substrate is also well known in the art. (see for a general discussion Harlow & Lane Antibodies : A Labora tory Manual , Cold Spring Harbor Laboratory Publications, New York, 1988 and Borrebaeck, Anti-body Engineering - A Practical Guide, W.H.
  • the detectable moieties contemplated with the present invention can include, but are not limited to, fluorescent, metallic, enzymatic and radioactive markers such as biotin, gold, ferritin, alkaline phosphatase, ⁇ -galactosidase, peroxidase, urease, fluorescein, rhodamine, tritium, 14 C and iodination.
  • fluorescent, metallic, enzymatic and radioactive markers such as biotin, gold, ferritin, alkaline phosphatase, ⁇ -galactosidase, peroxidase, urease, fluorescein, rhodamine, tritium, 14 C and iodination.
  • the present invention provides for transgenic gene and polymorphic gene animal and cellular (cell lines) models as well as for knockout models.
  • crene therapy For crene therapy:
  • gene therapy refers to the transfer of genetic material (e.g DNA or RNA) of interest into a host to treat or prevent a genetic or acquired disease or condition phenotype .
  • the genetic material of interest encodes a product (e.g. a protein, polypeptide, peptide or functional RNA) whose production in vivo is desired.
  • the genetic material of interest can encode a hormone, receptor, enzyme, polypeptide or peptide of therapeutic value.
  • ex vivo and (2) in vivo gene therapy Two basic approaches to gene therapy have evolved: (1) ex vivo and (2) in vivo gene therapy.
  • ex vivo gene therapy cells are removed from a patient, and while being cultured are treated in vi tro .
  • a functional replacement gene is introduced into the cell via an appropriate gene delivery vehicle/method (transfection, transduction, homologous recombination, etc.) and an expression system as needed and then the modified cells are expanded in culture and returned to the host/patient.
  • These genetically reimplanted cells have been shown to produce the transfected gene product in si tu .
  • target cells are not removed from the subject rather the gene to be transferred is introduced into the cells of the recipient organism in si tu, that is within the recipient.
  • the gene is repaired in si tu [Culver, 1998] .
  • These genetically altered cells have been shown to produce the transfected gene product in si tu .
  • the gene expression vehicle is capable of delivery/transfer of heterologous nucleic acid into a host cell.
  • the expression vehicle may include elements to control targeting, expression and transcription of the nucleic acid in a cell selective manner as is known in the art. It should be noted that often the 5'UTR and/or 3'UTR of the gene may be replaced by the 5'UTR and/or 3'UTR of the expression vehicle. Therefore as used herein the expression vehicle may, as needed, not include the 5'UTR and/or 3'UTR shown in SEQ ID No : 1 and only include the specific amino acid coding region.
  • the expression vehicle can include a promotor for controlling transcription of the heterologous material and can be either a constitutive or inducible promotor to allow selective transcription. Enhancers that may be required to obtain necessary transcription levels can optionally be included. Enhancers are generally any non-translated DNA sequence which works contiguously with the coding sequence (in cis) to change the basal transcription level dictated by the promoter.
  • the expression vehicle can also include a selection gene as described herein below.
  • Vectors can be introduced into cells or tissues by any one of a variety of known methods within the art . Such methods can be found generally described in Sambrook et al . , Molecular Cloning: A Laboratory Manual , Cold Springs Harbor Laboratory, New York (1989, 1992) , in Ausubel et al . , Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989), Chang et al . , Soma tic Gene Therapy, CRC Press, Ann Arbor, MI (1995), Vega et al .
  • nucleic acids by infection offers several advantages over the other listed methods. Higher efficiency can be obtained due to their infectious nature. Moreover, viruses are very specialized and typically infect and propagate in specific cell types. Thus, their natural specificity can be used to target the vectors to specific cell types in vivo or within a tissue or mixed culture of cells. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through receptor mediated events.
  • DNA viral vector for introducing and expressing recombinant sequences is the adenovirus derived vector Adenop53TK.
  • This vector expresses a herpes virus thymidine kinase (TK) gene for either positive or negative selection and an expression cassette for desired recombinant sequences.
  • TK herpes virus thymidine kinase
  • This vector can be used to infect cells that have an adenovirus receptor which includes most cancers of epithelial origin as well as others.
  • This vector as well as others that exhibit similar desired functions can be used to treat a mixed population of cells and can include, for example, an in vi tro or ex vivo culture of cells, a tissue or a human subject.
  • Additional features can be added to the vector to ensure its safety and/or enhance its therapeutic efficacy.
  • Such features include, for example, markers that can be used to negatively select against cells infected with the recombinant virus.
  • An example of such a negative selection marker is the TK gene described above that confers sensitivity to the antibiotic gancyclovir. Negative selection is therefore a means by which infection can be controlled because it provides inducible suicide through the addition of antibiotic. Such protection ensures that if, for example, mutations arise that produce altered forms of the viral vector or recombinant sequence, cellular transformation will not occur.
  • Features that limit expression to particular cell types can also be included. Such features include, for example, promoter and regulatory elements that are specific for the desired cell type.
  • recombinant viral vectors are useful for in vivo expression of a desired nucleic acid because they offer advantages such as lateral infection and targeting specificity.
  • Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles.
  • Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
  • viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types.
  • the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
  • the vector to be used in the methods of the invention will depend on desired cell type to be targeted and will be known to those skilled in the art.
  • a vector specific for such epithelial cells would be used.
  • a viral vector that is specific for blood cells and their precursors, preferably for the specific type of hematopoietic cell would be used.
  • Retroviral vectors can be constructed to function either as infectious particles or to undergo only a single initial round of infection. In the former case, the genome of the virus is modified so that it maintains all the necessary genes, regulatory sequences and packaging signals to synthesize new viral proteins and RNA. Once these molecules are synthesized, the host cell packages the RNA into new viral particles which are capable of undergoing further rounds of infection.
  • the vector's genome is also engineered to encode and express the desired recombinant gene.
  • the vector genome is usually mutated to destroy the viral packaging signal that is required to encapsulate the RNA into viral particles. Without such a signal, any particles that are formed will not contain a genome and therefore cannot proceed through subsequent rounds of infection.
  • the specific type of vector will depend upon the intended application.
  • the actual vectors are also known and readily available within the art or can be constructed by one skilled in the art using well-known methodology.
  • the recomnbinant vector can be administered in several ways. If viral vectors are used, for example, the procedure can take advantage of their target specificity and consequently, do not have to be administered locally at the diseased site.
  • administration can also be performed by, for example, intravenous or subcutaneous injection into the subject.
  • Injection of the viral vectors into a spinal fluid can also be used as a mode of administration, especially in the case of neuro-degenerative diseases.
  • the viral vectors will circulate until they recognize host cells with the appropriate target specificity for infection.
  • An alternate mode of administration can be by direct inoculation locally at the site of the disease or pathological condition or by inoculation into the vascular system supplying the site with nutrients or into the spinal fluid.
  • Local administration is advantageous because there is no dilution effect and, therefore, a smaller dose is required to achieve expression in a majority of the targeted cells. Additionally, local inoculation can alleviate the targeting requirement required with other forms of administration since a vector can be used that infects all cells in the inoculated area. If expression is desired in only a specific subset of cells within the inoculated area, then promoter and regulatory elements that are specific for the desired subset can be used to accomplish this goal.
  • non-targe ing vectors can be, for example, viral vectors, viral genome, plasmids, phagemids and the like.
  • Transfection vehicles such as liposomes can also be used to introduce the non-viral vectors described above into recipient cells within the inoculated area. Such transfection vehicles are known by one skilled within the art. Delivery of gene products/therapeutics (compound) :
  • the compound of the present invention is administered and dosed in accordance with good medical practice, taking into account the clinical condition of the individual patient, the site and method of administration, scheduling of administration, patient age, sex, body weight and other factors known to medical practitioners.
  • the pharmaceutically "effective amount" for purposes herein is thus determined by such considerations as are known in the art. The amount must be effective to achieve improvement including but not limited to improved survival rate or more rapid recovery, or improvement or elimination of symptoms and other indicators as are selected as appropriate measures by those skilled in the art.
  • the compound of the present invention can be administered in various ways. It should be noted that it can be administered as the compound or as pharmaceutically acceptable salt and can be administered alone or as an active ingredient in combination with pharmaceutically acceptable carriers, diluents, adjuvants and vehicles.
  • the compounds can be administered orally, subcutaneously or parenterally including intravenous, intraarterial, intramuscular, intraperitoneally, and intranasal administration as well as intrathecal and infusion techniques. Implants of the compounds are also useful.
  • the patient being treated is a warm-blooded animal and, in particular, mammals including man.
  • the pharmaceutically acceptable carriers, diluents, adjuvants and vehicles as well as implant carriers generally refer to inert, non-toxic solid or liquid fillers, diluents or encapsulating material not reacting with the active ingredients of the invention.
  • the doses may be single doses or multiple doses over a period of several days, but single doses are preferred.
  • the doses may be single doses or multiple doses over a period of several days.
  • the treatment generally has a length proportional to the length of the disease process and drug effectiveness and the patient species being treated.
  • the pharmaceutical formulations suitable for injection include sterile aqueous solutions or dispersions and sterile powders for reconstitution into sterile injectable solutions or dispersions.
  • the carrier can be a solvent or dispersing medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Nonaqueous vehicles such as cottonseed oil, sesame oil, olive oil, soybean oil, corn oil, sunflower oil, or peanut oil and esters, such as isopropyl myristate, may also be used as solvent systems for compound compositions. Additionally, various additives which enhance the stability, sterility, and isotonicity of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added.
  • antibacterial and antifungal agents for example, parabens, chlorobutanol , phenol, sorbic acid, and the like.
  • isotonic agents for example, sugars, sodium chloride, and the like.
  • Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the compounds .
  • Sterile injectable solutions can be prepared by incorporating the compounds utilized in practicing the present invention in the required amount of the appropriate solvent with various of the other ingredients, as desired.
  • a pharmacological formulation of the present invention can be administered to the patient in an injectable formulation containing any compatible carrier, such as various vehicle, adjuvants, additives, and diluents; or the compounds utilized in the present invention can be administered parenterally to the patient in the form of slow-release subcutaneous implants or targeted delivery systems such as monoclonal antibodies, vectored delivery, iontophoretic, polymer matrices, liposomes, and microspheres .
  • any compatible carrier such as various vehicle, adjuvants, additives, and diluents
  • the compounds utilized in the present invention can be administered parenterally to the patient in the form of slow-release subcutaneous implants or targeted delivery systems such as monoclonal antibodies, vectored delivery, iontophoretic, polymer matrices, liposomes, and microspheres .
  • Examples of delivery systems useful in the present invention include: 5,225,182; 5,169,383; 5,167,616; 4,959,217; 4,925,678; 4,487,603; 4,486,194; 4,447,233; 4,447,224; 4,439,196; and 4,475,196. Many other such implants, delivery systems, and modules are well known to those skilled in the art.
  • a pharmacological formulation of the compound utilized in the present invention can be administered orally to the patient.
  • Conventional methods such as administering the compounds in tablets, suspensions, solutions, emulsions, capsules, powders, syrups and the like are usable.
  • Known techniques which deliver it orally or intravenously and retain the biological activity are preferred.
  • the compound of the present invention can be administered initially by intravenous injection to bring blood levels to a suitable level.
  • the patient ' s levels are then maintained by an oral dosage form, although other forms of administration, dependent upon the patient's condition and as indicated above, can be used.
  • the quantity to be administered will vary for the patient being treated and will vary from about 100 ng/kg of body weight to 100 mg/kg of body weight per day and preferably will be from 10 ⁇ g/kg to 10 mg/kg per day.
  • Rat-1, Rat-l/Bcl-2 and MCF-7 cells used in this study were cultured in ⁇ -minimal essential medium ( -MEM) (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Gibco) .
  • Murine monoclonal anti-HA 12CA5 and anti-T7 antibody were purchased by Boehringer Mannheim (Laval, Quebec) and Novagen (Madison, WI) , respectively.
  • Rabbit anti-HSP60 antibody was donated by Dr. Radhey Gupta (McMaster University, Hamilton, Ont . ) .
  • FITC-conjugated goat anti-rabbit IgG (FITC) (Sigma Chemical Co.) and Cy-3 conjugated goat anti-mouse IgG (BioCan Ltd. , Mississauga) were used for fluorescence studies. Cloning and construction of expression plasmids.
  • Nip3 cDNA Following isolation of a Nip3 cDNA, RACE is used to identify both 3' and 5' ends using a premade human brain marathon-ready cDNA according to the manufacturer's instructions (Clontech, Palo Alto, CA) .
  • the Nip3 3' RACE was done using primer 5' CAGCGTTCCAGCCTCGGTTTCT 3' while the 5' RACE was done using three different primers 5' CAAAGGTGCTGGTGGAGGT 3' , 5' TGTGGTGTCTGCGAGCGAGGT 3' , and S' TCCAGCAGTATTTTTTCCA 3' .
  • the appropriate RACE products were TA cloned (Invitrogen, San Diego, CA) and several of the resulting clones were analysed to obtain the described Nip3 sequence .
  • Kpnl and EcoRI sites were introduced to the 5' and 3 ' end of the Nip3 cDNA encoding only the open reading frame by PCR amplification and its sequence was confirmed by the T7 sequencing Kit (Pharmacia) , the inserted in frame into the Kpni/BamHI sites of plasmid pKM1310 containing the 5' HA-tag.
  • the recombinant cDNA 5'HA-Nip3 was then isolated by EcoRI digestion and blunt end ligated into the plasmid pKG86 creating the plasmid pKG5HA-Nip3 under the control of SP6 promoter which was used for in vi tro transcription/translation of 5 'HA-tagged Nip3 proteins.
  • the plasmid pKG5HA-Nip3 163 was generated by PCR and constructed as described above.
  • the Hindlll site was introduced at the 5' end of HA-Nip3 cDNA by PCR amplification then cloning into the Hindlll/EcoRI sites.
  • the Hindlll/Kpnl fragment containing the HA-tag was inserted into the Hindlll/Kpnl sites of pcDNA3 vector making the pcD-5HA vector for cloning the 5'HA-tagged Nip3 cDNA and its mutants.
  • the cDNA fragments were isolated by KpnI/EcoRI digestion of pKG5HA-Nip3 and pKG5HA-Nip3 163 respectively, then inserted into KpnI/EcoRI sites of pcD-5HA vector, making pcD5HA-Nip3 and pcD5HA- Nip3 163 .
  • a cDNA fragment encoding the T7 epitope was inserted into the EcoRI/XhoI sites of pcDNA3 plasmid.
  • the 3' T7-tagged Nip3 and Nip3 163 open reading frame were cloned into this vector as described above. These recombinant plasmids were used for in vi tro translation and transient transfection into the mammalian cells.
  • plasmids encoding Nip3 and Nip3 163 with suitable restriction sites were generated by PCR then ligated in-frame in the GAL4 binding-domain of pASl or pGBT9 and GAL4 transcriptional activating domain of pACTII.
  • the nucleotide sequence of all constructs was confirmed on an ABI 310 Genetic Analyzer (Applied Biosystems, Foster City, CA) .
  • the pASl or pGBT9 and pACTII constructs were co-transformed into the yeast strain KGY37 and colonies selected on SC medium lacking leucine and tryptophan.
  • Protein-protein interactions were determined by growth on SC medium lacking leucine, tryptophan and histidine in the presence of ImM 3 -amino-1, 2 , 4-triazole (3AT) .
  • the relative ⁇ -galactosidase activity was measured using both the filter lift (X-Gal) and ONGP methods according to manufacturers instructions.
  • In Vitro translation 3S S-labeled Nip3 protein and mutants were prepared by in vi tro transcription and translation of cDNA cloned in pcD-3HA vector using TnT coupled Reticulocyte Lysate System
  • Nip3 and Nip3 163 proteins were immunoprecipitated using mouse monoclonal anti-Nip3 antibody.
  • the proteins were then recovered from unfixed dried SDS-polyacrylamide gels by homogenizing the gel slices then precipitated with trichloroacetic acid and oxidized with performic acid as described previously (Boyle, et al . , 1991).
  • the oxidized proteins were then resuspended in 25 mis of 50 mM NH 4 HC0 3 and digested overnight at 37°C with 10 mg TPCK-treated trypsin. An additional 5 mg of trypsin was then added, and digestion continued for at least another four hr.
  • Rat-1 cells, Rat-l/Bcl-2 or MCF-7 cells were transfected with Nip3 and mutants in the expression plasmid pcD-3HA using LipofectAMINE Reagent (Gibco, Gaithersburg, MD) .
  • Cells (3-8 x 10 5 ) were plated onto 100 x 20 mm tissue culture dishes (Nunc, Roskilde, Denmark) in 12 ml of complete medium 24 hrs . before transfection.
  • the DNA- LipofectAMINE mixture was allowed to incubate in a tissue culture incubator for three hr for Rat-1 or five hours for MCF-7 cells.
  • RNA Isolation and Northern Hybridization Analysis were grown on cover slips, transfected with HA-Nip3 then fixed with 4% formaldehyde in PBS. Cell were double stained with mouse monoclonal anti-HA antibody 12CA5 and anti-HSP60 antibody and visualized with FITC-conjugated goat anti-mouse IgG secondary antibody and Cy3-conjugated goat anti-rabbit antibody. Fluorescence was visualized using a Zeiss Axiophot microscope equipped with a cooled CCD camera driven by IPLabs Spectrum H-SU2 (version 3.0, Signal Analytics) and Multiprobe 1.1 E (Signal Analytics) software . RNA Isolation and Northern Hybridization Analysis
  • RNA from mice tissues was kindly provided by Dr. Robert Shiu (University of Manitoba) .
  • Northern blot analysis 30 ⁇ g of total RNA was hybridized with nick- translated Nip3 probe (1-5 X 10 8 cpm ⁇ g DNA) at 42°C for 16- 20 hrs . Following hybridization and washing blots were exposed to Kodak XAR film at -70°C with an intensify screen.
  • Nip3 cDNAs were isolated from a human EBV transformed peripheral B lymphocyte library (Clonetech) by PCR and RACE of both 5' and 3' ends, and identified the longest as a 1535 bp sequence (see Genebank accession number Bankltll2877 AF002697 for complete sequence) . This is similar to the cDNA identified earlier (Boyd, et al,
  • RNA has a long 3' UTR and shorter 5' UTR, and the encoded protein contains 194 amino acids and has a predicted molecular weight of about 21.54 kD with a pi of 6.08 (Expasy Tools).
  • Nip3 mRNA is expressed in human breast carcinoma MCF-7 as a major transcript of about 1.7 kb and two minor transcripts of 1.5 and 1.3 kb.
  • the level of Nip3 mRNA in mouse tissues was also examined to determine how widely the gene is expressed. Two transcripts of 2.5 and 1.7 kb were identified with the 1.7 kb transcript found in all tissues examined and the larger transcript only certain tissues such as brain, heart, kidney, liver and submaxillary gland
  • Nip3 protein is expressed as a di er and monomer
  • Nip3 35 S-methionine labelled Nip3 were prepared by in vi tro transcription and translation and examined the protein on SDS-PAGE. Nip3 was seen as a major band at approximately 60 kD and a small band of 30 kD (figure 2A) . Nip3 has a predicted molecular weight of about 21.54 kD, much smaller than the size of the two bands estimated from SDS-PAGE, indicating that the protein runs anomalously. The two bands were seen under both reducing and non-reducing conditions. However, when the C-terminus from amino acid 163 was removed (Nip3 163 ) ( Figure IA) , the large molecular weight form was absent and a major band of 28 kD and a minor band of 27 kD were detected.
  • the 30 kD protein is a Nip3 monomer while the 60 kD protein is a dimer that was formed by interaction at the C- terminus of the protein.
  • tryptic peptide fragments of the 60 kDa Nip3 were compared to the 28 kDa Nip3 163 .
  • 35 S-methionine-labelled Nip3 and Nip3 163 were purified by immunoprecipitation with mouse monoclonal antibody to Nip3 and SDS PAGE. Tryptic peptides were prepared and fragments separated by 2D electrophoresis and chromatography and detected by radioautography as described in Materials and Methods.
  • FIG. 2B illustrates that the two proteins have three major 35 S-methionine-labelled peptides and their positions are very similar following 2D mapping. No other major peptides are detected in the 60 kDa Nip3 band. Minor proteins are also similar and likely represent partially digested Nip3.
  • Nip3 was next examined in the yeast two hybrid system by inserting the Nip3 cDNA in either the GAL4 binding and activating domains which were then simultaneously expressed in yeast cells (KGY37) .
  • Nip3 interaction was compared to Nip3 interaction with non specific protein controls. A strongly positive interaction was found with Nip3 in both vectors indicating that the protein was capable of binding to itself (Table 1) . In contract, the Nip3 163 was unable to interact with Nip3 or with itself
  • Nip3 163 protein levels decreased very rapidly with time despite the inability of the mutant to induce apoptosis, thus indicating that the loss of protein in the cell lysates was not released to the death of cells .
  • Rat-1 cells were transiently transfected with T7-Nip3 for 12 hours then treated with increasing doses of the cytotoxic lymphocyte protease granzyme B, or the topoisomerase I and II inhibitors etoposide or camptothecin. The 12 hour transfection was chosen because of minimal effects of Nip3 on cell survival at this time. Apoptotic cells were then quantitated by Hoechst dye in cells either expressing or not expressing T7-Nip3 protein within the same samples, using immunofluorescence staining by anti-T7 antibody to detect Nip3.
  • Nip3 overcomes Bcl-2 suppression of apoptosis
  • Nip3 was identified as a pro-apoptotic protein that localizes to mitochondria. Nip3 protein is unusual in several respects. It migrates on SDS-PAGE at a molecular weight that is much higher than the 21.54 kD predicted by the primary amino acid sequence and appears in vivo following transfection and in vi tro after transcription and translation as 60 kD and 30 kD proteins. The 60 kD band does not dissociate after reduction or reduction and alkylation, nor after treatment with 6M urea (G. Chen and A.H. Greenberg, unpublished data) . Thus Nip3 appears to interact with a second protein very strongly and the evidence favors homodimerization .
  • Nip3 not only influences dimer formation but also directs its expression to mitochondria.
  • Nip3 163 does not interact with Nip3 or form a homodimer in vi tro so it likely does not homodimerize with endogenous Nip3 in vivo .
  • Nip3 protein expression progressively decreases over time, which may reflect the increasing death of Nip3 expressing cells. Partial Bcl-2 suppression of Nip-3 induced apoptosis and a significant increase in Nip3 protein levels suggests that at least part of the Nip3 is lost by cell death. However, a progressive decrease in protein levels was also observed with the Nip3 163 mutant which does not induce apoptosis, therefore another mechanism is affecting protein turnover. Nip3 contains PEST sequences suggesting that the protein may be susceptible to rapid degradation by other proteases. PEST sequences commonly contain high local concentrations of amino acids P,E,S,T and D flanked by charged amino acids
  • Nip3 The posttranslational control of Nip3 expression through rapid protein degradation may constitute a mechanism for regulating the intercellular levels of a potentially lethal protein.
  • Nip3 was originally identified as an ElB 19K interacting protein, but the structure of Nip3 does not closely resemble other death agonists of the Bcl-2 family.
  • Bcl-2 family agonists such as Bax act by heterodimerizing with anti-apoptotic family members and mutations in BH1 and BH2 domains in Bcl-2 or Bcl-X L result in loss of binding and anti-apoptotic activity (Yin, et al . , 1995; Cheng, et al . , 1996) .
  • pro- and anti- apoptotic Bcl-2 family members can act independently (Cheng, et al .
  • Nip3 does not contain either a BH1 or BH2 domain, although it may have a BH3 domain in which leucine 110 , aspartic acid 115 and isoleucine 117 are conserved based on the critical amino acids of the BH3 domain of BAK that determines BAK-Bcl-X L heterodimerization (Sattler, et al . , 1997).
  • Other BH3 domain-only Bcl-2 family members that are death agonists have been described such as Bik-Nbk (Boyd, et al . , 1995; Han, et al .
  • Bik and Hrk have putative transmembrane domains while Bid is a cytoplasmic factor that is hypothesized to be recruited to membrane associated Bcl-2 or Bax.
  • Nip3 is a death factor of the Bcl-2 family related to Bik/Nbk, Bid or Hrk.
  • Bcl-2 family members are integral membrane proteins that bear carboxy terminal regions that allow localization to the mitochondrial outer membrane, nuclear envelope and endoplasmic reticulum (Zhu, et al . , 1996; Hockenbery, et al . , 1990; Akao, et al . , 1994). Localization of Bcl-2 to mitochondria also appears to be important in its suppression of cell death as mutants lacking the transmembrane domain are ineffective when overexpressed (Tanaka, et al . , 1993; Nguyen, et al . , 1994).
  • Nip3 share the ability to localize to mitochondria and recent work suggests that mitochondria may play an important role in the regulation of apoptosis. They are necessary for the apoptotic activity of cytosolic extracts of Xenopus laevis oocytes (Newmeyer, et al . , 1994), and can initiate nuclear destruction when taken from cells undergoing apoptosis in in vi tro reconstituted cell systems (Zamzami, et al . , 1996). Nip3 localization in mitochondria places it in a position to influence mitochondrial function early in the apoptotic response.
  • Nip3 can overcome Bcl-2 suppression of apoptosis so it might act on Bcl-2 or other anti-apoptotic family members that regulate mitochondrial permeability transition pores (Zamzami, et al . , 1996; Marchetti, et al . , 1996) or cytochrome c release (Liu, et al., 1996; Yang, et al . , 1997; Kluck, et al . , 1997).
  • Nip3 preferentially forms homodimers even under reducing conditions and could provide a stable link between Bcl-2 homo- and/or heterodimers and other proteins perhaps forming larger complexes or altering their interaction with regulators such as BAD (Zha, et al .
  • Nip3 is identified as a homodimer localized to mitochondrial membrane. Nip3 expression in mitochondria induces apoptosis and can overcome Bcl-2 suppression of cell death, indicating that Nip3 is a novel pro-apoptotic protein.
  • Nip3 (mNip3) .
  • mouse 17 day embryo matchmaker cDNA library was PCRed and human fetal liver 5 '-stretch plus cDNA library (Clontech, Palo Alto, CA) to generate clones of the entire mNix and hNix respectively.
  • Murine Nip3 cDNA was cloned from a ⁇ GTll 3T3 fibroblast cDNA library using human Nip3 as a probe. The clones with the largest inserts were sequenced. Expression constructs.
  • Transmembrane domain deleted expression vector mNix TM was generated by PCR using splice overlap extension (Horton, et al., 1993) with the 5' primer: 5'-
  • Rat-1, Rat-l/Bcl-2, TC (10T1/2 parental cell line), TX5 and TX22 (Bcl-X L transfected 10T1/2 clones) and MCF-7 cells were culture in -minimal essential medium ( ⁇ - MEM) (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Gibco) .
  • Murine monoclonal anti-T7 antibody was purchased from Novagen (Madison, WI) .
  • Rabbit anti- HSP60 antibody was donated by Dr. Radhey Gupta (McMaster University, Hamilton, Ont . ) .
  • FITC-conjugated goat anti- rabbit IgG (Sigma Chemical Co.) and Cy3-conjugated goat anti-mouse IgG (BioCan Ltd. , Mississauga) were used for fluorescence studies .
  • Lactacystin was purchased from Calbiochem-Novabiochem (Cambridge, MA) .
  • Northern Analysis Total RNA (30 ⁇ g) from human erythroleukemia (HEL) cells or from mouse kidney was fractionated on a 1% (w/v) agarose/2.2M formaldehyde denaturing gel, and then transferred onto a nitrocellulose membrane and cross-linked as described (Chen, et al . , 1997).
  • Nick-translated human or mouse Nix probes (1-5 x 10 8 cpm/ ⁇ g DNA) , corresponding to the coding region, were then hybridized to the respective blots at 42°C for 16 hrs and developed. In vitro transcription.
  • 35 S- labeled Nix proteins were prepared by in vi tro transcription and translation of cDNA cloned in pcDNA3 vector using Tnt coupled Reticulocyte Lysate System (Promega, Madison, WI) according to manufacturer's instructions .
  • Nix expressing cells were detected with mouse anti-T7 antibody and FITC-conjugated rabbit anti-mouse IgG antibody.
  • Apoptotic cells exhibiting altered DNA morphology following Hoechst dye staining, were enumerated manually counting at least 200 cells per sample in five or more fields as described previously (Chen, et al . , 1997). Independent experiments were then combined and expressed as the mean and SEM. Fluorescence was visualized using a Zeiss Axiophot microscope equipped with a cooled CCD camera (Chen, et al . , 1997).
  • Nix Human and murine ESTs related to but different from Nip3 were identified by searching the Genebank and TIGR databases. Using PCR cloning, as described in Methods, a human 1337 bp and murine 1351 bp cDNA was obtained containing a large ORF of 219 and 218 amino acids, respectively.
  • the protein was named Nix.
  • the predicted human Nix (hNix) (Genebank accession # AF067396) and mouse Nix (mNix) (Genebank accession #AF067395) proteins share 56% and 53% identity with Nip3 of the same species, and are 97% identical to each other ( Figure IA) . The highest regions of homology between the four proteins resides in the C- terminus. Nix proteins bear a single hydrophobic alpha helical sequences at the extreme carboxy terminus corresponding to the location of the TM domain of Nip3 (2)
  • Nix has a significantly longer N-terminus that contains an unusual five asparagines in sequence and is proline rich. N-terminal amino acids 1-59 of hNix and 1-32 of hNip3 are the most divergent. Another region from amino acids 97-120 of hNix is also distinct from hNip3 , while the remainder is over 85% homologous with large blocks of identical sequences in both species.
  • Nix contains PEST sequences comprised of high frequency stretches of Pro, Glu, Ser, Thr and Asp, flanked by charged amino acids His, Arg or Lys. PEST sequences are associated with proteins having high turnover rates rates (Rogers, et al . , 1986) whose degradation is controlled by the proteasome . hNix and mNix are expressed as 4.5 and 1.4 kb mRNA transcripts, respectively ( Figure 7B) . The smaller transcript corresponds to the size of the cDNAs reported above and are likely the complete sequence.
  • the larger transcript has not been identified, however, on sequencing other mNix cDNAs recovered from PCR products, some clones were identified that bear a distinct 5' UTR suggesting alternate splicing of the Nix mRNA. These may represent a larger transcript with an extended 5' UTR.
  • mNix and hNix run as proteins of 48 kD relative molecular weight under reducing and non reducing conditions using the Tris-Tricine SDS PAGE method (Schagger, et al . , 1987).
  • hNip3 has a 40 kDa relative molecular weight in Tris-Tricine buffered SDS PAGE ( Figure 8A) .
  • Nix runs as a 70 kDa protein and Nip3 at 60 kDa (Chen, et al . , 1997).
  • Nip3 which is a homodimer that does not dissociate under reducing conditions (Chen, et al . , 1997), runs at its predicted molecular weight of 40 kDa in the Tris-Tricine SDS PAGE. Nix is also unaffected by reduction and is about double its 23.8 kDa predicted mass ( Figure 8A) . This suggest that Nix may also be a homodimer that resists reduction.
  • Nip3 The 11 kDa residual Nip3 fragment was only detectable using the Tris Tricine Buffered SDS PAGE, which is optimized for the detection of small peptides.
  • the proteolytic degradation is dependent on a active proteasome. Nix remains as a 48 kD protein when cells were first treated with lactacystin, the proteasome threonine protease inhibitor ( Figure 8B) . Nip3 is also degraded rapidly following transfection (Chen, et al . , 1997) and as with Nix, Nip3 degradation is also inhibited in lactacystin treated cells.
  • Nix is localized to mitochondria
  • mNix-T7 was transiently transfected into Rat-1 cells and stained with both monoclonal anti-T7 and rabbit anti-HSP60 antibodies.
  • Secondary antibodies FITC-labelled goat anti-mouse IgG and Cy3-labelled goat anti-rabbit IgG were then used to visualize the localization of Nix and HSP60 respectively within the cells after immuno-fluorescence and confocal microscopy.
  • HSP60 is primarily located in mitochondria (Soltys, et al .
  • Nix ⁇ TM is expressed evenly throughout the cytoplasm and is not localized to any organelle-like structure.
  • Figure 9B the Nix mutant was also detected in the nucleus. Because Nip3 induces apoptosis when transiently transfected, the effects of Nix expression in Rat-1 and MCF-7 cells were examined over time.
  • Nix expressing cells undergo apoptosis (Figure 9C) . This was quantitated over a 48 hour period and a progressive increase in the percent of cells that were apoptotic was observed to progressively increase ( Figure 10A) and at about the same rate as Nip3 ( Figure 10B) .
  • the ⁇ TM mutant of Nix was examined and found that despite its inability to localize to mitochondria, it was as efficient as intact Nix at inducing apoptosis in Rat-1 cells ( Figure IOC) .
  • Nix has a different mechanism of activating apoptosis than Nip3 and does not require mitochondrial localization to function.
  • Nip3- induced apoptosis is only partially suppressed in Bcl-2 expressing cell lines (Chen, et al . , 1997; Yasuda, et al . , 1998) . Inhibition is detected early in the time course but is overcome at later time points (Chen, et al . , 1997) . Examining the apoptosis rate over a 48 hour period following mNix transfection, there was no significant difference between between Rat-1 and Rat-l/Bcl-2 cell lines ( Figure 11A) , that latter being highly resistant to other apoptotic signals such as granzyme B (Chen, et al . , 1997) .
  • Nix plasmid At decreasing doses of Nix plasmid from 1.0 to 0.1 ⁇ g the transfection efficiency decreased progressively but the apoptosis rate in transfected cells remained constant between the two cells lines. Examining Nix apoptosis in Bcl-X L expressing cell lines TX22 and TX5 , only the higher Bcl-X L expressing cell line TX5 was effective at blocking Nix.
  • Nix a homolog of the Nip3 protein, shares the ability to induce apoptosis, localized to mitochondria and undergo proteasome-dependent degradation when overexpressed. Unlike Nip3 however, Nix can induce apoptosis as a free cytoplasmic protein when lacking a transmembrane domain. Nip3 and Nix form a new family of mitochondrial cell death proteins.
  • Relative level of interaction is based on ⁇ -galactosidase activity.
  • Binding domain Activating domain; pAS1 , empty vector; MK, Myotonin Kinase; PTP2, protein tyrosine phosphatase 2
  • C. elegans cell survival gene ced-9 encodes a functional homolog of the mammalian proto-oncogene bcl-2. Cell 76:665-676.
  • Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature 348:334-336.
  • Granzyme B autonomously crosses the cell membrane and perforin initiates apoptosis and GraB nuclear localization. J. Exp. Med. 185:855-866.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des protéines Nip, Nix et Nox purifiées et isolées, ainsi qu'un procédé d'induction de l'apoptose dans des cellules par transfection desdites cellules avec des protéines Nip, Nix et Nox. Elle concerne en outre un procédé d'induction de l'apoptose dans des cellules par création d'anticorps qui reconnaissent des protéines Nip, Nix et Nox spécifiques dans un muscle ou dans la peau d'un patient. Elle concerne encore un procédé d'induction de l'apoptose dans des cellules par création d'un transgène surexprimant le gène pour les protéines Nip, Nix et Nox. Elle concerne enfin un animal transgénique et sa descendance, possédant un facteur d'expression constitué essentiellement de protéines Nip, Nix et Nox choisies dans le groupe constitué essentiellement des Seq. ID No 1 à 6.
PCT/IB1998/001959 1997-11-24 1998-11-24 Famille nip3 de proteines WO1999027093A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU12559/99A AU1255999A (en) 1997-11-24 1998-11-24 The nip3 family of proteins
CA002311170A CA2311170A1 (fr) 1997-11-24 1998-11-24 Famille nip3 de proteines
EP98955851A EP1034263A1 (fr) 1997-11-24 1998-11-24 Famille nip3 de proteines

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US6664997P 1997-11-24 1997-11-24
US60/066,649 1997-11-24
US9815998P 1998-08-27 1998-08-27
US60/098,159 1998-08-27

Publications (2)

Publication Number Publication Date
WO1999027093A2 true WO1999027093A2 (fr) 1999-06-03
WO1999027093A3 WO1999027093A3 (fr) 1999-08-12

Family

ID=26746998

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB1998/001959 WO1999027093A2 (fr) 1997-11-24 1998-11-24 Famille nip3 de proteines

Country Status (4)

Country Link
EP (1) EP1034263A1 (fr)
AU (1) AU1255999A (fr)
CA (1) CA2311170A1 (fr)
WO (1) WO1999027093A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999060124A2 (fr) * 1998-05-15 1999-11-25 Fei Huang Sequences liees a la differenciation et procede d'utilisation correspondant
US7452869B2 (en) * 2000-06-30 2008-11-18 University Of Manitoba NIP3 family of proteins

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0733706A2 (fr) * 1995-03-21 1996-09-25 St. Louis University Protéine regulateur d'apoptose
WO1998029447A1 (fr) * 1996-12-27 1998-07-09 Incyte Pharmaceuticals, Inc. Nouveau regulateur d'apoptose humain

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0733706A2 (fr) * 1995-03-21 1996-09-25 St. Louis University Protéine regulateur d'apoptose
WO1998029447A1 (fr) * 1996-12-27 1998-07-09 Incyte Pharmaceuticals, Inc. Nouveau regulateur d'apoptose humain

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MINX P: "Hypothetical 23.6 kD protein (accession no. Q09969)" EMBL DATAASE,1 November 1996, XP002104782 Heidelberg, Germany *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999060124A2 (fr) * 1998-05-15 1999-11-25 Fei Huang Sequences liees a la differenciation et procede d'utilisation correspondant
WO1999060124A3 (fr) * 1998-05-15 2001-05-31 Fei Huang Sequences liees a la differenciation et procede d'utilisation correspondant
US7452869B2 (en) * 2000-06-30 2008-11-18 University Of Manitoba NIP3 family of proteins

Also Published As

Publication number Publication date
AU1255999A (en) 1999-06-15
CA2311170A1 (fr) 1999-06-03
EP1034263A1 (fr) 2000-09-13
WO1999027093A3 (fr) 1999-08-12

Similar Documents

Publication Publication Date Title
US5998583A (en) BH3 interacting domain death agonist
US5942490A (en) Cell death regulators
WO1995013292A9 (fr) Proteines associees a la bcl-2
AU1174295A (en) Bcl-2-associated proteins
US20110201780A1 (en) Novel death domain proteins
Holmgreen et al. Survival activity of Bcl-2 homologs Bcl-w and A1 only partially correlates with their ability to bind pro-apoptotic family members
JP4005636B2 (ja) アポトーシスに関連した蛋白ｂｂｋ
US20040146971A1 (en) Novel p53 inducible protein
US6545128B1 (en) Anti-bax inhibitor protein antibodies
WO1997045128A9 (fr) Proteine bbk associee a l'apoptose
US6818750B2 (en) Card proteins involved in cell death regulation
US6600024B1 (en) Blk genes, gene products and uses thereof in apoptosis
US6607880B1 (en) Methods and reagents for modulating apoptosis
WO1999027093A2 (fr) Famille nip3 de proteines
WO1998039434A9 (fr) Procede et reactifs servant a moduler l'apoptose
US7256321B2 (en) Intracellular modulators of apoptopic cell death pathways
WO2002040680A2 (fr) Nouvelles proteines du domaine de mort cellulaire
WO2001023568A2 (fr) Nouveaux membres de la famille du gene iap
CA2252422A1 (fr) Procede et reactifs servant a moduler l'apoptose

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2311170

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2311170

Country of ref document: CA

NENP Non-entry into the national phase in:

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 1998955851

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09554278

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1998955851

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1998955851

Country of ref document: EP