WO1999026647A1 - Utilisation de proteine de liaison a l'heparine pour la modulation ou la prophylaxie de l'apoptose des cellules de mammiferes - Google Patents

Utilisation de proteine de liaison a l'heparine pour la modulation ou la prophylaxie de l'apoptose des cellules de mammiferes Download PDF

Info

Publication number
WO1999026647A1
WO1999026647A1 PCT/DK1998/000510 DK9800510W WO9926647A1 WO 1999026647 A1 WO1999026647 A1 WO 1999026647A1 DK 9800510 W DK9800510 W DK 9800510W WO 9926647 A1 WO9926647 A1 WO 9926647A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
hbp
heparin
binding protein
mammalian
Prior art date
Application number
PCT/DK1998/000510
Other languages
English (en)
Inventor
Hans Jakob Flodgaard
Allan Ertmann Karlsen
Original Assignee
Novo Nordisk A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novo Nordisk A/S filed Critical Novo Nordisk A/S
Priority to AU13336/99A priority Critical patent/AU1333699A/en
Priority to EP98956825A priority patent/EP1032412A1/fr
Priority to JP2000521849A priority patent/JP2002505252A/ja
Publication of WO1999026647A1 publication Critical patent/WO1999026647A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • cytochrome c may play a role in the activation of apoptogenic proteases (Reed, 1997, Cell 91 :559-562).
  • Apoptosis can serve as a prominent force in sculpting the developing organism, as a major mechanism for the precise regulation of cell numbers and as a defense mechanism to remove unwanted and potentially dangerous cells.
  • the inappropriate activation of apoptosis may cause or contribute to a variety of disorders (reviewed in Thompson, 1995, Science 267:1456-1461). These include virus-induced lymphocyte depletion (AIDS); cell death in neurodegenerative disorders char- acterized by the gradual loss of specific sets of neurons (e.g..
  • growth factors anemia associated with chronic disease, aplastic anemia, chronic neutropenia and myelodysplastic syndromes
  • disorders arising out of an acute loss of blood flow e.g. myocardial infarctions and stroke.
  • treatments that can increase the apoptotic thresholds of specific cells may be beneficial in treatment of cell loss associated disorders (reviewed in Thompson, 1995, Science 267:1456-1461).
  • treatments may be physiological inhibitors of apoptosis such as growth factors, extracellular matrix, CD40 ligand. neutral amino acids, zinc, estrogen, androgens.
  • physiological inhibitors of apoptosis such as growth factors, extracellular matrix, CD40 ligand. neutral amino acids, zinc, estrogen, androgens.
  • pharmacological agents such as calpain inhibitors, cysteine protease inhibitors, tumor promoters such as PMA, phenobarbital. alpha-hexachlorocyclohexane have been thought to act as inhibitors of apoptosis.
  • Diabetes mellitus is a systemic disease characterized by disorders in the actions of insulin and other regulator)' hormones in the metabolism of carbohydrates, fats and proteins and in the structure and function of blood vessels.
  • the primary symptom of diabetes is hyperglycemia, often accompanied by glucosuria the presence in urine of large amounts of glucose and polyuria. the excretion of large volumes of urine. Additional symptoms arise in chronic or long standing diabetes. These symptoms include degeneration of the walls of blood vessels. Although many different organs are affected by these vascular changes, the nerves eyes and kidneys appear to be the most susceptible. As such, long-standing diabetes mellitus, even when treated with insulin, is a leading cause of blindness.
  • Type I diabetes is of juvenile onset, ketosis- prone, develops early in life with much more severe symptoms and has a near-certain prospect of later vascular involvement. Control of this type of diabetes is difficult and requires exogenous insulin administration.
  • Type II diabetes is of adult onset, ketosis-resistant, develops later in life is milder and has a more gradual onset.
  • the proteins lack protease activity.
  • the proteins have been named human heparin-binding protein (hHBP) and porcine heparin-binding protein (pHBP). respectively, owing to their high affinity for heparin;
  • hHBP human heparin-binding protein
  • pHBP porcine heparin-binding protein
  • CAP37 protein cationic antimicrobial protein due to its antimicrobial activity.
  • HBP was originally studied because of its antibiotic and LPS binding properties (Gabay et al., 1989, Proc. Natl. Acad. Sci. U.S.A.
  • a protein with the first 20 N-terminal amino acid residues identical to those of hHBP and CAP37 called azurocidin has also been isolated (J.E. Gabay et al., Proc. Natl. Acad. Sci. USA 86, 1989, p. 5610 ff; CG. Wilde et al., J. Biol. Chem. 265, 1990, p. 2038 ff.) and its antimicrobial properties have been reported (D. Campanelli et al., J. Clin. Invest. 85, 1990, p. 904 ff).
  • HBP HBP has otherwise been termed CAP37 (cf. WO 91/00907, U.S. Patent Nos. 5.458,874 and 5,484.885) and azurocidin (cf. CG. Wilde et al., J. Biol. Chem. 265, 1990, p. 2038).
  • HBP heparin-binding protein
  • the invention is directed to a method of modulating or decreasing apoptosis in mammalian cells of a mammal, particularly beta cells of the Islets of Langerhans, nerve cells and endothe- lial cells, comprising administering to said mammal in need thereof a mammalian heparin- binding protein which in glycosylated form has (i) a molecular weight of about 28 kD as determined by SDS PAGE under reducing conditions; (ii) is stored in the azurophil granules of polymorphonuclear leukocytes and (iii) is a chemoattractant for monocytes or pharmaceutically active fragment thereof or a composition comprising said heparin-binding protein and a pharmaceutically effective carrier in an amount effective to modulate or decrease apoptosis in said cells.
  • the invention is directed to the use of said heparin-binding protein (HBP) or fragment thereof for the manufacture of a medicament for the treatment or prophylaxis of a condition resulting from apoptosis as well as its use in treating or preventing said condition.
  • HBP heparin-binding protein
  • the invention is further directed to a composition comprising said heparin-binding protein and a mitochondrial matrix targeting protein.
  • a mitochondrial matrix targeting protein' is a protein that has an N-terminal extension that functions as a targeting signal to the mitochondria.
  • the targeting signal is a highly degenerate sequence having 20-30 residues capable of folding into a positively charged amphiphilic helix.
  • the invention is fur- ther directed to uses of these compositions for the manufacture of a medicament for treating or preventing a disorder resulting from cell apoptosis.
  • the invention is directed to a method for modulating and preventing mammalian cell apoptosis and accordingly a disorder resulting from cell apoptosis comprising administering to a mammal an effective amount of said composition.
  • Figure 1 shows the effect of human HBP on MTT values in control and cytokine exposed RIN cells.
  • Figure 2 shows the effect of human HBP on accumulated NO (nitrite) in control and cytokine exposed RIN cells.
  • Figure 3 shows the release of HBP in the presence of PMA (Figure 3 A) or fMLP (Figure 3B) from PMNs in the presence or absence of HUVECs.
  • Figure 4 shows the characterization of the binding of HBP to proteoglycans.
  • Figure 4A shows HBP binding proteoglycans from 35 S-labeled endothelial cells are enriched by ion exchange chromatography and affinity purified on HBP-agarose. Fractions, eluted with a stepwise ionic strength gradient (250 - 1000 mM NaCl). are separated on SDS-PAGE and visualized by Phospho-Imaging. Uncoupled agarose is used as a control column. Molecular markers are given on the left.
  • Figure 4B shows 35 S-labeled HBP-affinity purified proteoglycans. eluted with 300. 400 and 500 mM NaCl, were treated (+) with CABC or HNO2.
  • FIG. 4C shows unlabelled endothelial cell proteoglycans eluted from the HBP-column with 300 mM NaCl or endothelial cell lysates. were digested with CABC and heparitinase (+) or left undigested (-). The cleavage products were separated by SDS-PAGE and transferred to Zeta-Probe membranes.
  • Membranes were incubated with mAb 3G10 directed against desaturated glucuronate of heparitinase digested heparan sulfate proteoglycan core proteins. The positions of the different proteoglycans are indicated (*). Molecular markers are given on the left.
  • Figure 5 shows a characterization of the internalization process.
  • Endothelial cells are pretreated with diverse substances able to inhibit receptor-ligand interactions, protein synthesis or actin polymerization before addition of HBP.
  • Cells are preincu- bated with heparin (TOO mg/ml) for 30 min.
  • heparin TOO mg/ml
  • cells are pretreated with NH 4 C1 (50 mM), cycloheximide (1 nM) or cytocholasin D (1 mM) for 60 min prior to addition of HBP (50 mg ml).
  • Bound and/or internalized HBP is quantified in intact or permeabilized cells by FACS analysis.
  • endothelial cells are incu- bated with HBP or buffer (control) alone followed by incubation with primary and secondary antibodies as described.
  • FIG. 5B shows CHO wildtype (CHO-K1) and heparan sulfate proteoglycan deficient pgsD 677 cells are treated with HBP for indicated time periods. Cells are permeabilized and analyzed as described above.
  • Figure 6 shows the subcellular fractionation of HBP-treated HUVECs. Equal amounts of protein from the various cell fractions are subjected to Western blotting using anti-HBP (upper panel) and ani-p33 (lower panel).
  • Figure 7 shows binding of HBP to rp33.
  • microtiter plates are coated with H kininogen, HBP or the control protein KLH (1 mg/ml) followed by the incubation of serial dilutions (starting concentration 2 mg/ml, two fold dilution) of rp33 (fusion protein) or the fusion partner MBP.
  • Bound protein is detected by a rabbit antiserum raised against the fusion partner MBP (1 :2500 v/v) and a peroxidase-conjugated secondary antibody against rabbit IgG (1:3000 v/v). The absorption at 405 nm is presented in arbitrary units.
  • Figure 8 shows colocalization of HBP with p33 and HBP with mitochondria.
  • endothelial cells are incubated with FITC-labeled HBP (green) for 6 hours, fixed in 4% formaldehyde and incubated with an antibody against rp33 followed by a Texas Red conjugated secondary antibody against rabbit IgG (red).
  • Figure 10 shows the effect of HBP on hydrogen peroxide treated cells.
  • the HBP may suitably be of mammalian, in particular human or porcine, origin.
  • the HBP is a mature human HBP which has at least about an 80% identity with the amino acid sequence set forth in SEQ ID NO: 1 , more preferably at least about 90%, even more preferably at least about 95%, and most preferably at least about 97% (hereinafter "homologous polypeptides"), which qualitative retain the activity of said heparin-binding protein, or a fragment thereof which inhibits the entry of a pathogen into a mononuclear (e.g., monocyte or macrophage) cells of a patient.
  • a mononuclear e.g., monocyte or macrophage
  • the HBP is a mature porcine HBP which has at least about an 80% identity with the amino acid sequence set forth in SEQ ID NO:2, more preferably at least about 90%, even more preferably at least about 95%, and most preferably at least about 97%, which qualitative retain the activity of said heparin-binding protein, or a fragment thereof which inhibits decreases or modulates apoptosis of mammalian cells in a mammal.
  • the mammal is a human patient.
  • the homologous polypeptides have an amino acid sequence which differs by five amino acids, preferably by four amino acids, more preferably by three amino acids, even more preferably by two amino acids, and most preferably by one amino acid from the amino acid sequence set forth in SEQ ID NOS: 1 or 2.
  • the degree of identity between two or more amino acid sequences may be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Needleman and Wunsch, 1970, Journal of Molecular Biology 48:443-453). For purposes of determining the degree of identity between two amino acid sequences for the present invention, GAP is used with the following settings: GAP creation penalty of 3.0 and GAP extension penalty of 0.1.
  • amino acid sequences of the homologous polypeptides differ from the amino acid sequence set forth in SEQ ID NOS: 1 or 2 by an insertion or deletion of one or more amino acid residues and/or the substitution of one or more amino acid residues by different amino acid residues.
  • amino acid changes are of a minor nature, that is, conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.
  • conservative substitutions are within the group of basic amino acids (such as ar- ginine, lysine and histidine), acidic amino acids (such as glutamic acid and aspartic acid), polar amino acids (such as glutamine and asparagine), hydrophobic amino acids (such as leucine. isoleucine and valine). aromatic amino acids (such as phenylalanine, tryptophan and tyrosine) and small amino acids (such as glycine, alanine. serine, threonine and methionine). Amino acid substitutions which do not generally alter the specific activity are known in the art and are described, e.g., by H. Neurath and R.L.
  • the heparin binding protein may be encoded by a nucleic acid sequence having at least about an 80% identity with the nucleic acid sequence set forth in SEQ ID NO:3 (which encodes mature human HBP depicted in SEQ ID NO:l), SEQ ID NO:5 (which encodes a human HBP which includes the pro sequence and sequence of the mature protein, depicted in SEQ ID NO:6).
  • SEQ ID NO:7 (which encodes human HBP which includes the signal sequence, the pro sequence and sequence of the mature protein, depicted in SEQ ID NO:8) or SEQ ID NO:4 (which encodes porcine HBP depicted in SEQ ID NO:2), SEQ ID NO:9 (which encodes a porcine HBP which includes the pro sequence and sequence of the mature protein depicted in SEQ ID NO: 10).
  • SEQ ID NO: 1 1 (which encodes porcine HBP which includes the signal sequence, the pro sequence and sequence of the mature protein depicted in SEQ ID NO: 12). More preferably at least about 90%, even more preferably at least about 95%, and most preferably at least about 97%, as determined by agarose gel electrophoresis.
  • the nucleic acid se- quence may be of genomic, cDNA, RNA. semisynthetic, synthetic origin, or any combinations thereof.
  • GGCTCCAGCCCCC TTTTGGAC ATCGTTGGCGGC CGGAAGGCGA GGCCCCGCCA GTTCCCGTTC CTGGCCTCCA TTCAGAATCA AGGCAGGCAC TTCTGCGGGG GTGCCCTGAT CCATGCCCGCTTCGTGATGA CCGCGGCCAG CTGCTTCCAA AGCCAGAACC CCGGGGTTAG CACCGTGGTG CTGGGTGCCT ATGACCTGAG GCGGCGGGAG AGGCAGTCCC GCCAGACGTT TTCCATCAGCAGCATGAGCG AGAATGGCTA CGACCCCCAG CAGAACCTGA ACGACCTGAT GCTGCTTCAG CTGGACCGTG AGGCCAACCT CACCAGCAGC GTGACGATAC TGCCACTGCC TCTGCAGAACGCCACGGTGG AAGCCGGCAC CAGATGCCAG GTGGCCGGCT GGGGGGGAGCCA GCGCAGTGGGGGGCGTCTCT CCCGTTTTCC CAGGTTCGTC AACGTGACTG TGACT
  • the degree of identity between two nucleic acid sequences may be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Needleman and Wunsch, 1970, Journal of Molecular Biology 48:443-453). For purposes of determining the degree of identity between two nucleic acid sequences for the present inven- tion, GAP is used with the following settings: GAP creation penalty of 5.0 and GAP extension penalty of 0.3.
  • Modification of the nucleic acid sequence encoding the HBP may be necessary for the synthesis of polypeptide sequences substantially similar to the HBP.
  • the term "substantially simi- lar" to the HBP refers to non-naturally occurring forms of the HBP.
  • These polypeptide sequences may differ in some engineered way from the HBP isolated from its native source. For example, it may be of interest to synthesize variants of the HBP where the variants differ in specific activity, thermostability, pH optimum, or the like using, e.g., site-directed mutagenesis.
  • the analogous sequence may be constructed on the basis of the nucleic acid se- quence presented as the HBP encoding part of SEQ ID NOS:l, 2, 6, 8, 10, or 12, e.g., a subsequence thereof, and/or by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the HBP encoded by the nucleic acid sequence, but which corresponds to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence.
  • nucleotide substitution see, e.g., Ford ET al., 1991. in Protein Expression and Purification 2:95-107.
  • amino acid residues essential to the activity of the polypeptide encoded by the isolated nucleic acid sequence of the invention may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244:1081 1085). In the latter technique mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for HBP activity to identify amino acid residues that are critical to the activity of the molecule.
  • the heparin-binding protein may also be encoded by a nucleic acid sequence that hybridizes to a nucleic acid sequence set forth in SEQ ID NOS: 3. 4, 6. 8, 10. and 12 at low to high stringency conditions.
  • Low to high stringency conditions are defined as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 ug/ml sheared and denatured salmon sperm DNA and either 25, 35 or 50% formamide for low, medium and high stringencies, respectively.
  • the carrier material is washed three times each for 30 minutes using 2X SSC, 0.2% SDS preferably at least at 50°C (very low stringency), more preferably at least at 55°C (low stringency), more preferably at least at 60°C (medium stringency), more preferably at least at 65 °C (medium-high stringency), even more preferably at least at 70°C (high stringency) and most preferably at least at 75 °C (very high stringency).
  • 2X SSC 0.2% SDS preferably at least at 50°C (very low stringency), more preferably at least at 55°C (low stringency), more preferably at least at 60°C (medium stringency), more preferably at least at 65 °C (medium-high stringency), even more preferably at least at 70°C (high stringency) and most preferably at least at 75 °C (very high stringency).
  • a nucleic acid sequence encoding HBP may be prepared synthetically by established standard methods, e.g.. the phosphoamidite method described by S.L. Beaucage and M.H. Caruthers. Tetrahedron Letters 22, 1981, pp. 1859-1869, or the method described by Matthes et al., EMBO Journal 3, 1984, pp. 801-805.
  • oligonucleo- tides are synthesized, e.g., in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors.
  • the techniques used to isolate or clone a nucleic acid sequence encoding the heparin binding protein used in the method of the present invention are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof.
  • the cloning of the nucleic acid sequences of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, A Guide to Methods and Application, Academic Press, New York.
  • Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA) may be used.
  • a recombinant expression vector which may be any vector which may conveniently be subjected to recombinant DNA procedures.
  • the choice of vector will often depend on the host cell into which it is to be introduced.
  • the vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromoso- mal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid.
  • the vector may be one which, when introduced into a host cell, is inte- grated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
  • the nucleic acid sequence encoding HBP should be operably connected to a suitable promoter sequence.
  • the promoter may be any nucleic acid sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
  • suitable promoters for directing the transcription of the nucleic acid sequence encoding HBP in mammalian cells are the SV 40 promoter (Subramani et al., Mol. Cell Biol. 1, 1981, pp. 854-864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222. 1983, pp.
  • ade- novirus 2 major late promoter a Rous sarcoma virus (RSV) promoter, cytomegalovirus (CMV) promoter (Boshart et al., 1981, Cell 41:521-530) and a bovine papilloma virus promoter (BPV).
  • RSV Rous sarcoma virus
  • CMV cytomegalovirus
  • BPV bovine papilloma virus promoter
  • a suitable promoter for use in insect cells is the polyhedrin promoter (Vasuvedan et al.. FEBS Lett. 311. 1992, pp. 7-11).
  • Suitable promoters for directing the transcription of the nucleic acid sequence encoding HBP. especially in a bacterial host cell are the promoters obtained from the E. coli lac operon, the Streptomyces coelicolor agarase gene (dagA).
  • Bacillus subtilis levansu- erase gene sacB
  • Bacillus licheniformis alpha-amylase gene amyL
  • Bacillus stea- rothermophilus maltogenic amylase gene amyM
  • Bacillus amyloliquefaciens alpha amylase gene amyQ
  • Bacillus licheniformis penicillinase gene penP
  • Bacillus sub- tilis xylA and xylB genes and the prokaryotic beta-lactamase gene
  • promoters for directing the transcription of the nucleic acid sequence encoding HBP in a filamentous fungal host cell are promoters obtained from the genes encoding Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus ni- ger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium oxysporum trypsin-like protease (as described in U.S.
  • Patent No. 4,288,627 which is incorporated herein by reference
  • Particularly preferred promoters for use in filamentous fungal host cells are the TAKA amylase, NA2-tpi (a hybrid of the promoters from the genes encoding Aspergillus niger neutral a amylase andAs- pergillus oryzae triose phosphate isomerase), and glaA promoters.
  • useful promoters are obtained from the Saccharomyces cerevisiae enolase (ENO-1) gene, the Saccharomyces cerevisiae galactokinase gene (GAL1), the Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3 -phosphate dehydrogenase genes (ADH2/GAP). and the Saccharomyces cerevisiae 3-phosphoglycerate kinase gene.
  • ENO-1 Saccharomyces cerevisiae enolase
  • GAL1 Saccharomyces cerevisiae galactokinase gene
  • ADH2/GAP Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3 -phosphate dehydrogenase genes
  • Saccharomyces cerevisiae 3-phosphoglycerate kinase gene Other useful promoters for yeast host cells are described by Romanos et al
  • the nucleic acid sequences encoding SEQ ID NOS: 1 and 2, e.g.. SEQ ID NOS:3 and 9 may be operably linked to a nucleic acid encoding a heterologous pro sequence.
  • the nucleic acid encoding SEQ ID NOS:6, 8, 10, and 12. e.g., SEQ ID NOS:5, 7. 9, and 11 and may be operably linked to a nucleic acid sequence encoding a heterologous signal sequence and/or pro sequence.
  • the nucleic acid sequence encoding HBP may also be operably connected to a suitable terminator, such as the human growth hormone terminator (Palmiter et al., op.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes encoding Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.
  • Preferred terminators for yeast host cells are obtained from the genes encoding Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), or Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.
  • Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
  • the vector may further comprise elements such as polyadenylation signals (e.g. from SV 40 or the adenovirus 5 Elb region), transcriptional enhancer sequences (e.g. the SV 40 enhancer) and translational enhancer sequences (e.g. the ones encoding adenovirus VA RNAs).
  • polyadenylation signals e.g. from SV 40 or the adenovirus 5 Elb region
  • transcriptional enhancer sequences e.g. the SV 40 enhancer
  • translational enhancer sequences e.g. the ones encoding adenovirus VA RNAs.
  • preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes encoding Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, and Aspergillus niger alpha-glucosidase.
  • the recombinant expression vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
  • a sequence when the host cell is a mammalian cell
  • a sequence is the SV 40 or polyoma origin of replication.
  • bacterial origins of replication are the origins of replication of plasmids pBR322, pUC 19, pACYC 177, pA- C YC 184, pUB 110, pE 194, pTA 1060, and pAMB 1.
  • origin of replications for use in a yeast host cell are the 2 micron origin of replication, the combination of CEN6 and ARS4. and the combination of CEN3 and ARS 1.
  • the origin of replication may be one having a mutation to make its function temperature-sensitive in the host cell (see, e.g., Ehrlich. 1978, Proceedings of the National Academy of Sciences USA 75: 1433).
  • the vector may also comprise a selectable marker, e.g., a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or one which confers resistance to a drug, e.g., neomycin, geneticin, ampicillin, or hygromycin.
  • DHFR dihydrofolate reductase
  • Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3.
  • a selectable marker for use in a filamentous fungal host cell may be selected from the group including, but not limited to, amdS (acetamidase), argB (ornithine carbamoyltrans- ferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5' -phosphate decarboxylase), sC (sulfate adenyl- transferase), trpC (anthranilate synthase), and glufosinate resistance markers, as well as equivalents from other species.
  • amdS acetamidase
  • argB ornithine carbamoyltrans- ferase
  • bar phosphinothricin acetyltransferase
  • hygB hygromycin phosphotransferas
  • amdS and pyrG markers of Aspergillus nidulans or Aspergillus oryzae and the bar marker of Streptomyces hygroscopicus.
  • selection may be accomplished by co transformation, e.g.. as described in WO 91/17243, where the selectable marker is on a separate vector.
  • the host cell into which the expression vector is introduced may be any cell which is capable of producing HBP and is preferably a eukaryotic cell, such as invertebrate (insect) cells or vertebrate cells, e.g., Xenopus laevis oocytes or mammalian cells, in particular insect and mammalian cells.
  • a eukaryotic cell such as invertebrate (insect) cells or vertebrate cells, e.g., Xenopus laevis oocytes or mammalian cells, in particular insect and mammalian cells.
  • suitable mammalian cell lines are the COS (e.g., ATCC CRL 1650), BHK (e.g., ATCC CRL 1632, ATCC CCL 10) or CHO (e.g., ATCC CCL 61) cell lines.
  • the host cell may be a mammalian basophilic cell or mammalian hybrid cell.
  • the mammalian basophilic cell may be human, guinea pig. rabbit or rat basophilic cells.
  • the mammalian basophilic cell is a rat basophilic cell.
  • the rat basophilic cell may be an RBL-1 cell having the identifying characteristics of ATCC CRL- 1378 or RBL-2H3 cell having the identifying characteristics of ATCC CRL 2256.
  • the mammalian basophilic cell is transfected with DNA encoding HBP using an electroporation apparatus.
  • the medium used to culture the cells may be any conventional medium suitable for growing mammalian cells, such as a serum-containing or serum-free medium containing appropriate supplements, or a suitable medium for growing mammalian cells. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection).
  • the cells are then screened for antibiotic resistance. Subsequently, the selected clones are subsequently assayed for HBP activity using assays known in the art such as a chemotaxis assay and assaying for cytokine release from monocytes (see, for example, Rasmussen et al., 1996, FEBS Lett. 390:109-112).
  • the host cell may be a hybrid mammalian cell.
  • a myeloma line e.g., mouse, rat, human
  • a myeloma line is transfected with DNA encoding HBP using the procedures described above. It may be subsequently be fused with a mammalian cell expressing an acidic proteoglycan such as a mammalian basophilic cell or mast cell using the following procedures.
  • the parental cells are mixed in culture media such as RPMI-1640 and exposed to a chemical fusion agent such a polyethylene glycol (see, for example, Gefter et al., 1997, Somat. Cell
  • the fusion agent is subsequently diluted out and the cells are incubated in media and HAT. Selected clones are subsequently assayed for HBP activity as described above.
  • two parental cells may be fused by electrofusion.
  • Membrane contact between cells are achieved by a non-uniform alternating field that leads to dielectrophoresis and cell chain formation. Fusion is then triggered by the injection of a field pulse that is strong enough to induce reversible breakdown in the membrane contact zone (see, for example, Okada et al., 1984, Biomed. Res. 5:511-566).
  • cell fusion may be induced by Sendai virus (see, for example, Wainberg et al., 1973, J. Cell Biol. 57:388-396).
  • the host cell may be a unicellular pathogen, e.g., a prokaryote, or a non-unicellular pathogen, e.g., a eukaryote.
  • Useful unicellular cells are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e.g., Bacillus alkalophilus, Bacillus amylolique- faciens, Bacillus brevis, Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus len- tus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus sub- tilis, and Bacillus thuringiensis; or a Streptomyces cell, e.g., Streptomyces lividans or Streptomyces murinus.
  • the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus or Bacillus subtilis cell.
  • the transformation of a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Mo- lecular General Genetics 168:11 1-115), by using competent cells (see, e.g., Young and Spiz- izin, 1961, Journal of Bacteriology 81 :823-829, or Dubnar and Davidoff Abelson, 1971.
  • the host cell may be a fungal cell.
  • "Fungi" as used herein includes the phyla Ascomycota. Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University' Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra).
  • Basidiomycota include mushrooms, rusts, and smuts.
  • Representative groups of Chytridiomycota include, e.g., Allomyces, Blastocladiella, Coelomomyces, and aquatic fungi.
  • Represen- tative groups of Oomycota include, e.g., Saprolegniomycetous aquatic fungi (water molds) such as Achlya.
  • mitosporic fungi examples include Aspergillus, Penicillium, Candida, and Alternaria.
  • Representative groups of Zygomycota include, e.g., Rhizopus and Mucor.
  • the fungal host cell is a yeast cell.
  • yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). The ascosporogenous yeasts are divided into the fami- lies Spermophthoraceae and Saccharomycetaceae.
  • the latter is comprised of four subfamilies, Schizosaccharomycoideae (e.g., genus Schizosaccharomyces), Nadsonioideae, Lipomy- coideae, and Saccharomycoideae (e.g., genera Pichia, Kluyveromyces and Saccharomyces).
  • the basidiosporogenous yeasts include the genera Leucosporidim, Rhodosporidium, Sporidiobolus, Filobasidium, and Filobasidiella.
  • yeast belonging to the Fungi Imperfecti are divided into two families, Sporobolomycetaceae (e.g., genera Sorobolomyces and Bullera) and Cryptococcaceae (e.g., genus Candida). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M., and Davenport, R.R., eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
  • yeast and manipulation of yeast genetics are well known in the art (see, e.g., Biochemistry and Genetics of Yeast, Bacil, M., Horecker, B.J., and Stopani, A.O.M., editors, 2nd edition, 1987; The Yeasts, Rose, A.H., and Harrison, J.S., editors, 2nd edition, 1987; and The Molecular Biology of the Yeast Saccharomyces, Strathern et al., editors, 1981).
  • the yeast host cell is a cell of a species of Candida, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Pichia, or Yarrowia.
  • the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell.
  • the yeast host cell is a Kluyveromyces lactis cell.
  • the yeast host cell is a Yarrowia lipolytica cell.
  • the medium used to culture the cells may be any conventional medium suitable for growing mammalian cells, such as a serum-containing or serum-free medium containing appropriate supplements, or a suitable medium for growing insect, yeast or fungal cells. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g,. in catalogues of the American Type Culture Collection).
  • the HBP produced by the cells may then be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g., ammonium sulphate, purification by a variety of chromatographic procedures, e.g., ion exchange chromatography, affinity chromatography, or the like.
  • the recombinant host cells may also produce an acid proteoglycan such as heparin sulfate. To obtain active HBP, the acid proteoglycan will need to be removed.
  • This may be accomplished using a series of separation methods, ie., precipitation or column chromatography, such as reverse phase HPLC, HIC, SEC, IEC and affinity based techniques.
  • the separation method may be combined with other treatments like increasing salt concentration, by change in the pH and by other means that reduce interactions between the acidic proteoglycan and HBP.
  • the recombinant host cells may also produce an acid proteoglycan such as heparin sulfate. To obtain active HBP, the acid proteoglycan will need to be removed.
  • an acid proteoglycan such as heparin sulfate.
  • the HBP may be formulated by any of the established methods of formulating pharmaceutical compositions, e.g. as described in Remington's Pharmaceutical Sciences, 1985.
  • the composition may typically be in a form suited for local or systemic injection or infusion and may, as such, be formulated with sterile water or an isotonic saline or glucose solution.
  • the compositions may be sterilized by conventional sterilization techniques which are well known in the art.
  • the re- suiting aqueous solutions may be packaged for use or filtered under aseptic conditions and lyophilized, the lyophilized preparation being combined with the sterile aqueous solution prior to administration.
  • the composition may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as buffering agents, tonicity adjusting agents and the like, for instance sodium acetate, sodium lactate, sodium chloride. potassium chloride, calcium chloride, etc.
  • concentration of HBP may vary widely, i.e. from less than about 0.5%, such as from 1%, to as much as 15-20% by weight.
  • a unit dosage of the composition may typically contain from about 10 mg to about 1 g of HBP.
  • HBP or pharmaceutically active fragments thereof are admimstered topically or by intravenous injection. Dosages will be prescribed by the physician according to the particular condition and the particular individual to be treated. Dosages and frequency is carefully adapted and adjusted according to parameters determined by the physician in charge.
  • a preferred administration route may be e.g. injections intraperitoneally.
  • Intravenous intraperitoneal injections of HBP may be given per 24 hours in the range of from 0.1-100 mg, especially 0.1-20 mg, in particular 0.1-10 mg per kg body weight.
  • the dose may be given 1-4 times per 24 hours or administered continuously through a catheter.
  • Compositions used in the present invention may additionally comprise a mitochondrial matrix targeting protein.
  • the mitochondrial matrix targeting protein has a molecular weight of about 33 kD, binds to H- but not L-kininogen.
  • the mitochondrial matrix targeting protein has an N-terminal amino acid sequence depicted in SEQ ID NO: 15, the 32 N-terminal amino acid sequence of p33 (Ghebrehiwet et al., 1994, J. Exp. Med. 179: 1809):
  • mitochondrial matrix targetting protein is the zinc dependent p33 protein depicted in SEQ ID NO: 16:
  • compositions used in the methods of the present invention are contemplated to be of use in treating or preventing disorders caused by apoptosis. These include but are not limited to HIV, neurodegenerative or neuromuscular diseases, ischemic stroke, anoxia, ische- mia/reperfusion damage and intoxication septic shock.
  • said compositions may be used to prevent the destruction of beta cells in the Islets of Langerhans in the pancreas. Damage to such beta cells leads to diabetes mellitus.
  • HBP is obtained from RBL-1 cells using the procedure described in application serial no. PCT/DK98/00275. The procedure is summarized below.
  • the vectors pBlueBacIII and pcDNA3 are obtained from Invitrogen. All primers and oligos are synthesized on an Applied Biosystems Model 394 DNA synthesizer. Restriction enzymes are obtained from New England Biolabs. Pfu polymerase. used in PCR reactions is obtained from Stratagene.
  • RBL-1 cells (ATCC CRL-1378) and RBL-2H3 cells (ATCC CRL-2256) are obtained from American Type Culture Collection (ATCC) in Manassas, VA.
  • Cells are grown as recommended by the supplier or in RPMI 1640 culture medium (Gibco, Life Technologies) supplemented with 10% heat inactivated gamma- irradiated FCS (origin: NZ, Gibco, Life Technologies) or fetal calf serum (FCS) North American origin from HyClone or BioWhit- taker. Cells are grown in 5% CO, at 37°C in an 80% humidified atmosphere. Exponentially growing cells are used in all experiments.
  • RPMI 1640 culture medium Gibco, Life Technologies
  • FCS fetal calf serum
  • a 770 bp BamHI-Hindlll fragment is constructed using PCR technology from a human bone marrow DNA library (Clontech) based on the human HBP amino acid sequence (Flodgaard et al, 1991, Eur. J. Biochem. 197:535-547) and the CAP 37/azurocidin DNA sequence (Morgan et al., 1991, J. Immunol. 147:3210-3214 and Almeida et al., 1991, Biochem. Biophys. Res. Commun. 177:688-695).
  • This fragment contains the entire coding region of HBP, including a 19-residue signal peptide, a 7 amino acid pro-peptide, a mature part of 22 amino acids, and a 3 amino acid C-terminal extension.
  • the fragment is inserted into pBlue-BacIII resulting in the plasmid pSX556.
  • an oligonucleotide linker of 99 bp, covering the signal peptide and the first 4 amino acids of mature HBP (from BamHI to Eagl) is substituted for the original BamHI-Eagl fragment in pSX556 giving rise to pSX559.
  • pSX556 and pSX559 described above are used as templates in PCR reactions using the primers
  • PBRa 246 (5'-CCGGGGATCCAACTAGGCTGGCCCCGGTCCCGG-3 * ) (SEQ ID NO: 13 )
  • PBRa247 (5'-CCGGGGATCCGATGACCCGGCTGACAGTCCTGG-3') (SEQ ID NO: 14) with a Pfu polymerase according to manufacturer's instructions (Stratagene).
  • the fragments are ligated in correct orientation into the mammalian expression vector pcDNA3 (Invitrogen), linearized with BamHI, resulting in two plasmids, pcDNA3-HBP and pcDNA3-HBP pro.
  • Transfection is performed according to the following procedures. 25 ⁇ g of pcDNA3-HBP or pcDNA3-HBP pro is transfected into RBL-1 cells or RBL-2H3 cells (8 x 10 6 cells are transfected using a BioRad Electroporation Apparatus with electric settings 960 uF and 300V as described by Gullberg et al., 1994, J. Biol. Chem. 269:25219-25225 and Garwicz et al., 1995, J. Biol. Chem. 270:28413-28418, or are transfected using LipofecAmine (Gibco, Life Technologies) or Superfect (Qiagen) transfection reagents as recommended by the suppliers.
  • LipofecAmine Gibco, Life Technologies
  • Superfect Qiagen
  • HBP ELISA is a sandwich immunoassay using a monoclonal antibody as catcher and a polyclonal rabbit antibody conjugated to horseradish peroxidase as detector. Antibodies are prepared according to standard procedures by immunizing mice and rabbits with HBP purified from human buffy coat cells (Flodgaard et al..
  • each well is coated with 0.5 ⁇ g monoclonal anti-hHBP dissolved in 100 ⁇ l of PBS overnight.
  • the coated wells are washed three times with a solution of 5% lactose, 0.5% Byco A 0.05% Tween 20 and 0.024% thiomersal. After the last washing, the plates are left to dry at room temperature upside-down on a piece of cloth.
  • the coated plates are rapped with staniol and can be stored up to three months.
  • Purified hHBP is used as reference preparation.
  • a working dilution of 100 ng hHBP/ml is prepared in a BSA-EDTA buffer and stored in aliquots at -80°C for a maximum of two weeks.
  • Serial dilution's containing 0; 0.3; 1 ; 4 and 12 ng hHBP/ml diluted in BSA-EDTA are made fresh and 100 ⁇ l are added to each well.
  • hHBP samples are also diluted in BSA-EDTA buffer and all the samples are in-cubated agitated for 1 hour at room temperature.
  • the wells are emptied and washed three times with phosphate buffered saline followed by the addition of 100 ⁇ l/well diluted (1 : 1000) Fab-peroxidase conjugated rabbit anti-hHBP, and incubated agitated for 1 hour at room temperature.
  • Peroxidase activity is measured using 100 ⁇ l/well TMB perborate substrate solution, resulting in a color formation measurable photometrically at 450 nm.
  • the reference curve is linear when the logarithm to the absorbance is plotted against the logarithm to the dose.
  • Clones with the most pronounced expression are chosen for further experiments, recloned and retested for expression levels.
  • the highest HBP producers are selected and grown into mass culture or adapted to serum free or protein free medium.
  • the isolation of HBP from RBL-1 cells is carried out essentially as described by Rasmussen et al., 1996, FEBS Lett. 390:109-112.
  • the transfected and selected RBL-1 cells are initially filtered to remove any remaining cells and cell debris.
  • the culture medium is subsequently applied to a CM-Sepharose cation-exchange column (Pharmacia and Upjohn), previously equilibrated with 50 mM sodium phosphate, pH 7.3. Unbound and loosely bound materials are eluted with equilibration buffer until baseline is achieved measured by on-line UV detection at 280 nm.
  • the column is then developed with a linear gradient from 0 to 1 M sodium chloride in equilibration buffer.
  • HBP eluted with about 0.7 M sodium chloride and fractions are combined based on UV absorption. Pooled fractions are diluted with two volumes of distilled water and applied on a new CM-Sepharose column. Following equilibration HBP is step eluted with 1 M sodium chloride in equilibration buffer and fractions combined based on absorption at 280 nm. Highly concentrated and pure HBP is obtained by this procedure. Fi- nal purification is carried out on a Sephadex G-25 gel-filtration column (Pharmacia & Upjohn) equipped with a UV-flow cell and equilibrated and eluted with 0.02% trifluoroacetic acid. HBP is collected based on absorption at 280 nm. The gel filtration serves mainly as a buffer exchange step to produce a stable preparation of HBP that is kept at 4°C until use.
  • Day 0 Rat Insulinoma cells (RIN cells) are seeded in 200 ⁇ l medium with 10,000 cells per well.
  • Day 1 After 24 hours the medium is discarded and new medium containing 0, 20 or 50 ⁇ g/ml medium of HBP is added to a total volume of 100 ⁇ l.
  • Day 2 The medium in the wells without HBP is discarded and fresh medium containing 0 or 1500 units IL-1 beta and 20 ⁇ g/ml medium of HBP is added in a total volume of 200 ⁇ l.
  • To the wells pretreated with HBP (cells not attached) 0 or 1500 units IL-1 Beta and 20 ⁇ g/ml medium of HBP is added in a to- tal volume of 100 ⁇ l giving a total volume of 200 ⁇ l.
  • Day 5 The NO content in the medium and the accumulation of insulin are measured.
  • MTT assay succinate dehydrogenase activity. a measure of apoptosis
  • the results are shown in Figures 1 and 2.
  • the numbers 1-6 depict the following: 1 : Control (all media changed after preincub. with HBP, 200 ⁇ l new media with HBP and cytokines added; 2: as 1 but with 20 ⁇ g/ml HBP; 3: as 1 but with 50 ⁇ g/ml HBP; 4: Control (100 ml media (with HBP and 2x cytokines) added on top of 100 ⁇ l HBP preincubation; 5: as 4 but with 20 ⁇ g/ml HBP; 6: as 4 but with 50 ⁇ g/ml HBP. It is evident from the results that treatment of beta cells with HBP results in a decreased apoptosis, but no effect on NO production.
  • Beta cells are pre-incubated with HBP or control vehicle for 24 hours before treatment with varying concentrations of the NO donor, Streptozotocin. After 1-2 days of incubation at standard conditions (37°C, 5% CO 2 ) cells are assayed for apoptosis. The cells pre-incubated with HBP show less or no apoptosis as compared to control incubations. Thus, HBP prevents de- struction of the beta cells.
  • Beta cells are incubated with HBP and Streptozotocin or control vehicle and Streptozotocin for 24 hours.
  • the cells incubated with HBP show less or no apoptosis as compared to control incubations.
  • HBP prevents destruction of the beta cells.
  • Wistar adult rats are pre-treated with a sustained release of HBP or control vehicle from a subcutaneouslv implanted mini osmotic pump on the back. 24 or 48 hours later, the rats are rendered diabetic by intraperitoneal injection of Streptozotocin in the tail. Blood glucose and urinary excretion of glucose and albumin are monitored for 2-3 weeks. The HBP treated rats show a significant lower frequency of diabetes symptoms than the controls. Finally, the animals are sacrificed and histological examination of the pancreas is performed. The HBP treated rats show no or little beta cell destruction.
  • Spontaneously diabetic NOD nonobese diabetic mice are treated with HBP or control vehicle for 1-2 months.
  • the HBP treated mice show a significant lower frequency of diabetes symptoms than the controls.
  • the animals are sacrificed and histological examination of the pancreas is performed.
  • the HBP treated mice show no or little beta cell destruction.
  • Human umbilical vein endothelial cells are isolated by digestion with collagenase
  • Wildtype CHO cells (CHO-Kl) and the heparan sulfate deficient variant (pgsD-677) (Murphy Ulrich et al., 1988, J. Biol. Chem. 272:24363-243670). are grown in F12K Nutrient mixture with Kaighn's modification (GIBCO) supplemented with fetal calf serum and antibiotics.
  • GEBCO Kaighn's modification
  • Recombinant human HBP is produced using a baculovirus expression system in Sf9 insect cells (BRL) and purified as described (Rasmussen et al., 1996, FEBS Lett. 390:109-112).
  • the mouse monoclonal antibody (mab) 2F23C3 and rabbit antisera against recombinant HBP (anti-HBP) were affinity-purified.
  • the antiserum against mitochondrial protein p33/gClqR (anti-p33) was raised in rabbits and affinity-purified (Dedio et al., 1998, J. Immunol
  • mice mab 3G10 recognizing desaturated glucuronate reactive with heparitinase-digested heparan sulfate proteoglycan core proteins has been characterized previously (David et al., 1992, J. Cell Biol. 119:961-975).
  • Texas red-conjugated goat anti-rabbit immunoglobulin IgG and goat anti-mouse IgG are from Jackson ImmunoResearch Laborato- ries Inc.
  • Endothelial cells are cultured in the presence of 100 mCi/ml Na 2 35 SO 4 (specific activity) (Amersham International, Buckinghamshire, UK) or 50 mCi/ml 3 H leucine (Amersham) diluted in endothelial cell culture media. After 24 hours, the cells are washed 4 times with cold phosphate buffered saline (PBS, GIBCO) and lysed for 1 hour at 4°C on a shaker.
  • PBS cold phosphate buffered saline
  • the lysis buffer consisted of 1% Triton-X-100, 20 mM Tris-HCl, 1 mM CaCl,, 1 mM MgCl 2 , 2 mM PMSF, 5 mM 1,10-phenanthroline, 4 mg/ml leupeptin, 4 mg/ml pepstatin A and 100 mg/ml aprotonin at pH 8.0.
  • the lysate is centrifuged at 10,000 g for 30 minutes at 4°C and the pellet is discarded.
  • endothelial cell lysate containing 0.2 M NaCl
  • DEAE Sepharose Fast Flow (Pharmacia Biotech AB, Uppsala, Sweden) pre-equilibrated with 0.2 M NaCl, 20 mM Tris-HCl, 0.1% Triton-X-100 and 1 mM PMSF at pH 8.0.
  • the DEAE-Sepharose is washed with 10 gel volumes of 0.2 M NaCl, 50 mM Na-acetate, 0.1% Triton-X-100, 1 mM PMSF at pH 4.0 and then eluted with 1 M NaCl in buffer A (20 mM Tris HCl, 0.1% Triton-X-100 and 1 mM PMSF at pH 7.4).
  • Biotinylated HBP (5 mg) is bound to 2.5 ml streptavidin-agarose (Sigma). Uncoupled agarose is used as a control column. Successful coupling of HBP to the column is confirmed by SDS PAGE (data not shown) .
  • Equal gel volumes of the HBP- and control agarose are equilibrated at 4°C with buffer A containing 150 mM NaCl, 1 mM CaCl 2 and 1 mM MgCl 2 .
  • the material eluted from the DEAE-Sepharose is dialyzed against equilibration buffer, incubated end over end with the control column for 2 h at 4°C followed by the HBP-column for 2 h at 4°C
  • the HBP- and control columns are washed with 10 gel volumes of equilibration buffer and then eluted with 5 gel volumes each of a discontinuous NaCl gradient ranging from 250 to 1000 mM NaCl in buffer A.
  • Samples from eluted material are separated by 4-16% SDS-PAGE under reducing or non-reducing conditions. Analysis of radioactive material is done on gels exposed to X-ray film or to Fuji Imaging plates (Biolmaging Analyzer Bas2000, Fuji Photo Film Co., LTD, Tokyo, Japan). When the samples contained 3 H-leucine-labeled material, gels are treated with 1.3 M Na-salicylate in 5 mM NaH 2 PO 4 at pH 7 (Chamberlain, 1979, Anal. Biochem. 98:132-135) prior to exposure to X-ray film.
  • Radiolabeled HBP-binding material eluted from the HBP-streptavidin agarose is treated over night at room temperature with either 60 mU/ml CABC (Sigma), 4 U/ml heparinase III (Sigma), or a combination of both in 50 mM Tris-HCl, 0.1 M NaCl at pH 7.3.
  • the samples are treated with HNO, at pH 1.5 for 10 min at room temperature (Shively and Conrad, 1976, Biochemistry 15:3932-3942).
  • Proteoglycans can be separated based on their size in agarose gels where they run as discrete units rather than as a broad smear (Bjornsson, 1993, Anal. Chem. 210:282-291 and Bjornsson, 1993, Anal. Chem.
  • the HBP-affinity purified material is concentrated on 100 ml DEAE-Trisacryl columns (BioSepra S.A., Villeneuve la Garenne Cedex, France) and eluted with buffer A containing 1 M NaCl (5 x 50 ml).
  • the concentrated samples and the sample from the original endothelial cell lysate are doubly digested with 0.5 U/ml CABC (Seikagaku Kogyo, Tokyo, Japan) and 10 mU/ml heparitinase (Seikagaku) in 100 mM NaCl, 1 mM CaCl 2 , 0.1% Triton-X-100, 50 mM 6-amino-hexanoic acid, 20 mg/ml leupeptin, 2.5 mg/ml pepstatin A, 1 mM PMSF and 50 mM HEPES at pH 7.0, for 3 hours at 37°C After separation under non-reducing conditions by 20% SDS-PAGE, materials are transferred onto Zeta-Probe membranes (Bio-Rad laboratories, Hercules, CA, USA) at 70 V, 0.5 mA for 4 hours at 4°C The membranes are blocked in 0.5% casein in PBS (buffer B) containing 0.6 M NaCl over night at 4
  • the membranes are washed once in buffer B containing 0.15 M NaCl and then incubated with rabbit anti-mouse IgG conjugated with alkaline phosphatase diluted 1 :5000 in buffer B containing 0.15 M NaCl. After two washes, bound antibodies are detected using the CSPD detection system (Tropix. Bedford, MA, USA) according to the manufacturer.
  • Protein samples eluted from the HBP-coupled column are separated by 12.5 % SDS-PAGE and transferred onto nitrocellulose membranes for 30 min at 100 mA.
  • the membranes are blocked with 50 mM KH,PO 4 , 0.2 M NaCl. containing 5% w/v dry milk powder and 0.05% w/v Tween 20 at pH 7.4 (buffer C).
  • Transferred proteins are incubated with primary antibodies (anti-rp33, anti-CDR31, anti-MBP, anti-HBP) diluted to 1 mg/ml in buffer C. Bound primary antibodies are detected by a peroxidase-conjugated secondary antibody against rabbit IgG followed by the ECL (Amersham) detection method.
  • Microtiter plates are coated overnight at room temperature with HBP, H-kininogen or a control peptide KLH (1 mg/ml each) in 100 mM sodium acetate and 100 mM NaCl at pH 5.5 (Herwald et al., op. Cit.).
  • Binding of the recombinant fusion protein rp33 or the fusion partner MBP (starting concentration 2 mg/ml. two fold dilutions) to the immobilized proteins is detected by a-MBP (1 :2500 v/v) followed by incubation with a peroxidase-conjugated secondary antibody directed against rabbit IgG (1 :3000 v/v) (Herwald et al., op. cit).
  • the incubation steps are done in a buffer containing 50 mM KH,PO 4 , 0.2 M NaCl. contaimng 2% w/v bovine serum albumin (BSA) and 0.05% w/v Tween 20 at pH 7.4.
  • BSA bovine serum albumin
  • a substrate solution of 0.15% w/v diammonium 2,2-azino-bis-(3-ethyl-2,3-dihydrobenzthiazoline-6- sulfonate), (ABTS), 0.012 % H 2 O 2 in 100 mM citric acid, pH 4.5 is applied for 30 min, and the change in absorbance is determined at 405 nm.
  • HBP surface plasmon resonance spectroscopy
  • CM5 sensor chip Specific interactions between HBP and rp33 are studied using surface plasmon resonance spectroscopy (BIAlite, Pharmacia, Freiburg, Germany).
  • HBP is coupled to a CM5 sensor chip according to the manufacturer's instructions.
  • MBP and rp33 are dissolved in HEPES- Tyrodes buffer in the presence or in the absence of 50 ⁇ M Zn 2" in two fold serial dilution, with a starting concentration of 100 ⁇ g/ml.
  • 30 ⁇ l of each protein sample is applied using a flow rate of 10 ml/min. After 3 min, the chip is washed with PBS to follow dissociation for 3 min. The chip is regenerated by washing with 30 mM HCl.
  • the BIAevaluation 2.0 program (Pharmacia. Freiburg, Germany) is used.
  • Endothelial cells grown to confluency in 12-well plates are washed once in Ml 99 with Hank ' s solution (GIBCO) and then incubated with unconjugated recombinant HBP (50 ⁇ g/ml) diluted in the same media for various periods of time at 37°C
  • HBP unconjugated recombinant HBP
  • the cells are washed twice with 0.5% human serum albumin (Calbiochem, La Jolla, CA. USA) in PBS and once with Ca :" and Mg + free PBS.
  • Cell dissociation solution 500 ⁇ l; Sigma is added, the cells are placed at 37°C for 15 min and then harvested using a cell scraper.
  • the cells After fixation in 1% formaldehyde for a minimum of 1 hour at room temperature, the cells are incubated with a mouse mAb against HBP (25 ⁇ g/ml) in PBS/0.02% azide containing 1% heat-inactivated human serum or the same solution containing 1% saponin (Sigma) and 0.0125% digitonin (Sigma).
  • the cells are incubated with a FITC-conjugated secondary goat-anti-mouse antibody diluted 1:100.
  • the cells (5,000/experiment) are analyzed on a FACSort (Becton Dickinson, Palo Alto, CA, USA) using a FACStation with Cellquest software.
  • the control cells are incubated with either primary or both primary and secondary antibodies but not with HBP.
  • the mean fluorescence intensity (MFI) is calculated on channel values. Results are given as means SD.
  • the endothelial cells are pretreated with NH 4 C1 (50 mM), cytochalasin D (1 ⁇ M) or cycloheximide (1 nM) before addition of HBP (50 ⁇ g/ml).
  • HBP is incubated with heparin (100 ⁇ g/ml) prior to addition of the HBP-heparin mixture to the cells.
  • HBP heparan sulfate proteoglycan deficient CHO cells
  • Endothelial cells grown overnight on microscopic slides are incubated with 50 ⁇ g/ml FITC labeled or unconjugated HBP in Ml 99 with Hank's solution (GIBCO) for various periods of time. After a brief wash with PBS, the endothelial cells are fixed in 4% formaldehyde for 1 hour. Cells are washed with 100 mM glycine for 1 hour and permeabilized with cold methanol for 10 min. Cells are incubated with 1% BSA in PBS prior to incubation with antibodies. The staining steps are performed so as to avoid crossreactions from secondary reagents.
  • the cells are incubated up to 24 hours, fixed in formaldehyde and stained for p33. After 30 min incubation with anti-rp33 (10 ⁇ g/ml), the cells are washed and fixed with a Texas Red-conjugated goat-anti-rabbit IgG. The slides are equili- brated and mounted with SlowFade Antifade (Molecular Probes. Leiden, The Netherlands) according to manufacturer's instructions. The cells are analyzed using a Zeiss LSM 310 (Laser Scan Microscope, Oberkochen, Germany). A 590 nm filter is used to prevent interference of emitted light from the green to the red signal.
  • Zeiss LSM 310 Laser Scan Microscope, Oberkochen, Germany
  • Confluent endothelial cells grown in five 12-well plates were washed once in Ml 99 with Hank's solution (GIBCO). Each plate was incubated with non-conjugated recombinant wildtype HBP (25 mg/ml) in 5 ml of the same buffer for 24 h at 37°C. Cells are washed once with Ca 2" and Mg 2+ free PBS, and scraped from the plates.
  • GEBCO Hank's solution
  • cells After centrifugation (800 x g, 10 min) cells are resuspended in 2.5 ml of 50 mM phosphate, pH 7.4, 0.28 M sucrose, 100 ⁇ g/ml phenylmethanesulfonyl fluoride, 1 ⁇ g/ml aprotinin, 0.5 ⁇ g/ml leupeptin, 1 ⁇ g/ml pepstatin A, 3.6 ⁇ g/ml trans-epoxylsuccinyl-L-leucylamido-(4-guanidino)butane. Washed cells are pressurized with N 2 for 5 min at 350 psi at 4°C and the cavitate is collected.
  • the homogenate is centrifiiged at 800 x g for 10 min and the nuclear pellet PI is discarded.
  • the supernatant (SI) is further analyzed as described earlier Briefly, supernatant S 1 is centrifiiged at 20,000 x g for 20 min and the resulting supernatant S2 is collected.
  • the membrane pellet P2 is washed in 5 ml of 50 mM phosphate buffer containing proteinase inhibitors and centrifuged again.
  • Washed pellet, P2 is resuspended in 1 ml of phosphate buffer containing 12% (w/v) sucrose and layered on top of a 33% (w/v) sucrose cushion (10 ml) followed by centrifugation carried out at 100,000 x g for 3 h.
  • the pellet P3 (vesicular fraction) was resuspended in phosphate buffer.
  • the membranes at the gradient interface were collected, diluted with 30 ml of phosphate buffer and centrifuged (30,000 x g, 45 min).
  • Pellet P4 membrane fraction
  • Centrifugation (100,000 x g, 3 h) of supernatant S2 gave pellet P3 (microsomal fraction) and supernatant S3 (cytosolic fraction). All treatments are performed at 4°C.
  • HUNEC cells are retrieved and subcultured.
  • Cells in passage #1 are trypsinized and seeded (10,000 cells/well in 100 ⁇ l complete growth medium) in 96-well CulturePlates, precoated with gelatine. The cells are cultured overnight to obtain confluence. As a visual control, cells are seeded in parallel in a standard 96-well tissue culture plate ( ⁇ unc).
  • the medium is changed to Ml 99 + 10% FCS, hHBP is added to final concentrations 0, 10 or 50 ⁇ g/ml and the cells are incubated for 24 hours.
  • apoptosis is induced by simultaneously washing away hHBP and changing the medium to either M199 + 10% FCS or M199 without additives.
  • the cells are subse- quently incubated for 24 hours.
  • the D ⁇ A fragmentation is measured by the TU ⁇ EL as described in the kit sold by PharMingen method with a few modifications.
  • culture medium is carefully removed and the cells are fixe by adding 200 ⁇ l 10% formaldehyde buffered in PBS (20 mM phosphate, 150 mM ⁇ aCl, pH 7.4) 0 for 30 min. at room temperature.
  • the cells are washed once with PBS and permeabilized for 5 min. with 100 ⁇ l of a mix of 0.1 % sodium citrate and 0.1 % Triton X-100 at room temperature, followed by a wash with PBS.
  • the TU ⁇ EL reaction is initiated by adding 50 ⁇ l of TU ⁇ EL reaction mix (5 U Tdt enzyme and 0.3 ⁇ l [ 32 P]dCTP/well in 200 mM sodium cacodylate, 25 mM Tris-HCl.
  • the plate is incubated at 37°C for 1 hr. to determine the background level, wells in parallel are incubated with reaction mix without Tdt enzyme. The reaction is terminated by carefully removing the TU ⁇ EL reaction mix and washing the cells twice with PBS. Subsequently, the plate is completely dried under vacuum, 200 ⁇ l of Microscint-PS scintillation fluid is added, the plate is sealed and counted in a microplate scintillation counter (Packard TopCount). The degree of labelling is determined by subtracting the background level from the values obtained in the samples containing Tdt enzyme.
  • HUVEC cells are treated with medium (control) and medium containing hydrogen peroxide as indicated for 18 hours. Apoptosis is determined as described above.
  • HBP is a protein that is almost exclusively synthesized and stored in polymorphonuclear (PMN) leukocytes.
  • PMN leuko- cytes are stimulated from human plasma with increasing concentrations of phorbol myristate acetate (PMA) or f-Met-Leu-Phe (fMLP) in the presence or absence of human umbilical vein endothelial cells (HUVECs).
  • PMA phorbol myristate acetate
  • fMLP f-Met-Leu-Phe
  • HBP umbilical vein endothelial cells
  • Endothelial cells are metabolically labeled with Na 2 [ 35 S]SO 4 to allow incorporation into the glycosaminoglycan chains of proteoglycans.
  • Cells are lysed, the total cellular lysate was applied to DEAE-Sepharose. and the eluted material was affinity-purified on HBP covalenth bound to agarose.
  • the radiolabeled material was eluted from the HBP-column by a step gradient of 250 to 500 mM NaCl, and the resultant fractions were analyzed by SDS-PAGE ( Figure 4A, left panel).
  • the eluted material appears as a broad smear of bands covering a molecular weight range of approximately 40 kDA to > 400 kDa as often found for proteoglycans whereas minor amounts of unspecifically bound material was eluted from the uncoupled matrix (Figure 4A, right panel).
  • a heterogeneous population of [ 35 S]-labeled molecules sticks to the HBP-Sepharose which may - at least in part - represent proteoglycans; these are referred to HBP binding sites.
  • Radioactively labeled material from the HBP column was treated with chondroitinase AB c (C ABC ) t0 remove side chains of chondroitin sulfate and dermatan sulfate, or with HNO, to selectively destroy heparan sulfate side chains.
  • C ABC chondroitinase AB c
  • HNO HNO
  • endothelial cells express six major types of proteoglycans containing glycosamino- glycan of the heparan sulfate type, i.e. perlecan, glypican. and syndecan-1, -2, -3 and —4.
  • Affinity-purified HBP binding sites were treated by double digestion with heparinase III and C ABC to completely remove their heparan side chains (see above).
  • proteoglycans of total HUVEC lysates are run in parallel and identified by the relative molecular masses of their core proteins: syndecan-4 (35 K). syndecan-2 (48 K), glypican (64 K), syndecan-1 (90 K), syndecan-3 (125 K). and perlecan (> 200 K), Figure 4 (right panel. from bottom to top). All the heparan sulfate-containing proteoglycans present in total HUVEC lysates are also present in the HBP-binding fraction (left panel) indicating that they represent docking sites for HBP.
  • HBP internalization process FACS analyses is performed on HUVECs that are preincubated with 50 ⁇ g/ml of HBP for 0.5 h followed by extensive washes to remove the free ligand (Figure 5A).
  • Permeabilized HUVECs showed a significantly higher mean fluorescence index (MFI) than intact cells suggesting that a significant fraction of the exogenously applied HBP had entered the cells.
  • MFI mean fluorescence index
  • Incubation in the absence of HBP resulted in a MFI similar to that of intact cells indicating that the ligand had been effectively removed.
  • Preincubation of the cells with 100 ⁇ g/ml of heparin effectively prevented uptake of HBP.
  • HBP internalization possibly due to competition with HBP for binding sites on heparan sulfate-containing proteoglycans.
  • Incubation at 4°C significantly decreased HBP internalization for permeabilized HUVECs but not for non-permeabilized cells demonstrating that HBP internalization is an energy-dependent process.
  • Addition of NH4C1 which has been shown to interfere with ligand release from internalized receptors thus leading to destruction rather than recirculation of internalized receptors (Gekle et al, 1995, Am. J. Physiol. 268:F899-906 and Rao et al., 1983, FEBS Lett. 160:213-216) drastically reduces HBP internalization.
  • Cytochalasin D an inhibitor of actin filament polymerization (Cooper, 1987, J. Cell Biol 105:1473-1478), lowers HBP internalization by 40.6%, whereas cycloheximide, an inhibitor of protein synthesis (Ennis, 1964, FEBS Lett.399:255-258), diminishes HBP internalization.
  • Colchicine an inhibitor of microtubulus assembly (Olmstead and Borisy, 1973, Ann. Rev. Biochem. 42:507-540) decreases HBP internalization by 21%.
  • heparan sulfate proteoglycan-deficient Chinese hamster ovary (CHO) cells, pgsD-677 (Murphy-Ulrich et al, 1988, J. Biol. Chem. 272:24363-243670) and the corresponding wild-type CHO cells are used to study HBP internalization by FACS analysis.
  • the cells are incubated with 50 ⁇ g/ml HBP for various periods of time, and HBP content is analyzed in fixed and permeabilized cells (Figure 5B). Progressive internalization of exogenously added HBP was seen over 3 hours with the wild-type CHO cells.
  • Heparan sulfate-deficient cells also internalized HBP though at a considerably lower efficiency: internalization was decreased by 33% (30 min), 38% (lh) and 57% (3h), respectively in pgsD-677 cells compared to wild-type CHO-Kl (100% at each time point).
  • This finding suggests that heparan sulfate-type proteoglycans are involved in HBP internalization though other sites capable of internalizing HBP must exist, e.g. chondroitin sulfate-containing proteoglycans known to be overexposed by pgsD-677 cells (Murphy-Ullrich, 1988, op. cit.).
  • HBP human protein
  • HBP binds with p33/gClqR. Because internalized HBP colocalizes with p33/gClqR in the vesicular fraction of HUVECs double stainings for the two proteins are performed. Endothelial cells are incubated with FITC-labeled HBP for up to 24 h, fixed and double-stained for p33 using antibodies to human p33 (from rabbit) followed by a Texas red-conjugated anti-rabbit immunoglobulin (from goat). Both FITC-conjugated HBP (green) and p33/gClqR (red) are prominent in parnuclear spots (Figure 8A).
  • HUVECs are incubated for 24 hours with hHBP at the indicated concentrations.
  • the medium is changed and the preincubation is followed by an 18 hours incubation in serum-free medium, to induce apoptosis.
  • Control cells are incubated with Ml 99 supplemented with 10% FCS.
  • DNA fragmentation is measrued by a TUNEL method.
  • the results are shown in Figure 9. They indicate that there is a decrease in apoptosis in hHBP treated cells.
  • HUVEC cells are treated with medium (control) and medium containing hydrogen peroxide as indicated for 18 hours in the presence or absence of hHBP for 18 hours. Apoptosis is determined as above.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Zoology (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pain & Pain Management (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Rheumatology (AREA)
  • Transplantation (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Urology & Nephrology (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne l'utilisation d'une protéine de liaison à l'héparine pour assurer la modulation ou la diminution de l'apoptose des cellules de mammifères. Le procédé selon l'invention consiste à administrer au mammifère une quantité efficace d'une protéine de liaison à l'héparine ou d'un fragment pharmaceutiquement actif de cette dernière.
PCT/DK1998/000510 1997-11-20 1998-11-20 Utilisation de proteine de liaison a l'heparine pour la modulation ou la prophylaxie de l'apoptose des cellules de mammiferes WO1999026647A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU13336/99A AU1333699A (en) 1997-11-20 1998-11-20 Use of heparin-binding protein for the modulation or prophylaxis of apoptosis ofmammalian cells
EP98956825A EP1032412A1 (fr) 1997-11-20 1998-11-20 Utilisation de proteine de liaison a l'heparine pour la modulation ou la prophylaxie de l'apoptose des cellules de mammiferes
JP2000521849A JP2002505252A (ja) 1997-11-20 1998-11-20 哺乳類細胞のアポトーシスの調整又は予防のためへのヘパリン−結合タンパク質の使用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DK132497 1997-11-20
DK1324/97 1997-11-20
DK1394/97 1997-12-03
DK139497 1997-12-03

Publications (1)

Publication Number Publication Date
WO1999026647A1 true WO1999026647A1 (fr) 1999-06-03

Family

ID=26065587

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK1998/000510 WO1999026647A1 (fr) 1997-11-20 1998-11-20 Utilisation de proteine de liaison a l'heparine pour la modulation ou la prophylaxie de l'apoptose des cellules de mammiferes

Country Status (4)

Country Link
EP (1) EP1032412A1 (fr)
JP (1) JP2002505252A (fr)
AU (1) AU1333699A (fr)
WO (1) WO1999026647A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000026352A1 (fr) * 1998-11-04 2000-05-11 Chugai Research Institute For Molecular Medicine, Inc. Nouvelles serine proteases de la famille de la trypsine
WO2001016285A2 (fr) * 1999-08-31 2001-03-08 Novozymes A/S Nouvelles proteases et leurs variants
WO2003080660A2 (fr) * 2002-03-27 2003-10-02 Leukotech A/S Procede de preparation d'une proteine de liaison a l'heparine (hbp) mammifere recombinee
US7217554B2 (en) 1999-08-31 2007-05-15 Novozymes A/S Proteases and variants thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4028012A1 (fr) * 2019-09-09 2022-07-20 Christian-Albrechts-Universität zu Kiel Composé pour inhiber la mort cellulaire

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996028544A1 (fr) * 1995-03-09 1996-09-19 Novo Nordisk A/S Conjugue proteine-lipide, constitue de la proteine fixant l'heparine et d'un analogue d'un ceramide, et son utilisation pharmaceutique pour le traitement de troubles lies a des lesions causees a des cellules par diverses agressions

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996028544A1 (fr) * 1995-03-09 1996-09-19 Novo Nordisk A/S Conjugue proteine-lipide, constitue de la proteine fixant l'heparine et d'un analogue d'un ceramide, et son utilisation pharmaceutique pour le traitement de troubles lies a des lesions causees a des cellules par diverses agressions

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DIALOG INFORMATION SERVICES, File 155, Dialog Accession No. 09343439, MEDLINE, Medline Accession No. 98042252, BARASCH J. et al., "Ureteric Bud Cells Secrete Multiple Factors, Including bFGF, which Resuce Renal Progenitors from Apoptosis"; & AM. J. PHYSIOL., (United States), Nov. 1997, 273 (5 Pt 2), p. F757-F767. *
DIALOG INFORMATION SERVICES, File 155, MEDLINE, Dialog Accession No. 09354396, Medline Accession No. 98060597, ZUSHI S. et al., "Role of Heparin-Binding EGF-Related Peptides in Proliferation and Apoptosis of Activated Ras-Stimulated Intestinal Epithelial Cells"; & INT. J. CANCER, (United States), 10 Dec. 1997, 73(6), p. *
DIALOG INFORMATION SERVICES, File 155, MEDLINE, Dialog Accession No. 09354776, Medline Accession No. 98049575, TAKEMURA T. et al., "The Membrane-Bound form Heparin-Binding Epidermal Growth Factor-Like Growth Factor Promotes Survival of Cultures Renal Epithelial Cells"; & J. BIOL. CHEM., (United States), 5 Dec. 1997, *
DIALOG INFORMATION SERVICES, File 73, EMBASE, Dialog Accession No. 05701574, EMBASE Accession No. 1994116083, SMALL D.H. et al., "A Heparin-Binding Domain in the Amyloid Protein Precursor of Alzheimer's Disease is Involved in the Regulation of Neurite Outgrowth"; & JOURNAL OF NEUROSCIENCE, (J. NEUROSCI.) (United *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000026352A1 (fr) * 1998-11-04 2000-05-11 Chugai Research Institute For Molecular Medicine, Inc. Nouvelles serine proteases de la famille de la trypsine
WO2001016285A2 (fr) * 1999-08-31 2001-03-08 Novozymes A/S Nouvelles proteases et leurs variants
WO2001016285A3 (fr) * 1999-08-31 2001-09-13 Novozymes As Nouvelles proteases et leurs variants
US7217554B2 (en) 1999-08-31 2007-05-15 Novozymes A/S Proteases and variants thereof
US7537922B2 (en) 1999-08-31 2009-05-26 Novozymes A/S Proteases and variants thereof
EP2206786A1 (fr) * 1999-08-31 2010-07-14 Novozymes A/S Nouvelles protéases et variantes associées
US7901918B2 (en) 1999-08-31 2011-03-08 Novozymes A/S Proteases and variants thereof
EP2336331A1 (fr) * 1999-08-31 2011-06-22 Novozymes A/S Nouvelles protéases et variantes associées
US8119386B2 (en) 1999-08-31 2012-02-21 Novozymes Als Proteases and variants thereof
WO2003080660A2 (fr) * 2002-03-27 2003-10-02 Leukotech A/S Procede de preparation d'une proteine de liaison a l'heparine (hbp) mammifere recombinee
WO2003080660A3 (fr) * 2002-03-27 2003-12-18 Leukotech As Procede de preparation d'une proteine de liaison a l'heparine (hbp) mammifere recombinee

Also Published As

Publication number Publication date
EP1032412A1 (fr) 2000-09-06
JP2002505252A (ja) 2002-02-19
AU1333699A (en) 1999-06-15

Similar Documents

Publication Publication Date Title
US6228834B1 (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
Scoles et al. Neurofibromatosis 2 tumour suppressor schwannomin interacts with βII-spectrin
CA2367750C (fr) Tribonectines
AU772778B2 (en) Novel inhibitors of angiogenesis and tumor growth
US6960562B2 (en) Tribonectin polypeptides and uses thereof
US6994974B1 (en) Intracellular amyloid-beta binding (ERAB) polypeptide-related assays
KR100682666B1 (ko) 항혈관형성 단백질 및 이들을 사용하는 방법
US20030171547A1 (en) Adipocyte-specific protein homologs
KR20030067755A (ko) 글루코세레브로시다제 활성을 갖는 이관능성 융합 단백질
IL199316A (en) An antibody is cleared and a kit that includes it for diagnosing retinal dystrophy
US20030220490A1 (en) Cell membrane directed drugs
AU632474B2 (en) 14-beta-gal mammalian lectins
WO2005121340A1 (fr) Nouvelle protéine de modification galectine 8 et utilisation de celle-ci
CA2237051A1 (fr) Affinite amelioree de peptides lies a l'hyaluronan
US7001881B1 (en) Tribonectins
JP4979867B2 (ja) 新規なｒｇ１ポリペプチドをコードするｄｎａ
EP1032412A1 (fr) Utilisation de proteine de liaison a l'heparine pour la modulation ou la prophylaxie de l'apoptose des cellules de mammiferes
RU2200573C2 (ru) Связывающий гепарин белок для лечения сепсиса
CA2227972A1 (fr) Une protease du venin du cobra, la mocarhagine, et ses utilisations therapeutiques
WO2000043027A1 (fr) Utilisation d'une proteine inhibitrice du complement viral dans le traitement et le diagnostic de la maladie d'alzheimer
WO1999003489A2 (fr) Procedes et compositions permettant de reguler le transport des proteines dans le noyau
US6803450B2 (en) Adipocyte-specific protein homologs
US7547676B2 (en) Antagonist peptides to the C5A chemotactic function of vitamin D binding protein
US6759047B1 (en) Anti-angiogenic proteins and methods of use thereof
RU2820132C2 (ru) Способ улучшения симптомов со стороны нижних мочевыводящих путей

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 1998956825

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: KR

WWP Wipo information: published in national office

Ref document number: 1998956825

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

WWW Wipo information: withdrawn in national office

Ref document number: 1998956825

Country of ref document: EP