WO1999011801A2 - Protease based gene switching system - Google Patents
Protease based gene switching system Download PDFInfo
- Publication number
- WO1999011801A2 WO1999011801A2 PCT/GB1998/002596 GB9802596W WO9911801A2 WO 1999011801 A2 WO1999011801 A2 WO 1999011801A2 GB 9802596 W GB9802596 W GB 9802596W WO 9911801 A2 WO9911801 A2 WO 9911801A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protease
- gene
- transcription factor
- cleavage site
- expression
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/503—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/033—Fusion polypeptide containing a localisation/targetting motif containing a motif for targeting to the internal surface of the plasma membrane, e.g. containing a myristoylation motif
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
- C07K2319/81—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding
Definitions
- the present invention relates to materials and methods for protease-based gene switching systems. It also relates to the use of such materials and methods in the identification of substrates and inhibitors of proteases and in the design of altered specificity proteases.
- proteases are involved in both intracellular and extracellular processes. Proteases are also essential in the propagation of pathogenic organisms. For these reasons, proteases are important targets for therapeutic agents. For example, inhibitors of angiotensin-converting enzyme, such as captopril, have been used since the early 1980s in the treatment of hypertension (Materson and Preston, 1994). Amongst infectious agents, the identification of human immunodeficiency virus (HIV) protease inhibitors has led to new therapies for HIV infection (Richman, 1996).
- HIV human immunodeficiency virus
- Proteases may be useful agents in themselves. Delivery of a gene encoding a protease to a target cell could result in the cleavage and alteration in activity of selected proteins.
- Proteases may be used in industrial or pharmaceutical processes to generate mature proteins or degrade undesirable proteins.
- an in vitro assay is used. This requires a sample of the protease, isolated from either a natural source, or expressed from the gene encoding the protease in a heterologous system.
- a recombinant cell is configured so that some easily measurable property of a cell is made dependent upon the activity of a protease expressed within a cell.
- Such genetic systems for proteases are generally designed by incorporating a cleavage site for the protease into a target protein so that when the protease cleaves the target protein, the function of the target protein is lost. For example, McCall et al.
- ⁇ -galactosidase activity is low in a cell containing both the protease and the modified enzyme, but high in a cell which contains only the modified enzyme.
- Protease cleavage sites have also been introduced into transcription factors so that cleavage of the transcription factor results in the loss of transcriptional activation capacity through separation of the activation domain and DNA binding domain (Smith and Kohorn, 1991; DasMahaptra et al, 1992).
- An analogous approach has been taken to ⁇ repressor, a prokaryotic gene regulator (Sices and Kristie, 1998).
- An HIV-1 protease site was inserted between the DNA binding domain and the dimerisation domain. This modified ⁇ repressor is functional, but is non-functional when cleaved by the HIV-1 protease.
- An alternative approach to the design of genetic systems for proteases is suggested in
- Hirowatari (1995) which is to use protease cleavage to activate, rather than abolish, a property of the substrate protein by releasing a transcription factor from an inactive membrane-bound precursor.
- transcription factors are synthesised in an inactive form, where inactivation is due to the association of the transcription factor with a membrane (reviewed by Pahl and Baeuerle, 1996).
- the transcription factor SREBP-1 activates genes involved in sterol biosynthesis. This protein is naturally synthesised with an amino terminal extension which anchors it to the membrane of the endoplasmic reticulum (Wang et al, 1994).
- the membrane anchor is derived from the same protein as the protease cleavage site.
- yeast two-hybrid assay system two fusion proteins are expressed, preferably in a yeast cell, so that interaction of the two proteins results in activation of a target gene (Fields and Song, 1989).
- two proteins are also expressed, a protease and a substrate fusion protein. Cleavage of the substrate fusion protein by the protease results in target gene activation.
- the event of interest leads to target gene activation, and in both cases the systems may be configured in yeast cells, which are particularly amenable to genetic manipulation and for use in screening (Sherman, 1991).
- a heterologous cell which comprises: (i) a transcription factor precursor which comprises a transcription factor linked to a membrane anchoring domain via a protease cleavage site, in which the membrane anchoring domain and protease cleavage site are not derived from the same protein;
- a protease which recognises the protease cleavage site in the transcription factor precursor; and (iii) a target gene under the control of the transcription factor, wherein if cleavage of the protease cleavage site by the protease is allowed to occur subsequent release of the transcription factor enhances expression of the target gene.
- the target gene is not expressed, or is expressed at low levels, when cleavage of the transcription factor precursor is prevented, but when cleavage is allowed to proceed the transcription factor is released and expression of the target gene, or genes, is measurably increased.
- the protease cleavage site may be altered, the specificity of the protease may be altered, or a molecule may interfere between the protease and the protease cleavage site.
- the above system is constructed in such a manner that the effects of any such changes may be directly measured by monitoring expression of the target gene.
- a particularly useful membrane localisation domain is the amino terminal region of the enzyme hydroxymethylglutaryl coenzyme A reductase (HMG-CoA reductase).
- HMG-CoA reductase from Saccharomyces cerevisiae S. cerevisiae
- has an amino terminal region with seven transmembrane helices Basson et al, 1988.
- Other proteins which contain different numbers of transmembrane helices, such as members of the HMG-CoA reductase family from other organisms (Hampton et al.
- lipid membrane anchors may be used.
- peptide sequences which are substrates for myristoylation (Pellman et al, 1985) or farnesylation and farnesylation-dependent modification (Hancock et al. , 1991) may be used in place of transmembrane peptide domains.
- the transcription factor can be a natural transcription factor, a chimaeric factor containing functional domains from different proteins, for example a DNA binding domain linked to an activation domain, or it may contain synthetic domains.
- DNA binding domains which may be used include those of the S. cerevisiae factor Gal4 (Keegan et al, 1986), the E. coli protein LexA (Brent and Ptashne, 1981) and a variety of other proteins such as those listed by Harrison (1991).
- Transcriptional activation domains include naturally-occurring domains, such as the activation domain of herpes simplex virus VP16 protein (Iriezenberg et al, 1988) and the activation domains of Gal4 (Ma and Ptashne, 1987a) as well as acidic domains generated from semi-random sequence libraries (Ma and Ptashne, 1987b). Other activation domains have been listed by Triezenberg (1995).
- the transcription factor does not need to bind directly to DNA but may instead bind to proteins which do bind to DNA.
- the transcription factors, or proteins to which the transcription factors bind will bind to promoter/enhancer sequences upstream from the target gene. Such sequences are well known in the literature and are described in the above references.
- the cell types within which such a system may be configured include: prokaryotic cells (E. coli); eukaryotic cells such as those of the model organisms budding yeast (S. cerevisiae), fission yeast (Schizosaccharomyces pombe), the fruit fly (Drosophila melanogaster), the nematode worm Caenorhabditis elegans) and the plant Arabidposis thaliana; maize (Zea mays); and mammalian cells such as primary human cells, established human cell lines, primary mouse cells and established mouse cell lines.
- prokaryotic cells E. coli
- eukaryotic cells such as those of the model organisms budding yeast (S. cerevisiae), fission yeast (Schizosaccharomyces pombe), the fruit fly (Drosophila melanogaster), the nematode worm Caenorhabditis elegans) and the plant Arabidposis thaliana
- maize Ze
- the target gene used to measure the output of the system may be one which produces an easily measurable gene product (a target or reporter gene) such as E. coli ⁇ -galactosidase (Casadaban et al 1983), firefly luciferase (de Wet et al, 1987), E. coli chloramphenicol acetyl transferase (Gorman et _/., 1982), E.coli ⁇ -lactamase (Zlokarnik et al, 1998) or green fluorescent protein (Chalfie et al, 1994).
- the target gene may be a toxic gene, and activation of this gene through the action of the protease will result in cell death.
- the target gene may be a useful gene which requires regulation.
- the target gene may be under the control of a protease-dependent gene switch.
- a gene switch is a system in which a gene of interest is turned off or is largely inactive, or alternatively is turned on, in one state, but may be switched on, or off, by some alteration in the cell.
- One type of gene switch employs small molecules to effect the switch, for example, tetracycline-regulatable gene switches have been described in mammalian cells (see Shockett and Schatz, 1996).
- tetracycline can either activate or repress a gene, depending on how the system is configured.
- a different type of gene switch in which the switching event is effected by a protease.
- the advantage of this system is the high degree of control which may be obtained; in the absence of protease or where the activity of the protease is blocked, the target gene can be effectively completely inactive. In the presence of the protease, or absence of an inhibitor, it can be activated to a high level.
- Control of the switch may be exerted in the expression or the activity of the protease, for example in the use of a modulator (inhibitor or activator) of the protease, or a modulator of the level of expression of the protease.
- a modulator inhibitor or activator
- a modulator of the level of expression of the protease it would be possible, for example, to place the gene encoding the protease under the control of a tetracycline-regulatable promoter and achieve protease regulation through tetracycline. This may be superior to regulating the target gene with tetracycline itself, since the insertion of the protease system between the tetracycline- regulatable promoter and the target gene introduces an amplification step.
- a gene switch mechanism comprising: (i) a transcription factor linked to a membrane anchoring domain via a protease cleavage site; (ii) a protease which recognises the protease cleavage site in the transcription factor precursor; and (iii) a gene placed under the control of the transcription factor, whereby enhanced expression of the gene occurs after cleavage of the protease cleavage site by the protease and thereby expression of the gene may be modulated by directly or indirectly affecting the activity or expression of the protease.
- a further aspect of the invention relates to the possibility of identifying peptide substrates for a protease using a cell configured in accordance with the invention. Identifying the peptide substrates for proteases is useful in that (i) they provide information which may lead to the discovery of the substrate protein, thus elucidating the biological function of the protease (ii) they provide substrates which can be used in in vitro assays to screen for inhibitors of the proteases (iii) derivatives of the substrates may in themselves be inhibitors of the proteases.
- This family includes the enzyme TNF ⁇ - converting enzyme, considered to be a target for therapeutic agents in inflammation (Black et al, 1997; Moss et al, 1997). However, the substrate proteins of most members of this family remain unknown (Blobel, 1997).
- One route to the identification of peptide substrates is to select from a library of potential substrates the sequences which are substrates for the protease. This allows the definition of a consensus sequence for the cleavage site for the protease. Using bioinformatic search tools, databases of protein sequences can then be searched for sequences which correspond to this consensus. The existence of the consensus sequence within a protein will indicate that the protein is a potential substrate for the protease.
- Methods for determining the cleavage sites of proteases by selecting substrates from peptide libraries currently rely upon in vitro techniques.
- One such method employs phage display of peptide libraries (Matthews and Wells, 1993).
- a library of peptides is constructed and expressed on the surface of bacteriophages so that if cleavage occurs at one of these sequences then they are not retained upon an affinity column. Determination of the DNA sequence of the gene encoding the peptides which are not retained on the column allows deduction of the cleavage sites for proteases.
- This method was employed in the analysis of the specificity of stromelysin and matrilysin (Smith et al, 1995).
- a second approach uses the activity of proteases against mixtures of substrates to derive information about protease cleavage sites (see for example Berman et al, 1992; Petithory et al, 1991).
- a version of this approach positional scanning of synthetic combinatorial libraries (Pinilla et al, 1992), was applied to the interleukin-l ⁇ converting enzyme to reveal a novel consensus sequence (Rano et al. , 1997). An aldehyde derivative of this novel consensus sequence was a potent inhibitor of the enzyme.
- a library of such precursors is constructed such that each precursor contains a different sequence between the membrane anchor and the transcription factor. This library is then introduced into cells which contain the protease and the target gene. Cells in which the target gene becomes activated will therefore have expressed a precursor which contains a cleavage site for the protease. Upon recovery of the gene encoding the precursor from these cells, the sequence of the cleavage site may be deduced from the sequence of the DNA which encodes it. Combination of the results of several such screens will allow a consensus sequence to be deduced.
- this system is an intracellular system, so that no purification or expression of any protease is required; only a DNA sequence encoding the protease is required. This allows an assessment of the activity of a protease in a cellular environment. Therefore in a further aspect of the invention we provide a method for identifying a substrate peptide sequence of a protease, which method comprises:
- sequence of the putative protease cleavage site introduced into each cell is not known, for example where the sequences are generated by random mutagenesis or a peptide library is generated by combinatorial techniques, then the following additional steps are required in order to elucidate the sequence.
- a further aspect of the invention relates to methods for altering the specificity of proteases.
- Many proteases display specificity for the amino acid sequence surrounding the peptide bond which they cleave. If this sequence specificity could be altered then it might be possible to design proteases which would cleave target proteins at desired sites.
- Such reagents could be useful therapeutic agents. For example they could be used to cleave viral proteins and so prevent a viral infection. Attempts to alter protease specificity have had some limited success.
- two approaches have been taken to the alteration of the substrate specificity of proteases (Leis and Cameron, 1994). In the first approach, the three dimensional structure of the protease is known and is used to predict the effects that amino acid side chain alterations will have upon substrate recognition.
- sequence 1 may be introduced into a precursor protein to create precursor 1.
- the target gene is activated.
- Sequence 2 may be introduced into the precursor protein to create precursor 2.
- the target gene is not expressed.
- the gene encoding the protease is then subjected to some form of mutagenesis and the mutated protease genes are introduced into cells containing precursor 2 and the target gene.
- the protease is now capable of cleaving precursor 2.
- the genes encoding the proteases may be recovered from these cells and the sequence of the new proteases deduced from the DNA sequences of the genes. New proteases obtained in this manner may be able to recognise sequence 2 but not sequence 1 , in which case we may speak of the specificity of the proteases having been altered. Alternatively they may be able to cleave both sequence 1 and 2, in which case we may described their specificity as having been relaxed.
- the reverse procedure may also be carried out if it is desirable to obtain a protease which does not recognise a certain site.
- a sequence which the protease does cleave is introduced into the precursor protein.
- the target gene is activated.
- the gene encoding the protease is then subjected to some form of mutagenesis and the mutated protease genes are introduced into the cell containing the precursor and the target gene.
- the protease is now either incapable of cleaving the precursor protein, or has a reduced ability to cleave respectively.
- the genes encoding the proteases may be recovered from these cells and the sequence of the new protease deduced from the DNA sequence of the gene. In this way it may be possible to "restrict" the specificity of a protease. If a protease recognises several substrates (i.e. has a broad substrate range) it may be possible to restrict the specificity of the protease so that it only recognises one substrate. This is useful in designing therapeutics that will have few side effects. Therefore in a further aspect of the invention we provide a method for altering the specificity of a protease which method comprises:
- sequence of the protease introduced into each cell is not known, for example where the sequences are generated by random mutagenesis or a peptide library is generated by combinatorial techniques or gene shuffling techniques are used, then the following additional steps are required in order to elucidate the sequence.
- protease cleavage site and the membrane binding domain are derived from different proteins.
- Table 1 lists the plasmids used in Example 1.
- the first column gives the plasmid reference number.
- the second column (“Marker") indicates which selectable marker the plasmids contain.
- the third and fourth column describe the expression cassette which is located within each plasmid.
- the third column gives the promoter region which is used (either ACT I (actin gene promoter) or ADHl (alcohol dehydrogenase gene promoter) from S. cerevisiae).
- the fourth column describes the coding region which is under the control of the promoter.
- Gal is the DNA binding domain of Gal4;
- mVP is an activation domain;
- HMG is the amino terminal region of the Hmgl protein;
- tev is the wild type cleavage site for TEV protease;
- TEV protease comprises a methionine fused to amino acids 2051-2279 of the tobacco etch virus polyprotein.
- Table 2 displays the activity of the lacZ reporter gene in the S. cerevisiae strain NLY2::185 transformed with different combinations of plasmids (see Example 1).
- the first column indicates the number of the transformation.
- the second column indicates which proteins are being expressed within the cells.
- the third column indicates which plasmids have been transformed into the NLY2::185 cells.
- the fourth column indicates the supplements omitted from the medium (thus UHL- indicates that uracil, histidine and leucine were omitted).
- the final two columns indicate the reporter gene activity as scored by the blue colour on X-Gal indicator plates (fifth column) and as measured in liquid culture in mOD/min per OD of culture (sixth column).
- Table 3 shows the results of an alanine scan performed on the TEV protease cleavage site (see Example 2). Plasmids encoding the wild type and variant TEV protease cleavage site were cotransformed into NLY2::185 with a plasmid encoding the TEV protease (LDD208) and selected on UHL- media. Cleavage of the wild type site occurs between the Q and S residues of the sequence ENLYFQS. Q is designated position -1 and S as position +1.
- the sixth column shows the activity of the reporter gene as measured using a liquid assay. For each member of the alanine scan, approximately 20 colonies were taken in a single loop. The resulting culture was assayed three times; the final column shows the mean and standard deviation of these measurements.
- Table 4 shows different ways in which the specificity profile of a protease can be changed.
- the "profile" of the parental protease may be characterised against a variety of related cleavage sites.
- the parental protease may be capable of cleaving a wild type cleavage site and variant 1, but not variant 2 (column 2); this profile of activity is the "wild type” profile.
- a derivative of the protease retains the ability to cleave at the wild type site and variant 1 but can also cleave variant 2, then the specificity of the protease in this derivative is "relaxed" (column 3).
- protease can cleave at the wild type site but cannot cleave either variant 1 or 2
- specificity of the protease in this derivative is "restricted” (column 4).
- Protease derivatives may also be obtained which have lost the ability to cleave the wild type cleavage site but have gained the ability to cleave at a site not recognised by the parental protease (variant 2). In this case the specificity of the protease has been "altered” (column 4).
- Table 5 displays the effects of deletions of the TEV protease upon the specficity of the protease. Plasmids encoding proteases were transformed with the cleavage site variants indicated in the first column. The results of the transformation were scored on X-Gal indicator plates and were also measured using the liquid ⁇ -galactosidase assay. For each transformation, approximately 20 colonies were taken in a single loop. The resulting culture was assayed three times; the final column shows the mean and standard deviation of these measurements.
- Figure 1 is a diagram illustrating the design of a protease-dependent gene switch.
- the cell on the left contains: a membrane (1); a transcription factor fusion (2-5) comprising a membrane anchoring domain (2), a protease cleavage site (3), a DNA binding domain (4) and a transcription activation domain (5); and a target gene comprising a promoter containing one or more binding sites for the DNA binding domain (6) and the transcribed region of the gene (7).
- the target gene is switched off since the transcription factor is membrane anchored and is unable to activate transcription.
- a protease (8) which can act at the protease cleavage site has been expressed. Cleavage of the transcription factor fusion results in release of a transcription factor which can bind the promoter of the target gene and activate target gene expression (indicated by the arrow).
- FIG. 2 shows the structures of the transcription activator fusions used in Example 1 (see also Table 1).
- Plasmid LDD883 encodes the activator Gal-mVP.
- the coding region comprises a methionine linked to amino acids 2-147 of S. cerevisiae Gal4 (the DNA binding region of Gal4 (abbreviated to “Gal” here) linked to a 28 amino acid peptide which contains two repeats of the sequence LDDFDLDMLG. This 28 amino acid region is the activation region referred to as minimal VP16 (abbreviated to "mVP").
- the fusion of the Gal4 DNA binding domain to the activation domain is illustrated in the box at the bottom of the figure and is referred to as "Activator" in the other portions of this figure.
- LDD1123 encodes the protein tev-Gal-mVP, which comprises a peptide containing a TEV protease cleavage site (abbreviated to "tev”) fused to the amino terminus of Gal-mVP.
- TEV protease cleavage site is underlined.
- Plasmid LDD1117 encodes the protein HMG-Gal-mVP, which comprises the amino terminal region of the S. cerevisiae Hmgl protein (abbreviated to "HMG”) fused, via a 9 amino acid linker, to the amino terminus of Gal-mVP.
- the plasmid LDD882 encodes the activator HMG-tev-Gal-mVP, which is identical to HMG-tev-Gal-mVP except for the addition of a TEV protease cleavage site (underlined) to the linker region separating HMG and Gal-mVP.
- FIG. 3 shows the structures of the tobacco etch virus (TEV) protease and the deletions of this protease used in Examples 1-3.
- the numbers refer to the sequence of the polyprotein encoded by the tobacco etch virus.
- the protease referred to as "full length" in this work comprises a methionine fused to amino acids 2051 -2079 and is encoded by plasmid LDD208.
- LDD855 encodes a version of TEV protease in which the C-terminal deletion 16 amino acids are deleted. This deletion is referred to as TEV protease[ ⁇ C-16].
- LDD859 encodes a version of TEV protease in which a region of 10 amino acids has been deleted. This deletion is referred to as TEV protease [ ⁇ I-10]
- Example 1 a protease-dependent gene switch
- protease and its substrate are well defined.
- the protease has a molecular weight of 49kdal and is encoded by an open reading frame of 430 amino acids. However, only the amino terminal 229 residues are required for activity of the protease (Dougherty and Carrington, 1988).
- the protease cleaves the viral polyprotein at several positions.
- TEV protease does not appear to require activation from an inactive form, but rather is constitutively active. Therefore, no other components other than a gene encoding the protease open reading frame needs be introduced into a cell in order to express an active TEV protease.
- TEV protease is not toxic when expressed in yeast cells (S. cerevisiae; Smith and Kohorn, 1991; DasMahapatra et al, 1992) and in bacterial cells (E. coli: Marcos and Beachy, 1994, Mondigler and Ehrmann, 1996).
- TEV protease As a substrate for TEV protease we designed the following transcription factor precursor (as illustrated in Figure 1). As a membrane localisation domain, we selected the amino terminal region of the S. cerevisiae HMG-CoA reductase enzyme (Hmglp). The amino terminal region of this protein (amino acids 1-526) contains seven transmembrane spanning regions and is inserted into the membrane of the endoplasmic reticulum (ER) so that the carboxy terminus is exposed to the cytoplasmic face the ER (Basson et al, 1988; Senstag et al, 1990).
- Hmglp S. cerevisiae HMG-CoA reductase enzyme
- the transcription factor precursor comprises the HMGlp amino terminal domain linked to a consensus cleavage site for TEV protease which in turn is linked to a transcription factor consisting of a DNA binding domain fused to a transcription activation domain.
- the DNA binding domain is derived from the S. cerevisiae protein Gal4 (Keegan et al., 1986) and the activation domain is based on the herpes simplex virus VP16 transcription activation domain (Triezenberg et al ., 1988).
- the budding yeast S. cerevisiae As a host cell we used the budding yeast S. cerevisiae.
- E. coli lacZ gene As a target gene for the transcription factor fusion we employed the E. coli lacZ gene, which has been used in a number of studies to measure the strength of Gal4-based transcription factors (for example Ma et al 1987a; 1987b).
- Plasmids in this and the following examples were constructed using fragments of existing plasmids, fragments obtained from other plasmids by the polymerase chain reaction and synthesised oligonucleotides. These were linked together by standard techniques (Sambrook et al, 1989). For each plasmid we describe the structure of the final plasmid, rather than describing the steps by which the plasmid was made. It will be apparent to the person of ordinary skill that there are many possible steps by which the plasmids we described could be constructed. The structures of the plasmids are described by reference to sequences in public databases. Sequences which link these fragments are derived from synthesised oligonucleotides and we provide sequences of the linking region.
- linking sequences do not necessarily correspond to the oligonucleotides which would have been synthesised.
- LDD208 is a plasmid from which a truncated version of the tobacco etch virus (TEV) protease (part of the Nla gene) is expressed under the control of the S. cerevisiae ADHl promoter.
- the backbone of this vector is the plasmid RS313 (Sikorski and Hieter, 1989).
- an expression cassette comprising the promoter of the S. cerevisiae ADHl gene, the coding region of TEV protease and the transcription termination region region of the S. cerevisiae ADHl gene.
- the ADHl promoter sequence consists of a 1.4kb Bam HI-Hind III fragment from the plasmid pADNS (Colicelli et al., 1989).
- the Hind III site is followed immediately by the linker:
- This linker introduces a translation initiation codon.
- This codon is linked in frame to a sequence which encodes the active portion of the TEV protease. This sequence corresponds to nucleotides 6295-6981 of Genbank entry g335201 (Allison et al, 1986). This encodes amino acids 2051-2279 of the tobacco etch virus polyprotein precursor, or amino acids 202-430 of the predicted 430 amino acid Nla protein released by proteolysis from the polyprotein precursor.
- This sequence is followed by a linker which incorporates an in- frame stop codon and an Eco RI site:
- LDD882 is a plasmid from which the following fusion protein is expressed: a seven transmembrane spanning region of S. cerevisiae HMG-CoA reductase linked to a cleavage site for TEV protease linked to the DNA binding domain of the S. cerevisiae Gal4 protein linked to a synthetic transcription activation domain based upon the herpes simplex virus VP16 activation domain.
- the backbone of this vector is the plasmid RS315 (Sikorski and Hieter, 1989). Between the Sac I and Kpn I restriction enzyme sites in the polylinker of this vector we have placed an expression cassette comprising the promoter of the S.
- the promoter region of ACTl consists of a 0.65kb DNA fragment obtained by polymerase chain reaction from S. cerevisiae genomic DNA. The fragment corresponds to nucleotides 8-671 of Genbank entry gl70985 and is flanked at the 5' end by a Sac I site and at the 3' end by a Hind III site. Following the Hind III site is a region of the HMG1 gene from S. cerevisiae which encodes amino acids 1- 526 of S. cerevisiae HMG-CoA reductase (Basson et al, 1988). This sequence corresponds to nucleotides 112-1698 of Genbank entry gl 71685. Following this is the linker:
- This linker encodes the peptide LQTSTENLYFQSGTHG.
- ENLYFQS is a cleavage site for the TEV protease (Dougherty et ⁇ /.,1988). This sequence is followed by a sequence encoding the DNA binding domain (amino acids 2-147) of S. cerevisiae Gal4.
- This linker encodes the peptide PRVELDDFDLDMLGLDDFDLDMLGVDTS.
- This protein fragment contains two copies of a peptide (LDDFDLDMLG) based on the amino acid sequence of part of the activation region of the herpes simplex virus VP16 protein (amino acids 440-449 of the protein encoded by Genbank entry g330318 ). Following this peptide is a stop codon and a Not I site. The Not I site is linked to a DNA fragment which includes the transcription terminator region of the S. cerevisiae ADHl gene. This fragment is the 0.6kb Not I-Bam HI from the plasmid pADNS (Colicelli et al, 1989).
- LDD1117 encodes a plasmid which is identical to LDD882, except that the linker region between the Hmgl fragment and the Gal4 fragment is the sequence:
- CTGCAGACTAGTACTGGTACCCATGGT This encodes the amino acid sequence LQTSTGTHG.
- LDD883 is a plasmid from which a fusion protein comprising the DNA binding domain of Gal4 (amino acids 1-147) fused to the minimal activation domain based upon VP16 is expressed under the control of the S. cerevisiae ACT1 promoter.
- This plasmid is similar to LDD882 except that the sequences which encode the HMG-CoA reductase region and the TEV protease cleavage site are replaced by a sequence which supplies an initiation codon for Gal4:
- LDP 1123 is a plasmid from which a fusion protein comprising a TEV protease cleavage site linked to the DNA binding domain of Gal4 and the minimal activation domain based on VP16 is expressed.
- This plasmid is similar to LDD882 except that the sequences which encode the HMG-CoA reductase is replaced by an initiation codon.
- Yeast was manipulated according to standard protocols (Sherman, 1991; Ausabel et al, 1993). Yeast cultures were grown in synthetic complete media lacking the appropriate nutrients to allow for selection of transformed plasmids. This media was supplemented with 2% (w/v) glucose as a carbon source. Plasmids were transformed in yeast using the lithium acetate procedure (Ito et al 1983). 3 days after transformation, colonies were transferred to X-Gal indicator plates (Ausabel et al, 1993), and 24 hours later were scored for the degree of blue colour. Liquid ⁇ -galactosidase assays were performed in microtitre plates using a modification of the method of Dixon et al (1997).
- a final concentration of 5mM substrate (chlorophenol red galactopyranoside (CPRG) -approximately lOxKm) was used in the reaction.
- CPRG chlorophenol red galactopyranoside
- Single colonies or a loop of approximately 20 colonies was inoculated into 10ml miminal medium plus supplements. This culture was grown for approximately 40 hours.
- the cultures were diluted back to an OD600 of 0.1. 120 ⁇ l of each culture was transferred to wells of a Costar 96-well microtitre plate. 30 ⁇ l of a 5x reaction cocktail was added and an initial absorbance at 570nm read. The initial rate of reaction (production of colour at 570nm) was then measured over a ten minute period after addition of substrate.
- a unit is defined as the rate of production of CPRG (mOD570/min) divided by the optical density of the culture in the microtitre plate.
- a culture with an optical density of 0.1 at 5 600nm (measured in spectrophotometer with a 1 cm path length) has an optical density of 0.01 16 in Costar 96-well microtitre plates in a Molecular Devices platereader. Since the culture is diluted by a factor of 1.25 by the addition of reaction cocktail, units are calculated as:
- the components of the chimaeric transcription factor constructed have been previously described, with the exception of the transcriptional activation domain.
- the activation domain of the herpes simplex virus VP16 protein is acidic (T Drenberg et al, 1988) and very potent (Sadowski et al, 1988).
- the negative charges provided by the acidic 0 residues are required for the transcription function (Cress and Triezenberg,1991), as is a critical phenylalanine residue (F442: Regier et al, 1993).
- HMG-tev-Gal-mVP 11 units- transformation 5
- HMG-Gal-mVP 5 units - transformation 4
- TEV protease was unable to activate reporter gene transcription ( limit: transformation 1).
- Cotransformation of the plasmid encoding TEV protease with the plasmid encoding the substrate protein lacking a TEV protease cleavage site did not result in activation of the reporter gene, indicating that there were no sequences within HMG- Gal-mVP capable of acting as substrates for TEV protease ( 6 units: transformation 6).
- the true level of stimulation by TEV protease expression is difficult to measure because the activity of the reporter gene in the presence of the precursor HMG-tev-Gal-mVP is very low. Comparison of transformations 5 and 7 indicates that the level of reporter gene stimulation by the protease is at least 700 fold.
- the level of reporter gene stimulation and the absolute level of target gene expression in the presence of protease may be manipulated according to the choice of components used in the system. Thus the use of weaker transcription activation domains in place of mVP will result in a lower absolute level of target gene expression. Alteration of the structure of the promoter controlling the target gene will also affect the levels of expression that may be achieved.
- a transcription factor fusion would be expressed in a cell.
- a target gene containing binding sites for the transcription factor would also be introduced into the cell.
- expression of the protease capable of cleaving the transcription factor precursor expression of the target gene would be obtained.
- One way to use such a system would be to regulate desirable genes; the system may also be used as a method of amplifying another gene switch. The first switch would turn on the gene encoding the protease, which would then activate the target gene of the transcription factor.
- viruses including plant pathogens such as the tobacco etch virus, from which the TEV protease comes, and retroviruses, such as the HIV virus, are dependent upon the activity of a virally encoded protease for viral propagation.
- Two genes could be incorporated into the cells of an organism. One gene would express a transcription factor fusion as described in this example, but having the TEV protease site replaced by a cleavage site for the virally encoded protease. The other gene would be a toxic gene under the control of a promoter containing binding sites for the transcription factor. The cells of the organism would not be affected by the presence of these genes.
- the expression of the virally-encoded protease would result in cleavage of the transcription factor precursor, release of transcription factor, activation of the toxic gene and consequent cell death, in this way it may be possible to kill the cell before mature virions are produced from infection and stop the virus from propagating itself.
- the system disclosed here provides a method to clone genes encoding proteases. If the cleavage site for a protease is known, but the protease itself is not known, a cell may configured in which a transcription factor precursor containing the cleavage site is expressed, together with a reporter gene as a target. A library of DNA sequences would be placed in an expression vector and this library transformed or transfected into the cell type. Cells which show activation of the reporter gene may contain a gene encoding a protease which acts on the cleavage site. This gene may be recovered and sequenced in order to deduce the sequence of the protease.
- the library of sequences may consist of cDNA sequences or of genomic fragments. Optionally the library would be constructed in such a way as to favour the intracellular expression of encoded proteins.
- the system described in this example may be used to screen for modulators of proteases by the identification of compounds which affect the level of reporter gene induction.
- a particular advantage of yeast cells is the ease with which encoded libraries may be screened.
- DNA encoding a library of peptides could be introduced into cells containing a system in which a protease is activating a reporter gene. Cells in which an increase or a decrease in the reporter gene expression occurs would be identified and the modulating peptide identified by recovery and sequencing of the gene which encodes the peptide.
- the peptide libraries used could be essentially random, or they could be based upon partial randomisation of known protease inhibitors.
- Example 2 Identifying protease substrates
- the protease system described in Example 1 can be used to study protease specificity.
- TEV cleavage site used in Example 1 is a naturally occurring TEV protease site which also conforms to the consensus site (see Table 1 of Dougherty et al, 1988).
- One method to assess the contribution of amino acid residues to an event such as a protein:protein interaction or enzyme catalysis is to perform an alanine scan (Cunningham and Wells, 1989). In an alanine scan, each amino acid in a region of interest is replaced with alanine, and the effect of this substitution is assessed on the event being studied.
- LDD882 contains a naturally occurring cleavage site for TEV protease (ENLYFQS). This is referred to as the "wild type" cleavage site. Cleavage occurs between the glutamine and serine residues and we number residues within this site relative to the cleavage point; thus Q is -1 and S is +1. Within this sequence are sites for the restriction endonucleases Spe I and Nco I. These restriction sites are unique within the plasmid LDD882.
- Plasmids encoding variants of the cleavage site which differed at a single residue from the wild type site were constucted by ligating oligonucleotides into LDD882 cleaved with Spe I and Nco I.
- the following variants were constructed by inserting oligonucleotides containing the triplet GCT (encoding alanine) at the appropriate position:
- LDD1102 phenylalanine at -2 changed to alanine
- the consensus cleavage site for TEV protease is E-x-hy-Y-x-Q-(S/G), where x denotes any amino acid and hy denotes a hydrophobic amino acid.
- Replacement of the glutamine by alanine abolishes reporter gene activity. This is consistent with the strong conservation of glutamine at position -1 of the cleavage sites for TEV protease and for the cleavage sites of related viruses. Positions -3 is preferentially tyrosine. When this amino acid was changed to alanine an intermediate phenotype was observed (scored as 2 out of 4 by blue colour, measured as 2926 units).
- tyrosine contributes to the consensus site but is not as important as the glutamine at position -1.
- Dougherty et al (1988) also found an intermediate effect when they changed the tyrosine to alanine in an in vitro reaction.
- Position -4 is usually leucine, valine or isoleucine, and alteration of this amino acid to an alanine also results in an intermediate phenotype.
- positions -2 (phenylalanine) and -5 (asparagine) are not conserved, and alteration of these residues to alanine has little effect on the reporter gene activity, indicating that the enzyme is as active on these substrates as it is on the wild type substrate.
- the glutamate residue at position -6 was predicted to be important since it is highly conserved; however alteration of this residue to alanine has little effect. This change was not made by Dougherty et al. (1988), so no comparison with an in vitro result can not be made. Although position +1 is normally glycine or serine, Dougherty et al. (1988) show that a number of different amino acids can be tolerated at this position (though they did not examine alanine), so it is not surprising that an alanine substitution has no effect on the reporter gene activity. In general (and particularly for positions -5 to -1) the results of the alanine scan are as might be predicted from the known consensus sequence for the TEV cleavage site.
- protease reporter system is a valid approach to the analysis of protease specificity.
- intermediate levels of reporter gene activation obtained with some of the cleavage site point mutants suggest that if this system were to be used as a gene switch, then one way to modulate the strength of the switch would be to vary the peptide sequence of the protease cleavage site.
- the reporter gene system may be used to study protease cleavage sites in two ways. Firstly, as described here, a sequence known to contain a protease cleavage site can be used as a starting point. Defined changes are then introduced into this site and the effects of these changes on reporter gene output are observed. There is no need to recover the sequences encoding the cleavage sites, because these are characterised before being used in the experiment. Secondly, a library of sequences may be created as part of precursor protein. The protease would then be used to select sequences from this library. In this approach it would be necessary to recover the DNA encoding the cleavage site in order to deduce the amino acid sequence of the site.
- the DNA encoding the cleavage site sequences that have been identified by reporter gene activation could be recovered by amplification through the polymerase chain reaction, or through recovery of the plasmid by transformation of E. coli with extracts of the cells which gave a positive output.
- a peptide library could be placed between the membrane anchor and the transcription factor, encoded by partially randomised oligonucleotides. This would be introduced into cells with a reporter gene and the protease of interest so that only one (or very few) members of the library would be present in each cell. Cells in which reporter gene output is stimulated would be identified.
- the extent of reporter gene activation would be scored for these cells, and the cleavage site present in the precursor deduced from the DNA encoding the precursor. Note that it would be important to confirm that any reporter gene activation is protease-dependent, and not due to some endogenous activity which is independent of the protease of interest.
- the information about the cleavage sites and the score of these sites would then be combined to generate a consensus sequence for the protease under study.
- Several methods could be employed to deduce this consensus. The simplest approach would involve two steps. Firstly the sequences obtained would be aligned. Secondly, in the most favourable alignment, a consensus would be deduced to which each individual sequence contributes according to the score of that sequence.
- cleavage sites which are associated with a higher reporter gene activity
- This consensus site could then be used to search protein sequence databases to identify proteins which may be substrates for the protease.
- the identification of a consensus cleavage site can also be used in inhibitor design.
- the peptide identified as a cleavage site may be directly convertible into an inhibitor. For example, Rano et al. (1997) identified a cleavage site for interleukin-l ⁇ converting enzyme and found that an aldehyde version of this peptide was a very potent inhibitor of the enzyme.
- the peptide may be a starting point for the design of a peptidomimetic (reviewed by Giannis and Rubsam, 1997).
- proteases will be able to function in the context of the system we have described. It will be necessary to remove sequences which target the protease to cellular compartments or the cell surface. It may also be necessary to remove inhibitory sequences that keep proteases in an inactive "pro" form.
- TACE metalloproteinase TNF ⁇ converting enzyme
- the signal sequence (amino acids 1-17) should be removed.
- Amino acids 19-214 constitute a "pro” region which may optionally be removed.
- the catalytic domain (215-473) may be expressed alone, or with some of the other domains, including the disintegrin domain (474-572) and also the transmembrane domain (672-694).
- Proteases are not generally completely specific for one substrate. Instead they will cleave, with varying efficiency, a set of related sequences. In considering how protease specificity may be altered we may imagine the scenarios outlined in Table 4. A "parental protease" will have a profile of activity. It will be active against a wild type cleavage site and perhaps one variant of this wild type sequence (variant cleavage site 1) but not against another variant of this wild type sequence (variant cleavage site 2). This profile can be described as a "wild type” profile. Through mutagenesis protocols it may be possible to select for a derivative of this protease (derivative 1) which can now act on variant 2 as well as variant 1 and the wild type site.
- this protease can recognise additional substrates, and its profile has been "relaxed".
- a derivative derivative 2 which can only act on the wild type cleavage site. Since this derivative has lost the ability to cleave at variant cleavage site 1 , it is described as having a "restricted” specificity.
- a protease derivative which has lost the ability to recognise the wild type cleavage site, but which can now recognise a cleavage site which it was formerly unable to recognise may be described as having an "altered” specificity.
- this derivative still retains activity towards variant cleavage site 1, then its profile will overlap with the parental protease, whereas if this protease does not show activity towards variant cleavage site 1 , then the specificity will not overlap. Since, in the genetic system described in Example 1, reporter gene activity is dependent upon the presence of both protease and substrate, the system can be used to generate and study protein mutants with changed specificity. In this example we demonstrate this effect by describing two deletion versions of the TEV protease, one of which has a relaxed specificity and the other of which has a tightened specificity.
- Plasmids LDD208 contains the coding region of the TEV protease (amino acids 2051 to 2279). Within this plasmid there is a unique Not I restriction endonuclease site before the translation start codon, a unique Spe I site encompassing amino acids 2165-2166, and a unique Eco RI site after the translation stop. Deletion variants of the TEV protease were constructed using the the polymerase chain reaction combined with replacement of regions between these sites.
- LDD859 contains a deletion often amino acids (amino acids 2155-2164) in the centre of the protease, adjacent to the region encoding the Spe I site.
- This deletion referred to as TEV protease [ ⁇ I- 10] (for internal deletion often amino acids) , was constructed by amplifying from LDD208 a region encoding amino acids 2051 to 2155 using the oligonucleotides: CCAGGCGGCCGCCCACCATGATATCGAGCACCATTTGT
- the DNA fragment obtained was digested with Not I and Spe I and ligated into LDD208 cleaved with Not I and Spe I to obtain LDD859.
- LDD855 contains a deletion of 16 amino acids (amino acids 2264- 2279) at the carboxy terminus of the TEV protease.
- This deletion referred to as TEV protease [ ⁇ C-16] (for carboxy-terminal deletion of sixteen amino acids) was constructed by amplifying from LDD208 a region encoding amino acids 2051 to 2264 using the oligonucleotides:
- the DNA fragment obtained was digested with Not I and Eco RI and ligated into LDD208 cleaved with Not I and Eco RI to obtain LDD 855.
- TEV protease[ ⁇ C-16] A set of amino and carboxy terminal deletions of TEV protease was made to examine the sequence requirements of the protease for activation of the reporter gene. It was found that removal often or more amino acids from the amino terminus of the protease encoded by plasmid LDD208 caused a complete loss of activity against the wild type cleavage site (data not shown), whereas sixteen amino acids could be removed from the carboxy terminus without loss of activity. An internal deletion often amino acids also retained activity against the wild type cleavage site.
- the carboxy terminal deletion (TEV protease[ ⁇ C-16]) and the internal deletion (TEV protease[ ⁇ I-10]) were tested against a variety of cleavage sites with single amino acid changes.
- proteases may in themselves have utility. If the system as depicted in Figure 1 is to be used as a gene switch, it may be desirable to use a protease which is very specific, so that there is a minimal chance that other proteins will be cleaved within the cell. In this setting, the protease with the restricted profile would be appropriate.
- the carboxy terminal deletion displays a relaxed profile.
- a protease with a relaxed profile may be of use in applications where it is desirable to maintain the diversity of a set of proteins or peptides. We show here that the carboxy terminal deletion has relaxed specificity for changes in the -1 position of the TEV protease cleavage site. It also displays a relaxed specificity for changes at the +1 position (data not shown).
- the +1 position of the cleavage site is also the amino terminal residue of the released protein.
- a library of random peptides is being released by cleavage with the protease. If a restricted specificity protease is used then only those peptides which have certain amino acids at the amino terminus will be released. However, if a protease with a relaxed specificity for position +1 of its cleavage site is employed, then the peptides which are released will have a greater diversity of residues at the amino terminal position.
- proteases used in this example were selected for study on the basis that they were active against the wild type cleavage site.
- the approach can be used to design novel specificity profiles of proteases if the generation of protease variants is combined with a selection system based on reporter gene output.
- a library of genes encoding protease variants could be generated by a number of methods, including chemical mutagenesis of the gene and DNA amplification strategies which introduce mutations or which allow mixing of sequences from homologous genes (Enell, L.P. and Loeb, L.A. (1998) Nature Biotech. 16, 234-235.
- This library may then be transformed into cells which contain substrate proteins which contain a certain cleavage site.
- the proteases that can act on this cleavage site will switch on the reporter gene, enabling the cells which contain these proteases to be identified and the genes encoding the proteases to be recovered.
- a novel protease obtained in this manner can then be tested against a panel of substrates to determine its specificity profile, in particular to determine whether it retains the ability to act on the wild type substrate (in which case the specificity will be "relaxed") or whether it has lost the ability to act on the wild type substrate (in which case the specificity will be "altered”).
- By following a series of such mutagenesis and selection steps it would be possible to evolve the specificity of a protease.
- the directed evolution of catalytic activities is useful where rational design approaches are limited (Kuchner and Arnold, 1997)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP98940421A EP1009835A2 (en) | 1997-09-03 | 1998-08-28 | Protease based gene switching system |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB9718591.2 | 1997-09-03 | ||
GBGB9718591.2A GB9718591D0 (en) | 1997-09-03 | 1997-09-03 | Methods |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1999011801A2 true WO1999011801A2 (en) | 1999-03-11 |
WO1999011801A3 WO1999011801A3 (en) | 1999-06-10 |
Family
ID=10818407
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB1998/002596 WO1999011801A2 (en) | 1997-09-03 | 1998-08-28 | Protease based gene switching system |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP1009835A2 (en) |
GB (1) | GB9718591D0 (en) |
WO (1) | WO1999011801A2 (en) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001049871A2 (en) * | 2000-01-06 | 2001-07-12 | Boehringer Ingelheim Pharma Kg | Process for finding a protease inhibitor |
WO2002024899A3 (en) * | 2000-09-25 | 2002-12-12 | Valentis Inc | Improved system for regulation of transgene expression |
EP1361284A1 (en) * | 2002-05-10 | 2003-11-12 | Direvo Biotech AG | Process for generating sequence-specific proteases by directed evolution and use thereof |
FR2849853A1 (en) * | 2003-01-15 | 2004-07-16 | Millegen | New fusion protein for inducing expression of a gene, useful particularly for regulating gene therapy, also in screening for active agents, comprises nucleic acid-binding, expression-activating and membrane-binding domains |
EP2110666A1 (en) | 2002-03-13 | 2009-10-21 | Sygnis Bioscience GmbH & Co. KG | New method of detecting and analysing protein interactions in vivo |
WO2010148413A2 (en) | 2009-06-19 | 2010-12-23 | Medimmune, Llc | Protease variants |
US7935788B2 (en) | 2004-10-04 | 2011-05-03 | National Research Council Of Canada | Reverse cumate repressor mutant |
US8728759B2 (en) | 2004-10-04 | 2014-05-20 | National Research Council Of Canada | Reverse cumate repressor mutant |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0355737A2 (en) * | 1988-08-24 | 1990-02-28 | BEHRINGWERKE Aktiengesellschaft | Expression of functional homologous and heterologous proteins on the outer membrane of E.coli and other gram-negative bacteria |
-
1997
- 1997-09-03 GB GBGB9718591.2A patent/GB9718591D0/en not_active Ceased
-
1998
- 1998-08-28 WO PCT/GB1998/002596 patent/WO1999011801A2/en not_active Application Discontinuation
- 1998-08-28 EP EP98940421A patent/EP1009835A2/en not_active Withdrawn
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0355737A2 (en) * | 1988-08-24 | 1990-02-28 | BEHRINGWERKE Aktiengesellschaft | Expression of functional homologous and heterologous proteins on the outer membrane of E.coli and other gram-negative bacteria |
Non-Patent Citations (3)
Title |
---|
HIROWATARI Y ET AL: "A novel method for analysis of viral proteinase activity encoded by hepatitus C virus in cultured cells" ANALYTICAL BIOCHEMISTRY, vol. 225, 1995, pages 113-120, XP002096985 cited in the application * |
KUMAGAI H ET AL: "Molecular dissection of the role of the membrane domain in the regulated degradation of 3-hydroxy-3- methylglutaryl coenzyme A reductase." JOURNAL OF BIOLOGICAL CHEMISTRY, (1995 AUG 11) 270 (32) 19107-13. JOURNAL CODE: HIV. ISSN: 0021-9258., XP002096987 United States * |
SMITH T A ET AL: "Direct selection for sequences encoding proteases of known specificity." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, (1991 JUN 15) 88 (12) 5159-62. JOURNAL CODE: PV3. ISSN: 0027-8424., XP002096986 United States * |
Cited By (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001049871A3 (en) * | 2000-01-06 | 2002-03-28 | Boehringer Ingelheim Pharma | Process for finding a protease inhibitor |
WO2001049871A2 (en) * | 2000-01-06 | 2001-07-12 | Boehringer Ingelheim Pharma Kg | Process for finding a protease inhibitor |
US7579326B2 (en) | 2000-09-25 | 2009-08-25 | Genetronics, Inc. | Gene switch systems employing regulators with decreased dimerization |
WO2002024899A3 (en) * | 2000-09-25 | 2002-12-12 | Valentis Inc | Improved system for regulation of transgene expression |
EP2110666A1 (en) | 2002-03-13 | 2009-10-21 | Sygnis Bioscience GmbH & Co. KG | New method of detecting and analysing protein interactions in vivo |
EP1361284A1 (en) * | 2002-05-10 | 2003-11-12 | Direvo Biotech AG | Process for generating sequence-specific proteases by directed evolution and use thereof |
WO2003095670A3 (en) * | 2002-05-10 | 2004-04-01 | Direvo Biotech Ag | Process for generating sequence-specific proteases by directed evolution and use thereof |
WO2003095670A2 (en) * | 2002-05-10 | 2003-11-20 | Direvo Biotech Ag | Process for generating sequence-specific proteases by directed evolution and use thereof |
FR2849853A1 (en) * | 2003-01-15 | 2004-07-16 | Millegen | New fusion protein for inducing expression of a gene, useful particularly for regulating gene therapy, also in screening for active agents, comprises nucleic acid-binding, expression-activating and membrane-binding domains |
WO2004067745A1 (en) * | 2003-01-15 | 2004-08-12 | Millegen | Gene expression inducing fusion protein and method for controlling gene expression induction |
US7935788B2 (en) | 2004-10-04 | 2011-05-03 | National Research Council Of Canada | Reverse cumate repressor mutant |
US8728759B2 (en) | 2004-10-04 | 2014-05-20 | National Research Council Of Canada | Reverse cumate repressor mutant |
WO2010148413A2 (en) | 2009-06-19 | 2010-12-23 | Medimmune, Llc | Protease variants |
Also Published As
Publication number | Publication date |
---|---|
GB9718591D0 (en) | 1997-11-05 |
EP1009835A2 (en) | 2000-06-21 |
WO1999011801A3 (en) | 1999-06-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU768126B2 (en) | Fusions of scaffold proteins with random peptide libraries | |
CA2266543C (en) | Methods and compositions for identifying receptor effectors | |
US5891635A (en) | Protease assays | |
AU2003280239B2 (en) | Inhibitor-resistant HCV NS3 protease | |
CA2174525A1 (en) | Customized proteases with altered transacylation activity | |
JPS6339586A (en) | Secretion signal selection vector for extracellular protein synthesis of bacillus | |
AU714424B2 (en) | In vivo selection of RNA-binding peptides | |
WO1999011801A2 (en) | Protease based gene switching system | |
Hoskins et al. | Clp ATPases and their role in protein unfolding and degradation | |
JP2024019600A (en) | Selective protein degradation | |
US5948620A (en) | Reverse two-hybrid system employing post-translation signal modulation | |
WO1996003501A1 (en) | Dual hybrid system | |
US7297482B2 (en) | Structurally biased random peptide libraries based on different scaffolds | |
WO1994013818A1 (en) | Identification of compounds modulations protein/cell membrane association | |
US6936421B2 (en) | Structurally biased random peptide libraries based on different scaffolds | |
US20090029369A1 (en) | Genetic selection system to identify proteases, protease substrates and protease inhibitors | |
WO1991016436A1 (en) | Novel protease assays | |
Klump et al. | Proteolytically Active 2A Proteinase of Human Rhinovirus 2 Is Toxic forSaccharomyces cerevisiaebut Does Not Cleave the Homologues of eIF-4γin Vivoorin Vitro | |
Pozzuolo et al. | Efficient bacterial expression of fusion proteins and their selective processing by a recombinant Kex-1 protease | |
HU216104B (en) | Method for in vitro processing of fusion proteins | |
US5866351A (en) | CD4+ T-lymphocyte proteases and genes encoding said proteases | |
WO2021028577A1 (en) | Bacterial selection system for target-specific proteases | |
KR100792187B1 (en) | Improved yeast two-hybrid system and method for detectining of bait-prey interaction using the same | |
US6261772B1 (en) | Method of assaying for RNA: protein interactions | |
KR100436552B1 (en) | A Method for Measuring Substrate Specificity of Protease |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): CA IL JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): CA IL JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1998940421 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09486385 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 1998940421 Country of ref document: EP |
|
NENP | Non-entry into the national phase in: |
Ref country code: CA |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1998940421 Country of ref document: EP |