KR100792187B1 - Improved yeast two-hybrid system and method for detectining of bait-prey interaction using the same - Google Patents

Abstract

A recombinant microorganism, which is an yeast two hybrid system, is provided to identify the interaction between proteins through a simple process since a separate substrate is not required for expressing a reporter gene. A recombinant microorganism comprises a DNA encoding an N-terminal domain of split enhanced green fluorescent protein(NEGFP) of EGFP(enhanced green fluorescent protein), which has a CNE6/ARS4 origin and includes a sequence of SEQ ID : NO. 1, and a DNA encoding a C-terminal domain of split enhanced green fluorescent protein(CEGFP) of the EGFP and is transformed by a recombinant vector in which a GAL4DD(GAL4 dimerization domain) is conjugated into a 3'-terminal of the NEGFP encoding DNA as a bait polynucleotide and a GAL11P(GAL11 protein) is conjugated into a 3'-terminal of the CEGFP encoding DNA as a prey polynucleotide. A method for detecting the interaction between a bait and a prey comprises a step of culturing the recombinant microorganism and then measuring the fluorescence of the cultured recombinant microorganism.

Description

Improved Yeast Two-Hybrid System and Method for Detectining of Bait-prey Interaction Using the Same

Figure 1 illustrates the mechanism of action of the yeast two-hybrid system. The bait and prey polynucleotides are fused to the N-terminus and C-terminus of the isolated EGFP, indicating that when these polynucleotides interact, the fluorophore moves closer, causing the EGFP to fluoresce again. .

Figure 2 shows the structure of plasmid (pNEGFP) comprising the N-terminal domain (NEGFP) of the isolated EGFP and plasmid (pCEGFP) comprising the C-terminal domain (CEGFP). NEGFP is the N-terminal domain of EGFP (1-158 amino acids), CEGFP is the C-terminal domain of EGFP (159-239 amino acids), P _ADH1 is the alcohol dehydrogenase 1 promoter, ADH1 promoter, T _ADH1 is an ADH1 terminator, MCS is a muti-cloning site, TRP1 is a gene encoding tryptophan biosynthetic protein, LEU2 is a gene encoding leucine biosynthetic protein, Col E1 ori is Col E1 origin, Amp ^r is ampicillin- The resistance gene, CEN6 / ARS4 ori, refers to CEN6 / ARS4 origin.

3 is a schematic diagram showing NEGFP and CEGFP fusion constructs. (A) shows the YM4271 strain (MATa, ura3-52, his3-200, ade2-101, ade5, lys2-801, leu2-3, 112) by combining plasmids encoding NEGFP and CEGFP fusion proteins into six different forms. , trp1-901, tyr1-501, gal4d, gal80d, and ade5 :: hisG). a to p represent the positions of the primers. (B) shows the primer sequence used therein.

Figure 4 shows the yeast two-hybrid assay using the isolated EGFP reporter. (A) is a result of confirming the yeast transformant by electrophoresis using the colony PCR method (colony PCR method). 1-6 show yeast transformants containing the NEGFP and CEGFP fusion proteins combined in FIG. 3A, where N represents the NEGFP fusion plasmid and C the CEGFP fusion plasmid. (B) shows the result of confirming the remodeling of the isolated EGFP by confirming that GAL4DD and GAL11P interact with each other to confirm that the yeast cells exhibit fluorescence.

Field of invention

The present invention relates to an improved yeast two-hybrid system, and more specifically, to the N-terminal domain of split EGFP (NEGFP) containing the DNA encoding the enhanced green fluorescent protein (CEGFP) and the C-terminus of the EGFP (CEGFP: C-terminal domain of split enhanced green fluorescent protein), and the 3'-end of the NEGFP encoding DNA and CEGFP encoding DNA. A yeast two-hybrid capable of confirming bait-prey interactions in which yeasts have prepared recombinant vectors conjugated to bait polynucleotides and prey polynucleotides, respectively, and introduced into yeast. It's about the system.

Background

Since cell growth, differentiation, migration, and death are caused by protein-protein interactions, protein-protein interactions play an important role in cells (E. Phizicky, PI et . Al . , Nature , 422: 208, 2003; S. Cho, et . Al ., J. Biochem . Mol . Biol ., 37:45, 2004). One of the methods for predicting the function of proteins is to confirm the interaction of the target protein with the interactor (J. Piehler, Curr . Opin . Struct . Biol ., 15: 4, 2005). Common methods for analyzing protein-protein interactions include immunoprecipitation, pull-down assays, and two-hybrid systems (SC Masters, Methods). Mol . Biol . , 261: 337, 2004; A. Bauer, et . al ., Eur . J. Biochem., 270: 570, 2003). The dual yeast two-hybrid system is a method used to detect binding between known proteins or to find unknown proteins that bind to certain proteins. It is mainly used to select genes for coding (B. Causier, et . Al ., Plant Mol . Biol ., 50: 855, 2002; S. Fields, et . al ., Nature , 340: 245, 1989). This system attaches the bait to the DNA binding domain of Gal4p (Gal4 protein), a protein that activates transcription by attaching DNA, to make a hybrid protein, and to a protein that binds to the protein. If a hybrid protein with a transcriptional activation domain of Gal4p is made and expressed in yeast at the same time, the two hybrid proteins bind to each other and become functional Gal4p if they have a property of binding between bait and prey. It acts as a transcriptional activator that mediates the expression of the gene.

In theory, upon interaction between the target gene and the interactor, the reporter gene is activated transcriptionally (P. Colas, et . Al ., Trends Biotechnol ., 16: 355, 1998). The most commonly used reporter gene in the yeast two-hybrid system is E. coli, which transcribed cells to turn blue . The gene LacZ (β-galactosidase gene), simply look for blue colonies to find interactions between target genes and interactors (W. Van Criekinge, et . Al ., Biol . Proced . Online) . , 4: 1, 1999). Recently, a fluorescent two-hybrid reporter gene (GFP) is screened with a flow cytometer that does not require a substrate or co-factor to emit green fluorescence when stimulated by UV. Methods are being studied (AL Starling, et . Al ., Genet . Mol . Res ., 31: 124, 2003).

Protein-protein interactions can be identified using a protein fragment complementation approach that divides the enzyme into two inactive fragments and fuses to each interaction partner (J. Piehler, Curr . Opin . Struct) . . Biol, 15:. 4, 2005). Enzymes used in this method are dihydrofolate reductase (DHFR), β-galactosidase and lactamase (JN Pelletier, Proc . Natl . Acad. Sci) . . USA, 95: 12141, 1998 ; F. Rossi, et al, Proc Natl Acad Sci USA, 94:.......... 8405, 1997; A. Galarneau, et al, Nat Biotechnol, 20: 619, 2002). When these proteins interact, the fragments are reconstituted to restore the function of the enzyme. This split-enzyme system has long been used to identify protein-protein interactions involving proteins immobilized on cell membranes (BT Blakely, et . Al ., Nat . Biotechnol ., 18: 218, 2000; I. Remy, et . Al ., Sciience , 283: 990, 1999). Recently, protein fragment complementation methods based on isolated yellow fluorescence protein (YFP) have been investigated (T. Nagai, et . Al ., Proc . Natl . Acad . Sci . USA , 98: 3197, 2001; V. Robert, et . al ., EMBO J. , 20: 4998, 2001; CD Hu, et . al ., Mol . Cell , 9: 789, 2002). Two separate fluorescent protein fragment domains, NGFP (1-158 amino acids) and CGFP (159-239 amino acids), can regenerate fluorescence upon formation of antiparallel leucine zippers that generate fluorescence. (I. Ghosh, et . Al ., J. Am. Chem . Soc ., 122: 5658, 2000). We have found that maltose-induced morphological changes in maltose binding protein (MBP) can be detected based on the remodeling of isolated green fluorescence proteins (GFP ) (J. Jeong, et . al ., Biochem . Biophys . Res . Commun ., 339: 647, 2006).

On the other hand, the search method by the double library protein binding search method that can investigate the mutual binding between proteins (Korean Patent No. 10-0445912) is not a single protein, but a method for simultaneously searching for binding pairs of library-level proteins And a search system for substances that regulate the interaction between proteins (Korean Patent No. 10-0402836) is a fusion protein and reporter protein in which two interacting proteins are fused to a binding site and an active site of a cleaved transcription promoter protein, respectively. The present invention relates to a yeast two-hybride system including an expression vector capable of expressing each of thyminin kinases, but has a disadvantage in that a yeast two-hybrid is performed in a nucleus and a substrate is required to express a reporter.

Accordingly, the present inventors have made efforts to develop a yeast two-hybrid system that confirms protein-protein interaction by supplementing the disadvantages of the conventional yeast two-hybrid system. As a result, the reporter protein, EGFP, which does not exhibit two fluorescence, After recombination with CEGFP to produce a recombinant vector, when the bait (GAL4DD) and prey (GAL11P) polynucleotides were fused to NEGFP and CEGFP, respectively, and introduced into yeast, fluorophore was formed according to protein-protein interaction and fluorescence again. By showing the new yeast two-hybrid system does not require a substrate or cofactor to complete the present invention.

The main object of the present invention contains DNA encoding the N-terminus (NEGFP) of EGFP and the DNA encoding the C-terminus (CEGFP) of EGFP, having the nucleotide sequence of SEQ ID NO: 2, and 3 of the NEGFP encoding DNA GAL4DD (GAL4 dimerization domain) is conjugated as a bait polynucleotide at the end, and GAL11P (GAL11 protein) is conjugated as a prey polynucleotide at the 3'-end of the CEGFP coding DNA. To provide a transformed recombinant microorganism.

Another object of the present invention is to provide a method for detecting interaction between bait-prey, after culturing the recombinant microorganism, measuring the fluorescence of the cultured recombinant microorganism.

delete

In order to achieve the above object, the present invention provides a CEN6 / ARS4 origin, the N-terminal domain of split enhanced green fluorescent protein (NEGFP) having an nucleotide sequence of SEQ ID NO: 1 (EGFP) Contains the DNA encoding the C-terminal of the EGFP (CEGFP: C-terminal domain of split enhanced green fluorescent protein) having the DNA coding and the nucleotide sequence of SEQ ID NO: 2, and at the 3'-terminus of the NEGFP coding DNA GAL4DD (GAL4 dimerization domain) conjugated as bait polynucleotide and GAL11P (GAL11 protein) conjugated as prey polynucleotide at 3'-end of CEGFP coding DNA Provide microorganisms.

In the present invention, the bait and prey may be, but are not limited to, GAL4DD (GAL4 dimerization domain) and GAL11P (GAL11 protein), respectively. For example, bait-prey includes PLK1 (polo-like kinase 1) kinase-NudC (Non-uniformly doped Channel) protein, Rad51 protein-Ask1 (Apoptosis signal-regulating kinase) protein, NFκB (Nuclear Factor kappar B) transcription factor- Protein kinase B alpha (PKBa) protein, Bcl-2-associated X protein-Ku70 protein, and Caspase-XIAP (X-chromosome-linked inhibitor of apoptosis) protein.

delete

In the present invention, the microorganism is preferably yeast, more preferably YM4271 ( Saccharomyces cerevisiae , Clontech, CA, USA).

delete

The present invention also provides a method for detecting interaction between bait-prey, after culturing the recombinant microorganism, measuring fluorescence of the cultured recombinant microorganism.

In the present invention, "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising an antibiotic resistance gene and (c) a restriction enzyme cleavage site into which foreign DNA fragments can be inserted. Although no appropriate restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA.

After ligation, the vector should be transformed into the appropriate host cell. Transformation is described by Sambrook, et . al ., the calcium chloride method described in section 1.82 of supra . Alternatively, electroporation (Neumann, et . Al ., EMBO J. , 1: 841, 1982) can also be used for transformation of these cells.

As the vector used for overexpression of the gene according to the present invention, an expression vector known in the art may be used.

Nucleic acids are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s). For example, the DNA for a pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, operably linked ”means that the linked DNA sequences are in contact, and in the case of a secretory leader, are in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.

As is well known in the art, to raise the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host. Preferably, the expression control sequence and the corresponding gene will be included in one recombinant vector containing the bacterial selection marker and the replication origin. If the host cell is a eukaryotic cell, the recombinant vector must further comprise an expression marker useful in the eukaryotic expression host.

Host cells transformed with the recombinant vectors described above constitute another aspect of the present invention. As used herein, the term “transformation” means introducing DNA into a host so that the DNA is replicable as an extrachromosomal factor or by chromosomal integration.

Of course, it should be understood that not all vectors function equally well to express the DNA sequences of the present invention. Likewise not all hosts function equally for the same expression system. However, those skilled in the art can make appropriate choices among various vectors, expression control sequences and hosts without departing from the scope of the present invention without undue experimental burden. For example, in selecting a vector, the host must be considered, since the vector must be replicated in it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example 1 Acquisition of N-terminal domain of split enhanced green fluorescent protein (NEGFP) gene and C-terminal domain of split enhanced green fluorescent protein (CEGFP) gene

DNA sequences encoding NEGFP and CEGFP gene order SEQ ID NO: NEGFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAG One CEGFP AAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAGACACCGAGAGAGAGACGACGACGACGACGACGACGA 2

NEGFP DNA was amplified by PCR using the primers of SEQ ID NOs: 3 and 4, with the pDNR-EGFP (Clontech, # 6357-1) vector as a template and the Hind III and EcoR I restriction enzyme cleavage sequences introduced. . PCR conditions were performed under the conditions of initial denaturation (95 ℃, 5 minutes, 1 cycle), and denaturation (95 ℃, 1 minute), annealing (62 ℃, 1 minute), extension (72 ℃ 1 minute) and 25 cycle reaction conditions. .

SEQ ID NO: 5'-CCCAAGCTTATGGTGAGCAAGGGCGAG

SEQ ID NO: 5'-GGAATTCCTGCTTGTCGGCCATG

In addition, CEGFP DNA was prepared by using pDNR-EGFP (Clontech, # 6357-1) vector as a template and performing PCR using primers of SEQ ID NOs: 5 and 6 into which Hind III and EcoR I restriction enzyme cleavage sequences were introduced. Amplified. PCR conditions were performed under the conditions of initial denaturation (95 ℃, 5 minutes, 1 cycle), and denaturation (95 ℃, 1 minute), annealing (62 ℃, 1 minute), extension (72 ℃ 1 minute) and 25 cycle reaction conditions. .

SEQ ID NO: 5'-CCCAAGCTTAAGAACGGCATCAAGG

SEQ ID NO: 5'-CGGAATTCCTTGTACAGCTCGTCCATG

Example 2. EGFP Reporter Plasmid Construction

In order to use fluorescence remodeling between fluorescence-free NEGFP and CEGFP in the yeast two-hybrid assay as a reporter, each of the NEGFP and CEGFP genes amplified in Example 1 above as a fusion tag was used in cells. Two low copy plasmids with fewer copies were constructed.

Pieces of CEN6 / ARS4 origin digested with Pvu I and Hind III restriction enzymes from the pGADT7-Rec2 vector (Clontech, # K1617-1) were treated with the same restriction enzymes, respectively, pGBT9 (Clontech, # K1605-A) and pGAD424 (Clontech, # K1605-1) was ligated to the plasmid using ligase. The pGBT9 and pGAD424 plasmids were treated with Hind III and EcoR I restriction enzymes to remove GAL4 BD (GAL4 binding domain) and GAL4 AD (GAL4 transcription activation domain), respectively, and then amplified NEGFP and CEGFP PCR fragments in Example 1. Plasmids were prepared by conjugation of each with ligation, which was named pNEGFP and pCEGFP plasmids, respectively (FIG. 2).

Example 3. Cloning and Transformation of NEGFP and CEGFP Fusion Genes

To clone the NEGFP: GAL4DD fusion gene, PCR using the primers of SEQ ID NOs: 8 and 9 with a gene encoding the yeast GAL4 dimerization domain (GAL4DD, SEQ ID NO: 7) as a bait polynucleotide Amplified by. PCR conditions were carried out with 25 cycles of initial denaturation (95 ℃, 5 minutes, 1 cycle), denaturation (95 ℃, 1 minute), annealing (62 ℃, 1 minute), extension (72 ℃ 1 minute).

SEQ ID NO: 5'-GGAATTCGGAGGAGGAGGAGAATCAAGGCTAGAAAG

SEQ ID NO: 5'-CGGGATCCTCAAAATAATCCTGTTAAC

The PCR product was purified using a DNA purification kit (Qiagen, Germany) and digested with EcoR I / BamH I restriction enzymes. The DNA fragment was conjugated using an ligation kit (Takara, Japan) to the 3′-end of the NEGFP gene of the pNEGFP vector prepared in Example 2, cut with the same enzyme.

In order to construct a CEGFP: GAL11P fusion gene, the primers of SEQ ID NOs: 11 and 12 were prepared using a gene encoding the P region (261-352 amino acids) of GAL11P (GAL11 protein, SEQ ID NO: 10) as a bait polynucleotide. And amplified by PCR. PCR conditions were carried out with 25 cycles of initial denaturation (95 ℃, 5 minutes, 1 cycle), denaturation (95 ℃, 1 minute), annealing (62 ℃, 1 minute), extension (72 ℃ 1 minute).

SEQ ID NO: 5'-GGAATTCGGAGGAGGAGGACCTCAACAGCAGCAAATG

SEQ ID NO: 12'-CGGGATCCTCACAAAGCTTGGATTTTTC

The amplified DNA product was digested with EcoR I / BamH I and then conjugated with an ligation kit (Takara, Japan) at the 3′-end of the CEGFP gene of the pCEGFP vector prepared in Example 2, which was digested with the same enzyme. I was.

To clone the GAL4DD: NEGFP fusion gene, GAL4DD was prepared as a prey polynucleotide and amplified by PCR using the following SEQ ID NOs: 13 and 14 primers. PCR conditions were carried out with 25 cycles of initial denaturation (95 ℃, 5 minutes, 1 cycle), denaturation (95 ℃, 1 minute), annealing (62 ℃, 1 minute), extension (72 ℃ 1 minute).

SEQ ID NO: 13: 5'-CCCAAGCTTACTAGTGAATCAAGGCTAGAA

SEQ ID NO: 14 5'-GGAATTCAAATAATCCTGTTAAC

The amplified DNA product was digested with Hind III / EcoR I restriction enzyme and conjugated to the 5′-end of the NEGFP gene of the pNEGFP vector prepared in Example 2 using an ligation kit (Takara, Japan).

To clone the GAL11P: CEGFP fusion gene, GAL11P was prepared as a prey polynucleotide and amplified by PCR using the following SEQ ID NOs: 15 and 16 primers. PCR conditions were carried out with 25 cycles of initial denaturation (95 ℃, 5 minutes, 1 cycle), denaturation (95 ℃, 1 minute), annealing (62 ℃, 1 minute), extension (72 ℃ 1 minute).

SEQ ID NO: 15'-CCCAAGCTTACTAGTCCTCAACAGCAGCAA

SEQ ID NO: 16: 5'-GGAATTCCAATGCTTGGATTTTTC

The amplified DNA product was digested with Hind III / EcoR I restriction enzyme and conjugated to the 5′-end of the CEGFP gene of the pCEGFP vector prepared in Example 2 using an ligation kit (Takara, Japan).

Then, the NEGFP: GAL4DD, CGFP: GAL11P, GAL4DD: NEGFP and GAL11P: CEGFP fusion genes were confirmed by DNA sequencing, and then YM4271 yeast strains (MATa, ura3-52, his3-200, ade2-101, ade5, lys2-801). , leu2-3, 112, trp1-901, tyr1-501, gal4D, gal80D, ade5 :: hisG, Clontech, CA, USA).

Example 4. yeast two-hybrid assay and in Fluorescence in vivo

Using NEGFP and CEGFP as a reporter gene, it was confirmed whether fluorescence remodeling was possible. To determine the proper structure of the isolated EGFP fusion protein, they were combined in different forms (FIG. 3). Combination 1 is a combination of NEGFP: GAL4DD and CEGFP: GAL11P, Combination 2 is NEGFP: GAL4DD and GAL11P: CEGFP, Combination 3 is GAL4DD: NEGFP and CEGFP: GAL11P, Combination 4 is GAL4DD: NEGFP and GAL11P: CEGFP , Combination 5 combines NEGFP: GAL4DD and CEGFP, and Combination 6 combines NEGFP and CEGFP: GAL11P.

For the yeast two-hybrid assay, the six NEGFP and CEGFP fusion constructs in YM4271 yeast strains requiring uracil, histidine, leucine, trypsin due to mutations of ura3-52, his3-200, leu2-3 and trp1-901, respectively Were introduced according to the manual of MATCHMAKER LexA two-hybrid system (Clontech, Calif.). To confirm that each yeast cell was transformed, yeast transformants expressing NEGFP and CEGFP fusion proteins were identified by colony PCR using primer pairs specific for the NEGFP and CEGFP fusion proteins shown in FIG. 3B. Colony PCR was carried out in Prime Taq Premix (GENET BIO, # G-2000) 1 μl each of the primer pair specific for the NEGFP and CEGFP fusion protein, 18 μl of distilled water to make 20 μl of the total volume, and transformed yeast Sift the sieve, then initial denaturation (95 ° C, 5 minutes, 1 cycle), and denaturation (95 ° C, 1 minute), annealing (62 ° C, 1 minute), extension (72 ° C 1 minute) 25 cycles It was carried out under the reaction conditions.

The PCR fragment was electrophoresed on 1% agarose gel containing 0.5 μg / ml ethidium bromide (EtBr). As a result, 594-bp (1N-5N), 474-bp (6N), 513-bp (1C-4C, 6C) and 243-bp (5C) PCR products were observed in the transformed yeast colonies, but It was not observed in YM4271 without transformation (FIG. 4A).

In order to confirm the fluorescence in the yeast two-hybrid assay, after spreading the transformed YM4271 on the slide (spreading), the fluorescence was observed under a scanning microscope (confocal microscope, Carl Zeiss LSM 510). The degree of fluorescence remodeling in the six different NEGFP and CEGFP structure combinations prepared above was measured by counting fluorescent yeast cells. Full-length EGFP used as a positive control showed 67% fluorescence and untransformed YM4271 cells used as a negative control showed no fluorescence. A transformant incorporating pCEGFP (empty vector) and pNEGFP together was used as a background control. As a result, the combination 1 exhibited 40.1% higher fluorescence remodeling ability than the EGFP positive control group and 2.4 times higher than the control group for the background, while the combination 2 was 19.4%, the combination 3 was 19.4%, and the combination 4 13.4% and Combination 5 showed a low remodeling rate of 17.9% (FIG. 4B).

As described in detail above, since the yeast two-hybrid system according to the present invention does not require a separate substrate to express the reporter gene, it is possible to confirm whether protein-protein interactions are performed by a simple process.

The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Attach sequence list electronic file

Claims (8)

CEN6 / ARS4 origin, the DNA encoding the N-terminal domain of split enhanced green fluorescent protein (NEGFP) and the nucleotide sequence of SEQ ID NO: 2 having the nucleotide sequence of SEQ ID NO: 1 GAL4DD (GAL4) containing DNA encoding the C-terminal domain of split enhanced green fluorescent protein (CEGFP), and a bait polynucleotide at the 3'-end of the NEGFP coding DNA. A recombinant microorganism transformed with a recombinant vector in which a dimerization domain is conjugated and GAL11P (GAL11 protein) is conjugated as a prey polynucleotide at the 3'-end of the CEGFP coding DNA. delete delete delete delete delete The recombinant microorganism of claim 1, wherein the microorganism is a yeast. A method for detecting interaction between bait-prey, wherein the recombinant microorganism of claim 1 or 7 is cultured to measure the fluorescence of the cultured recombinant microorganism.

Images