WO1999010525A1 - Procede pour le traitement du cancer - Google Patents

Procede pour le traitement du cancer Download PDF

Info

Publication number
WO1999010525A1
WO1999010525A1 PCT/US1998/017699 US9817699W WO9910525A1 WO 1999010525 A1 WO1999010525 A1 WO 1999010525A1 US 9817699 W US9817699 W US 9817699W WO 9910525 A1 WO9910525 A1 WO 9910525A1
Authority
WO
WIPO (PCT)
Prior art keywords
ras
cells
protein transferase
assay
map kinases
Prior art date
Application number
PCT/US1998/017699
Other languages
English (en)
Inventor
David C. Heimbrook
Deborah Defeo-Jones
Allen I. Oliff
Steven M. Stirdivant
Original Assignee
Merck & Co., Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9724299.4A external-priority patent/GB9724299D0/en
Application filed by Merck & Co., Inc. filed Critical Merck & Co., Inc.
Priority to JP2000507833A priority Critical patent/JP2001514191A/ja
Priority to CA002301880A priority patent/CA2301880A1/fr
Priority to AU89213/98A priority patent/AU8921398A/en
Priority to EP98941069A priority patent/EP1019529A4/fr
Publication of WO1999010525A1 publication Critical patent/WO1999010525A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity

Definitions

  • the present invention relates to methods of inhibiting prenyl-protein transferases and treating cancer which utilize prenyl- protein transferase inhibitors which inhibit the cellular processing of both the H-Ras protein and the K4B-Ras protein.
  • the present invention also relates to a method of identifying such compounds.
  • Prenylation of proteins by intermediates of the isoprenoid biosynthetic pathway represents a class of post- translational modification (Glomset, J. A., Gelb, M. H., and Farnsworth, C. C. (1990), Trends Biochem. Sci. 15, 139-142; Maltese, W. A. (1990), FASEB J. 4, 3319-3328).
  • Prenylated proteins share characteristic C-terminal sequences including CAAX (C, Cys; A, an aliphatic amino acid; X, another amino acid), XXCC, or XCXC.
  • CAAX C, Cys; A, an aliphatic amino acid
  • X another amino acid
  • XCXC XCXC
  • Three post-translational processing steps have been described for proteins having a C-terminal CAAX sequence: addition of either a 15 carbon (farnesyl) or 20 carbon (geranylgeranyl) isoprenoid to the Cys residue, proteolytic cleavage of the last 3 amino acids, and methylation of the new C-terminal carboxylate (Cox, A. D. and Der, C. J. (1992a), Critical Rev.
  • FPTase farnesyl-protein transferase
  • GGPTase-I geranylgeranyl- protein transferase type I
  • Rab GGPTase geranylgeranyl-protein transferase type-II
  • Each of these enzymes selectively uses farnesyl diphosphate or geranylgeranyl diphosphate as the isoprenoid donor and selectively recognizes the protein substrate.
  • FPTase farnesylates CAAX- containing proteins that end with Ser, Met, Cys, Gin or Ala.
  • CAAX tetrapeptides comprise the minimum region required for interaction of the protein substrate with the enzyme.
  • the enzymological characterization of these three enzymes has demonstrated that it is possible to selectively inhibit one with little inhibitory effect on the others (Moores, S. L., Schaber, M. D., Mosser, S. D., Rands, E., O'Hara, M. B., Garsky, V.
  • Ras protein is part of a signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein.
  • Ras In the inactive state, Ras is bound to GDP.
  • Ras Upon growth factor receptor activation, Ras is induced to exchange GDP for GTP and undergoes a conformational change.
  • the GTP-bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and D.M. Willumsen, Ann.
  • MAP Kinase pathway Activation of Ras leads to activation of multiple intracellular signal transduction pathways, including the MAP Kinase pathway and the Rho/Rac pathway (Joneson et al, Science 277:810-812).
  • MAP Kinase pathway activation of transcription factors, for example Elk- 1 , and transcription of specific proteins (R. Treisman, Current Opinion in Genetics and Development (1994) 4:96-101, and references therein).
  • Mutated ras genes are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias.
  • the protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
  • the Ras protein is one of several proteins that are known to undergo post-translational modification.
  • Farnesyl-protein transferase utilizes farnesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss et al, Cell, 62:81-88 (1990); Schaber et al, J. Biol. Chem., 2(55: 14701-14704 (1990); Schafer et al, Science, 249: 1133-1139 (1990); Manne et al, Proc. Natl. Acad. Sci USA, 87:7541-7545 (1990)).
  • Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modi- fications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras.
  • the Ras C-terminus contains a sequence motif termed a "CAAX” or "Cys-Aaa-Aaa-Xaa” box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al, Nature 370:583-586 (1984)).
  • this motif serves as a signal sequence for the enzymes farnesyl-protein transferase or geranyl geranyl-protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C 1 5 or C20 isoprenoid, respectively.
  • farnesylated proteins include the Ras-related GTP-binding proteins such as RhoB, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin.
  • RhoB Ras-related GTP-binding proteins
  • James, et al. have also suggested that there are farnesylated proteins of unknown structure and function in addition to those listed above.
  • Inhibitors of farnesyl-protein transferase (FPTase) have been described in two general classes.
  • the first class includes analogs of farnesyl diphosphate (FPP), while the second is related to protein substrates (e.g., Ras) for the enzyme.
  • FPP farnesyl diphosphate
  • protein substrates e.g., Ras
  • the peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation. (Schaber et al, ibid; Reiss et. al, ibid; Reiss et al, PNAS, 85:732-736 (1991)).
  • Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the farnesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al, Science, 260: 1934-1937 (1993); Graham, et al., /. Med. Chem., 37, 725 (1994)).
  • H-ras is an abbreviation for Harvey-ras.
  • K4A- ras and K4B-ras are abbreviations for the Kirsten splice variants of ras that contain the 4A and 4B exons, respectively.
  • the instant invention provides for a method of inhibiting prenyl-protein transferases and treating cancer which comprises administering to a mammal a prenyl-protein transferase inhibitor which is an inhibitor of cellular processing of the H-Ras and K4B-Ras proteins.
  • the invention in particular provides for a method of inhibiting farnesyl-protein transferase and geranylgeranyl-protein transferase type I by administering a compound that is a dual inhibitor of both of those prenyl-protein transferases.
  • the instant invention also provides for a method of identifying such a compound, the method comprising an assay whose readout is a consequence of the biological activity or inhibition of that activity of the Ras protein, thus providing convenient identifica- tion of compounds that inhibit cellular processing of the H-Ras and K4B-Ras proteins.
  • FIGURE 1 Schematic Diagram of the SEAP Assay:
  • the present invention relates to a method of inhibiting prenyl-protein transferases which comprises administering to a mammal in need thereof a pharmaceutically effective amount of a compound which has certain characteristics that are indicative of in vivo efficacy as an inhibitor of the growth of cancer cells.
  • the compound is characterized by: a) an inhibitory activity (IC50) of less than 12 ⁇ M against K4B-Ras dependent activation of MAP kinases in cells.
  • the compound utilized in the instant method is characterized by: a) an inhibitory activity (IC50) of less than 5 ⁇ M against
  • the compound may be further characterized by one or more of the following: b) an inhibitory activity (IC50) against K4B-Ras dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against Myr-Ras dependent activation of MAP kinases in cells; c) an inhibitory activity (IC50) against H-ras-CVLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against Myr-Ras dependent activation of MAP kinases in cells; d) an inhibitory activity (IC50) against H-Ras dependent activation of MAP kinases in cells greater than 2 fold lower but less than 20,000 fold lower than the inhibitory activity (IC50) against
  • H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; d) an inhibitory activity (IC50) against H-ras-CVLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein; and e) an inhibitory activity (IC50) against K4B-Ras dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
  • the compound is further characterized by: c) inhibitory activity (IC50) of ⁇ 10 nM against H-Ras dependent activation of MAP kinases in cells.
  • IC50 inhibitory activity
  • the prenyl-protein transferases that are being inhibited by the instant method are both farnesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • the compound that is being administered is a dual inhibitor of farnesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • such a potent dual inhibitor is particularly useful as an in vivo inhibitor of the growth of cancer cells, particularly those cancers characterized by a mutated K4B-Ras protein, at concentrations of inhibitor that do not cause mechanism based toxicity.
  • Mechanism-based toxicity of farnesyl- protein transferase inhibitors can be anticipated in rapidly proliferating tissues, for example, the bone marrow.
  • the present invention further relates to a method of identifying a prenyl-protein transferase inhibitor which is efficacious in vivo as an inhibitor of cancer cell growth.
  • the instant method comprises a novel in vitro assay (described in detail below) whose readout is a consequence of the biological activity of the Ras protein (or its inhibition) instead of a determination of the physical state of the Ras protein (whether or not the protein has been processed).
  • This assay differs from previously disclosed assays that measure the extent of inhibition of Ras processing in cells because the determination of the extent of processing may be performed with a high through-put luminometer and does not depend on time-intensive use of polyacrylamide gel electrophoresis.
  • Compounds that inhibit the processing of the Ras protein but do not inhibit its biological activity may be improperly identified by previously disclosed assays of Ras processing in cells which merely measure the extent to which the protein was processed.
  • the instant assay that is useful in the identification of the prenyl-protein transferase inhibitors of the instant invention, comprises the steps of: a) co-transfecting cells with an expression plasmid for a ras gene and an expression plasmid for a reporter construct that encodes the product of a reporter gene; b) incubating the cells in the presence of test compound; and c) analyzing an aliquot of the assay medium or a lysate of the cells for the presence of the product of the reporter gene.
  • the product of the reporter gene is secreted alkaline phosphatase.
  • the assay is termed the SEAP assay.
  • SEAP assay use of the SEAP assay is described.
  • other reporter systems including but not limited to: luciferase, ⁇ -galactosidase, chloramphenicol acetyl transferase and ⁇ -glucuronidase.
  • the expression of the reporter gene is controlled by a transcription factor which is activated by MAP kinases.
  • MAP kinases includes but is not limited to ERK- 1 (Extracellular-Regulated protein Kinase), ERK-2, SAPK/JNK (stress activated protein kinase/C-jun N-terminal kinase) and p38.
  • Plasmids that incorporate the SEAP reporter construct include but are not limited to those described by D. Defeo- Jones et al. (Mol. Cell. Biol. 11:2307-2310 (1991)), R. E. Jones et al.
  • the SEAP reporter plasmids pDSElOO and pDSElOl described in Example 15 hereinbelow is also useful in the instant assay.
  • the SEAP reporter plasmid pCMV is also useful in the methods of the instant invention as a control plasmid to identify non-mechanism based toxicity of a test compound.
  • ras gene includes the H-ras , N-ras , K4B-ras , Myr-ras and H-ras -CVLL genes.
  • Expression plasmids for a ras gene of the instant invention include but are not limited to pZIP-rasH, pZIP-rasN, pZIP-rasK4B, pSMS600, pSMS601, pSMS620, pSMS621, pSMS622, pSMS630, pSMS640, pSMS650, pBW1423 (B.W. Williamsen et al. Mol Cell Biol, 11:6026-6033 (1991)), pRcCMV-H-ras-V12 and pRcCMV-H-ras-vl2,L189 (G.L. James et al. /. Biol Chem. ,269:27705-27714 (1994)).
  • Alternate expression vectors that can be utilized to create expression plasmids for a ras gene include, but are not limited to, pCI, pSI, pSport (Promega), pBK-CMV, pBK-RSV (Stratagene), pEUK-Cl (Clonetech), pCMV-LIC (Pharmingen) and pcDNAl. l/Amp (Invitrogen).
  • the assay medium used in the instant assay may be selected from medium useful for maintaining transiently transfected cells.
  • the medium will lack phenol red and will be low in serum.
  • the assay medium comprises phenol red free DMEM, 2% mammalian serum, Pen Strep, glutamine and nonessential amino acids (NEAA).
  • transfectable host cells that arrest in low serum growth media can be used in connection with the instant assay.
  • Examples include cell lines typically employed for eukaryotic expression such as C33a (ATCC: HTB-31), Ratl and 3T3 cell lines.
  • a preferred line for use in the instant assay has been found to be the human cell line C33a.
  • the cancer cells are isolated after being co-transfected with the expression plasmids.
  • the method of identifying a prenyl-protein transferase inhibitor comprises the steps of: a) evaluating the test compound in the instant assay wherein the ras gene is K-ras ; b) evaluating the test compound in the instant assay wherein the ras gene is Myr-ra ; and c) comparing the activity of the test compound against Myr-Ras dependent activation of MAP kinases in the instant assay with the activity of the test compound against K- Ras dependent activation of MAP kinases in the instant assay.
  • the K-ras gene utilized in the instant method is the K4B-ras gene, although it is envisaged that the K4A-ras gene could also be utilized.
  • the first embodiment of the method of the instant invention comprises one or both of the additional steps of: d) evaluating the test compound in the instant assay wherein the ras gene is H-ras ; and e) evaluating the test compound in the instant assay wherein the ras gene is H-ras-CVLL.
  • the method of identifying a prenyl-protein transferase inhibitor comprises the steps of: a) evaluating the test compound in the instant assay wherein the ras gene is H-ras ; b) evaluating the test compound in the instant assay wherein the ras gene is H-ras-CVLL; c) evaluating the test compound in the instant assay wherein the ras gene is Myr-ras ; and d) comparing the activity of the test compound against Myr- Ras dependent activation of MAP kinases in the instant assay with the activity of the test compound against H- Ras dependent activation of MAP kinases in the instant assay and H-Ras-CVLL dependent activation of MAP kinases in the instant assay.
  • the method of identifying a prenyl-protein transferase inhibitor comprises the steps of: a) evaluating the test compound in the instant assay wherein the Ras gene is N-ras ; b) evaluating the test compound in the instant assay wherein the Ras gene is Myr-ras ; and c) comparing the activity of the test compound against Myr- Ras dependent activation of MAP kinases in the instant assay with the activity of the test compound against N- Ras dependent activation of MAP kinases in the instant assay.
  • the method of identifying a prenyl-protein transferase inhibitor comprises the steps of: a) evaluating the test compound in the instant assay wherein the ras gene is H-ras ; b) evaluating the test compound in the instant assay wherein the ras gene is H-ras-CVLL; c) evaluating the test compound in the instant assay wherein the cells have been transfected with a pCMV-SEAP plasmid in the absence of transfection with a rasgene; and d) comparing the activity of the test compound against H-Ras- CVLL dependent activation of MAP kinases in the instant assay with the activity of the test compound against H- Ras dependent activation of MAP kinases in the instant assay and the activity of the test compound against SEAP expression in part c) of this method.
  • the assay utilized in the above methods of identifying inhibitors is the SEAP assay.
  • the pCMV-SEAP plasmid used in the instant assay is the pCMV-SEAP-A plasmid.
  • the inhibitor compounds identified by the instant method are useful in the inhibition of prenyl-protein transferase and the treatment of cancer and other proliferative disorders in mammals in need thereof.
  • the above methods of identifying a single compound that is a prenyl-protein transferase inhibitor or a dual inhibitor of farnesyl-protein transferase and geranylgeranyl -protein transferase-type I may also be used to identify optimal ratios of the active components in a combination of a selective farnesyl-protein transferase inhibitor and a selective geranylgeranyl-protein transferase-type I inhibitor.
  • the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 100 nM against H-Ras dependent activation of MAP kinases in cells in the SEAP assay.
  • the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 10 nM against H-Ras dependent activation of MAP kinases in cells in the SEAP assay.
  • IC50 inhibitory concentrations
  • the ratio of inhibitory activity (IC50) against K-Ras4B dependent activation to inhibitory activity against H-Ras dependent activation is ⁇ 2000.
  • the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 10 ⁇ M against H-Ras-CVLL dependent activation of MAP kinases in cells in the SEAP assay. More preferably, the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 1 ⁇ M against H-Ras-CVLL dependent activation of MAP kinases in cells in the SEAP assay.
  • the ratio of inhibitory activity (IC50) against H-Ras-CVLL dependent activation to inhibitory activity against H-Ras dependent activation is from about 2 to about 20,000. More preferably, the ratio of inhibitory activity (IC50) against H-Ras-CVLL dependent activation to inhibitory activity (IC50) against H-Ras dependent activation is from about 20 to about 2,000.
  • the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 5 ⁇ M against cellular N-Ras dependent activation of MAP kinases in the SEAP assay. More preferably, the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 1 ⁇ M against cellular N-Ras dependent activation of MAP kinases in the SEAP assay.
  • the compounds of the invention selectively inhibit processing of a Ras protein, and therefore inhibit the growth of cells transformed by a ras oncogene.
  • the step of evaluating the activity of the test compound in the instant assay wherein the SEAP plasmid is selected from the mutated ras gene designated Myr-ras assesses whether the test compound inhibits signal transduction independent of inhibiting Ras prenylation, since the mutated gene Myr-ras enables the protein to bypass the requirement of prenylation for cellular activity (J. E. Buss et al. Science, 243: 1600-1603 (1989)). If the IC50 of the test compound against cellular Myr-Ras dependent activation of MAP kinases in the instant assay is close in value to the IC50 of the test compound against
  • non-specific cytotoxicity of a test compound may be evaluated by incubating a cell that has been transfected with the pCMV-SEAP plasmid and analyzing the assay medium for the presence of the SEAP protein.
  • the ratio of the activity (as an IC50) of the test com- pound against cellular Myr-Ras dependent activation of MAP kinases in the SEAP assay to the activity (as an IC50) of the test compound against K4B-Ras dependent activation of MAP kinases in the SEAP assay is greater than 1.
  • the ratio of inhibitory activity (IC50) against Myr- Ras dependent activation of MAP kinases (as measured in the SEAP assay) to the inhibitory activity (IC50) against K4B-Ras dependent activation of MAP kinases is >5.
  • an inhibitory activity (IC50) against K4B-Ras dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against Myr-Ras dependent activation of MAP kinases in cells has the same meaning as the phrase "the ratio of inhibitory activity (IC50) against Myr- Ras dependent activation of MAP kinases (as measured in the SEAP assay) to the inhibitory activity (IC50) against K4B-Ras dependent activation of MAP kinases is >5" (and other like phrases).
  • the ratio of the activity (as an IC50) of the test compound against cellular Myr- Ras dependent activation of MAP kinases in the SEAP assay to the activity (as an IC50) of the test compound against H-Ras-CVLL dependent activation of MAP kinases in the SEAP assay is greater than 1.
  • the ratio of inhibitory activity against Myr- Ras dependent activation of MAP kinases (as measured in the SEAP assay) to the inhibitory activity against H-Ras-CVLL dependent activation of MAP kinases is >5.
  • MAP kinases in the SEAP assay is greater than 5.
  • the ratio of inhibitory activity against Myr-Ras dependent activation of MAP kinases (as measured in the SEAP assay) to the inhibitory activity against N-Ras dependent activation of MAP kinases is >20.
  • the ratio of the activity (as an IC50) of the test compound against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid to the activity (as an IC50) of the test compound against H-Ras-CVLL dependent activation of MAP kinases in the SEAP assay is greater than 1.
  • the ratio of inhibitory activity against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid to the activity (as an IC50) of the test compound against H-Ras-CVLL dependent activation of MAP kinases in the SEAP assay is >5.
  • Ras protein When a particular Ras protein is referred to herein by a term such as "K4B-Ras”, “N-Ras”, “H-Ras” and the like, such a term represents both the protein arising from expression of the corresponding wild type ras gene and various proteins arising from expression of ras genes containing various point mutations.
  • a particular ras gene is referred to herein by a term such as “K4B- ras”, “N-ras”, “H-ras” and the like, such a term represents both the wild type ras gene and ras genes containing various point mutations.
  • prenyl-protein transferase inhibiting compound refers to compounds which antagonize, inhibit or counteract the activity of the genes coding farnesyl-protein transferase and geranylgeranyl-protein transferase type I or the proteins produced in response thereto.
  • the term selective as used herein refers to the inhibitory activity of the particular compound against one biological activity (such as inhibition of prenyl-protein transferases) when compared to the inhibitory activity of the compound against another biological activity. It is understood that the greater the selectivity of a prenyl- protein transferase inhibitor, the more preferred such a compound is for the methods of treatment described.
  • a compound when discussing the combination of a selective inhibitor of geranylgeranyl -protein transferase-type I and a selective inibitor of farnesyl-protein transferase, a compound is considered a selective inhibitor of geranylgeranyl -protein transferase-type I, when its in vitro activity, as assessed by the assay described in Example 11, is at least 10 times greater that the in vitro activity of the same compound against farnesyl-protein transferase in the assay described in Example 10.
  • a compound is considered a selective inhibitor of farnesyl-protein transferase, for example, when its in vitro farnesyl-protein transferase inhibitory activity, as assessed by the assay described in Example 10, is at least 10 times greater that the in vitro activity of the same compound against geranylgeranyl- protein transferase-type I in the assay described in Example 11.
  • a selective compound exhibits at least 20 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl- protein transferase inhibition. More preferably the selectivity is at least 100 times or more. It is understood that the greater the selectivity of a geranylgeranyl-protein transferase-type I inhibitor or farnesyl-protein transferase inhibitor, the more preferred such a compound is in the such a combination.
  • the preferred therapeutic effect provided by the instant composition is the treatment of cancer and specifically the inhibition of cancerous tumor growth and/or the regression of cancerous tumors.
  • Cancers which are treatable in accordance with the invention described herein include cancers of the brain, breast, colon, genitourinary tract, prostate, skin, lymphatic system, pancreas, rectum, stomach, larynx, liver and lung. More particularly, such cancers include histiocytic lymphoma, lung adenocarcinoma, pancreatic carcinoma, colo-rectal carcinoma, small cell lung cancers, bladder cancers, head and neck cancers, acute and chronic leukemias, melanomas, and neurological tumors.
  • composition of this invention is also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the instant composition to a mammal in need of such treatment.
  • the composition is useful in the treatment of neurofibromatosis, which is a benign proliferative disorder.
  • composition of the instant invention is also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1:541-545(1995).
  • the instant composition may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of Pathology, 142: 1051-1060 (1993) and B. Cowley, Jr. et al. FASEB Journal, 2: A3160 (1988)).
  • the instant compounds may also inhibit tumor angio- genesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575-4580 (1995)).
  • Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization.
  • the instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S. Glenn et al. Science, 256: 1331-1333 (1992).
  • the instant compounds may also be useful as inhibitors of proliferation of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologie
  • the compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice.
  • the compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
  • compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
  • Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc.
  • the tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a water soluble taste masking material such as hydroxypropylmethyl- cellulose or hydroxypropylcellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymefhylcellulose, methylcellulose, hydroxypropyl- methyl-cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene-oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate.
  • dispersing or wetting agents may be a naturally-occurring phosphatide, for
  • the aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
  • Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • the pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions.
  • the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
  • Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants.
  • Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • sweetening agents for example glycerol, propylene glycol, sorbitol or sucrose.
  • Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • compositions may be in the form of a sterile injectable aqueous solutions.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • the sterile injectable preparation may also be a sterile injectable oil-in-water microemulsion where the active ingredient is dissolved in the oily phase.
  • the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
  • the injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection.
  • a continuous intravenous delivery device may be utilized.
  • An example of such a device is the Deltec CADD- PLUSTM model 5400 intravenous pump.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration.
  • This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • Compounds of Formula A may also be administered in the form of a suppositories for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • compositions are intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts.
  • the compounds identified by the instant method may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the instant compounds may be useful in combination with known anti-cancer and cytotoxic agents.
  • the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of neuro- fibromatosis, restinosis, poly cystic kidney disease, infections of hepatitis delta and related viruses and fungal infections.
  • the instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • the instant compounds may be utilized in combination with farnesyl pyrophosphate competitive inhibitors of the activity of farnesyl-protein transferase or in combination with a compound which has Raf antagonist activity.
  • the instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase or selective inhibitors of farnesyl- protein transferase.
  • the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant prenyl-protein transferase inhibitors and an antineoplastic agent. It is also understood that the instant combination of antineoplastic agent and inhibitor of prenyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery.
  • combination products employ the combinations of this invention within the dosage range described below and the other pharmaceutically active agent(s) within its approved dosage range.
  • Combinations of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a multiple combination formulation is inappropriate.
  • Radiation therapy including x-rays or gamma rays which are delivered from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with an inhibitor of prenyl-protein transferase alone to treat cancer. Additionally, compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, and herein incorporated by reference.
  • the instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • the instant compounds may be utilized in combination with farnesyl pyrophosphate competitive inhibitors of the activity of farnesyl-protein transferase or in combination with a compound which has Raf antagonist activity.
  • the instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U.S. Ser. No. 09/055,487, filed April 6, 1998, which is incorporated herein by reference.
  • an integrin antagonist refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin(s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells.
  • the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ocv ⁇ 3 integrin, which selectively antagonize, inhibit or counteract binding of a physiological ligand to the v ⁇ 5 integrin, which antagonize, inhibit or counteract binding of a physiological ligand to both the ⁇ v ⁇ 3 integrin and the ⁇ v ⁇ 5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells.
  • the term also refers to antagonists of the v ⁇ 6, ⁇ v ⁇ 8, ocl ⁇ l, 2 ⁇ l, 5 ⁇ l, ⁇ 6 ⁇ l and 6 ⁇ 4 integrins.
  • the term also refers to antagonists of any combination of ⁇ v ⁇ 3, v ⁇ 5, v ⁇ 6, v ⁇ 8, l ⁇ l, ⁇ 2 ⁇ l, ⁇ 5 ⁇ l, ⁇ 6 ⁇ l and ⁇ 6 ⁇ 4 integrins.
  • the instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin.
  • the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, and response of the individual patient, as well as the severity of the patient's symptoms.
  • a suitable amount of a prenyl-protein transferase inhibitor are administered to a mammal undergoing treatment for cancer.
  • Administration occurs in an amount of each type of inhibitor of between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
  • a particular therapeutic dosage that comprises the instant composition includes from about O.Olmg to about lOOOmg of a prenyl-protein transferase inhibitor.
  • the dosage comprises from about lmg to about lOOOmg of a prenyl-protein transferase inhibitor.
  • antineoplastic agent examples include, in general, microtubule-stabilising agents (such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), or their derivatives); alkylating agents, anti-metabolites; epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes; biological response modifiers and growth inhibitors; hormonal/anti-hormonal therapeutic agents and haematopoietic growth factors.
  • microtubule-stabilising agents such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), or their derivatives)
  • alkylating agents such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), or their derivatives)
  • alkylating agents such as paclitaxel (also known as Taxol®), docetaxel (
  • Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine family of drugs, diynenes and the podophyllotoxins.
  • Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunorubicin, aminopterin, methotrexate, methopterin, dichloro- methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like.
  • antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, gemcitibine, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, camptothecin, CPT- 11 , topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins.
  • Rla is selected from: hydrogen or Cl-C6 alkyl
  • Rl is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 10 O-, -N(Rl°)2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, Rl°0-, or -N(R 10 )2;
  • R 3 and R 4 selected from H and CH3;
  • R2 is selected from H; unsubstituted or substituted aryl, unsubstituted or substituted heteroaryl,
  • R2 and R3 are optionally attached to the same carbon atom;
  • Ro and R ⁇ are independently selected from:
  • R6a is selected from:
  • R8 is independently selected from: a) hydrogen, b) C 1 -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C 1 -C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, N ⁇ 2, (RlO)2N-C(NRlO)-, RlOC(O)-, -N(RlO)2, or R l ⁇ C(O)NRl0-, and c) C 1 -C ⁇ alkyl substituted by C 1 -C ⁇ perfluoroalkyl, R OO-, Rl0C(O)NRl0-, (R10) 2 N-C(NR10)-, RlOC(O)-, -N(RlO)2, or Rl l ⁇ C(O)NRl0-;
  • R9 a is hydrogen or methyl
  • RIO is independently selected from hydrogen, C1-C6 alkyl, C1-C6 perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
  • R11 is independently selected from C1-C6 alkyl and aryl
  • V is selected from: a) hydrogen, b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S, and N, and e) C2-C20 alkenyl, and provided that V is not hydrogen if A is S(0)m and V is not hydrogen if A ⁇ is a bond, n is 0 and A ⁇ is S(0)m;
  • Z is selected from:
  • a unsubstituted or substituted group selected from aryl, heteroaryl, arylmethyl, heteroarylmethyl, arylsulfonyl, heteroarylsulfonyl, wherein the substituted group is substituted with one or more of the following: a) Cl-4 alkyl, unsubstituted or substituted with:
  • n 0, 1, 2, 3 or 4
  • p 0, 1, 2, 3 or 4
  • r 0 to 5, provided that r is 0 when V is hydrogen
  • Rla is selected from: hydrogen or C1-C6 alkyl
  • Rib is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, RlOO-, -N(R 10 )2 or C2-C6 alkenyl, c) Cl-C6 alkyl unsubstituted or substituted by unsubstituted or substituted aryl, heterocycle, cycloalkyl, alkenyl, R ⁇ O-, or
  • R c is selected from: a) hydrogen, b) unsubstituted or substituted C1-C6 alkyl wherein the substituent on the substituted C1-C6 alkyl is selected from unsubstituted or substituted aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, RlOO-, R ⁇ S(0) m -, R 10 C(O)NRl0-, (RlO) 2 N-C(0)-, CN, (RlO)2N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, N3, -N(RlO)2, and Rl 10C(0)-NR10-, and c) unsubstituted or substituted aryl;
  • R3 and R 4 independently selected from H and CH3;
  • R2 is selected from H; ORlO;
  • R6 and R7 are independently selected from: H; Cl-4 alkyl, C3-6 cycloalkyl, aryl, heterocycle, unsubstituted or substituted with: a) Cl-4 alkoxy, b) halogen, or c) aryl or heterocycle;
  • R6a is selected from:
  • R8 is independently selected from: a) hydrogen, b) C 1 -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C l -C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, N ⁇ 2, (RlO)2N-C(NRlO)-, RlOC(O)-, -N(RiO)2, or RUOC ⁇ NRlO- ⁇ nd c) C1-C6 alkyl substituted by -C6 perfluoroalkyl, RlOO-,
  • R9a is hydrogen or methyl
  • RlO is independently selected from hydrogen, C1-C6 alkyl, C1-C6 perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl
  • RU is independently selected from C1-C6 alkyl and aryl
  • Rl2 is selected from: H; unsubstituted or substituted Cl-8 alkyl, unsubstituted or substituted aryl or unsubstituted or substituted heterocycle, wherein the substituted alkyl, substituted aryl or substituted heterocycle is substituted with one or more of: 1) aryl or heterocycle, unsubstituted or substituted lttin ⁇ . a) Cl-4 alkyl,
  • V is selected from: a) hydrogen, b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S, and N, and e) C2-C2O alkenyl, and provided that V is not hydrogen if Al is S(0) m and V is not hydrogen if Al is a bond, n is 0 and A ⁇ is S(0)m;
  • Y is selected from: a) hydrogen, b) RlOO-, Rl lS(0)m-, R1°C(0)NR10-, (RlO) 2 N-C(0)-, CN, N02, (Rl°)2N-C(NRlO)-, Rl2c(0)-, RlO ⁇ C(O)-, N3, F, -N(RlO)2, or Rl 10C(0)NR10-, c) unsubstituted or substituted C1-C6 alkyl wherein the substituent on the substituted C1-C6 alkyl is selected from unsubstituted or substituted aryl, RlOO-, R!0C(O)NR10-, (RlO) N-C(0)-, RlOC(O)- and RlO ⁇ C(O)-;
  • Z is an unsubstituted or substituted aryl, wherein the substituted aryl is substituted with one or more of the following:
  • Cl-4 alkyl unsubstituted or substituted with: a) Cl-4 alkoxy, b) NR6R7, c) C3-6 cycloalkyl, d) aryl, substituted aryl or heterocycle, e) HO, f) -S(0) m R 6a , or g) -C(0)NR6R7,
  • n 0, 1, 2, 3 or 4
  • p 0, 1, 2, 3 or 4
  • r 0 to 5, provided that r is 0 when V is hydrogen; and v is 0, 1 or 2;
  • Rl is independently selected from: hydrogen or Cl-C6 alkyl
  • R2 is independently selected from: a) hydrogen, b) substituted or unsubstituted aryl, substituted or unsubstituted heterocycle, C3-C10 cycloalkyl, RlOO- or
  • C2-C6 alkenyl c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, R OO-, or -N(Rl ) 2 ;
  • R3 is selected from: a) hydrogen, b) Cl-C6 alkyl unsubstituted or substituted by
  • R 4 and R5 are independently selected from: a) hydrogen, b) C1-C6 alkyl unsubstituted or substituted by
  • R11OC(O)NR10- c) substituted or unsubstituted aryl, substituted or unsubstituted heterocycle, C3-C10 cycloalkyl,
  • R6 is independently selected from: a) hydrogen, b) substituted or unsubstituted aryl, substituted or unsubstituted heterocycle, Cl-C6 alkyl, C2-C6 alkenyl,
  • R7 is independently selected from a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted cycloalkyl, and e) C1-C6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl, heterocycle and cycloalkyl; wherein heterocycle is selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
  • R8 is selected from: a) hydrogen, b) C 1 -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C l -C6 perfluoroalkyl, F, Cl, RlOO-, R!0C(O)NR10-, CN, N ⁇ 2, (RlO)2N-C(NRlO)-, RlOC(O)-, RlO ⁇ C(O)-, -N(RlO)2, or R! 1OC(O)NR10-, and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, RlOO-,
  • R9 is selected from: a) hydrogen, b) C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F,
  • RHOC(O)NR10- and c) C1-C6 alkyl unsubstituted or substituted by C1-C6 perfluoroalkyl, F, Cl, RlOO-, RHS(0) m -, R 10 C(O)NRl0 . , CN, (R10) 2 N-C(NR10)-, RlOc(O)-, RlO ⁇ C(O)-, -N(RlO)2, or Rl 1OC(O)NR10-;
  • RIO is independently selected from hydrogen, C1-C6 alkyl, C1-C6 perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
  • Rl 1 is independently selected from C1-C6 alkyl and aryl
  • Rl2 is independently selected from hydrogen, C1-C6 alkyl, C1-C6 alkyl substituted with C ⁇ 2Rl°, C1-C6 alkyl substituted with aryl, C1-C6 alkyl substituted with substituted aryl, C1-C6 alkyl substituted with heterocycle, C1-C6 alkyl substituted with substituted heterocycle, aryl and substituted aryl;
  • A3 is selected from: a bond, -C(0)NR7-, -NR7C(0)-, -S(0)2NR7-,
  • a 4 is selected from: a bond, O, -N(R7)- or S;
  • V is selected from: a) hydrogen, b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) Cl-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S, and N, and e) C2-C2O alkenyl, and provided that V is not hydrogen if Al is S(0)m and V is not hydrogen if Al is a bond, n is 0 and A 2 is S(0)m;
  • Z is independently (Rl)2 or O
  • n 0, 1, 2, 3 or 4
  • p 0, 1, 2, 3 or 4
  • q is 0 or 1
  • r is 0 to 5, provided that r is 0 when V is hydrogen;
  • Rla is selected from: hydrogen or C1-C6 alkyl
  • Rib is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, Rl°0-, -N(R1°)2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, RlOO-, or -N(RlO)2;
  • R2a, R2b and R are independently selected from: a) hydrogen, b) C1-C6 alkyl unsubstituted or substituted by C2-C6 alkenyl, RlOO-, RHS(0) m -, R10C(O)NR10-, CN, N3, (RlO) 2 N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, -N(RlO)2, or RHOC(O)NR10-, c) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted cycloalkyl, alkenyl, RlOO-, Rl lS(0) m -, Rl0C(O)NRl0-, CN, NO2, (RlO)2N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, N3, -N(
  • R5 is hydrogen
  • R8 is selected from: a) hydrogen, b) C l -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C l -C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, NO2, (RlO)2N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, -N(RlO)2, or Rl l ⁇ C(O)NRl0-, and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, RlOO-, R!0C(O)NR10-, (R10)2N-C(NR10)-, RlOC(O)-, RlO ⁇ C(O)-, -N(RlO)2, or RHOC(O)NR10- ;
  • R ⁇ a is independently selected from C1-C6 alkyl and aryl
  • RIO is independently selected from hydrogen, C1-C6 alkyl, C1-C6 perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
  • RU is independently selected from C1-C6 alkyl, benzyl and aryl;
  • V is selected from: a) hydrogen, b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) C1-C2O alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S, and N, and e) C2-C20 alkenyl, provided that V is not hydrogen if Al is S(0)m and V is not hydrogen if A is a bond, n is 0 and A 2 is S(0)m;
  • Z is H2 or O; m is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is independently 0, 1, 2, 3 or 4; and r is 0 to 5, provided that r is 0 when V is hydrogen; or the pharmaceutically acceptable salts thereof.
  • R b is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, RlOO-, -N(RlO)2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R OO-, or -N(RlO)2;
  • R 2 is selected from H; unsubstituted or substituted aryl or C 1-5 alkyl, unbranched or branched, unsubstituted or substituted with one or more of:
  • R6 and R7 are independently selected from: Cl-4 alkyl, aryl, and heteroaryl, unsubstituted or substituted with: a) Cl-4 alkoxy, b) halogen, c) perfluoro-Cl-4 alkyl, or d) aryl or heteroaryl; R6a is selected from:
  • Cl-4 alkyl unsubstituted or substituted with: a) Cl-4 alkoxy, or b) aryl or heteroaryl;
  • R8 is independently selected from: a) hydrogen, b) C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, N02,
  • RlO is independently selected from hydrogen, C1-C6 alkyl, C1-C6 perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
  • Rl 1 is independently selected from C1-C6 alkyl and aryl
  • Z is an unsubstituted or substituted group selected from aryl, arylmethyl and arylsulfonyl, wherein the substituted group is substituted with one or more of the following: a) Cl-4 alkyl, unsubstituted or substituted with:
  • inhibitors of farnesyl-protein transferase are illustrated by the formula Il-a:
  • R b is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, Rl°0-, -N(R 10 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by unsubstituted or substituted aryl, heterocycle, cycloalkyl, alkenyl, RlOO-, or -N(RlO) 2 ;
  • Rlc is selected from: a) hydrogen, b) unsubstituted or substituted Cl-C6 alkyl wherein the substituent on the substituted C1-C6 alkyl is selected from unsubstituted or substituted aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, RlOO-, Rl lS(0) ⁇ r, R 10 C(O)NRl0-, (Rl0) 2 N-C(O)-, CN,
  • R6, R7 and R7a are independently selected from:
  • Roa is selected from:
  • R8 is independently selected from: a) hydrogen, b) C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, NO2, (RlO)2N-C(NRlO)-, RlOC(O)-, -N(RlO)2, or Rl l ⁇ C(O)NRl0-, and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, RlOO-,
  • RIO is independently selected from hydrogen, Cl-C6 alkyl, C1-C6 perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
  • Rl 1 is independently selected from C1-C6 alkyl and substituted or unsubstituted aryl
  • Rl 2 is selected from: H; unsubstituted or substituted Cl-8 alkyl, unsubstituted or substituted aryl or unsubstituted or substituted heterocycle, wherein the substituted alkyl, substituted aryl or substituted heterocycle is substituted with one or more of:
  • Y is selected from: a) hydrogen, b) RlOO-, Rl lS(0) m -, R!0C(O)NR10-, (RlO)2N-C(0)-, CN, N02, (R1°)2N-C(NR10)-, R12C(0)-, RlO ⁇ C(O)-, N3, F, -N(RlO)2, or Rl l ⁇ C(O)NRl0-, c) unsubstituted or substituted C1-C6 alkyl wherein the substituent on the substituted C1-C6 alkyl is selected from unsubstituted or substituted aryl, RlOO-, R1°C(O)NR10-, (Rl0)2N-C(O)-, RlOC(O)- and RlO ⁇ C(O)-;
  • Z is an unsubstituted or substituted aryl, wherein the substituted aryl is substituted with one or more of the following:
  • Cl-4 alkyl unsubstituted or substituted with: a) Cl-4 alkoxy, b) NR6R7, c) C3-6 cycloalkyl, d) aryl, substituted aryl or heterocycle, e) HO, f) -S(0) m R 6a or g) -C(0)NR6R7,
  • inhibitors of farnesyl-protein transferase are illustrated by the formula Ill-a:
  • R2 is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, RlOO-, -N(R 10 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, Rl°0-, or -N(Rl°)2;
  • R3 is selected from: a) hydrogen, b) C1-C6 alkyl unsubstituted or substituted by C2-C6 alkenyl, RlOO-, RHS(0) m -, R 10 C(O)NRl0-, CN, N3, (RlO)2N-C(NRlO)-, R10C(O)-, -N(RlO)2, or
  • Rll ⁇ C(O)NRl0-, c) substituted or unsubstituted aryl, substituted or unsubstituted heterocycle, C3-C10 cycloalkyl,
  • R 4 and R5 are independently selected from: a) hydrogen, b) C1-C6 alkyl unsubstituted or substituted by RlOO- or
  • R6 is independently selected from: a) hydrogen, b) substituted or unsubstituted aryl, substituted or unsubstituted heterocycle, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, RlOO-, allyloxy, R10C(O)NR10-, CN, N ⁇ 2, (R1°)2N-C(NR10)-,
  • RlOC(O)- -N(RlO)2, (Rl2)2NC(0 or RHOC(O)NR10-, and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, RlOO-, RlOC(0)NRlO-, (RlO) 2 N-C(NRlO)-, RlOC(O)-,
  • R7 is independently selected from a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted cycloalkyl, and e) Cl-C6 alkyl substituted with hydrogen or an unsubstituted or substituted group selected from aryl, heterocycle and cycloalkyl; wherein heterocycle is selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
  • R8 is independently selected from: a) hydrogen, b) C 1 -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C 1 -C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, N02,
  • RlO is independently selected from hydrogen, C1-C6 alkyl, C1-C6 perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
  • Rl is independently selected from C1-C6 alkyl and aryl
  • Rl2 is independently selected from hydrogen, C1-C6 alkyl, C1-C6 alkyl substituted with C ⁇ 2R °, -C6 alkyl substituted with aryl, C1-C6 alkyl substituted with substituted aryl, C1-C6 alkyl substituted with heterocycle, C1-C6 alkyl substituted with substituted heterocycle, aryl and substituted aryl;
  • A3 is selected from: a bond, -C(0)NR7-, -NR7C(0)-, -S(0)2NR7-,
  • Rib is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, Rl°0-, -N(R 10 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, Rl ⁇ O-, or -N(RlO)2;
  • R2a and R2b are independently selected from: a) hydrogen, b) C1-C6 alkyl unsubstituted or substituted by
  • R5 is hydrogen
  • R is independently selected from: a) hydrogen, b) C l -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C l -C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, N02, (RlO)2N-C(NRlO)-, RlOc(O)-, -N(RlO)2, or Rl l ⁇ C(O)NRl0-, and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, Rl°0-, Rl0C(O)NRl0-, (R10) 2 N-C(NR10)-, RlOC(O)-, -N(RlO)2, or RHOC(O)NR10-;
  • RIO is independently selected from hydrogen, C1-C6 alkyl, substituted or unsubstituted C1-C6 aralkyl and substituted or unsubstituted aryl;
  • Rl 1 is independently selected from Cl-C6 alkyl, benzyl and aryl;
  • alkyl refers to a monovalent alkane (hydrocarbon) derived radical containing from 1 to 15 carbon atoms unless otherwise defined. It may be straight, branched or cyclic. Preferred straight or branched alkyl groups include methyl, ethyl, propyl, isopropyl, butyl and t-butyl. Preferred cycloalkyl groups include cyclopentyl and cyclohexyl.
  • substituted alkyl when substituted alkyl is present, this refers to a straight, branched or cyclic alkyl group as defined above, substituted with 1-3 groups as defined with respect to each variable.
  • Heteroalkyl refers to an alkyl group having from 2-15 carbon atoms, and interrupted by from 1-4 heteroatoms selected from O, S and N.
  • alkenyl refers to a hydrocarbon radical straight, branched or cyclic containing from 2 to 15 carbon atoms and at least one carbon to carbon double bond. Preferably one carbon to carbon double bond is present, and up to four non- aromatic (non-resonating) carbon-carbon double bonds may be present.
  • alkenyl groups examples include vinyl, allyl, iso- propenyl, pentenyl, hexenyl, heptenyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, 1-propenyl, 2-butenyl, 2-methyl-2- butenyl, isoprenyl, farnesyl, geranyl, geranylgeranyl and the like.
  • Preferred alkenyl groups include ethenyl, propenyl, butenyl and cyclohexenyl.
  • alkynyl refers to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 15 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon- carbon triple bonds may be present.
  • Preferred alkynyl groups include ethynyl, propynyl and butynyl.
  • the straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted when a substituted alkynyl group is provided.
  • Aryl refers to aromatic rings e.g., phenyl, substituted phenyl and like groups as well as rings which are fused, e.g., naphthyl and the like.
  • Aryl thus contains at least one ring having at least 6 atoms, with up to two such rings being present, containing up to 10 atoms therein, with alternating (resonating) double bonds between adjacent carbon atoms.
  • the preferred aryl groups are phenyl and naphthyl.
  • Aryl groups may likewise be substituted as defined below.
  • Preferred substituted aryls include phenyl and naphthyl substituted with one or two groups.
  • aryl is intended to include any stable monocyclic, bicyclic or tricyclic carbon ring(s) of up to 7 members in each ring, wherein at least one ring is aromatic.
  • aryl groups include phenyl, naphthyl, anthracenyl, biphenyl, tetrahydronaphthyl, indanyl, phenanthrenyl and the like.
  • heteroaryl refers to a monocyclic aromatic hydrocarbon group having 5 or 6 ring atoms, or a bicyclic aromatic group having 8 to 10 atoms, containing at least one heteroatom, O, S or N, in which a carbon or nitrogen atom is the point of attachment, and in which one additional carbon atom is optionally replaced by a heteroatom selected from O or S, and in which from 1 to 3 additional carbon atoms are optionally replaced by nitrogen heteroatoms.
  • the heteroaryl group is optionally substituted with up to three groups.
  • Heteroaryl thus includes aromatic and partially aromatic groups which contain one or more heteroatoms.
  • this type are thiophene, purine, imidazopyridine, pyridine, oxazole, thiazole, oxazine, pyrazole, tetrazole, imidazole, pyridine, pyrimidine, pyrazine and triazine.
  • partially aromatic groups are tetrahydroimidazo[4,5-c]pyridine, phthalidyl and saccharinyl, as defined below.
  • heterocycle or heterocyclic represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic or stable 11-15 membered tricyclic heterocycle ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring.
  • the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure.
  • heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydro- benzothienyl, dihydrobenzothiopyranyl, dihydrobenzothio-pyranyl sulfone, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, isothiazolidinyl, morpholinyl, naphthyridinyl, oxadiazoly
  • substituted aryl substituted heterocycle
  • substituted cycloalkyl are intended to include the cyclic group which is substituted with 1 or 2 substituents selected from the group which includes but is not limited to F, Cl, Br, CF3, NH2, N(Cl-C6 alkyl)2, N02, CN, (C1-C6 alkyl)0-, -OH, (C1-C6 alkyl)S(0) m -, (C1-C6 alkyl)C(0)NH-, H2N-C(NH)-, (C1-C6 alkyl)C(O)-, (C1-C6 alkyl)OC(O)-, N3,(Cl-C6 alkyl)OC(0)NH- and C1-C2O alkyl.
  • amino acids which are disclosed are identified both by conventional 3 letter and single letter abbreviations as indicated below:
  • Valine Val V With respect to the term “CAAX” the letter “A” represents an aliphatic amino acid and is not limited to alanine.
  • the compounds used in the present method may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention.
  • named amino acids are understood to have the natural "L" stereoconfiguration
  • cyclic moieties When R2 and R are combined to form - (CH2)u -, cyclic moieties are formed. Examples of such cyclic moieties include, but are not limited to:
  • cyclic moieties may optionally include a heteroatom(s).
  • heteroatom-containing cyclic moieties include, but are not limited to:
  • cyclic moieties are formed.
  • examples of such cyclic moieties include, but are not limited to:
  • the pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids.
  • such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenyl- acetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
  • any substituent or variable e.g., RlO, Z, n, etc.
  • -N(RlO)2 represents -NHH, -NHCH3, -NHC2H5, etc. It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art as well as those methods set forth below.
  • the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared by reacting the free base with stoichiometric amounts or with an excess of the desired salt- forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • the compounds used in the methods of the instant invention are useful in various pharmaceutically acceptable salt forms.
  • pharmaceutically acceptable salt refers to those salt forms which would be apparent to the pharma-ceutical chemist, i.e., those which are substantially non-toxic and which provide the desired pharmacokinetic properties, palatability, absorption, distribution, metabolism or excretion.
  • compositions may be prepared from the active ingredients in combination with pharmaceutically acceptable carriers.
  • Non-toxic salts include conventional non-toxic salts or quarternary ammonium salts formed, e.g., from non-toxic inorganic or organic acids.
  • Non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
  • the pharmaceutically acceptable salts of the present invention can be synthesized by conventional chemical methods. Generally, the salts are prepared by reacting the free base or acid with stoichiometric amounts or with an excess of the desired salt- forming inorganic or organic acid or base, in a suitable solvent or solvent combination.
  • the farnesyl transferase inhibitors of formula I can be synthesized in accordance with Schemes 1-11, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures.
  • Substituents R, R a and Rb, as shown in the Schemes, represent the substituents R2, R3, R4 5 an d R5; however their point of attachment to the ring is illustrative only and is not meant to be limiting.
  • Piperazin-5-ones can be prepared as shown in Scheme 1.
  • the protected suitably substituted amino acid IV can be converted to the corresponding aldehyde V by first forming the amide and then reducing it with LAH.
  • Reductive amination of Boc-protected amino aldehydes V gives rise to compound VI.
  • the intermediate VI can be converted to a piperazinone by acylation with chloroacetyl chloride to give VII, followed by base-induced cyclization to VIII.
  • the intermediate VIII can be reductively alkylated with a variety of aldehydes, such as XII.
  • the aldehydes can be prepared by standard procedures, such as that described by O. P. Goel, U. Krolls, M. Stier and S. Kesten in Organic Syntheses. 1988, 67, 69-75, from the appropriate amino acid (Scheme 2).
  • the reductive alkylation can be accomplished at pH 5-7 with a variety of reducing agents, such as sodium triacetoxyborohydride or sodium cyanoborohydride in a solvent such as dichloroethane, methanol or dimethylformamide.
  • the product XIII can be deprotected to give the final compounds XIV with trifluoroacetic acid in methylene chloride.
  • the final product XIV is isolated in the salt form, for example, as a trifluoroacetate, hydrochloride or acetate salt, among others.
  • the product diamine XIV can further be selectively protected to obtain XV, which can subsequently be reductively alkylated with a second aldehyde to obtain XVI. Removal of the protecting group, and conversion to cyclized products such as the dihydroimidazole XVII can be accomplished by literature procedures.
  • the imidazole acetic acid XVIII can be converted to the acetate XIX by standard procedures, and XIX can be first reacted with an alkyl halide, then treated with refluxing methanol to provide the regiospecifically alkylated imidazole acetic acid ester XX (Scheme 3).
  • Hydrolysis and reaction with piperazinone VIII in the presence of condensing reagents such as l-(3-dimethylaminopropyl)- 3-ethylcarbodiimide (EDC) leads to acylated products such as XXI.
  • the piperazinone VIII is reductively alkylated with an aldehyde which also has a protected hydroxyl group, such as XXII in Scheme 4, the protecting groups can be subsequently removed to unmask the hydroxyl group (Schemes 4, 5).
  • the alcohol can be oxidized under standard conditions to e.g. an aldehyde, which can then be reacted with a variety of organometallic reagents such as Grignard reagents, to obtain secondary alcohols such as XXIV.
  • the fully deprotected amino alcohol XXV can be reductively alkylated (under conditions described previously) with a variety of aldehydes to obtain secondary amines, such as XXVI (Scheme 5), or tertiary amines.
  • the Boc protected amino alcohol XXIII can also be utilized to synthesize 2-aziridinylmethylpiperazinones such as XXVII (Scheme 6). Treating XXIII with l,l'-sulfonyldiimidazole and sodium hydride in a solvent such as dimethylformamide led to the formation of aziridine XXVII.
  • Scheme 8 illustrates the use of an optionally substituted homoserine lactone XXXIII to prepare a Boc-protected piperazinone XXXVII.
  • Intermediate XXXVII may be deprotected and reductively alkylated or acylated as illustrated in the previous Schemes.
  • intermediate XXXVII may be mesylated and displaced by a suitable nucleophile, such as the sodium salt of ethane thiol, to provide an intermediate XXXVIII.
  • Intermediate XXXVII may also be oxidized to provide the carboxylic acid on intermediate IXL, which can be utilized form an ester or amide moiety.
  • N-Aralkyl-piperazin-5-ones can be prepared as shown in Scheme 9. Reductive amination of Boc-protected amino aldehydes V (prepared from III as described previously) gives rise to compound XL. This is then reacted with bromoacetyl bromide under Schotten-Baumann conditions; ring closure is effected with a base such as sodium hydride in a polar aprotic solvent such as dimethylformamide to give XLI. The carbamate protecting group is removed under acidic conditions such as trifluoroacetic acid in methylene chloride, or hydrogen chloride gas in methanol or ethyl acetate, and the resulting piperazine can then be carried on to final products as described in Schemes 1-7.
  • the isomeric piperazin-3-ones can be prepared as described in Scheme 10.
  • the imine formed from arylcarboxamides XLII and 2-aminoglycinal diethyl acetal (XLIII) can be reduced under a variety of conditions, including sodium triacetoxyborohydride in dichloroethane, to give the amine XLIV.
  • Amino acids I can be coupled to amines XLIV under standard conditions, and the resulting amide XLV when treated with aqueous acid in tetrahydrofuran can cyclize to the unsaturated XL VI.
  • Catalytic hydrogenation under standard conditions gives the requisite intermediate XL VII, which is elaborated to final products as described in Schemes 1-7.
  • Amino acids of the general formula IL which have a sidechain not found in natural amino acids may be prepared by the reactions illustrated in Scheme 11 starting with the readily prepared imine XL VIII.
  • Reactions used to generate the compounds of the formula (II) are prepared by employing reactions as shown in the Schemes 16- 37, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures.
  • Substituents R a and Rb, as shown in the Schemes, represent the substituents R2, R3, R4 ? an d R5; substituent "sub” represents a suitable substituent on the substituent Z.
  • the point of attachment of such substituents to a ring is illustrative only and is not meant to be limiting.
  • the protected piperidine intermediate LIII can be deprotected and reductively alkylated with aldehydes such as l-trityl-4-imidazolyl-carboxaldehyde or 1-trityl- 4-imidazolylacetaldehyde, to give products such as LVI.
  • aldehydes such as l-trityl-4-imidazolyl-carboxaldehyde or 1-trityl- 4-imidazolylacetaldehyde
  • the trityl protecting group can be removed from LVI to give LVII, or alternatively, LVI can first be treated with an alkyl halide then subsequently deprotected to give the alkylated imidazole LVIII.
  • the deprotected intermediate LIII can also be reductively alkylated with a variety of other aldehydes and acids as shown above in Schemes 4-7.
  • Scheme 18 An alternative synthesis of the hydroxymethyl intermediate LIV and utilization of that intermediate in the synthesis of the instant compounds which inco ⁇ orate the preferred imidazolyl moiety is illustrated in Scheme 18.
  • Scheme 19 illustrates the reductive alkylation of intermediate LIV to provide a 4-cyanobenzylimidazolyl substituted piperidine. The cyano moiety may be selectively hydrolyzed with sodium borate to provide the corresponding amido compound of the instant invention.
  • Scheme 20 alternative preparation of the methyl ether intermediate LV and the alkylation of LV with a suitably substituted imidazolylmethyl chloride to provide the instant compound. Preparation of the homologous l-(imidazolylethyl)piperidine is illustrated in Scheme 21.
  • the protected piperidine LX may be dehydrated and then hydroborated to provide the 3- hydroxypiperidine LXIII.
  • This compound may be deprotected and further derivatized to provide compounds of the instant invention (as shown in Scheme 27) or the hydroxyl group may be alkylated, as shown in Scheme 26, prior to deprotection and further manipulation.
  • the dehydration product may also be catalytically reduced to provide the des-hydroxy intermediate LXV, as shown in Scheme 28, which can be processed via the reactions illustrated in the previous Schemes.
  • Schemes 29 and 30 illustrate further chemical manipulations of the 4-carboxylic acid functionality to provide instant compounds wherein the substituent Y is an acetylamine or sulfonamide moiety.
  • Scheme 31 illustrates inco ⁇ oration of a nitrile moiety in the 4-position of the piperidine of the compounds of formula II.
  • the hydroxyl moiety of a suitably substituted 4-hydroxypiperidine is substituted with nitrile to provide intermediate LXVI, which can undergo reactions previously described in Schemes 17-21.
  • Scheme 32 illustrates the preparation of several pyridyl intermediates that may be utilized with the piperidine intermediates such as compound LI in Scheme 16 to provide the instant compounds.
  • Scheme 33 shows a generalized reaction sequence which utilizes such pyridyl intermediates.
  • R CH 3 , CH 3 CH 2
  • Reaction B Preparation of a reduced peptide subunit by reductive alkylation of an amine by an aldehyde using sodium cyanoborohydride or other reducing agents.
  • Reaction C Alkylation of a reduced peptide subunit with an alkyl or aralkyl halide or, alternatively, reductive alkylation of a reduced peptide subunit with an aldehyde using sodium cyanoborohydride or other reducing agents.
  • Reaction E Preparation of a reduced subunit by borane reduction of the amide moiety.
  • Reaction B Preparation of reduced peptide subunits by reductive alkylation
  • RA and RB are R2, R3 or R5 as previously defined; RC and RD are R ⁇ or Rl2; XL is a leaving group, e.g., Br, I- or MsO-; and Ry is defined such that R7 is generated by the reductive alkylation process.
  • Reaction Scheme 43 illustrates inco ⁇ oration of the cyclic amine moiety, such as a reduced prolyl moiety, into the compounds of the formula III of the instant invention.
  • Reduction of the azide LXXXI provides the amine LXXXII, which may be mono- or di-substituted using techniques described above.
  • inco ⁇ oration of a naphthylmethyl group and an acetyl group is illustrated.
  • Reaction Scheme 45 illustrates the use of protecting groups to prepare compounds of the instant invention wherein the cyclic amine contains an alkoxy moiety.
  • the hydroxy moiety of key intermediate LXXXIVa may be further converted to a fluoro or phenoxy moiety, as shown in Reaction Scheme 46.
  • Intermediates LXXXV and LXXXVI may then be further elaborated to provide the instant compounds.
  • Reaction Scheme 474 illustrates syntheses of instant compounds wherein the variable is a suitably substituted oc-hydroxybenzyl moiety.
  • the protected intermediate aldehyde is treated with a suitably substituted phenyl Grignard reagent to provide the enantiomeric mixture LXXXVII.
  • Reaction Scheme 48 and 49 Syntheses of imidazole-containing intermediates useful in synthesis of instant compounds wherein the variable p is 0 or 1 and Z is H2 are shown in Reaction Scheme 48 and 49.
  • the mesylate XCI can be utilized to alkylate a suitably substituted amine or cyclic amine, while aldehyde XCII can be used to similarly reductively alkylate such an amine.
  • Reaction Scheme 50 illustrates the syntheses of imidazole-containing intermediates wherein the attachment point of the -(CR22)p-C(Z)- moiety to W (imidazolyl) is through an imidazole ring nitrogen.
  • Reaction Scheme 51 illustrates the synthesis of an intermediate wherein an R ⁇ substituent is a methyl.
  • prenyl transferase inhibitors of formula (A) can be synthesized in accordance with Reaction Scheme below, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures. Some key reactions utilized to form the aminodiphenyl moiety of the instant compounds are shown.
  • the reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the alkylation reactions described in the Reaction Scheme.
  • a method of forming the benzophenone intermediates is a Stille reaction with an aryl stannane. Such amine intermediates may then be reacted as illustrated hereinabove with a variety of aldehydes and esters/acids.
  • the standard workup referred to in the examples refers to solvent extraction and washing the organic solution with 10% citric acid, 10% sodium bicarbonate and brine as appropriate. Solutions were dried over sodium sulfate and evaporated in vacuo on a rotary evaporator.
  • Step A Preparation of l-triphenylmethyl-4-(hydroxymethyl)- imidazole To a solution of 4-(hydroxymethyl)imidazole hydrochloride (35.0 g, 260 mmol) in 250 mL of dry DMF at room temperature was added triethylamine (90.6 mL, 650 mmol). A white solid precipitated from the solution. Chlorotriphenylmethane (76.1 g, 273 mmol) in 500 mL of DMF was added dropwise. The reaction mixture was stirred for 20 hours, poured over ice, filtered, and washed with ice water. The resulting product was slurried with cold dioxane, filtered, and dried in vacuo to provide the titled product as a white solid which was sufficiently pure for use in the next step.
  • Step B Preparation of l-triphenylmethyl-4-(acetoxymethyl)- imidazole
  • Step C Preparation of l-(4-cyanobenzyl)-5-(acetoxymethyl)- imidazole hydrobromide
  • a solution of the product from Step B (85.8 g, 225 mmol) and ⁇ -bromo-/?-tolunitrile (50.1 g, 232 mmol) in 500 mL of EtOAc was stirred at 60°C for 20 hours, during which a pale yellow precipitate formed.
  • the reaction was cooled to room temperature and filtered to provide the solid imidazolium bromide salt.
  • the filtrate was concentrated in vacuo to a volume 200 mL, reheated at 60°C for two hours, cooled to room temperature, and filtered again.
  • the filtrate was concentrated in vacuo to a volume 100 mL, reheated at 60°C for another two hours, cooled to room temperature, and concentrated in vacuo to provide a pale yellow solid. All of the solid material was combined, dissolved in 500 mL of methanol, and warmed to 60°C. After two hours, the solution was reconcentrated in vacuo to provide a white solid which was triturated with hexane to remove soluble materials. Removal of residual solvents in vacuo provided the titled product hydrobromide as a white solid which was used in the next step without further purification.
  • Step D Preparation of l-(4-cyanobenzyl)-5-(hydroxymethyl)- imidazole
  • Step E Preparation of l-(4-cyanobenzyl)-5- imidazolecarboxaldehyde
  • Step G Preparation of V-( -butoxycarbonyl)-.V'-(3- chlorophenvDethylenediamine
  • the amine hydrochloride from Step F (ca. 282 mmol, crude material prepared above) was taken up in 500 mL of THF and 500 mL of sat. aq. NaHC ⁇ 3 soln., cooled to 0°C, and ⁇ i-tert- butylpyrocarbonate (61.6 g, 282 mmol) was added. After 30 h, the reaction was poured into EtOAc, washed with water and brine, dried (Na2S04), filtered, and concentrated in vacuo to provide the titled carbamate as a brown oil which was used in the next step without further purification.
  • Step H Preparation of ⁇ -[2-(tert-butoxycarbamoyl)ethyl]- ⁇ -(3- chlorophenyl)-2-chloroacetamide
  • Step I Preparation of 4-(tert-butoxycarbonyl)-l-(3- chlorophenyl)-2-piperazinone To a solution of the chloroacetamide from Step H ⁇ ca.
  • Step K Preparation of l-(3-chlorophenyl)-4-[l-(4- cyanobenzyl)imidazolylmethyll-2-piperazinone dihydrochloride
  • Examples 2-5 were prepared using the above protocol, which describes the synthesis of the structurally related compound l-(3-chlorophenyl)-4-[l-(4-cyanobenzyl)-imidazolylmethyl]-2- piperazinone dihydrochloride.
  • Step F the appropriately substituted aniline was used in place of 3-chloroaniline.
  • Step C Preparation of Methyl 4-Cyano-3-hydroxybenzoate
  • a mixture of the iodide product from Step B (101 g, 0.36 mol) and zinc(II)cyanide (30 g, 0.25 mol) in 400 mL of dry DMF was degassed by bubbling argon through the solution for 20 minutes. Tetrakis(triphenylphosphine)palladium (8.5 g, 7.2 mmol) was added, and the solution was heated to 80°C for 4 hours. The solution was cooled to room temperature, then stirred for an additional 36 hours.
  • Step F Preparation of 4-Cyano-3-methoxybenzyl Bromide A solution of the alcohol from Step E (35.5 g,
  • Step G Preparation of l-(4-cyano-3-methoxybenzyl)-5-
  • the titled product was prepared by reacting the bromide from Step F (21.7 g, 96 mmol) with the imidazole product from Step B of Example 1 (34.9 g, 91 mmol) using the procedure outlined in Step C of Example 1.
  • the crude product was triturated with hexane to provide the titled product hydrobromide (19.43 g, 88% yield).
  • Step H Preparation of l-(4-cyano-3-methoxybenzyl)-5- (hydroxymethyl)-imidazole
  • the titled product was prepared by hydrolysis of the acetate from Step G (19.43 g, 68.1 mmol) using the procedure outlined in Step D of Example 1.
  • the crude titled product was isolated in modest yield (11 g, 66% yield). Concentration of the aqueous extracts provided solid material (ca. 100 g) which contained a significant quantity of the titled product , as judged by H NMR spectroscopy.
  • Step I Preparation of l-(4-cyano-3-methoxybenzyl)-5- imidazolecarboxaldehyde
  • the titled product was prepared by oxidizing the alcohol from Step H (11 g, 45 mmol) using the procedure outlined in Step E of Example 1.
  • the titled aldehyde was isolated as a white powder (7.4 g, 68% yield) which was sufficiently pure for use in the next step without further purification.
  • Step J Preparation of l-(3-chlorophenyl)-4-[l-(4-cyano-3- methoxybenzyl)imidazolylmethyl]-2-piperazinone dihydrochloride
  • the titled product was prepared by reductive alkylation of the aldehyde from Step I (859 mg, 3.56 mmol) and the amine (hydrochloride) from Step K of Example 1 (800 mg, 3.24 mmol) using the procedure outlined in Step H of Example 1. Purification by flash column chromatography through silica gel (50%-75% acetone CH 2 C1 2 ) and conversion of the resulting white foam to its dihydrochloride salt provided the titled product as a white powder (743 mg, 45% yield). FAB ms (m+1) 437. Anal. Calc. for C23H23ClN5 ⁇ 2*2.0HCl « 0.35CH2Cl2: C, 51.97; H, 4.80; N, 12.98.
  • the titled product was prepared by reductive alkylation of the aldehyde from Step E of Example 1 (124 mg, 0.588 mmol) and 4-aminobenzophenone (116 mg, 0.588 mmol) using the procedure outlined in Step K of Example 1. Purification by flash column chromatography through silica gel (2-6% MeOH/CH 2 Cl 2 ) and conversion to the hydrochloride salt provided the titled product as a white solid (126 mg, 50% yield). FAB ms (m+1) 393.11. Anal. Calc. for C25H2 ⁇ N5 ⁇ l.40HCl » 0.40H2 ⁇ :
  • Step B N-t-Butoxycarbonyl-4(R)-hydroxyproline methyl ester
  • Step C N-t-Butoxycarbonyl-4(R)-t-butyldimethylsilyloxy proline methyl ester
  • the resulting mixture was stirred for 16hrs at room temperature.
  • Step D N-t-Butoxycarbonyl-4(R)-t-butyldimethylsilyloxy-2(S)- hydroxymethylpyrrolidine
  • Step E N-t-Butoxycarbonyl-4(R)-t-butyldimethylsilyloxy-2(S)- methanesulfonyloxymethylpyrrolidine
  • Step F Preparation of N-t-Butoxycarbonyl-4(R)-t- butyldimethylsilyloxy-2(S)-azidomethylpyrrolidine
  • Step G Preparation of N-t-Butoxycarbonyl-4(R)-t- butyldimethylsilyloxy-2(S)-aminomethylpyrrolidine
  • EtOAc 120ml
  • argon 10% palladium on carbon
  • the flask was evacuated and stirred under an atmosphere of hydrogen (49 psi) for 16hrs.
  • the hydrogen was replaced by argon, the catalyst removed by filtration and the solvent evaporated in vacuo.
  • Step H Preparation of N-t-Butoxycarbonyl-4(R)-t- butyldimethylsilyloxy-2(S)- ⁇ N'-3- chlorobenzyl ⁇ aminomethylpyrrolidine
  • Step K N-t-Butoxycarbonyl-4(R)-benzyloxyoxy-2(S)- ⁇ N'- acetyl-N'-3-chlorobenzyl ⁇ aminomethylpyrrolidine
  • N-t-Butoxycarbonyl-4(S)-hydroxy - 2(S)- ⁇ N'-acetyl-N' 3-chlorobenzyl ⁇ aminomethylpyrrolidine 701mg, 1.83 mmol
  • sodium hydride HOmg of a 60% dispersion in mineral oil, 2.75mmol
  • benzyl bromide 0.435ml, 3.66mmol
  • Step L 4(S)-Benzyloxy-2(S)- ⁇ N'-acetyl-N'-3-chlorobenzyl ⁇ - aminomethylpyrrolidine hydrochloride
  • EtOAc 25 ml
  • EtOAc 25 ml
  • the solvent was evaporated in vacuo to afford the title compound as a white solid.
  • Step M Preparation of lH-Imidazole-4- acetic acid methyl ester hydrochloride.
  • Step N Preparation of 1 -(Triphenylmethyl)- lH-imidazol-4- ylacetic acid methyl ester.
  • Step O Preparation of [l-(4-cyanobenzyl)-lH-imidazol-5- yll acetic acid methyl ester.
  • Step P Preparation of (l-(4-Cyanobenzyl)-lH-imidazol-5-yl)- ethanol
  • methanol 20ml
  • sodium borohydride l.Og, 26.3mmol
  • the reaction was stirred at 0°C for 1 hr and then at room temperature for an additional 1 hr.
  • the reaction was quenched by the addition of sat.NH4Cl solution and the methanol was evaporated in vacuo..
  • Step O l-(4-Cyanobenzyl)-imidazol-5-yl-ethylmethanesulfonate
  • Step R N ⁇ 1 -(4-Cy anobenzyl)- 1 H-imidazol-5-ylethyl ⁇ -4(R)- benzyloxyoxy-2(S)- ⁇ N'-acetyl-N'-3- chlorobenzyl ⁇ aminomethylpyrrolidine
  • Isoprenyl-protein transferase activity assays were carried out at 30°C unless noted otherwise.
  • a typical reaction contained (in a final volume of 50 ⁇ L): [ 3 H]farnesyl diphosphate or [ 3 H] geranylgeranyl diphosphate, Ras protein , 50 mM HEPES, pH 7.5, 5 mM MgCl 2 , 5 mM dithiothreitol, 10 ⁇ M ZnCl 2 , 0.1% polyethyleneglycol (PEG) (15,000-20,000 mw) and isoprenyl-protein transferase.
  • a modulating anion such as lOmM glycerol phosphate or 5mM ATP may also be added to the assay medium.
  • the FPTase employed in the assay was prepared by recombinant expression as described in Omer, C.A., Krai, A.M., Diehl, R.E., Prendergast, G.C., Powers, S., Allen, CM., Gibbs, J.B. and Kohl, N.E. (1993) Biochemistry 32:5167-5176.
  • the geranylgeranyl-protein transferase-type I employed in the assay was prepared as described in U.S. Pat. No. 5,470,832, inco ⁇ orated by reference.
  • inhibitors were prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 20-fold into the enzyme assay mixture.
  • Substrate concentrations for inhibitor IC50 determinations were as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 2), 100 nM farnesyl diphosphate; GGPTase-I, 500 nM Ras-CAIL (SEQ.ID.NO.: 3), 100 nM geranylgeranyl diphosphate.
  • the modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature.
  • a typical reaction contains (in a final volume of 50 ⁇ L): [ 3 H] geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 7 mM MgCl 2 , 10 ⁇ M ZnCl 2 ,
  • the GGTase- type I enzyme employed in the assay is prepared as described in U.S. Pat. No. 5,470,832, inco ⁇ orated by reference.
  • the Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCVIM (single amino acid code) (SEQ.ID.NO.: 13).
  • Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 ⁇ L of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter. For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 25-fold into the enzyme assay mixture.
  • GGTase and inhibitors are preincubated for one hour and reactions are initiated by the addition of peptide substrate, following methodology described by J.F. Morrison, C.T. Walsh, Adv. Enzymol. & Related Areas Mol. Biol., 61 201-301 (1988).
  • IC 50 values are determined with Ras peptide near KM concentrations. Enzyme and substrate concentrations for inhibitor IC 50 determinations are as follows: 75 pM GGTase-I, 1.6 ⁇ M
  • Ras peptide 100 nM geranylgeranyl diphosphate.
  • enzymologic K values for inhibition of GGPTase-I can be determined using the methodology described by I. H. Segel ("Enzyme Kinetics", pages 342-345; Wiley and Sons, New York, N.Y. (1975) and references cited therein).
  • the assay can also be performed using cell lines transformed with human H-ras, N-ras or Ki4B-ras. The assay is performed essentially as described in DeClue, J.E.
  • the media is removed, the cells washed, and 3 ml of media containing the same or a different test compound added.
  • the lysis is carried out as above. Aliquots of lysates containing equal numbers of acid-precipitable counts are bought to 1 ml with IP buffer (lysis buffer lacking DTT) and immunoprecipitated with the ras-specific monoclonal antibody Y13-259 (Furth, M.E. et al., J. Virol. 43:294-304, (1982)).
  • the SEAP reporter plasmid, pDSElOO was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI.
  • the SEAP gene is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA).
  • the plasmid pCMV-RE-AKI was constructed by Deborah Jones (Merck) and contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus immediate early promoter.
  • the plasmid also contains a bovine growth hormone poly-A sequence.
  • the plasmid, pDSElOO was constructed as follows.
  • a restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2-Basic using the restriction enzymes EcoRl and Hpal. The ends of the linear DNA fragments were filled in with the Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment.
  • the vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-II and the ends filled in with Klenow DNA Polymerase I.
  • the SEAP DNA fragment was blunt end ligated into the pCMV-RE-AKI vector and the ligation products were transformed into DH5-alpha E.
  • coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
  • the SEAP repotrer plasmid, pDSElOl is also constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI.
  • the SEAP gene is derived from plasmid pGEM7zf(-)/SEAP.
  • the plasmid pDSElOl was constructed as follows: A restriction fragment containing part of the SEAP gene coding sequence was cut out of the plasmid pGEM7zf(-)/SEAP using the restriction enzymes Apa I and KpnI. The ends of the linear DNA fragments were chewed back with the Klenow fragment of E. coli DNA Polymerase I. The "blunt ended" DNA containing the truncated SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1910 base pair fragment. This 1910 base pair fragment was ligated into the plasmid pCMV-RE-AKI which had been cut with Bgl-II and filled in with E. coli Klenow fragment DNA polymerase.
  • the plasmid pCMV-RE-AKI is derived from plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61, 1796-1807) by removing an EcoRI fragment containing the DHFR and Neomycin markers.
  • the plasmid pGEM7zf(-)/SEAP was constructed as follows.
  • the SEAP gene was PCRed, in two segments from a human placenta cDNA library (Clontech) using the following oligos.
  • Sense strand N-terminal SEAP 5' GAGAGGGAATTCGGGCCCTTCCTGCAT
  • Antisense strand N-terminal SEAP 5' GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO.:5)
  • Sense strand C-terminal SEAP 5' GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3' (SEQ.ID.NO.:6)
  • Antisense strand C-terminal SEAP 5' GAAGAGGAAGCTTGGTACCGCCACTG GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO. :7)
  • the N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and Hpal restriction sites at the ends.
  • the Antisense N-terminal oligo introduces an internal translation STOP codon within the SEAP gene along with the Hpal site.
  • SEQ.ID.NO.: 6 and SEQ.ID.NO.: 7 were used to amplify a 412 bp C-terminal PCR product containing Hpal and Hindlll restriction sites.
  • the sense strand C-terminal oligo (SEQ.ID.NO.: 6) introduces the internal STOP codon as well as the Hpal site.
  • the N-terminal amplicon was digested with EcoRI and Hpal while the C-terminal amplicon was digested with Hpal and Hindlll.
  • the two fragments comprising each end of the SEAP gene were isolated by electrophoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments.
  • An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegalovirus (CMV) IE-1 promoter.
  • the expression plasmid also includes the CMV intron A region 5' to the SEAP gene as well as the 3' untranslated region of the bovine growth hormone gene 3' to the SEAP gene.
  • the plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61: 1796-1807) containing the CMV immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV-AKI. Next, the cytomegalovirus intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV-AKI.
  • the intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid pl6T-286.
  • the intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer, R.M., Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979- 3986) to remove a Sad restriction site using site directed mutagenesis.
  • the mutated intron A sequence was PCRed from the plasmid pl6T-287 using the following oligos.
  • Sense strand 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 8)
  • Antisense strand 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.ID.NO.: 9)
  • oligos generate a 991 base pair fragment with a Sad site inco ⁇ orated by the sense oligo and a Bgl-II fragment inco ⁇ orated by the antisense oligo.
  • the PCR fragment is trimmed with Sad and Bgl-II and isolated on an agarose gel.
  • the vector pCMV-AKI is cut with Sad and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis.
  • the two gel isolated fragments are ligated at their respective Sad and Bgl-II sites to create plasmid pCMV-AKI- InA.
  • the DNA sequence encoding the truncated SEAP gene is inserted into the pCMV- AKI-InA plasmid at the Bgl-II site of the vector.
  • the SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above) using EcoRI and Hindlll. The fragment is filled in with Klenow DNA polymerase and the 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis.
  • the pCMV- AKI-InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the pCMV- AKI-InA vector.
  • Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence.
  • the resulting plasmid named pCMV-SEAP-A (deposited in the ATCC under Budapest Treaty on August 27, 1998, and designated ATCC), contains a modified SEAP sequence downstream of the cytomegalovirus immediately early promoter IE- 1 and intron A sequence and upstream of the bovine growth hormone poly-A sequence.
  • the plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells.
  • An expression plasmid constitutively expressing the SEAP protein can be created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegalovirus (CMV) IE- 1 promoter and upstream of the 3' unstranslated region of the bovine growth hormone gene.
  • CMV cytomegalovirus
  • the plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61: 1796-1807) containing the CMV immediate early promoter and bovine growth hormone poly-A sequence can be cut with EcoRI generating two fragments. The vector fragment can be isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV-AKI.
  • the DNA sequence encoding the truncated SEAP gene can be inserted into the pCMV-AKI plasmid at a unique Bgl-II in the vector.
  • the SEAP gene is cut out of plasmid pGEMzf(-)/SEAP (described above) using EcoRI and Hindlll. The fragments are filled in with Klenow DNA polymerase and the 1970 base pair fragment is isolated from the vector fragment by agarose gel electrophoresis.
  • the pCMV-AKI vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the vector and transforming the ligation reaction into E. coli DH5 ⁇ cells.
  • Transformants can then be screened for the proper insert and mapped for restriction fragment orientation. Properly oriented recombinant constructs would be sequenced across the cloning junctions to verify the correct sequence.
  • the resulting plasmid named pCMV-SEAP-B contains a modified SEAP sequence downstream of the cytomegalovirus immediate early promoter, IE1, and upstream of a bovine growth hormone poly-A sequence. The plasmid would express SEAP in a constitutive nammer when transfected into mammalian cells.
  • a DNA fragment containing viral-H-ras can be PCRed from plasmid "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) using the following oligos.
  • the sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5' to the ATG start site.
  • cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo.
  • the PCR primer oligos introduce an Xhol site at the 5' end and a Xbal site at the 3 'end.
  • the Xhol-Xbal fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with Xhol and Xbal. This results in a plasmid, pSMS600, in which the recombinant myr-viral-H-ras gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • a viral-H-ras clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid "HB-11" by PCR using the following oligos.
  • Antisense strand 5 ' C ACTCTAGACTGGTGTC AGAGC AGC AC AC ACTTGC AGC-3 ' (SEQ.ID.NO.: 13)
  • the sense strand oligo optimizes the 'Kozak' sequence and adds an Xhol site.
  • the antisense strand mutates serine 189 to leucine and adds an Xbal site.
  • the PCR fragment can be trimmed with Xhol and Xbal and ligated into the Xhol-Xbal cut vector pCI (Promega).
  • CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • the human cellular-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-H-Ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I site at the C-terminal end.
  • the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-H-ras-Leu61 can be excised from the pAlter-
  • the human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • the primers will amplify a c-N-Ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I site at the C-terminal end.
  • the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glycine-12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 19)
  • the mutated c-N-ras-Val-12 can be excised from the pAlter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
  • the new recombinant plasmid, pSMS630 will constitutively transcribe c-N-ras- Val-12 from the CMV promoter of the pCI vector.
  • the human c-K4B-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand 5 ' -CTCTGTCG ACGTATTTAC AT AATT AC AC ACTTTGTC-3 ' (SEQ.ID.NO.: 21)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un procédé pour inhiber les prényl-protéine-transférases et traiter le cancer, qui consiste à administrer à un mammifère un inhibiteur de prényl-protéine-transférase constituant un inhibiteur du traitement cellulaire des protéines H-Ras et K4B-Ras. En particulier, l'invention concerne un procédé permettant d'inhiber la farnésyl-protéine-transférase et la géranylgéranyl-protéine-transférase de type I en administrant un composé qui est un double inhibiteur pour ces deux prényl-protéine-transférases. L'invention concerne aussi un procédé permettant d'identifier le composé susmentionné, par le biais d'un essai dont l'indication correspond à l'activité biologique de la protéine Ras ou à l'inhibition de ladite activité, moyennant quoi on identifie aisément les composés qui inhibent le traitement cellulaire des protéines H-Ras et K4B-Ras.
PCT/US1998/017699 1997-08-27 1998-08-26 Procede pour le traitement du cancer WO1999010525A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2000507833A JP2001514191A (ja) 1997-08-27 1998-08-26 癌の治療方法
CA002301880A CA2301880A1 (fr) 1997-08-27 1998-08-26 Procede pour le traitement du cancer
AU89213/98A AU8921398A (en) 1997-08-27 1998-08-26 A method of treating cancer
EP98941069A EP1019529A4 (fr) 1997-08-27 1998-08-26 Procede pour le traitement du cancer

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US5710297P 1997-08-27 1997-08-27
US60/057,102 1997-08-27
GBGB9724299.4A GB9724299D0 (en) 1997-11-18 1997-11-18 A method of treating cancer
GB9724299.4 1997-11-18

Publications (1)

Publication Number Publication Date
WO1999010525A1 true WO1999010525A1 (fr) 1999-03-04

Family

ID=26312616

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/017699 WO1999010525A1 (fr) 1997-08-27 1998-08-26 Procede pour le traitement du cancer

Country Status (5)

Country Link
EP (1) EP1019529A4 (fr)
JP (1) JP2001514191A (fr)
AU (1) AU8921398A (fr)
CA (1) CA2301880A1 (fr)
WO (1) WO1999010525A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6849599B2 (en) 2000-03-08 2005-02-01 Rhode Island Hospital Combination drug therapy
US6939540B1 (en) 2000-07-31 2005-09-06 Cornell Research Foundation, Inc. Method of enhancing bone density

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5185248A (en) * 1990-05-08 1993-02-09 E. R. Squibb & Sons, Inc. Farnesyl-protein transferase assay for identifying compounds that block neoplastic transformation

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5962243A (en) * 1990-04-18 1999-10-05 Board Of Regents, The University Of Texas System Methods for the identification of farnesyltransferase inhibitors
IL117580A0 (en) * 1995-03-29 1996-07-23 Merck & Co Inc Inhibitors of farnesyl-protein transferase and pharmaceutical compositions containing them
US6011029A (en) * 1996-02-26 2000-01-04 Bristol-Myers Squibb Company Inhibitors of farnesyl protein transferase
AU2802297A (en) * 1996-04-18 1997-11-07 Merck & Co., Inc. A method of treating cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5185248A (en) * 1990-05-08 1993-02-09 E. R. Squibb & Sons, Inc. Farnesyl-protein transferase assay for identifying compounds that block neoplastic transformation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHEMICAL ABSTRACTS, 1 January 1900, Columbus, Ohio, US; abstract no. 126:8133, XP002915013 *
See also references of EP1019529A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6849599B2 (en) 2000-03-08 2005-02-01 Rhode Island Hospital Combination drug therapy
US6939540B1 (en) 2000-07-31 2005-09-06 Cornell Research Foundation, Inc. Method of enhancing bone density

Also Published As

Publication number Publication date
JP2001514191A (ja) 2001-09-11
EP1019529A1 (fr) 2000-07-19
AU8921398A (en) 1999-03-16
CA2301880A1 (fr) 1999-03-04
EP1019529A4 (fr) 2002-09-11

Similar Documents

Publication Publication Date Title
US6387903B1 (en) Inhibitors of prenyl-protein transferase
US6358956B1 (en) Inhibitors of prenyl-protein transferase
US20020052363A1 (en) Inhibitors of prenyl-protein transferase
EP1165084A1 (fr) Inhibiteurs de prenyl-proteine transferases
AU741725B2 (en) Inhibitors of prenyl-protein transferase
WO2001060368A1 (fr) Inhibiteurs de la prenyle proteine transferase
US6103487A (en) Method of treating cancer
US6376496B1 (en) Inhibitors of prenyl-protein transferase
WO2001060458A2 (fr) Inhibiteurs de la prenyl-proteine transferase
US6335343B1 (en) Inhibitors of prenyl-protein transferase
US6355643B1 (en) Inhibitors of prenyl-protein transferase
EP1019529A1 (fr) Procede pour le traitement du cancer
WO1999010329A1 (fr) Inhibiteurs de prenyl-proteine-transferase
WO1999010523A1 (fr) Procede de traitement du cancer
WO2000016626A1 (fr) Methode de traitement du cancer
WO1999010524A1 (fr) Procede pour le traitement du cancer

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AU AZ BA BB BG BR BY CA CN CU CZ EE GE HR HU ID IL IS JP KG KR KZ LC LK LR LT LV MD MG MK MN MX NO NZ PL RO RU SG SI SK SL TJ TM TR TT UA US UZ VN YU

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 1998941069

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 507833

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 89213/98

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2301880

Country of ref document: CA

Ref country code: CA

Ref document number: 2301880

Kind code of ref document: A

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: KR

WWP Wipo information: published in national office

Ref document number: 1998941069

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998941069

Country of ref document: EP